journal of research in biology volume 4 issue 2
Post on 12-Nov-2014
362 Views
Preview:
DESCRIPTION
TRANSCRIPT
Aim and Scope
Journal of Research in Biology is an international scientific journal committed to the development and spread of
research in Biological sciences. It accepts research articles with affiliation to biological science from all around the globe and
publishes them in the journal. The submitted articles are peer-reviewed by experts in the field and editorial board members. Make
the most of your research by publishing articles in Journal of Research in Biology.
Journal of Research in Biology works as a portal for biological scientific research publication. It works to promote the use
of biological sciences knowledge in the world public policy, and to develop and advance science policy that serves the needs of scientific research and education communities, particularly the biological sciences.
The journal has been uniquely positioned to help members of the scientific community; become effective advocates for their science and to be better known for the public that relate to or impact the biological sciences.
Call for Papers
Journal of Research in Biology seeks Research Articles, Short Communications and Mini reviews. The Journal will accept
and review submissions in English from any author, in any global locality. A body of international peers will review all
submissions with potential author revisions as recommended by reviewers, with the intent to achieve published papers that:
Relate to the field of Biology
Represent new, previously unpublished work
Advance the state of knowledge of the field
Conform to a high standard of presentation.
Disclaimer: Journal of Research in Biology is not responsible for the content of individual manuscripts. Manuscripts available in this journal were peer reviewed. Manuscripts accepted in the issues conform to the editorial policies. But more details regarding the nature of their research, conflicts in their workplace, plagiarisms, stealing of others property, manipulation of data, illegal formulation of a paper from other allied papers etc., were all not known to us. Any details, queries regarding the manuscripts should be only dealt with the authors and not with the publisher. The concept of peer review can only limit the plagiarism to a small extent where as it is the work of the public and the individuals to identify and stop the illegal formulation of new articles from the other. The publisher invites all details regarding the plagiarism of an article published in the journal provided with the original data and supplementary files for confirmation. On identifying plagiarism issues in an article, the article published will be removed from the journal website and further on the citation of the same will be debarred. Provided the author of the manuscript will be prohibited to publish his/her other studies in our journal or throughout the journals under our portal.
List of Editors of Editors in the Journal of Research in Biology
Managing and Executive Editor:
Abiya Chelliah [Molecular Biology] Publisher, Journal of Research in Biology.
Editorial Board Members:
Ciccarese [Molecular Biology] Universita di Bari, Italy.
Sathishkumar [Plant Biotechnologist] Bharathiar University.
SUGANTHY [Entomologist] TNAU, Coimbatore.
Elanchezhyan [Agriculture, Entomology] TNAU, Tirunelveli.
Syed Mohsen Hosseini [Forestry & Ecology] Tarbiat Modares University (TMU), Iran.
Dr. Ramesh. C. K [Plant Tissue Culture] Sahyadri Science College, Karnataka.
Kamal Prasad Acharya [Conservation Biology] Norwegian University of Science and Technology (NTNU), Norway.
Dr. Ajay Singh [Zoology] Gorakhpur University, Gorakhpur
Dr. T. P. Mall [Ethnobotany and Plant pathoilogy] Kisan PG College, BAHRAICH
Ramesh Chandra [Hydrobiology, Zoology] S.S.(P.G.)College, Shahjahanpur, India.
Adarsh Pandey [Mycology and Plant Pathology] SS P.G.College, Shahjahanpur, India
Hanan El-Sayed Mohamed Abd El-All Osman [Plant Ecology] Al-Azhar university, Egypt
Ganga suresh [Microbiology] Sri Ram Nallamani Yadava College of Arts & Sciences, Tenkasi, India.
T.P. Mall [Ethnobotany, Plant pathology] Kisan PG College,BAHRAICH, India.
Mirza Hasanuzzaman [Agronomy, Weeds, Plant] Sher-e-Bangla Agricultural University, Bangladesh
Mukesh Kumar Chaubey [Immunology, Zoology] Mahatma Gandhi Post Graduate College, Gorakhpur, India.
N.K. Patel [Plant physiology & Ethno Botany] Sheth M.N.Science College, Patan, India.
Kumudben Babulal Patel [Bird, Ecology] Gujarat, India.
CHANDRAMOHAN [Biochemist] College of Applied Medical Sciences, King Saud University.
B.C. Behera [Natural product and their Bioprospecting] Agharkar Research Institute, Pune, INDIA.
Kuvalekar Aniket Arun [Biotechnology] Lecturer, Pune.
Mohd. Kamil Usmani [Entomology, Insect taxonomy] Aligarh Muslim university, Aligarh, india.
Dr. Lachhman Das Singla [Veterinary Parasitology] Guru Angad Dev Veterinary and Animal Sciences University, Ludhiana, India.
Vaclav Vetvicka [Immunomodulators and Breast Cancer] University of Louisville, Kentucky.
José F. González-Maya [Conservation Biology] Laboratorio de ecología y conservación de fauna Silvestre, Instituto de Ecología, UNAM, México.
Dr. Afreenish Hassan [Microbiology] Department of Pathology, Army Medical College, Rawalpindi, Pakistan.
Gurjit Singh [Soil Science] Krishi Vigyan Kendra, Amritsar, Punjab, India.
Dr. Marcela Pagano [Mycology] Universidade Federal de São João del-Rei, Brazil.
Dr.Amit Baran Sharangi [Horticulture] BCKV (Agri University), West Bengal, INDIA.
Dr. Bhargava [Melittopalynology] School of Chemical & Biotechnology, Sastra University, Tamilnadu, INDIA.
Dr. Sri Lakshmi Sunitha Merla [Plant Biotechnology] Jawaharlal Technological University, Hyderabad.
Dr. Mrs. Kaiser Jamil [Biotechnology] Bhagwan Mahavir Medical Research Centre, Hyderabad, India.
Ahmed Mohammed El Naim [Agronomy] University of Kordofan, Elobeid-SUDAN.
Dr. Zohair Rahemo [Parasitology] University of Mosul, Mosul,Iraq.
Dr. Birendra Kumar [Breeding and Genetic improvement] Central Institute of Medicinal and Aromatic Plants, Lucknow, India.
Dr. Sanjay M. Dave [Ornithology and Ecology] Hem. North Gujarat University, Patan.
Dr. Nand Lal [Micropropagation Technology Development] C.S.J.M. University, India.
Fábio M. da Costa [Biotechnology: Integrated pest control, genetics] Federal University of Rondônia, Brazil.
Marcel Avramiuc [Biologist] Stefan cel Mare University of Suceava, Romania.
Dr. Meera Srivastava [Hematology , Entomology] Govt. Dungar College, Bikaner.
P. Gurusaravanan [Plant Biology ,Plant Biotechnology and Plant Science] School of Life Sciences, Bharathidasan University, India.
Dr. Mrs Kavita Sharma [Botany] Arts and commerce girl’s college Raipur (C.G.), India.
Suwattana Pruksasri [Enzyme technology, Biochemical Engineering] Silpakorn University, Thailand.
Dr.Vishwas Balasaheb Sakhare [Reservoir Fisheries] Yogeshwari Mahavidyalaya, Ambajogai, India.
Dr. Pankaj Sah [Environmental Science, Plant Ecology] Higher College of Technology (HCT), Al-Khuwair.
Dr. Erkan Kalipci [Environmental Engineering] Selcuk University, Turkey.
Dr Gajendra Pandurang Jagtap [Plant Pathology] College of Agriculture, India.
Dr. Arun M. Chilke [Biochemistry, Enzymology, Histochemistry] Shree Shivaji Arts, Commerce & Science College, India.
Dr. AC. Tangavelou [Biodiversity, Plant Taxonomy] Bio-Science Research Foundation, India.
Nasroallah Moradi Kor [Animal Science] Razi University of Agricultural Sciences and Natural Resources, Iran
T. Badal Singh [plant tissue culture] Panjab University, India
Dr. Kalyan Chakraborti [Agriculture, Pomology, horticulture] AICRP on Sub-Tropical Fruits, Bidhan Chandra Krishi Viswavidyalaya,
Kalyani, Nadia, West Bengal, India.
Dr. Monanjali Bandyopadhyay [Farmlore, Traditional and indigenous
practices, Ethno botany] V. C., Vidyasagar University, Midnapore.
M.Sugumaran [Phytochemistry] Adhiparasakthi College of Pharmacy, Melmaruvathur, Kancheepuram District.
Prashanth N S [Public health, Medicine] Institute of Public Health, Bangalore.
Tariq Aftab Department of Botany, Aligarh Muslim University, Aligarh, India.
Manzoor Ahmad Shah Department of Botany, University of Kashmir, Srinagar, India.
Syampungani Stephen School of Natural Resources, Copperbelt University, Kitwe, Zambia.
Iheanyi Omezuruike OKONKO Department of Biochemistry & Microbiology, Lead City University,
Ibadan, Nigeria.
Sharangouda Patil Toxicology Laboratory, Bioenergetics & Environmental Sciences Division,
National Institue of Animal Nutrition
and Physiology (NIANP, ICAR), Adugodi, Bangalore.
Jayapal Nandyal, Kurnool, Andrapradesh, India.
T.S. Pathan [Aquatic toxicology and Fish biology] Department of Zoology, Kalikadevi Senior College, Shirur, India.
Aparna Sarkar [Physiology and biochemistry] Amity Institute of Physiotherapy, Amity campus, Noida, INDIA.
Dr. Amit Bandyopadhyay [Sports & Exercise Physiology] Department of Physiology, University of Calcutta, Kolkata, INDIA .
Maruthi [Plant Biotechnology] Dept of Biotechnology, SDM College (Autonomous),
Ujire Dakshina Kannada, India.
Veeranna [Biotechnology] Dept of Biotechnology, SDM College (Autonomous), Ujire Dakshina Kannada, India.
RAVI [Biotechnology & Bioinformatics] Department of Botany, Government Arts College, Coimbatore, India.
Sadanand Mallappa Yamakanamardi [Zoology] Department of Zoology, University of Mysore, Mysore, India.
Anoop Das [Ornithologist] Research Department of Zoology, MES Mampad College, Kerala, India.
Dr. Satish Ambadas Bhalerao [Environmental Botany] Wilson College, Mumbai
Rafael Gomez Kosky [Plant Biotechnology] Instituto de Biotecnología de las Plantas, Universidad Central de Las Villas
Eudriano Costa [Aquatic Bioecology] IOUSP - Instituto Oceanográfico da Universidade de São Paulo, Brasil
M. Bubesh Guptha [Wildlife Biologist] Wildlife Management Circle (WLMC), India
Rajib Roychowdhury [Plant science] Centre for biotechnology visva-bharati, India.
Dr. S.M.Gopinath [Environmental Biotechnology] Acharya Institute of Technology, Bangalore.
Dr. U.S. Mahadeva Rao [Bio Chemistry] Universiti Sultan Zainal Abidin, Malaysia.
Hérida Regina Nunes Salgado [Pharmacist] Unesp - Universidade Estadual Paulista, Brazil
Mandava Venkata Basaveswara Rao [Chemistry] Krishna University, India.
Dr. Mostafa Mohamed Rady [Agricultural Sciences] Fayoum University, Egypt.
Dr. Hazim Jabbar Shah Ali [Poultry Science] College of Agriculture, University of Baghdad , Iraq.
Danial Kahrizi [Plant Biotechnology, Plant Breeding,Genetics]
Agronomy and Plant Breeding Dept., Razi University, Iran
Dr. Houhun LI [Systematics of Microlepidoptera, Zoogeography, Coevolution,
Forest protection] College of Life Sciences, Nankai University, China.
María de la Concepción García Aguilar [Biology] Center for Scientific Research and Higher Education of Ensenada, B. C., Mexico
Fernando Reboredo [Archaeobotany, Forestry, Ecophysiology] New University of Lisbon, Caparica, Portugal
Dr. Pritam Chattopadhyay [Agricultural Biotech, Food Biotech, Plant Biotech] Visva-Bharati (a Central University), India
Table of Contents (Volume 4 - Issue 2)
Serial No Accession No Title of the article Page No
1 RA0416 Associations of Arbuscular Mycorrhizal (AM) fungi in the
Phytoremediation of Trace Metal (TM) Contaminated Soils.
Dhritiman Chanda, Sharma GD, Jha DK and Hijri M.
