inquiry learning through the world of csi phillip b. danielson associate professor department of...

Inquiry Learning through the World of CSI

Phillip B. DanielsonAssociate Professor

Department of Biological SciencesInstitute for Forensic Genetics

UNIVERSITY OF

DENVER

Forensic Science and Inquiry LearningForensic Science and Inquiry Learning

Forensics is applied science that Forensics is applied science that students see as “relevant”.students see as “relevant”.

Observational skills and critical Observational skills and critical thinking are key. thinking are key.

Forensics is about Forensics is about formulating hypotheses and formulating hypotheses and “doing inquiry”.“doing inquiry”.

Forensic Science in the ClassroomForensic Science in the Classroom

...and ...and of course…of course…

Kids see it as cool Kids see it as cool stuff!stuff!

Celebrity Endorsements of DNA Celebrity Endorsements of DNA

The Cool Effect: Don’t get swept away! The Cool Effect: Don’t get swept away!

I want to study Marine I want to study Marine Biology!Biology!

That’s great. Why?That’s great. Why?

Career Choice: The CSI EffectCareer Choice: The CSI Effect

I want to study Forensic Stuff!I want to study Forensic Stuff!

That’s great! That’s great! Why?Why?

Keeping Your Goals ClearKeeping Your Goals Clear

Crime scenes, police investigators, DNA Crime scenes, police investigators, DNA analysts, fingerprint examiners, ballistics analysts, fingerprint examiners, ballistics experts, forensic pathologists are all cool but experts, forensic pathologists are all cool but don’t forget ……………don’t forget ……………

– – It’s really about inquiry learning !It’s really about inquiry learning !

Forensics: Reality vs. HollywoodForensics: Reality vs. Hollywood

Forensic science is about thinking like a geek not being a Forensic science is about thinking like a geek not being a Hollywood hottie. Hollywood hottie.

Geek Geek Geek

DNA: A Child of Violence

Miescher (1869) DNA is discovered as a Miescher (1869) DNA is discovered as a component of pus in war wounds.component of pus in war wounds.

The Crimean War and DNA

It’s All the Same DNAIt’s All the Same DNA

Bill’s DNA

All people have 23 pairs of chromosomes made of DNA. What makes each of us unique?

Lets Look just at Chromosomes 1

Can you see any DNACan you see any DNA

Zoom in still more to see if you can see any DNA.

Even CloserSee any DNA Yet?Even CloserSee any DNA Yet?

Wow? So this is what all the excitement is about…..

What’s Special What’s Special about DNA ?about DNA ?

The double helical (twisted The double helical (twisted spiral) molecule that makes up spiral) molecule that makes up chromosomes. chromosomes.

Each DNA molecule is a long Each DNA molecule is a long chain made of multiple links chain made of multiple links called “g” “a” “t” “c”. called “g” “a” “t” “c”.

Variations in the order of the Variations in the order of the links exist between different links exist between different individuals. individuals.

Regardless of tissue source, all Regardless of tissue source, all genomic DNA from a single genomic DNA from a single individual is identical. individual is identical.