1247-1263
2 RA0423 Biometry and fouling study of intertidal black-lip pearl oyster, Pinctada
margaritifera (Linnaeus, 1758) to determine their eligibility in the pearl
culture industry.
Jha S and Mohan PM.
1264-1275
3
RA0429
Genetics characterization, nutritional and phytochemicals potential of
gedi leaves (Abelmoschus manihot (L.) Medik) growing in the North
Sulawesi of Indonesia as a candidate of poultry feed.
Jet S Mandey, Hendrawan Soetanto, Osfar Sjofjan and Bernat Tulung.
1276-1286
4 RA0392 The growth performance of Clarias gariepinus fries raised in varying
coloured receptacles.
Ekokotu Paterson Adogbaji and Nwachi Oster Francis.
1287-1292
5 RA0407 High adaptability of Blepharis sindica T. Anders seeds towards
moisture scarcity: A possible reason for the vulnerability of this
medicinal plant from the Indian Thar desert.
Purushottam Lal, Sher Mohammed and Pawan K. Kasera.
1293-1300
Article Citation: Dhritiman Chanda, Sharma GD, Jha DK and Hijri M.
Associations of Arbuscular Mycorrhizal (AM) fungi in the Phytoremediation of Trace Metal (TM) Contaminated Soils. Journal of Research in Biology (2014) 4(2): 1247-1263
Jou
rn
al of R
esearch
in
Biology
Associations of Arbuscular Mycorrhizal (AM) fungi in the
Phytoremediation of Trace Metal (TM) Contaminated Soils.
Keywords: Arbuscular Mycorrhiza, Heavy metals, Phytoremediation, Glomus, Paper mill effluents.
ABSTRACT: Arbuscular mycorrhizal fungi (AM) are integral, functioning parts of plant roots, widely recognized as plant growth enhancing beneficial mycobionts and tolerance to variety of stresses such as nutrient, drought, salinity and trace metals (TM). A study was undertaken to access the influence of paper mill effluents on mycorrhizal colonization and mycorrhizal spore count. Plants grown in metal contaminated site were found less mycotrophic than their counterparts on the non-polluted one. Regression analyses revealed that the mycorrhizal colonization and mycorrhizal spore count are significantly and positively correlated with various soil physio-chemical properties in the polluted and non-polluted site. Glomus was the most frequently isolated mycorrhizal species from the polluted site. The isolated indigenous strains of AM can be used for inoculation of plant species that might be used for rehabilitation of contaminated site. The study highlights the potential use of AM as bioremediation agent of polluted soils and as bioindicator of pollution for future research priorities.
1247-1263 | JRB | 2014 | Vol 4 | No 2
This article is governed by the Creative Commons Attribution License (http://creativecommons.org/
licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.
www.jresearchbiology.com Journal of Research in Biology
An International
Scientific Research Journal
Authors:
Dhritiman Chanda 1,
Sharma GD2, Jha DK3 and
Hijri M4.
Institution:
1. Microbiology Laboratory,
Department of Life Science
and Bioinformatics, Assam
University, Silchar, Assam,
India.
2. Bilaspur University,
Bilaspur, India.
3. Department of Botany,
Gauhati University, Assam,
India.
4. Institut de Recherche en
Biologie Vegetale,
University de Montreal,
Montreal, Canada.
Corresponding author:
Dhritiman Chanda.
Email Id:
Web Address: http://jresearchbiology.com/documents/RA0416.pdf.
Dates: Received: 17 Jan 2014 Accepted: 22 March 2014 Published: 23 April 2014
Journal of Research in Biology
An International Scientific Research Journal
Original Research
ISSN No: Print: 2231 – 6280; Online: 2231- 6299.
INTRODUCTION:
Arbuscualr mycorrhizal (AM) fungi are
ubiquitous obligate mycobionts forming symbiosis with
the terrstrial plant communities (Barea and Jeffries
1995). They are essential components of soil biota and
are found in almost all ecological situations particularly
those supporting plant communities with high species
diversity. AM are known to enhance plant tolerance to a
variety of stresses including nutrients, drought, metal
toxicity, salinity and pathogens all of which may affect
plants success in a contaminated or polluted soil (Olexa
et al., 2000; Zarei et al., 2010). AM can help alleviate
metal toxicity to plants by reducing metal translocation
from root to shoot (Leyval et al., 1997). Therefore they
may contribute to plant establishment and survival in
trace metals polluted sites and could be used as a
complement to immobilization strategies. In the last few
years, research interest has been focused on the diversity
and tolerance of AM in trace metals contaminated soil.
To understand the basis underlying adaptation and
tolerance of AM to trace metals in soils,since this could
facilitate and manage these soil microoraganisms for
restoration and bioremediation programs (Khan et al.,
2000; Shah et al., 2010). AM constitute an important
functional component of the soil plant system that is
critical for sustainable productivity in stressed soils and
promote plant growth to reduce or eliminate the
bioavilibility of plants as studied by Joner and Leyval
(2003). The variation in metal accumulation and inter-
plant translocation depends on the different factors like
host-plant, root density, soil characteristics, metals and
their availibility. Metal tolerant AM isolates can decrease
metal absorption capacity of these fungi, which could
filter metal ions during uptake as described (Val et al.,
1999; Andrew et al., 2013 and Martina and Vosatka
(2005)). AM increases its host’s uptake of nutrients and
can improve the growth and resistance to environmental
stresses (Biro et al., 2005; Smith and Read, 2008).
AM fungi could prove beneficial in
phytoremediation system as they can increase the rate of
plant survival and establishment, reduce plant stress and
increase plant nutrients acquisition, increase carbon and
nitrogen deposition into soil, thereby contributing to
bacterial growth and increase the volume of soil being
remediated (Almas et al., 2004).Trace metals
concentration may decrease the number and vitality of
AM as a result of HM toxicity. Metal transporters and
plant-encoded transporters are involved in the tolerance
and uptake of TM (Glassman and Casper 2012;
Rahmanian et al., 2011).
In recent times, one of the challenges facing the
mankind is the degradation and pollution of soil by
industrial effluents, sludge and solid waste. The pulp and
paper mill which has been categorized as one of the
twenty most polluting industries in India discharge huge
quantities of coloured and waste water (effluent) into the
environment and are responsible for soil pollution
consequently the hazardous chemicals enter into surface
or ground water and poison the soil or crops. The decline
of plant diversity is due to the soil toxicity generated by
dumping of solid paper mill wastes in the area. Several
researches have been carrying out to understand the role
of AM fungi in plant interaction with toxic metal for
promoting plant growth and the bioavailibility in stressed
soils. In order to develop the restoration protocol for
disturbed habitats, it is necesaary to study benificial
rhizosphere fungi like AM fungi that are tolerant to
various stresses. This will help us develop a protocol by
studying the association of arbuscular mycorrhizal fungi
in plants growing in soils polluted with paper mill
effluents.
MATERIAL AND METHODS:
Location of the study area:
The study was conducted at two sites i.e. one
polluted with paper mill effluents and another non-
polluted site. The first site was effluent dumping site
Chanda et al., 2014
1248 Journal of Research in Biology (2014) 4(2): 1247-1263
inside the campus of Hindustan Paper Corporation
Limited, HPC, Assam, India. The two sites were
approximately 2 Km apart. The study area was located at
an altitude of 116mMSL between 24052`N and 92036`E
longitides.
Collection of soil Sample:
From the polluted and non-polluted site,10
dominant plant species were selected for the study of
mycorrhizal association. The rhizosphere soil samples of
these individuals of a species were collected. The
rhizospheric soil samples were randomly selected and
then mixed together to obtain a composite representative
sample. The soil samplings were done trimonthly from
April 2010 to January 2012. The soil samples were
brought to the laboratory in sterile condition and stored
in a refrigerator at 4°C until they were processed.
Collection of root samples:
Fine roots from ten dominant different plants of
the same species were randomly collected and mixed
properly and a composite root sample was obtained for
each plant species. Trypan blue method was followed for
the determination of the intensity of root colonization as
described by Phillips and Hayman (1970).
Isolation of Mycorrhizal spores:
Spore extraction from the soil was carried out
using the Wet Sieving and Decanting Technique by
Gerdemann and Nicolson (1963). The isolated spores
were mounted on glass slide using Polyvinyl Alcohol-
Lactic acid Glycerol (PVLG) and observed under
compound microscope (100-1000X). Spores were
identified according to the manual of identification of
VAM fungi by Schenck and Perez (1990). The INVAM
worksheet was used for diagnosing the spores.
Additional spores not included in the manual were
identified as per the description given in the INVAM
website (http://invam.caf.wvu.edu/).
Soil Physico-chemical analysis:
The physical chracteristics of soil i.e., Moisture
content, soil pH and soil temperature were recorded in
both polluted and non-polluted sites.
The chemical chracteristic i.e., N, P, K, Ca, Mg
etc of the soil samples were estimated using the
technique in the polluted and non-polluted site
(Jackson,1985). Concentration of trace metalss i.e., Zn,
Journal of Research in Biology (2014) 4(2): 1247-1263 1249
Chanda et al., 2014
Caesalpinia pulcherrima
Fig 1: Monthly variation in Mycorrhizal spore population 50gm-1soil of different plant
species growing in the polluted site.
Ni and Cu were determined by Atomic Absorption
Spectrophotometer (VARIAN Spectra AA 220).
Statistical analysis:
Statistical analysis was carried out by following
the techniques of Gomez and Gomez (1984). Linear
Regression analyses and correlation-coefficient values
were calculated to find out the influence and association
of various edaphic factors with mycorrhizal spore
population and mycorrhizal root colonization (%) in the
both polluted and non-polluted site.
RESULTS AND DISCUSSION:
The plants were more mycotrophic in the non-
polluted site than those growing in the polluted site. The
maximum root colonization was obtained in July both in
the polluted and non-polluted site. The mycorrhizal root
colonization were estimated maximum in the month of
July and decreased gradually from October to January
and again increased from April. The rhizosphere soil of
the non-polluted site harboured more mycorrhizal spores
in all the selected plants than the non-polluted site.
Among the different plant species studied, maximum
mycorrhizal spore count was estimated in Melastoma
malabathricum (54, 50 gm-1 soil) followed by Samanea
saman (52, 50 gm-1 soil) and Caesalpinia pulcherrima
(49, 50 gm-1 soil) in the polluted site and in the non-
polluted site Melastoma malabathricum (123, 50 gm-1
soil) harboured maximum number of mycorrhizal spores
followed by Samanea saman (109,50 gm-1 soil) ,Cassia
sophera (109,50 gm-1 soil) and Caesalpinia pulcherrima
(98, 50 gm-1 soil) (Figures-1 and 2).
The maximum root colonization was obtained in
July and found decreased gradually until January and
again increased in April studied among the different
plant species studied in the both polluted and non-
polluted site. In the polluted site the maximum root
colonization was estimated in Melastoma malabathricum
(44%) followed by Caesalpinia pulcherrima (43%) and
Mimosa pudica (41%) and the minimum percentage
colonization was obtained in Colocasia esculenta (35%)
and Axonopus compressus (32%). In the non-polluted
site the maximum root colonization was estimated in
Melastoma malabathricum (68%) followed by
Caesalpinia pulcherrima (64%), Samanea saman (62%)
and Axonopus compressus (61%) and the minimum root
Chanda et al., 2014
Fig 2: Monthly variation in mycorrhizal spore population 50gm-1soil of different plant
species growing in the non-polluted site.
Caesalpinia pulcherrima
1250 Journal of Research in Biology (2014) 4(2): 1247-1263
colonization was estimated in Eupatorium odoratum
(54%) and Mimosa pudica (52%) (Figures- 3 and 4).
Inter relationship of mycorrhizal association with soil
Physio-chemical factors
The different soil parameters like N, P, K,
Organic C (%), Ca and Mg were estimated in the
polluted and non-polluted site. The polluted soil was less
moist than the non-polluted one. The rhizosphere soil
from polluted site was more alkaline than the non-
polluted one. Likewise more temperature was recorded
in the polluted site and less temperature was recorded in
the non-polluted site. All physical parameters were
recorded maximum in the month of July that gradually
decreased from October till April except soil pH
(Table- 1).
The soil samples from polluted and non-polluted
site showed marked monthly variation in their chemical
properties. Nitrogen, phosphorous and organic carbon
(%) content of the rhizosphere soil gradually decreased
from July to January and slightly increased in April.