DNA stores Info DNA stores Info about Youabout You

DNA stores Info DNA stores Info about Youabout You G G

gaaactggcc tccaaacact gcccgccgtc cacggccggc cggtcctgcg gaaactggcc tccaaacact gcccgccgtc cacggccggc cggtcctgcg tgtgaatgac tcaggagcgt attccccacg cgccagcact gcattcagat tgtgaatgac tcaggagcgt attccccacg cgccagcact gcattcagat aagcgctggc tcagtgtcag cccaaggaag acagaccaca ggcaaggagg aagcgctggc tcagtgtcag cccaaggaag acagaccaca ggcaaggagg accaccggaa aggaagacca ccggaaagga agaccaccgg aaaggaagac accaccggaa aggaagacca ccggaaagga agaccaccgg aaaggaagac cacaggcaag gaggaccacc ggaaaggaag accaccggca aggaggacca cacaggcaag gaggaccacc ggaaaggaag accaccggca aggaggacca ccggcaagga ggaccaccag gaaggaggac caccagcaag gaggaccacc ccggcaagga ggaccaccag gaaggaggac caccagcaag gaggaccacc agcaaggagg accaccagga aggaggacca ccaggaagga ggaccaccgg agcaaggagg accaccagga aggaggacca ccaggaagga ggaccaccgg caaggaggac caccaggaag gaggaccacc aggaaggagg accaccggca caaggaggac caccaggaag gaggaccacc aggaaggagg accaccggca aggaggacca ccaggaagga gaaccaccag gaaggaggac caccaggaag aggaggacca ccaggaagga gaaccaccag gaaggaggac caccaggaag gaggaccacc aggaaggagg accactggca aggaagacca ccggcaagcc gaggaccacc aggaaggagg accactggca aggaagacca ccggcaagcc tgcaaggggc acgtgcatct ccaacaagac gaaggaggac caccagcaag tgcaaggggc acgtgcatct ccaacaagac gaaggaggac caccagcaag gaggaccacc agcaaggagg accaccagga aggaggacca ccaggaagga gaggaccacc agcaaggagg accaccagga aggaggacca ccaggaagga ggaccaccgg caaggaggac caccaggaag gaggaccacc aggaaggagg ggaccaccgg caaggaggac caccaggaag gaggaccacc aggaaggagg accaccggca aggaggacca ccaggaagga gaaccaccag gaaggaggac accaccggca aggaggacca ccaggaagga gaaccaccag gaaggaggac caccaggaag gaggaccacc aggaaggagg accactggca aggaagacca caccaggaag gaggaccacc aggaaggagg accactggca aggaagacca ccggcaagcc tgcaaggggc acgtgcatct ccaacaagac accactggcaccggcaagcc tgcaaggggc acgtgcatct ccaacaagac accactggca

So there is this stuff called DNA – but what

makes each of us genetically unique?

So there is this stuff called DNA – but what

makes each of us genetically unique?

Unique DNA ProfilesUnique DNA Profiles

Short Tandem Repeats (STRs) “DNA Stutters”

CCTATCGGGTGTCTGATCGATCGATCGATCTATACCTCGATACCACGGATAGCCCACAGACTAGCTAGCTAGCTAGATATGGAGGTATGGTG

CCTATCGGGTGTCTGATCGATCGATCGATCGATCGATCTATACCTCGGATAGCCCACAGACTAGCTAGCTAGCTAGCTAGCTAGATATGGAG

4 repeat DNA

6 repeat DNA

13 CODIS Core STR Loci with Chromosomal Positions

CSF1PO

D5S818

D21S11

D13S317

D7S820

D16S539 D18S51

D8S1179

D3S1358

DNA Always Comes in Pairs DNA Always Comes in Pairs

5 Repeats 6 Repeats4 Repeats

4 Repeats

Remember these

parents?

Even in Children Even in Children

6 Repeats

4 Repeats 5 Repeats

4 Repeats

Needles in a Haystack?

This is what I’m interested in. This is what’s unique. How can I get enough to study?

CRIME SCENE DO NOT CROSS CRIME SCENE DO NOT CROSS CRIME SCENE DO NOT CROSS

DNA from Tiny SourcesDNA from Tiny Sources

Gut Contents of bugs that Gut Contents of bugs that feed on human blood and feed on human blood and skin (lice, mosquitos). skin (lice, mosquitos).

Objects that are in direct Objects that are in direct contact with the human contact with the human tissues (licked surfaces, tissues (licked surfaces, contact lenses, jewelry)contact lenses, jewelry)

More Small Stuff

Dandruff is made of dead skin cells that still contain DNA.

The root of a single hair has enough DNA to yield a profile

Gathering DNA EvidenceGathering DNA EvidenceSmall amounts of blood

might provide DNA

Gathering DNA EvidenceGathering DNA EvidenceCRIME SCENE DO NOT CROSS CRIME SCENE DO NOT CROSS CRIME SCENE DO NOT CROSS

Old blood from a parking lot might give you DNA

DNA from Grooming Tools

DNA might be found in a DNA might be found in a hair brush or a razor.hair brush or a razor.

Possible Sources of DNA?Possible Sources of DNA?

Spit (gross)Spit (gross)Used CupsUsed CupsChewed GumChewed Gum

ShoesShoes HatsHats Ropes/LigaturesRopes/Ligatures GlassesGlasses

Urine Urine Feces Feces VomitVomit

Kary Mullis (1985)Kary Mullis (1985)

Develops the Develops the

Polymerase Chain Reaction, Polymerase Chain Reaction,

PCRPCR(After he was abducted by aliens, (After he was abducted by aliens,

Earned frequent flyers miles on LSD trips and Earned frequent flyers miles on LSD trips and nearly did himself in with laughing gas. )nearly did himself in with laughing gas. )

Start of the Modern Era of Molecular Biology

Show me the MoneyShow me the Money

Yo Xerox! Yo Xerox!