A similar trend of monthly variation was also observed
in the non-polluted site as well. The soil phosphorus
content of polluted site was found less than the non-
polluted site. The soil calcium and magnesium content
were also found more in the polluted site than the non-
polluted site. The various trace metals like Cu, Ni and Zn
were also estimated and found gradually decreased from
July to January and then slightly increased from the
month of April (Tables- 2 and 3).
Liner regression analyses were calculated to find
out the influence of various edaphic factors on
mycorrhizal colonization and mycorrhizal spore
population. The results of regression analysis showed a
positive and significant correlation coefficient(R) values
between mycorrhizal spore population with soil moisture
content (r = 0.95; P < 0.01; Fig. 5(a)), soil temperature
(r = 0.86; P < 0.01; Fig. 5(b)), Nitrogen (r = 0.81;
P < 0.01;Fig. 5(d)), Organic carbon (r = 0.82; P < 0.01;
Fig. 5(g)), Calcium (r = 0.84; P < 0.01; Fig. 5(h)), Zinc
(r = 0.59; P < 0.01; Fig. 5(k)), Cu (r = 0.97;P < 0.01; Fig.
5(i)) and Ni (r = 0.92; P < 0.01; Fig. 5(j)). The
correlation coefficient with soil pH (r = 0.75; P < 0.01;
Fig 5(c)) and soil phosphorus (r = 0.75; P < 0.01; Fig. 5
(e)) were however, negative and significant.
Chanda et al., 2014
Fig 3: Monthly variation in mycorrhizal colonization (%) of different plant
species growing in the polluted site.
Caesalpinia pulcherrima
Journal of Research in Biology (2014) 4(2): 1247-1263 1251
The positive and significant correlation
coefficient values were between mycorrhizal
colonization and soil moisture content (r = 0.86;
P < 0.01; Fig. 7(a)), soil temperature (r = 0.70; P < 0.01;
Fig. 7(b)), Nitrogen (r = 0.85;P < 0.01; Fig. 7(d)),
phosphorus (r = 0.90;P < 0.01; Fig. 7(e)), soil organic
carbon (r = 0.64; P < 0.01; Fig. 7(f)), Calcium (r = 0.97;P
< 0.01; Fig. 7(g)), copper (r = 0.78; P < 0.01; Fig. 7(i))
and Nickel (r = 0.82; P < 0.01; Fig. 7(j)) and Zinc (r =
0.39; P < 0.01; Fig. 7(k)) in the polluted site. The
correlation coefficient with soil Mg and soil pH was
however found negative and significant.
In the non-polluted site, a significant correlation
coefficient values were estimated between mycorrhizal
spore population soil pH (r = 0.67; P<0.01; Fig. 6(b)),
soil moisture content (r = 0.82;P < 0.01; Fig. 6(a)), soil
organic carbon (r = 0.82; P < 0.01; Fig. 6(f)), soil
nitrogen (r = 0.94; P<0.01; Fig. 6(d)), soil phosphorus
Chanda et al., 2014
Sampling Period Physical parameters
Months Moisture Content (%) pH Soil Temperature (C0)
April,10 7.8 ± 0.08 (16.3 ± 0.05) 6.9 ± 0.08 (4.10 ± 0.05) 23.1 ± 0.08 (15.2 ± 0.03)
July,10 14.4 ± 0.12 (24.8 ± 0.05) 6.1 ± 0.05 (4.80 ± 0.06) 27.5 ± 0.03 (21.5 ± 0.05)
October,10 11.3 ± 0.05 (18.8 ± 0.03) 6.7 ± 0.03 (4.30 ± 0.03) 22.8 ± 0.03 (17.8 ± 0.08)
January,11 5.7 ± 0.03 ( 8.2 ± 0.08) 7.1 ± 0.03 (4.48 ± 0.13) 19.8 ± 0.06 (14.6 ± 0.03)
April,11 8.1 ± 0.03 (14.2 ± 0.06) 6.9 ± 0.05 (4.00 ± 0.05) 22.8 ± 0.03 (15.4 ± 0.08)
July,11 16.5 ± 0.05 (23.8 ± 0.05) 6.5 ± 0.03 (5.30 ± 0.03) 28.2 ± 0.06 (21.0 ± 0.03)
October,11 12.5 ± 0.03 (18.2 ± 0.03) 6.9 ± 0.03 (4.60 ± 0.03) 23.0 ± 0.05 (18.2 ± 0.08)
January,12 6.2 ± 0.03 ( 8.4 ± 0.05) 7.2 ± 0.03 (4.40 ± 0.05) 18.7 ± 0.06 (15.1 ± 0.05)
Table 1: Monthly Variation in the physical properties of polluted & non-polluted soils.
Data are represented in mean ±SE; Value in parentheses represents the data from non-polluted site
Caesalpinia pulcherrima
Fig 4: Monthly variation in mycorrhizal colonization (%) of different plant spe-
cies growing in the non-polluted site.
1252 Journal of Research in Biology (2014) 4(2): 1247-1263
Chanda et al., 2014
Sam
pli
ng p
erio
ds
Mon
ths
Ch
em
ica
l p
aram
ete
rs
N (
mg/g
) P
(m
g/g
) K
(m
g/g
) O
rg
an
ic C
%
Mg
(m
g/g
) C
a (
mg/g
) C
u (
pp
m)
Ni
(pp
m)
Zn
(p
pm
)
Apri
l,10
0.3
125±
0.0
80
(0.0
217±
0.0
50)
0.0
057±
0.0
6
(0.0
027±
0.0
3)
0.2
1±
0.0
2
(0.0
50
±0.0
3)
1.7
8±
0.0
8
(0.4
13
±0.0
3)
3.2
4±
0.0
5
(0.1
32
±0.0
3)
4.7
6±
0.0
3
(0.1
2±
0.0
5)
0.0
34
±0.0
2
BD
L
0.0
13
± 0
.05
BD
L
0.3
17
±0.0
4
BD
L
July
,10
0.4
270±
0.0
60
(0.0
740±
0.0
30)
0.0
016±
0.0
5(0
.0062±
0.0
6)
0.3
8±
0.0
5(0
.04
6±
0.0
6)
2.1
7±
0.0
6(0
.61
5±
0.0
5)
1.8
9±
0.0
6(0
.08
1±
0.0
8)
5.7
9±
0.0
6(0
.07
±0
.03
) 0
.07
5±
0.0
5
BD
L
0.0
34
±0.0
3
BD
L
0.3
58
±0.0
6
BD
L
Oct
ober
,10
0.4
100±
0.0
50
(0.0
380±
0.0
30)
0.0
035±
0.0
7(0
.0047±
0.0
3)
0.2
6±
0.0
5(0
.03
2±
0.0
3)
1.8
6±
0.0
7(0
.57
8±
0.0
3)
2.2
4±
0.0
7(0
.11
8±
0.0
5)
5.3
1±
0.0
2(0
.06
8±
0.0
6)
0.0
47
±0.0
7
BD
L
0.0
22
±0.0
6
BD
L
0.2
97
±0.0
5
BD
L
Januar
y,11
0.3
630±
0.0
60
(0.0
240±
0.0
50)
0.0
047±
0.0
5(0
.0020±
0.0
3)
0.1
8±
0.0
6(0
.01
7±
0.0
5)
1.2
3±
0.0
5(0
.43
9±
0.0
6)
2.0
8±
0.0
3(0
.12
7±
0.0
6)
4.8
6±
0.0
8(0
.07
9±
0.0
7)
0.0
23
±0.0
8
BD
L
0.0
08
±0.0
2
BD
L
0.2
78
±0.0
3
BD
L
Apri
l,11
0.3
290±
0.0
70
(0.0
260±
0.0
30)
0.0
062±
0.0
6
(0.0
034±
0.0
5)
0.3
1±
0.0
7
(0.0
80
±0.0
4)
1.8
2±
0.0
7
(0.4
24
±0.0
3)
3.1
9±
0.0
7
(0.1
41
±0.0
5)
4.6
7±
0.0
5
(0.1
7±
0.0
3)
0.0
41
±0.0
6
BD
L
0.0
16
±0.0
3
BD
L
0.3
24
±0.0
4
BD
L
July
,11
0.4
510±
0.0
50
(0.0
870±
0.0
30)
0.0
021±
0.0
3(0
.0071±
0.0
5)
0.4
6±
0.0
5(0
.05
7±
0.0
3)
2.3
4±
0.0
7(0
.64
8±
0.0
3)
1.7
5±
0.5
7(0
.10
5±
0.3
8)
5.6
3±
0.0
5(0
.11
±0
.06
) 0
.08
7±
0.0
3
BD
L
0.0
41
±0.0
5
BD
L
0.3
49
±0.0
3
BD
L
Oct
ober
,11
0.3
800±
0.0
57
(0.0
420±
0.0
60)
0.0
031±
0.0
6(0
.0039±
0.0
3)
0.3
7±
0.0
5(0
.03
7±
0.0
6)
1.8
9±
0.0
6(0
.58
0±
0.0
5)
2.1
5±
0.0
3(0
.12
0±
0.0
4)
5.3
7±
0.0
3(0
.07
±0
.05
)
0.0
52
±0.0
6
BD
L
0.0
29
±0.0
6
BD
L
0.2
85
±0.0
6
BD
L
Januar
y,12
0.3
200±
0.0
30
(0.0
280±
0.0
28)
.0049±
0.0
7(0
.0051±
0.0
3)
0.2
2±
0.0
3(0
.02
2±
0.0
6)
1.2
8±
0.0
3(0
.44
7±
0.0
2)
2.0
1±
0.0
5(0
.12
9±
0.0
6)
4.7
7±
0.0
6(0
.08
2±
0.0
2)
0.0
29
±0.0
5
BD
L
0.0
06
±0.0
7
BD
L
0.2
75
±0.0
4
BD
L
Tab
le 2
: M
on
thly
Varia
tion
in
th
e c
hem
ical
prop
erti
es
of
poll
ute
d a
nd
non
-poll
ute
d s
oil
.
Dat
a ar
e re
pre
sen
ted
in
mea
n ±
SE
; B
DL
=B
elo
w D
etec
table
Lim
it;
Val
ue
in p
aren
thes
es r
epre
sen
ts t
he
dat
a fr
om
non
-poll
ute
d s
ite
Journal of Research in Biology (2014) 4(2): 1247-1263 1253
(r = 0.85; P < 0.01; Fig. 6(e)) and soil magnesium (r =
0.77; P < 0.01; Fig. 6(g)).
In the non-polluted site, the mycorrhizal
colonization was found significantly and positively
correlated with soil moisture content (r = 0.80; P < 0.01;
Fig. 8(a)), soil temperature (r = 0.94; P < 0.01; Fig. 8(c)),
soil pH (r = 0.54; P < 0.01; Fig. 8(b)) soil Nitrogen (r =
0.79; P < 0.01; Fig. 8(d)), phosphorus (r = 0.92; P < 0.01;
Fig. 8(e)), soil organic carbon (r = 0.90; P < 0.01; Fig. 8
(f)), Magnesium (r = 0.85; P < 0.01; Fig. 8(h)). The
correlation coefficient with soil Calcium was however
found negative and significant.
The present experimental findings revealed the
relationship of mycorrhizal spore population and
mycorrhizal colonization with various physio-chemical
properties of soil polluted with trace metals. The low
intensity of root colonization and low spore count in the
polluted site may be attributed to the sensitivity of
endomycorrhizal fungi to various soil pollutants. This
may be due to the alkaline pH, higher soil temperature
due to the deposition of more amounts of Calcium and
trace metals that might have adversely affected the
sporulation and colonization ability of the mycorrhizal
fungi as reported by Schenck and Smith (1982). Rohyadi
et al., (2004) also observed that the relative growth
improvement by mycorrhizas was highest at pH 4.7 and
the same decreased as the pH increased. The presence of
trace metals in the polluted soil may be responsible for
less percentage of root colonization in the polluted site.
AM spore population decreased with increased amount
of trace metals in the soil (Val et al., 1999; Hayes et al.,
2003).The negative correlation with soil Phosphorous,
Magnesium and pH is may be responsible for the less
percentage of root colonization in the plants. High
alkalinity in the soil was also responsible for decrease in
the number of spores as well as root colonization in the
polluted soil. The spore population and mycorrhizal root
colonization of AMF fungi were found decreased by the
higher levels of heavy metals in the soil. Our results also
supports the findings of (Shah et al., (2010); Biro et al.,
(2005); Göhre and Paszkowski (2006); Mathur et al.,
(2007)).
Among the isolated genera of AM fungi, Glomus
was the most dominant AM genus isolated during the
present investigation followed by Gigaspora and
Scutellospora sp. Dominance of Glomus sp in the
polluted soil may be due to its higher metal tolerance
capacity as reported earlier by various workers (Martina
and Vosatka 2005; Carrasco et al., 2011; Chen et al.,
2007; Zaefarian et al., 2010). The decline of AM fungal
occurance (propagule density) and infectivity in trace
metal polluted site which can be used as bioindicators of
Chanda et al., 2014
Sampling Periods Endogonaceous Spore Population(50gm-1) Mycorrhizal colonization (%)
Months
April,10 24 ± 0.6 ( 52 ±0.8) 21 ± 0.8 (32 ± 0.6)
July,10 54 ± 0.5 (118 ±0.8) 44 ± 0.3 (68 ± 0.4)
October,10 39 ± 0.3 ( 75 ±0.8) 34 ± 0.5 (53 ± 0.3)
January,11 18 ± 0.5 ( 46 ±0.5) 21 ± 0.5 (26 ± 0.3)
April,11 26 ± 0.5 ( 49 ±0.8) 19 ± 0.5 (34 ± 0.6)
July,11 61 ± 0.5 (124 ±0.5) 39 ± 0.3 (61 ± 0.5)
October,11 35 ± 0.5 ( 68 ±0.8) 32 ± 0.3 (48 ± 0.8)
January,12 20 ± 0.5 ( 40 ±0.5) 18 ± 0.3 (28 ± 0.4)
Table 3: Monthly Variation in the Mycorrhizal spore population and Mycorrhizal root colonization (%) in
50gm-1 soil of polluted and non-polluted sites
Data are represented in mean ±SEM; Value in parentheses represents the data from non-polluted site
1254 Journal of Research in Biology (2014) 4(2): 1247-1263
soil contamination (Citterio et al., 2005; Liao et al.,
2003).
CONCLUSION:
Our study suggests that the effluents and the
solid wastes dumped by the paper mill have high
concentration of trace metals that changed the other
physical and chemical properties of the soil. The
indigenous AM isolates existing naturally which are
isolated from trace metal polluted soils are reported
efficiently to colonize plant roots in trace metal-stressed
environments by significantly correlated with various
physic-chemical properties of the soil. It is therefore of
great importance that we combine selected plants with
specific AM fungal isolates adapted to high
concentrations of trace metal in future research for
phytoremediation programes. Thus, the isolated strains
of AM fungi can be of great interest since they can be
used for inoculation of the plant species and the present
study provides evidences for the potential use of the
Chanda et al., 2014
(a) (b)
(c) (d)
(e) (f)
Journal of Research in Biology (2014) 4(2): 1247-1263 1255
Chanda et al., 2014
Figure 5: Mycorrhizal spore population 50gm-1 soil (X) expressed as a function of soil physio-chemical
factors (Y) in the polluted site.Regression is drawn only for statistically significant relationship (p < 0.01).
(MC=Moisture Content; Soil temp(C0),soil pH,Nitrogen (N), Potassium (K), Phosphorus (K),Organic
Carbon (%),Calcium (Ca),Copper (Cu), Nickel (Ni) and Zinc (Zn)).
(g) (h)
(i) (j)
(k)
1256 Journal of Research in Biology (2014) 4(2): 1247-1263
Chanda et al., 2014
(a) (b)
(c) (d)
(e)
Figure 6: Mycorrhizal spore population 50gm-1 soil (X) expressed as a function of soil physio-chemical factors (Y) in the
non-polluted site.Regression is drawn only for statistically significant relationship (p < 0.01). (MC=Moisture Content;
Soil temp(C0),Soil pH, Nitrogen(N), Potassium(K),Phosphorus(P),Organic Carbon (%),Magnesium(Mg)).
(g)
(f)
Journal of Research in Biology (2014) 4(2): 1247-1263 1257
(e)
(d)
(a)
(f)
(b)
(c)
Chanda et al., 2014
1258 Journal of Research in Biology (2014) 4(2): 1247-1263
Chanda et al., 2014
Figure 7: Mycorrhizal colonization (X) expressed as a function of soil physio-chemical factors (Y) in
the polluted site.Regression is drawn only for statistically significant relationship (p < 0.01).
MC=Moisture Content; Soil temp(C0),Nitrogen (N), Phosphorous (P),Organic Carbon (%),Calcium
(Ca),Magnesium (Mg),Copper (Cu),Nickel (Ni) and Zinc (Zn)).
(i)
(g) (h)
(k)
(j)
Journal of Research in Biology (2014) 4(2): 1247-1263 1259
Chanda et al., 2014
(k)
(a) (b)
(c) (d)
(e) (f)
(g) (h)
1260 Journal of Research in Biology (2014) 4(2): 1247-1263
plant species in combination with AM fungi in the paper
mill polluted with paper mill effluents contaminated with
various trace metals.
ACKNOWLEDGEMENT:
The authors are grateful to the Department of
Life Science, Microbiology Laboratory, Assam
University (Silchar), India for providing the laboratory
facilities.
REFERENCES:
Almas AR, Bakken LR and Jan Mulder. 2004.
Changes in tolerance of soil microbial communities in
Zn and Cd contaminated soils. Soil Biol Biochem. 36(5):
805–813.
Andrew B, Brown MV, Steven DS and Peter HT.
2013. Microbial community responses to
anthropogenically induced environmental change:
towards a systems approach. Ecol Lett. 16 (Supplement
S1): 128-139.
Barea JM and Jeffries P. 1995. Arbuscular
mycorrhizas in sustainable soil plant systems. In: B.
Hock and A. Varma (eds) Mycorrhiza, structure,
Function, Molecular Biology and biotechnology.
Springer-Verlag, Heidelberg. 521-559.
Biró B, Posta K, Füzy A, Kádár I and Németh T.
2005. Mycorrhizal Functioning as part of the Survival
Mechanisms of Barley (Hordeum vulgare L.) at Long-
term Heavy Metal Stress, Acta Biol.Szegedien. 49 (1-2):
65-67.
Carrasco L, Azcon R, Kohler J, Roldán A and
Caravaca F. 2011. Comparative effects of native
filamentous and arbuscular mycorrhizal fungi in the
establishment of an autochthonous, leguminous shrub
growing in a metal-contaminated soil. Sci Total
Environ., 409(6): 1205-1209.
Chen BD, Zhu Y.-G, Duan J, Xiao XY and Smith SE.
2007. Effects of the arbuscular mycorrhizal
fungus Glomus mosseae on growth and metal uptake by
four plant species in copper mine tailings. Environ
Pollut. 147(2): 374-380.
Citterio S, Prato N, Fumagalli P. Aina R, Massa N,
Santagostino A, Sgorbati S and Berta G. 2005. The
arbuscular mycorrhizal fungus Glomus mosseae induces
growth and metal accumulation changes in Cannabis
Chanda et al., 2014
Figure 8: Mycorrhizal colonization (X) expressed as a function of soil physio-chemical factors (Y) in
the non-polluted site.Regression is drawn only for statistically significant relationship (p < 0.01).
(MC = Moisture Content; Soil temp(C0),Soil pH, Nitrogen(N), Potassium (K),Phosphorus (P),Organic
Carbon (%),Magnesium (Mg) and Calcium (Ca)).
(i)
Journal of Research in Biology (2014) 4(2): 1247-1263 1261
sativa L. Chemosphere. 59(1): 21-29.
Glassman SI and Casper BB. 2012. Biotic contexts
alter metal sequestration and AMF effects on plant
growth in soils polluted with heavy metals. Ecology.
93(7): 1550-1559.
Gerdemann JW and Nicolson TH. 1963. Spores of
mycorrhizal Endogone species extracted from soil by wet
sieving and decanting. Trans Br Mycol Soc., 46(2):
235-244.
Göhre V and Paszkowski U. 2006. Contribution of the
Arbuscular Mycorrhizal Symbiosis to Heavy Metal
Phytoremediation. Planta. 223(6): 1115-1122.
Gomez KA and Gomez AA. 1984. Statistical
Procedures for Agricultural Research (2nd edn), An
International Rice Research Institute book, A Wiley-
Interscience Publication, John Willey and Sons, New
York.
Hayes WJ, Chaudhry TM, Buckney RT and Khan
AG. 2003. Phytoaccumulation of Trace Metals at the
Sunny Corner Mine, New South Wales with Suggestions
for a Possible Remediation Strategy, Aust J Toxicol.,
9(1):69-82.
Jackson ML. 1985. Soil chemical analysis, 2nd edition,
Madison, WI, USA.
Joner EJ and Leyval C. 2003. Phytoremediation of
organic pollutants using mycorrhizal plants: a new aspect
of rhizosphere interactions. Agronomie. 23(5-6):
495-502.
Khan AG, Kuek C, Chaudhry TM, Khoo CS and
Hayes WJ. 2000. Role of plants,mycorrhizae and
phytochelators in heavy metal contaminated land
remediation. Chemosphere. 41(1-2):197-207.
Leyval C, Turnau K and Haselwandter K. 1997.
Effect of heavy metal pollution on mycorrhizal
colonization and function: physiological, ecological and
applied aspects. Mycorrhiza. 7(3): 139-153.
Liao JP, Lin XG, Cao ZH, Shi YQ and Wong MH.
2003. Interactions between arbuscular mycorrhizae and
heavy metals under sand culture experiment.
Chemosphere. 50(6): 847-853.
Mathur N, Bohra JSS, Quaizi A and Vyas A. 2007.
Arbuscular Mycorrhizal Fungi: A Potential Tool for
Phytoremediation, J Plant Sci., 2(2): 127-140.
Martina J and Vosatka M. 2005. Response to
Cadmium of Daucus carota hairy roots dual cultures
with Glomus intraradices or Gigaspora margarita.
Mycorrhiza. 15(3): 217-224.
Olexa TJ, Gentry TJ, Hartel PG. Wolfb DC,
Fuhrmannc JJ and Reynoldsd CM. 2000.
Mycorrhizal Colonization and microbial community
structure in the rhizosphere of annual ryegrass grown in
pyrene-amended soils. Int J Phytol., 2(3): 213-231.
Phillips JM and Hayman DS. 1970. Improved
procedures for cleaning and staining parasitic and
vesicular-arbuscular mycorrhizal fungi for rapid
assessment of infection. Trans Br Mycol Soc., 55(1):
158-161.
Rahmanian M, Khodaverdiloo H, Rezaee DY and
Rasouli SMH. 2011. Effects of Heavy Metal Resistant
Soil Microbes Inoculation and Soil Cd Concentration on
Growth and Metal Uptake of Millet, Couch Grass and
Alfalfa. Afr J Microbiol Res., 5(4): 403-410.
Rohyadi A, Smith FA, Murray RS and Smith SE.
2004. Effects of pH on mycorrhizal colonisation and
nutrient uptake in cowpea under conditions that minimise
confounding effects of elevated available aluminium.
Plant Soil. 260(1-2): 283-290.
Shah FR, Ahmad N, Masood KR. Peralta-Videa JR
and Ahmad FuD. 2010. Heavy Metal Toxicity in Plants.
Chanda et al., 2014
1262 Journal of Research in Biology (2014) 4(2): 1247-1263
In: Ashraf, M. Ozturk M. and S.A. Ahmad (eds) Plant
Adaptation and Phytoremediation, Springer Dordrecht
Heidelberg London, New York.71-98.
Schenck NC and Smith GS. 1982. Responses of six
species of vesicular arbuscular mycorrhizal fungi and
their effects on soybean at four-soil temperatures. New
Phytol., 92(2):193-201.
Schenck, NC and Perez Y. 1990. Manual for the
Identification of VA Mycorrhizal Fungi. (3rd edn).
Gainesville, Florida, Synergistic Publications.
Smith SE and Read DJ. 2008. Mycorrhizal Symbiosis
Academic press London.
Val CD, Barea, JM and Azcon-Aguilar C. 1999.