Copies of the target Copies of the target DNA which is DNA which is flanked flanked by PCR primersby PCR primers increase exponentiallyincrease exponentially

Cycle 1 = 1Cycle 1 = 1Cycle 2 = 2Cycle 2 = 2Cycle 3 = 4Cycle 3 = 4Cycle 4 = 8Cycle 4 = 8Cycle 5 = 16Cycle 5 = 16Cycle 10 = 512Cycle 10 = 512Cycle 15 = 16,384Cycle 15 = 16,384Cycle 20 = 524,288Cycle 20 = 524,288Cycle 25 = 16,777,216Cycle 25 = 16,777,216Cycle 30 = 536,870,912Cycle 30 = 536,870,912Cycle 32 = 2,147,483,648Cycle 32 = 2,147,483,648

Polymerase Chain ReactionPolymerase Chain Reaction

Primers:Target the piece of DNA to be amplified

Taq Polymerase:Makes copies of the DNA

Simple Amplification Simple Amplification

CCTATCGGGTGTCTGATCGATCGATCGATCGATCTCATATACCTGGTATACGTGTAAGGATAGCCCACAGACTAGCTAGCTAGCTAGCTAGAGTATATGGAGGATATGCACATT

PCRPCRPrimer Primer

Notice that the sequence between the primers is repeated. This type of sequence is often quite variable from one person to the next (i.e., the greater the number of repeats, the larger the PCR product).

CCTATCGGGTGTCTGATCGATCGATCGATCGATCGATCGTACTATACCTGGTATACGTGGATAGCCCACAGACTAGCTAGCTAGCTAGCTAGCTAGCATGATATGGAGGATATGCA

PCR: One Technique; 100 Different Flavors

A Simple Technique with Very Broad ApplicabilityA Simple Technique with Very Broad Applicability Screening of blood and tissue samples for low Screening of blood and tissue samples for low

abundance pathogens (HIV). abundance pathogens (HIV). Screening of animals for breeding purposes, pedegree Screening of animals for breeding purposes, pedegree

and ownership.and ownership. Identification of new species which cannot be grown in Identification of new species which cannot be grown in

a laboratory.a laboratory. Tracking the mating behavior of birds.Tracking the mating behavior of birds. Recovering molecular tags from commercial products. Recovering molecular tags from commercial products. Identifying tissue matches between humans prior to Identifying tissue matches between humans prior to

organ transplants.organ transplants.

DNA, PCR and Inquiry: Your creativity is the only limit

Gel ElectrophoresisGel Electrophoresis

Porous Sieving MatricesPorous Sieving MatricesPorous Sieving MatricesPorous Sieving Matrices Electrophoresis separates DNA using electricity to push Electrophoresis separates DNA using electricity to push

them through a sieve made of gel-like chemical.them through a sieve made of gel-like chemical. Mobility is a function of size, i.e., Smaller is faster and Mobility is a function of size, i.e., Smaller is faster and

Bigger is slower.Bigger is slower. It’s like McDonalds on a busy weekend. It’s like McDonalds on a busy weekend.

Heredity: Passing on your unique DNA. Heredity: Passing on your unique DNA.

5 Repeats 6 Repeats4 Repeats

4 Repeats

Remember these

parents?

Analyzing your unique DNA Analyzing your unique DNA

6 Repeats

4 Repeats 5 Repeats

4 Repeats

Separating FragmentsSeparating Fragments

The PCR The PCR amplification for amplification for each person must each person must be run in a separate be run in a separate tube and a separate tube and a separate lane on a gel. lane on a gel.

For each gene For each gene (locus) humans (locus) humans have either one have either one (homozygous) or (homozygous) or two (heterozygous) two (heterozygous) bands.bands.

Person #1

800Volts

-Person

#2Person

Repeats

Separating MixturesSeparating Mixtures

Alleles 3, 6, 7Alleles 3, 6, 7

Possible Possible combinations:combinations:

6, 7 and 3, 66, 7 and 3, 6

3, 7 and 6, 63, 7 and 6, 6

Mixture #1

800Volts

-Mixture

#2Mixture

Children of the RomanovsChildren of the Romanovs

DNA profiles that make each of us unique look at multiple loci

HomozygousAllele 5,5

HeterozygousAllele 2,4

Allelic Ladder(Shows all

possible alleles)

DNA left over in wells of the gel. Not

part of DNA fingerprint.