Diversity of arbuscular mycorrhizal fungus populations
in heavy- metal- contaminated soils. Appl Environ.
Microbiol., 65(2): 718-723.
Zaefarian F, Rezvani M, Rejali F, Ardakani MR and
Noormohammadi G. 2010 Ability of Glomus mosseae-
Alfalfa (Medicago sativa L.) Association for Heavy
Metal Phytoextraction from Soil. Environ Sci., 7(3):
77-90.
Zarei M, Hempel S, Wubet T, Schäfer SH,
Savaghebi G, Jouzani GS, Nekouei MK and Buscot F.
2010. Molecular diversity of arbuscular mycorrhizal
fungi in relation to soil chemical properties and heavy
metal contamination. Environ. Pollu., 158(8): 2757-
2765.
Submit your articles online at www.jresearchbiology.com
Advantages
Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright
submit@jresearchbiology.com
www.jresearchbiology.com/Submit.php.
Chanda et al., 2014
Journal of Research in Biology (2014) 4(2): 1247-1263 1263
Article Citation: Jha S and Mohan PM. Biometry and fouling study of intertidal black-lip pearl oyster, Pinctada margaritifera (Linnaeus, 1758) to determine their eligibility in the pearl culture industry. Journal of Research in Biology (2014) 4(2): 1264-1275
Jou
rn
al of R
esearch
in
Biology
Biometry and fouling study of intertidal black-lip pearl oyster, Pinctada margaritifera
(Linnaeus, 1758) to determine their eligibility in the pearl culture industry
Keywords: Black-lip pearl oyster, Allometry, Biofouling, Intertidal Limiting factors, Reproductive maturity, Pearl culture.
ABSTRACT: The present study on the biometry and fouling load of black-lip pearl oyster, Pinctada margaritifera (Linnaeus, 1758), was conducted to understand the eco-biology of these intertidal oysters so that their eligibility in the pearl culture industry could be determined. Biometric parameters viz., Anteroposterior measurement (APM), hinge length (HL), thickness (THK) and total weight (TWT) of each oyster were checked for their correlation with dorsoventral measurement (DVM) and fouling load (ΔF) separately by regression analysis. Shell length of collected specimens ranged between 16 ± 3.7- 88.2 ± 6.5 mm. Most of the P. margaritifera from intertidal regions of Andaman were confined to 61-80 mm size group. The average size of all the shell dimensions and TWT increased with increase in the shell length. The rate of increase of all the biometric parameters except TWT, declined in size range >41-60 mm. Maximum and minimum fouling load was observed during September 2011 (27.8 ± 5.1 g) and July 2012 (3.2 ± 3.7 g), respectively. Lower size groups showed maximum correlation indicating isometric growth but in higher size range, allometry was observed as the rate of increase of biometric parameters varied with increasing size range. On the basis of this study it could be concluded that if transferred to suspended culture at an early stage, these intertidal oysters, adapted to survive in harsh environmental conditions, would acclimatize more easily to the new environment and would cross the 61-80 mm size range becoming larger and thicker, a parameter favourable for pearl production.
1264-1275| JRB | 2014 | Vol 4 | No 2
This article is governed by the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.
www.jresearchbiology.com Journal of Research in Biology
An International
Scientific Research Journal
Authors:
Jha S and Mohan PM.
Institution:
Department of Ocean
Studies and Marine Biology,
Pondicherry University
(Brookshabad Campus),
Chakkargaon Post, Port
Blair, 744112,
Andaman and Nicobar
Islands, India.
Corresponding author:
Jha S.
Email Id:
Web Address: http://jresearchbiology.com/
documents/RA0423.pdf.
Dates: Received: 19 Feb 2014 Accepted: 01 Apr 2014 Published: 14 May 2014
Journal of Research in Biology
An International Scientific Research Journal
Original Research
ISSN No: Print: 2231 – 6280; Online: 2231 - 6299.
INTRODUCTION
Pearl oyster Pinctada margaritifera (Linnaeus,
1758) is commonly known as the black-lip pearl oyster
due to dark colouration of the nacre of its inner shell
towards the distal rim (Saville-Kent, 1893). This
exclusively marine, sedentary bivalve is distributed along
the tropic belt within the Indo-Pacific Ocean (Pouvreau
and Prasil, 2001; El-Sayed et al., 2011).
P. margaritifera are cultured around the world
for the production of black pearls, designer mabe (Kripa
et al., 2008), and for their lustrous inner shell known as
mother of pearl which is used in the ornamental and
button industry (Kimani and Mavuti, 2002; Fletcher
et al., 2006). A thorough knowledge of the biometry of
pearl oyster is of prime importance in the pearl culture
industry. Thickness and wet weight of the pearl oyster
helps in predicting the nuclei size (Mohamed et al.,
2006; Abraham et al., 2007). Kripa et al., (2008)
considered shell size to be an important criteria for mabe
production.
In different parts of the world, research is being
carried out to understand the biometric relationship of
black pearl oysters in natural and cultured conditions.
Friedman and Southgate (1999) studied the biometric
relationship of these oysters in Solomon Islands.
Pouvreau et al., (2000a) reported the isometric relation
between their length and thickness in French Polynesia.
El-Sayed (2011) studied the concept of allometric growth
in P. margaritifera from the Egyptian coastal waters.
In India P. margaritifera is the most abundant in
Andaman and Nicobar Islands (Alagarswami, 1983).
Alagarswami (1983) and Abraham et al., (2007) studied
the biometric relationship between various shell
dimensions viz., hinge length (HL), thickness (THK) and
total weight (TWT) with the dorsoventral measurement
(DVM) or the shell length of the black-lip pearl oyster in
Andaman and Nicobar Islands. But the size range and
total number of specimens studied by them were
different from the present study. Alagarswami studied
the correlation of biometric parameter of all the oysters
without dividing them into any size group. None of these
authors studied the correlation between DVM and the
fouling load (ΔF).
In the natural habitat, several environmental
factors such as availability of food and space, nature of
substratum, fouling, competition, predation etc., affect
the biometric growth of black pearl oysters
(Alagarswami, 1991; Gervis and Sims, 1992; Mohamed
et al., 2006). Fouling on the sedentary organism plays a
major role in adversely affecting their growth and
development as more the fouling more is the energy
required for oysters to open its valve for food filtration
and respiration (Alagarswami and Chellam, 1976;
Mohammad, 1976; Alagarswami, 1987; Taylor et al.,
1997; Mohammed, 1998; Pit and Southgate, 2003).
The main objective of the present study was to
determine the eligibility of intertidal P. margaritifera in
the pearl culture industry by understanding their
biometry as well as month-wise variation in the fouling
load at natural habitat. A novel aspect of pearl oyster
ecology explored in this study was the correlation
between DVM-ΔF, which shall be the first known
reference available from Andaman and elsewhere.
MATERIALS AND METHODS
Study Area
Preliminary surveys were conducted in 10
intertidal regions of South Andaman, out of which only
three regions viz. Burmanallah (11°34’19” N; 92°44’39”
E), Carbyn (11°38’49” N; 92°44’81” E) and Marina Jetty
area (11°40’16” N; 92°44’53” E) showed natural
availability of P. margaritifera and hence were selected
as the study area for the present study conducted during
July 2011 to July 2012.
Sampling Method
For studying the relationship between various
shell dimensions during different growth size of the
oysters, 151 specimens of P. margaritifera were
Jha and Mohan, 2014
1265 Journal of Research in Biology (2014) 4(2): 1264-1275
collected and brought to the laboratory in a bucket filled
with raw sea water.
The individual morphometric parameters viz.
shell length or the dorsoventral measurement (DVM),
anteroposterior measurement (APM), hinge length (HL)
and shell thickness (THK) were measured with the help
of a digital vernier calliper (Aerospace, accuracy = 0.01
mm) using the method of Hynd (1955) and then grouped
into five length classes with a class interval of 20 mm
viz., 1-20, 21-40, 41-60, 61-80 and 81-100 mm. DVM
and APM were measured excluding the growth process.
To minimize any error during the measurement
of total weight (TWT), oysters were taken out from the
bucket and kept outside in a tray covered with wet cloth
for 15 minutes to remove the water trapped inside the
oyster as described in Moullac et al., (2012). Once most
of the in-held water had seeped out, weight of the fouled
oysters were measured by using digital balance
(Professional Digital Scale, accuracy = 0.01 g).
The attached foulers on the shells of the oysters
were then scrapped off and oysters were washed with
filtered sea water to clean all the epiphytic growth. The
cleaned oysters were weighed again to determine their
actual total weight (foul free weight). The fouling load
(ΔF) was calculated by comparing the individual weight
of each fouled oyster with their respective weight after
cleaning.
Statistical Analysis
The average value of biometric dimensions,
fouling load and their rate of increment for five different
size groups were obtained by calculating the mean and
standard deviation. Month-wise average fouling load was
also calculated using the same method. Pearson’s
Correlation Coefficient between biometric relationships
viz., DVM-APM, DVM-HL, DVM-THK and the
correlation between ΔF with biometric parameters
(DVM, APM, HL, THK and TWT) were calculated by
fitting the least square method equation, y = a+bx, of
linear regression.
The length-weight relationship was determined
by following the method of Abraham et al., (2007) where
the length measurements were expressed in centimeters
and the weight was expressed in grams. Exponential
curvi-linear regression models were prepared for the
estimation of correlation between DVM-TWT, as their
relationship was non-linear. The correlation values were
tested for significance with one-way ANOVA adopting
Hynd (1955).
RESULTS
Trend of biometric growth and fouling
The DVM of the 151 collected specimens ranged
between 16 ± 3.7- 88.2 ± 6.5 mm. The average values of
biometric dimensions of all the size groups and their
fouling load have been graphically represented in Fig.1,
Journal of Research in Biology (2014) 4(2): 1264-1275 1266
Jha and Mohan, 2014
Fig. 1 Average biometric dimensions (±SE) of 5 size groups of
Pinctada margaritifera.
along with their standard deviation values.
From the observation it was found that as the
DVM increased the average size of all other shell
dimensions also increased, though not at a constant rate
(Fig. 2). ΔF also increased with the DVM except for the
largest size group (81-100 mm) where ΔF was lesser
than 61-80 mm group. The size group, 61-80 mm was
the most heavily fouled of all the other size ranges. The
monthly average fouling load on an individual specimen
of P. margaritifera has been graphically shown in Fig.3.
It can be inferred that ΔF showed a changing trend over a
span of one year. Maximum fouling load was observed
during the month of September 2011 (27.8 ± 5.1 g)
followed by February 2012 (19.5 ± 13.5 g) and June
2012 (15.0 ± 3.6 g).
Fouling load was minimal during July 2012 (3.2
± 3.7 g) followed by November 2011 (4.6 ± 6.9 g) and
December 2011 (4.7 ± 14.1 g).
Correlation of DVM with other biometric parameters
The size-wise correlation of biometric
dimensions with the DVM (at 99.5% significance level)
has been presented in Table 1.
In the lower size group of 1-20 mm, the
maximum correlation was observed between DVM-APM
(r2 = 0.876, P > 0.05, n = 18). Correlation coefficient
values of DVM-THK (r2 = 0.673, P < 0.001, n = 18) and
DVM-HL (r2 = 0.550, P > 0.05, n = 18) were moderate to
low.
In the size group of 21-40 mm, higher degree of
correlation was observed between DVM-APM
(r2 = 0.802, P > 0.05, n = 24) and DVM-HL (r2 = 0.808,
P < 0.001, n = 24). DVM-THK (r2 = 0.673, P < 0.001,
n = 24) and DVM-TWT (r2 = 0.304, P > 0.05, n = 24)
showed moderate and poor correlation, respectively.
The value of correlation between DVM-TWT
(r2 = 0.725, P < 0.001, n = 33) was highest for the 41-60
mm size group. However, it showed moderate correlation
between DVM-APM (r2 = 0.577, P = 0.002, n = 33) and
DVM-HL (r2 = 0.523, P < 0.001, n = 33).
Maximum number of individuals collected
during the study belonged to the size group 61-80 mm.
The regression analysis of this size group showed
moderate to low correlation between DVM and all the
other parameters, with the exception of DVM-APM
(r2 = 0.721, P < 0.001, n = 52).
In the largest size group of 81-100 mm (n = 24),
all the parameters showed poor correlation with the
DVM. The regression coefficient for most of
the parameters of the above mentioned size ranges
when tested against DVM with one-way ANOVA,
showed significant value except for a few as mentioned
in Table 1.
Jha and Mohan, 2014
1267 Journal of Research in Biology (2014) 4(2): 1264-1275
Fig. 2 Average increment (±SE) in the biometric dimensions of 5 size groups
of Pinctada margaritifera.
Correlation of ΔF with biometric parameters
The regression analysis of biometric parameters
with ΔF showed poor correlation in all the size groups
except for a moderate correlation between TWT-ΔF
(r2 = 0.619, P < 0.001, n = 33) for the 41-60 mm size
group (Table 2).
DISCUSSION
Maximum value of correlation coefficient for
most of the shell dimensions was seen in small size
oysters hinting towards isometric growth of the oyster at
this stage. The site of attachment selected by settling
larval stage plays a pivotal role in the biometric growth
of these sessile organisms, as the Pediveliger larvae settle
in the crevices of rocks during the juvenile stage and it
has enough space available for growth in all the
dimensions. Optimum space availability and lesser food
requirement could be a possible reason for such type of
growth.
Harsh environmental conditions viz. atmospheric
and respiratory stress due to exposure during low tide,
limited food availability (Bartol et al., 1999), water
temperature and turbidity (Pouvreau and Prasil, 2001),
competition between foulers with oyster (Zhenxia et al.,
2007), limited space for growth (Abraham et al., 2007),
decrease in growth rate with age due to progressive
investment of body energy in reproduction rather than
shell growth (Pouvreau et al., 2000b), etc., might have
consequently resulted in the slow allometric growth rate
(Gimin et al., 2004; El-Sayed et al., 2011) and hence
poor correlation between DVM and other shell
dimensions in the higher size groups of black-lip pearl
oyster of intertidal region of South Andaman.
Shell Dimensional Relationship
The smaller oysters showed more increment in
shell dimension than in total weight. It might be due to
the fact that in the initial stages of the oyster’s
development, the body energy is mainly utilized towards
the shell growth when compared to the tissue growth or
reproductive development (Chellam, 1987; Dharmaraj
et al., 1987b; Gimin et al., 2004).
A good correlation between DVM-APM was
observed between smaller size groups, 1-20 mm
(r2 = 0.876, P > 0.05, n = 18) and 21-40 mm, (r2 = 0.802,
P > 0.05, n = 24) indicating comparable increase in the
growth rate of the two variables. Low regression value
for higher size groups could have been due to the
investment of energy for tissue development or
reproductive maturity.
The correlation values for DVM-HL in
the present study were slightly better (highest
being r2 = 0.808, P = 0.001, n = 24, 21-40 mm) than that
Jha and Mohan, 2014
Journal of Research in Biology (2014) 4(2): 1264-1275 1268
Fig. 3 Month-wise average fouling load (±SE) on Pinctada margaritifera.
Jha and Mohan, 2014
Size Group (mm) N Variables ‘a’ Value ‘b’ value r2 value P value- S/NS
1-20 18
DVM- APM 0.848 0.878 0.876* 0.370 - NS
DVM-HL 1.547 0.793 0.550 0.180 - NS
DVM-THK 2.402 0.430 0.673* < 0.001 - S
DVM-TWT 0.275 1.218 0.218 < 0.001 - S
21-40 24
DVM-APM 1.113 0.955 0.802* 0.120 - NS
DVM-HL 3.006 0.926 0.808* 0.001 - S
DVM-THK 3.113 0.402 0.673* < 0.001 - S
DVM-TWT 0.304 2.236 0.304 0.110 - NS
41-60 33
DVM-APM 1.525 0.936 0.577* 0.002 - S
DVM-HL 3.664 0.666 0.523* < 0.001 - S
DVM-THK 2.076 0.380 0.372 < 0.001 - S
DVM-TWT 0.144 3.015 0.725* < 0.001 - S
61-80 52
DVM-APM 20.16 1.182 0.721* < 0.001 - S
DVM-HL 1.911 0.554 0.378* < 0.001 - S
DVM-THK 2.158 0.355 0.343* < 0.001 - S
DVM-TWT 0.127 3.026 0.412* < 0.001 - S
81-100 24
DVM-APM 48.46 0.351 0.210 0.001 - S
DVM-HL 30.68 0.191 0.101 < 0.001 - S
DVM-THK 12.82 0.148 0.106 < 0.001 - S
DVM-TWT 1.878 1.786 0.180 < 0.001 - S
Table 1. Estimates of biometric relationship between DVM and other shell parameters in different size
groups of Pinctada margaritifera, along with the results of one-way ANOVA.
N= Number of individuals, a= Slope, b= Intercept, r2= Correlation coefficient, *Pearson’s correlation coefficient
significance level= 99.5%, P= Significance value, S= Significant, NS= Non-Significant.
1269 Journal of Research in Biology (2014) 4(2): 1264-1275
Jha and Mohan, 2014
Size Group (mm) N Variables ‘a’ Value ‘b’ value r2 value P value- S/NS
1-20 18
DVM - ΔF 0.019 2.032 0.293 <0.001- S
APM - ΔF 0.020 2.232 0.325 <0.001- S
HL - ΔF 0.029 1.592 0.292 <0.001- S
THK - ΔF 0.076 0.429 0.236 <0.001- S
TWT - ΔF 0.167 0.018 0.293 <0.001- S
21-40 24
DVM - ΔF 0.005 4.402 0.243 <0.001- S
APM - ΔF 0.030 2.938 0.142 <0.001- S
HL - ΔF 0.056 2.569 0.120 <0.001- S
THK - ΔF 0.786 2.196 0.190 <0.001- S
TWT - ΔF 0.235 0.111 0.331 <0.001- S
41-60 33
DVM - ΔF 0.012 3.649 0.300 <0.001- S
APM - ΔF 0.034 3.248 0.412 <0.001- S
HL - ΔF 0.646 1.890 0.211 <0.001- S
THK - ΔF 1.790 1.981 0.341 <0.001- S
TWT - ΔF 0.495 4.893 0.619* <0.001- S
61-80 52
DVM - ΔF 0.031 3.035 0.088 <0.001- S
APM - ΔF 0.286 2.017 0.091 <0.001- S
HL - ΔF 1.214 1.61 0.063 0.002- S
THK - ΔF 5.468 0.924 0.029 <0.001- S
TWT - ΔF 0.150 7.487 0.066 <0.001- S
81-100 24
DVM - ΔF 7.363 1.940 0.046 <0.001- S
APM - ΔF 1.717 2.450 0.057 <0.001- S
HL - ΔF 10.81 0.134 0.038 <0.001- S
THK - ΔF 1.949 1.802 0.096 <0.001- S
TWT - ΔF 0.015 11.300 0.004 <0.001- S
Table 2. Estimates of biometric relationship between ΔF and other shell parameters in different size groups
of Pinctada margaritifera, along with the results of one-way ANOVA.
N= Number of individuals, a= Slope, b= Intercept, r2= Correlation coefficient, * Pearson’s correlation coefficient
significance level= 99.5%, P= Significance value, S= Significant, NS= Non-Significant.
Journal of Research in Biology (2014) 4(2): 1264-1275 1270
obtained by Abraham et al., 2007 (highest being
r2 = 0.31, n = 22, 36-55 mm) and the value (r2 = 0.79,
n = 106, 34.0-109.5 mm) obtained by Alagarswami
(1983). The site of collection of specimen may also have
an impact on this observation because oysters in the
present study were collected exclusively from intertidal
area where they are attached to the crevices of rocks
having limited space for growth whereas in case of other
authors sub tidal and deep water specimens were also
studied.
The values obtained for coefficient of correlation
between DVM-THK in the present study was moderate
for size range 1-20 mm (r2 = 0.673, P < 0.001, n = 18)
and 21-40 mm (r2 = 0.673, P < 0.001, n = 24). But was
slightly lower (r2 = 0.372, P < 0.001, n = 33) for size
range 41-60mm) than those obtained by Abraham,
(2007) (r2 = 0.82 for size range 36-55 mm). In larger
oysters, a poor correlation existed between DVM-THK
(r2 = 0.343, P < 0.001, n = 52 and r2 = 0.106, P < 0.001,
n = 24 for 61-80 mm and 81-100 mm size group
respectively). This could be explained by the report of
Sims (1993) which stated that, in the larger oysters the
rate of increase of DVM becomes very slow and the
subsequent growth consists mainly of increase in shell
thickness with continuous secretion of nacre throughout
its life.
As the size range and total number of specimen
in biometry study by other authors (34-109.5 mm,
n = 106, Alagarswami, 1983; 40.18-132.72 mm, n = 458,
Abraham et al., 2007) were different from the present
study (7.06-99.01 mm, n = 151) the correlation value
between shell dimensions also differed and only few size
ranges could be compared.
Length –Weight Relationship
Similar to the observation of Abraham et al.,
(2007), there was an increase in the average total weight
with respect to increase in the average shell length
(Fig. 1). Hence, the low value of correlation between
these two variables in the present study suggests that the
rate of increase in the individual TWT with respect to the
increase in individual DVM is not uniform amongst the
specimen belonging to the same size class.
In the size group of 1-20 mm (r2 = 0.218,
P < 0.001, n = 18) and 21-40 mm (r2 = 0.304, P > 0.05,
n = 24) the correlation between DVM-TWT was poor
indicating gonadal development might still be in the
nascent stages accounting for slower rate of increase in
their tissue weight (Chellam, 1987). However, good and
moderate correlation was observed in the size group
41-60 mm (r2 = 0.725, P < 0.001, n = 33) and 61-80 mm
(r2 = 0.412, P < 0.001, n = 52), respectively, indicating
that the concentration of body energy was beginning to
direct more towards tissue growth rather than shell
growth which finally concluded with low correlation
values in the 81-100 mm group (r2 = 0.180, P < 0.001,
n = 24), where most of the body energy was directed
towards tissue growth indicated by a higher rate of
increase in TWT when the rate of increase of all the
other biometric parameters declined.
In the present study, the lower degree of
correlation between DVM-TWT compared to
Alagarswami (1983), Friedman and Southgate (1999)
and Pouvreau (2000) who obtained very good correlation
between these two variables (r2 = 0.96, 0.86 and 0.97
respectively) could be due to the fact that in the other
studies specimen were either cultured in farm (Friedman
and Southgate, 1999; Pouvreau, 2000a) or collected
mostly from sub tidal or deep waters (Alagarswami,
1983; Abraham et al., 2007).
In those habitats isometric growth can take place
due to less stress per unit area in terms of availability of
food and space, protection from direct sunlight and
desiccation, predators, low turbidity and continuous
oxygen supplies as opposed to the harsh intertidal
condition in this study.
Shell Dimensions and Fouling Load
Biofouling caused by the settlement of fouling
organisms on the shell surface adversely affects the
Jha and Mohan, 2014
1271 Journal of Research in Biology (2014) 4(2): 1264-1275
wellbeing of pearl oysters. It leads to retarded growth
(Southgate and Beer, 2000), deformation and
deterioration of the shell (Taylor et al., 1997b; Doroudi,
1996) and even mortality of the oyster in extreme cases
(Alagarswami and Chellam, 1976; Mohammad, 1976).
Maximum fouling load observed during the
month of September 2011 (27.8 ± 5.1 g) followed by
February 2012 (19.5 ± 13.5 g) and June 2012 (15.0 ± 3.6
g) could be attributed to the settlement of heavy foulers
(weight-wise) such as predatory mussel, tube forming
polychaetes, barnacles, sponges and ascidians found to
be dominant during these months. Such settlement may
have caused the increase in the fouling load (Dharmaraj
1987a) and in turn might have influenced the recruitment
of other foulers.
Minimal fouling load during July 2012
(3.2 ± 3.7 g), November 2011 (4.6 ± 6.9 g) and
December 2011 (4.7 ± 14.1 g) could be due to the fact
that these months are peak period of spawning of the
above foulers, no attachment of heavy foulers occurred
during this period. Similar results were reported by
Alagarswami and Chellam (1976), Dev and Muthuraman
(1987) and Velayudhan (1988) in their studies on
biofouling of Akoya pearl oyster Pinctada fucata.