Smudges are PCR primers left over. Not part of DNA

fingerprint.

6 repeat allele5 repeat allele4 repeat allele3 repeat allele2 repeat allele1 repeat allele

13 CODIS Core STR Loci with Chromosomal Positions

CSF1PO

D5S818

D21S11

D13S317

D7S820

D16S539 D18S51

D8S1179

D3S1358

Probability and the Statistics of DNA

profiles

Probability and the Statistics of DNA

profiles

Each STR has a known frequency in the human population.

STR#14,6

STR#29,9

STR#34,4

STR#46,12

STR#524,38

STR#67,15

STR#718,18

STR#14,6

STR#29,9

STR#34,4

STR#46,12

STR#524,38

STR#67,15

STR#718,18

1/10 1/15 1/12 1/18 1/16 1/20 1/11

1/1501/101/1,8001/32,4001/518,4001/10,368,0001/114,048,000

DNA profiles from the cases that you worked yesterday.

HomozygousAllele 5,5

HeterozygousAllele 2,4

Allelic Ladder(Shows all

possible alleles)

DNA left over in wells of the gel. Not

part of DNA fingerprint.

Smudges are PCR primers left over. Not part of DNA

fingerprint.

6 repeat allele5 repeat allele4 repeat allele3 repeat allele2 repeat allele1 repeat allele

Case #6Case #6

Victim: Stephanie Lecaude (3,6)Victim: Stephanie Lecaude (3,6)

Suspect: Richard Alverenga (1,4)Suspect: Richard Alverenga (1,4)

Victim Profile / Suspect ProfileVictim Profile / Suspect Profile

Case #1Case #1

Victim: Megan Calmus (3,5)Victim: Megan Calmus (3,5)

Suspect: Jamal Thompson (2,6)Suspect: Jamal Thompson (2,6)

Case #2Case #2

Victim: Ruby Lucero (4,5)Victim: Ruby Lucero (4,5)

Suspect: Carlos Lucero (5,6)Suspect: Carlos Lucero (5,6)

Case #3Case #3

Victim: Brenda Bagroski (2,3)Victim: Brenda Bagroski (2,3)

Roommate: Janet Smithers (5,5)Roommate: Janet Smithers (5,5)

Case #4Case #4

Victim: Tonya Thompson (6,6)Victim: Tonya Thompson (6,6)

Suspect: Father (unknown)Suspect: Father (unknown)

Case #5Case #5

Victim: Brian Bevis (2,5)Victim: Brian Bevis (2,5)

Suspect: Richard Alverenga (1,4) Suspect: Richard Alverenga (1,4)

Final Thoughts

Thank you for your Thank you for your attention.attention.

Any questions?Any questions?

Contact InformationContact Information

Phillip B. DanielsonPhillip B. DanielsonUniversity of DenverUniversity of DenverDepartment of Biological SciencesDepartment of Biological Sciences2101 E. Wesley Avenue Rm. 2112101 E. Wesley Avenue Rm. 211Denver, CO 80210Denver, CO 80210Email: pdaniels@du.eduEmail: pdaniels@du.eduTel: (303) 871-3561Tel: (303) 871-3561

inquiry learning through the world of csi phillip b. danielson associate professor department of...

dna molecule

dna analysts

genomic dna

dna stores info

celebrity endorsements

forensic stuff

forensic geneticscopyright

forensic pathologists

Documents

danielson framework for teaching

danielson lzd 5b3 danielson airport danielson

karen danielson horney

81 danielson drive, aspen

gcd's - joint and regional planning_velma danielson

danielson fft 10-29-10

kelly j. godoy de danielson y robert danielson música

rel38 danielson final-lo#cc

the danielson framework

charlotte danielson for kentucky department of education ......

danielson intro

danielson sandalow doe keynotes

karen danielson horney-foreign psychologist

diane danielson social mediasalescycle-dwc_teleclass

danielson pd module #544

rachel danielson

brainstorming sessions linsey danielson

portal training for the danielson observer

ltps nto danielson presentation

seth danielson - alaska