Scardino et al., (2003) and Aji (2011) in their
respective studies on pearl oysters reported that the rate
of fouling is lower in the smaller oysters due to the
presence of periostracum layer (a physical defence
against fouling) which wears off with aging in larger
oysters. An increase in the shell surface area also
facilitates higher settlement of biofoulers (Mohammed,
1998).
This explains the lower values of fouling load in
size groups 1-20 mm (0.1 ± 0.1 g, n = 18) and 21-40 mm
(1.0 ± 1.0 g, n = 24). Availability of more surface area
for settlement of foulers and wearing off of the
periostracum layer could be responsible for multifold
time increment in the fouling load in the size groups
41-60 mm (7.3 ± 5.3 g, n = 33) and 61-80 mm (14.9 ±
9.9 g, n = 52) expressed in Fig. 1.
Occurrence of lesser ΔF in 81-100 mm size
group (12.8 ± 7.1 g, n = 24) as compared to its preceding
length group could be attributed to the attachment of
these specimens in area having oligotrophic waters with
less fouling activity, lesser competition for available
resources and lower risk of predators which could be the
reason for their large size in the first place.
A poor correlation in general was observed
between ΔF and other shell dimensions for all the size
groups except 41-60 mm (r2 = 0.619, P < 0.001, n = 33)
in Table 2. The variation in the growth rate of shell and
rate of fouling in different size groups could be the
reason for their poor correlation.
The Critical Size Group, 41-60 mm
Contrary to all the other size groups, 41-60 mm
size group showed the best correlation between DVM-
TWT with r2 corresponding to 0.725. However, the
correlation between other biometric dimensions was
moderate to low (Table 1). Amongst all the size classes,
ΔF showed better correlation with other shell dimensions
in this size class (Table 2). The above observations
suggest that the P. margaritifera of the intertidal regions
of Andaman, attains initial sexual maturity in this size
group with the beginning of their gonad development
and complete reproductive development takes place as
the oyster reaches 61-80 mm size group and becomes
fully mature. This justifies their increased tissue weight
and retarded growth of other shell dimensions with
respect to DVM (Fig. 2). The body energy at this stage
gets distributed more towards tissue growth than shell
growth (Bayne and Newell, 1983; Dharmaraj, 1987b).
Gervis and Sims (1992) also stated that full
maturity occurs in P. margaritifera in 2nd year at size
>70 mm. Pouvreau et al., (2000b) and Kimani and
Mavuti (2002) in their respective studies on black-lip
pearl oyster of French Polynesia and Kenya reported that
the initial sexual maturity, corresponding to the smallest
individual with mature gonads occur at the end of 1st
Jha and Mohan, 2014
Journal of Research in Biology (2014) 4(2): 1264-1275 1272
year at size <40 mm. Chellam (1987) in his study on
Indian Pinctada fucata also reported that cultured oysters
became sexually mature in 9 months (size <47 mm). This
difference in size at sexual maturity of both the species
in India is possible as P. margaritifera in comparison to
P. fucata is a larger and late maturing species (Pouvreau
et al., 2000b).
From the present study it can be concluded that,
1) Smaller oysters show isometric growth pattern but in
larger oysters, allometry is observed as the rate of
increase of biometric parameters vary with increasing
size range. 2) September, February and June months
witness settlement of heavy foulers whereas fouling load
is minimal during the month of July, November and
December, 3) Even though ΔF did not show any
significant correlation with the DVM, biofouling could
also be a possible factor responsible for restricting the
maximum size attained by these oysters or in extreme
cases even mortality of the oyster by competing for
resources required for their growth, 4) 41-60 mm size
group is a critical stage in the life cycle of these
specimen when sexual maturity initiates, 5) Harsh
intertidal environment could be responsible for
difference in growth pattern and also for confining most
of the P. margaritifera from intertidal regions of
Andaman, to the size group of 61-80 mm, 6) The
intertidal P. margaritifera which are adapted to survive
in tough environmental conditions would more easily
acclimatize to a new environment such as in the case of
suspended or raft culture, if transferred at an early stage,
they could cross the 61-80 mm size range and become
larger and thicker, a parameter favourable for pearl
production.
The present biometric study of P. margaritifera
will be helpful in 1) Understanding the correlation
existing between length and other shell dimensions of
different size groups in intertidal rocky habitat and the
factors responsible for it, 2) Observing the trend of
biofouling on various size ranges of P. margaritifera and
its effect on their biometry. 3) It shall also throw some
light on the importance of these intertidal oysters in the
pearl culture industry.
ACKNOWLEDGEMENT
The authors are thankful to the Vice Chancellor,
Pondicherry University for providing infrastructural
support for this study at the Department of Ocean Studies
and Marine Biology, Pondicherry University, Port Blair
campus. The first author is also obliged to the University
Grants Commission (UGC), New Delhi for providing
financial aid in the form of Research Fellowship in
Science for Meritorious Student (RFSMS).
REFERENCES
Abraham KJ, Libini CL, Basak R, Madhupal P,
Kripa V, Velayudhan TS, Mohamed KS and Modayil
MJ. 2007. Biometric relationships of the black-lip pearl
oyster Pinctada margaritifera (Linnaeus, 1758) from the
Andaman and Nicobar waters. Indian J Fish. 54(4):409-
415.
Aji L. 2011. An overview of the method, management,
problem and their solution in the pearl oyster (Pinctada
margaritifera) culture. J Coast Develop., 14(3):181-190.
Alagarswami K. 1991. Production of cultured pearls.
ICAR, New Delhi.15-21.
Alagarswami K. 1983. The black-lip pear oyster
resource and pearl culture potential. In: Mariculture
potential of Andaman and Nicobar Islands-An indicative
survey (K. Alagarswami, Ed.). Bulletin of Central
Marine Fisheries Research Institute, CMFRI, Cochin.
34:72-78.
Alagarswami K. 1987. Pearl culture. Bulletin of Central
Marine Fisheries Research Institute, CMFRI, Cochin.
39:136 p.
Alagarswami K and Chellam A. 1976. On fouling and
boring organisms and mortality of pearl oysters in the
farm at Veppalodai, Gulf of Mannar. Indian J Fish. 23
(1-2):10-22.
Bartol IK, Mann R and Luckenbach M. 1999. Growth
and mortality of oysters (Crassostrea virginica) on
Jha and Mohan, 2014
1273 Journal of Research in Biology (2014) 4(2): 1264-1275
constructed intertidal reefs: effects of tidal height and
substrate level. J Expt Mar Boil Ecol., 237(2):157-184.
Bayne BL and Newell RCA. 1983. Physiological
energetics of marine molluscs. In: The Mollusca,
Volume 4, Physiology, part 1 (eds: S. M. Saleuddin, Karl
Milton Wilbur), Academic Press, London. p.407-515.
Chellam A. 1987. Biology of pearl oyster. In: Pearl
culture (K. Alagarswami, Ed.). Bulletin of Central
Marine Fisheries Research Institute, CMFRI, Cochin.
39:13-20.
Dev DS and Muthuraman AI. 1987. Observation on
the biofouling in pearl oyster farm at Krusadai Island,
Gulf of Mannar. In: National seminar on shellfish
resources and farming sessions-II-IV (eds: Mahadevan S,
Narasimham KA, Satya Narayana Rao K, Ameer Hamsa
KMS and Muthiah P). Bulletin of Central Marine
Fisheries Research Institute, CMFRI, Cochin. 42(2): 306
-310.
Dharmaraj S, Chellam A and Velayudhan TS. 1987a.
Biofouling, boring and predation of pearl oyster. In:
Pearl culture (K. Alagarswami, Ed.). Bulletin of Central
Marine Fisheries Research Institute, CMFRI, Cochin, p.
39: 92-97.
Dharmaraj S, Kandasami D and Alagarswami K.
1987b. Some aspects of physiology of Indian pearl
oyster. In: Pearl culture (K. Alagarswami, Ed.). Bulletin
of Central Marine Fisheries Research Institute, CMFRI,
Cochin. 39: 21-28.
Doroudi MS. 1996. Infestation of pearl oysters by
boring and fouling organisms in the northern Persian
Gulf. Indian J. Mar. Sci., 25(2):168–169.
El-Sayed AEH, Razek FAA, Abou-Zaid MM and
Taha SM. 2011. Measures of allometric growth of black
-lip pearl oyster Pinctada margaritifera (Linnaeus, 1758)
Red Sea, Egypt. Int J Zool Res., 7(2):201-211.
Fletcher W, Friedman K, Weir V, McCrea J and
Clark R. 2006. Pearl oyster fishery. Department of
Fisheries, Western Australia.
Friedman KJ and Southgate PC. 1999. Grow-out of
black-lip pearl oysters, Pinctada margaritifera (Linnaeus
1758) on chaplets in suspended culture in Solomon
Islands. J Shellfish Res., 18:451-458.
Gervis MH and Sims NA. 1992. The biology and
culture of pearl oysters (Bivalvia: Pteriidae). Manila
(Philippines). ICLARM Stud. Rev., 21:1-49.
Gimin R, Mohan R, Thinh LV and Griffiths AD.
2004. The relationship of shell dimensions and shell
volume to live weight and soft tissue weight in the
mangrove clam, Polymesoda erosa (Solander, 1786)
from Northern Australia. NAGA, World Fish Center
Quarterly. 27(3 and 4): 32-35.
Hynd JS. 1955. A revision of Australian pearl- shells,
genus Pinctada (Lamelli-branchia). Aust J Mar
Freshwater Res., 6(1):98-138.
Kimani EN and Mavuti KM. 2002. Abundance and
population structure of the black-lip pearl oyster,
Pinctada margaritifera L. 1758 (Bivalvia: Pteriidae), in
coastal Kenya. Western Indian Ocean J Mar Sci.,
1(2):169-179.
Kripa V, Abraham KJ, Libini CL, Velayudhan TS,
Radhakrishnan P, Mohamed KS and Modayil MJ.
2008. Production of designer Mabe Pearls in the black-
lipped pearl oyster, Pinctada margaritifera, and the
winged pearl oyster, Pteria penguin, from Andaman and
Nicobar Islands, India. J World Aquacult Soc., 39(1):131
-137.
Mohamed KS, Kripa V, Velayudhan TS and
Appukuttan KK. 2006. Growth and biometric
relationships of the pearl oyster Pinctada fucata (Gould)
on transplanting from the Gulf of Mannar to the Arabian
sea. Aquaculture Research. 37(7):725-741.
Mohammad MBM. 1976. Relationship between
biofouling and growth of the pearl oyster Pinctada
fucata (Gould) in Kuwait, Arabian Gulf. Hydrobiologia.
51(2):129-138.
Mohammed SZ. 1998. On the epifouling of pearl oyster
(Pinctada radiata) in Qatari water Arabian Gulf and its
influence on the flesh growth. Egyptain J Aquat Biol and
Fish. 2(2):73-85.
Moullac GL, Tiapari J, Teissier H, Martinez E and
Cochard JC. 2012. Growth and gonad development of
the tropical black-lip pearl oyster, Pinctada
Jha and Mohan, 2014
Journal of Research in Biology (2014) 4(2): 1264-1275 1274
margaritifera (L.), in the Gambier archipelago (French
Polynesia). Aquac Internat. 20(2): 305-315.
Pit JH and Southgate PC. 2003. Fouling and predation;
how do they affect growth and survival of the black-lip
pearl oyster, Pinctada margaritifera, during nursery
culture? Aquac Internat. 11(6): 545 555.
Pouvreau S, Gangnery A, Tiapari J, Lagarde F,
Garnier M and Bodoy A. 2000b. Gametogenic cycle
and reproductive effort of the tropical black- lip pearl
oyster, Pinctada margaritifera (Bivalvia: Pteriidae),
cultivated in Takapoto atoll (French Polynesia). Aquat
Living Resour., 13(1): 37-48.
Pouvreau S and Prasil V. 2001. Growth of the black-lip
pearl oyster, Pinctada margaritifera, at nine culture sites
of French Polynesia: synthesis of several sampling
designs conducted between 1994 and 1999. Aquat Living
Resour., 14(3): 155-163.
Pouvreau S, Tiapari J, Gangnery A, Lagarde F,
Garnier M, Teissier H, Haumani G, Buestel D and
Bodoy A. 2000a. Growth of the black-lip pearl oyster,
Pinctada margaritifera, in suspended culture under
hydrobiological conditions of Takapoto lagoon (French
Polynesia). Aquaculture. 184(1-2):133-154.
Saville-Kent W. 1893. The great barrier reef of
Australia: its products and potentialities, W.H. Allen and
Co., London, p. 204-224.
Scardino A, Nys RD, Ison O, Connor WO and
Steinberg P. 2003. Microtopography and antifouling
properties of the shell surface of the bivalve molluscs
Mytilus galloprovincialis and Pinctada imbricata.
Biofouling. 19(Supplement 1): 221-230.
Sims NA. 1993. Size, age and growth of the black-lip
pearl oyster, Pinctada margaritifera (L.) (Bivalvia:
Pteriidae). J Shellfish Res., 12:223-228.
Southgate PC and Beer A. 2000. Growth of black-lip
pearl oyster (Pinctada margaritifera) juveniles using
different nursery culture techniques. Aquaculture. 187
(1-2): 97-104.
Taylor JJ, Rose RA, Southgate PC and Taylor CE.
1997. Effects of stocking density on growth and survival
of early juvenile silver-lip pearl oysters, Pinctada
maxima (Jameson), held in suspended nursery culture.
Aquaculture. 153(1-2): 41-49.
Velayudhan TS. 1988. Studies on the settlement
of barnacles at different depths in the pearl oyster farm
at Tuticorin. In: National seminar on shellfish resources
and farming sessions-II-IV (eds: Mahadevan S,
Narasimham KA, Satya Narayana Rao K, Ameer
Hamsa KMS and Muthiah P). Bulletin of Central
Marine Fisheries Research Institute, CMFRI, Cochin.
42(2): 301-305.
Zhenxia SU, Yan Y and Liangmin H. 2007. Effect of
Fouling on Feeding, Oxygen Consumption and Waste
Excretion of Pearl Oyster Pinctada martensii in Daya
Bay Cultivation. Mar Sci Bull., 9(2): 34-42.
Jha and Mohan, 2014
1275 Journal of Research in Biology (2014) 4(2): 1264-1275
Submit your articles online at www.jresearchbiology.com
Advantages
Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright
submit@jresearchbiology.com
www.jresearchbiology.com/Submit.php.
Article Citation: Jet S Mandey, Hendrawan Soetanto, Osfar Sjofjan and Bernat Tulung.
Genetics characterization, nutritional and phytochemicals potential of gedi leaves (Abelmoschus manihot (L.) Medik) growing in the North Sulawesi of Indonesia as a candidate of poultry feed. Journal of Research in Biology (2014) 4(2): 1276-1286
Jou
rn
al of R
esearch
in
Biology
Genetics characterization, nutritional and phytochemicals potential of gedi leaves
(Abelmoschus manihot (L.) Medik) growing in the North Sulawesi of Indonesia as a
candidate of poultry feed
Keywords: Abelmoschus manihot, genetic characterization, nutritional analysis, phytochemical constituents.
ABSTRACT: Gedi, local name of Abelmoschus manihot (L.) Medik was used by local people in Northern Sulawesi-Indonesia as vegetable, because of its medicinal properties. The potency of gedi leaves in broiler diet has not been reported in literatures. The objective of this research was to investigate a genetic diversity of gedi commonly consumed as a gourmet cuisine in the North Sulawesi of Indonesia, and exploring the potential of this plant as a herb plant for a candidate of poultry feedstuff. Eight morphologically different gedi leaves (GH1, GH2, GH3, GH4, GH5, GH6, GM1 and GM2) that grow in Manado area, North Sulawesi of Indonesia were collected and identified. The leaves were extracted for DNA isolation followed by PCR and DNA sequencing analysis. During DNA isolation, 3 of 6 GH (GH4, GH5, GH6) were discontinued because of difficulty in separating the mucilage properties. Following PCR analysis, GH2 and GH3 did not produce bands and consequently were excluded from further analysis. In addition to that, chemical analysis was also performed to determine the phytochemical and nutritional contents .The results indicated that all gedi leaf samples showed similarity (99%) to species member of Abelmoschus manihot, and tribe of Malvaceae. In terms of proximate analysis, gedi leaves showed high crude protein (18.76 - 24.16%) and calcium (2.92-3.70%) content. Also, showed high crude fibre (13.06-17.53%). Together with the presence of alkaloid and steroidal saponin gedi leaves may offer beneficial effects as poultry feedstuff to a special production trait such as cholesterol-less meat.
1276-1286 | JRB | 2014 | Vol 4 | No 2
This article is governed by the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.
www.jresearchbiology.com Journal of Research in Biology
An International
Scientific Research Journal
Authors:
Jet S Mandey1*,
Hendrawan Soetanto2,
Osfar Sjofjan2 and
Bernat Tulung1.
Institution:
1. Animal Husbandry
Faculty, Sam Ratulangi
University, Manado,
The North Sulawesi,
Indonesia .
2. Animal Nutrition
Department, Animal
Husbandry Faculty,
Brawijaya University,
Malang, The East Java,
Indonesia.
Corresponding author:
Jet S Mandey.
Email Id:
Web Address: http://jresearchbiology.com/
documents/RA0429.pdf.
Dates: Received: 06 Mar 2014 Accepted: 22 Mar 2014 Published: 19 May 2014
Journal of Research in Biology
An International Scientific Research Journal
Original Research
ISSN No: Print: 2231 – 6280; Online: 2231 - 6299.
INTRODUCTION
Abelmoschus manihot (L.) Medik is a native
plant which is 1.2 – 1.8 m height and is widely
distributed in the tropical regions. This plant has various
local names such as aibika. It was hypothesized that the
origin of this plant from the survey of literature the local
names of Abelmoschus manihot (L.) Medik varies and
the data available were largely derived from studies
carried out in the polynesian-pacific regions (Preston,
1998). In North Sulawesi of Indonesia this plant is called
“gedi” and its leaves provide essential ingredient for
cooking porridge as a special gourmet food among the
North Sulawesi cuisine. According to Jain and Bari
(2010), gedi leaves contain polysaccharides and protein
containing mucilage (gum) that enables the porridge to
have a special viscosity. Morphologically, gedi plants
vary in shape, color and other properties regardless of
geographical differences suggesting some genetic
variation may occur after a long period of adaptation.
Gedi plants have been reported to posses
medicinal properties that may benefit to human health.
Puel et al., (2005) reported that the female wistar rat
which feeding 15 % of gedi leaves prevent osteopenia
that was attributable to the calcium content of gedi
leaves. Other authors, Jain et al., (2009) reported that
woody stem of gedi plant contain stigmasterol and
γ-sitosterol, and also contain isoquercitrin, hyperoside,
hibifolin, quercetin and isohamnetin that have anti
consulvant and anti depressant-like activity (Guo et al.,
2011; Wang et al., 1981; Wang et al., 2004). Gedi leaves
have active pharmacological properties against analgesic
effect (Jain et al., 2011). Sarwar et al., (2011) stated that
Abelmoschus manihot has a profound anti-inflammatory
and anti-diabetic effect. From these reports it can be
concluded that gedi plants posses herbal medicine
properties that can be used to manipulate the human and
animal health. In spite of its phytopharmaceutical
benefits there is paucity in information dealing with
genetic diversity of gedi plant in Indonesia. Most
information of Abelmoschus manihot derived from the
studies carried out in the polynesian pacific regions
(Preston, 1998).
Gedi as a culinary herb and medicinal herb may
have beneficial effects in animals. The phytochemical
and nutritional compounds of leaf material may affect to
poultry health and productivity. Cross et al., (2007)
reported that culinary herbs in diets affect chick
performance, gut health and endogenous secretions.
Al-Sultan and Gameel (2004) suggests that feeding
Curcuma longa (turmeric) to chicken through diet can
induce hepatic changes and that these changes are not
dose or time dependent. Windisch et al., (2008) cited
several research, i.e. that phytogenic product also
reduced activities of intestinal and fecal urease enzyme
in broilers.
Ashayerizadeh et al., (2009) reported that garlic
powder and turmeric powder in diet significantly reduced
abdominal fat percent, LDL and VLDL concentration in
serum of broiler. Moreover, Yang et al., (2003) reported
that green tea by product affect the reduction of body
weight gain and meat cholesterol in broilers. Khatun
et al., (2010) observed using in vitro model that viscous
water-soluble portion of the fruit of Abelmoschus
esculentus (L.) Moench has significant capacity to
reduce the glucose diffusion form the dietary fiber-
glucose systems.
The study was undertaken to investigate the
compositional characterization of gedi. The samples
were an alysed for the molecular characterization and
identification, the proximate composition of the leaf part,
energy content and the phytochemical composition, in
order to get some useful information to be used in the
preparation of poultry feed. Because there are no major
reports in the literature, this would be an information for
the detailed utilization of gedi to poultry feed.
Mandey et al., 2014
1277 Journal of Research in Biology (2014) 4(2): 1276-1286
MATERIAL AND METHODS
Plant Identification
Eight accessions of gedi (Abelmoschus manihot)
collected from Manado, the North Sulawesi, Indonesia
were used for this study. Herbarium specimens were
identified for plant species at the Research Center for
Biology, Indonesian Institute of Sciences, Bogor,
Indonesia.
DNA extraction, quantification, and sequencing
DNA was extracted from 80-100 mg of fresh leaf
tissue from each of the 5 randomly selected samples
using a protocol of AxyPrep Multisource Genomic DNA
M i n i p r e p K i t ( A x y g e n B i o s c i e n c e s ,
www.axygenbio.com). Three samples were scored as
missing because of unable to isolate the mucilage. The
final DNA supernatant were diluted for DNA
quantifications with PCR technique. PCR analysis were
performed using a Thermocycler machine, and in 50 µl
reaction mixture containing 2 µl template of DNA, 2 x
master Mix Vivantis 25 µl (Vi Buffer A 1 x; Taq
Polimerase 1,25 unit), Primer F1 (10 pmol/µl) 1 µl (0,2
mM), Primer R1318 (10 pmol/µl) 1 µl (0,2 mM), MgCl2
(50 mM) 1,5 µl (3 mM dNTPs 0,4 mM), H2O 20,5 µl,
sample 1 µl.Initial trial was run on 5 samples and Taq
quantity was Taq Polimerase 1,25 unit. Two primers
were initially screened for amplification in PCR, they are
Primer ndhF-F1 with product description 5’-GAA-TAT-
GCA-TGG-ATC-ATA-CC-3’ (length 20) dan primer
ndhF-R1318 with product description 5’-CGA-AAC-
ATA-TAA-AAT-GCR-GTT-AAT-CC-3’ (length 26).
PCR conditions were pre-hot 94°C (5 minutes),
denaturation 94°C (45 seconds), annealing 54°C (45
seconds), primerization 72°C (1 minute 30 seconds) in
35 cycles and hold at 72°C (5 minutes). All PCR
products were separated by electrophoresis in 1%
agarose gel in 1 x TBE ran for 2 hours followed by
ethidium bromide staining (5 µg ethidium bromide/ml).
The gel was then stained and rinsed in water for about 10
minutes, and after that visualized under UV-light in trans
-illuminator.
All PCR products were sequenced. Sequence
data were identified at First Base Laboratories Sdn, Bhd
(1st base), Taman Serdang Perdana, Selangor, Malaysia.
Sequences were aligned using BLAST programme, and
the building of a phylogenetic tree was established by
Bioedit 7.19 and Mega 5 programme (http://
megasoftware.net).
Phytochemical Screening
Chemical tests were carried out to evaluate the
presence of the phytochemicals such as alkaloids,
Journal of Research in Biology (2014) 4(2): 1276-1286 1278
Mandey et al., 2014
No Place of Collection Species Tribe
1 (1) (GH4) Abelmoschus manihot (L.) Medik Malvaceae
2 (2) (GH5) Abelmoschus manihot (L.) Medik Malvaceae
3 (3) (GH2) Abelmoschus manihot (L.) Medik Malvaceae
4 (4) (GM2) Abelmoschus manihot (L.) Medik Malvaceae
5 (6) (GH3) Abelmoschus manihot (L.) Medik Malvaceae
6 (8) (GM1) Abelmoschus manihot (L.) Medik Malvaceae
7 (9) (GH1) Abelmoschus manihot (L.) Medik Malvaceae
8 (11) (GH6) Abelmoschus manihot (L.) Medik Malvaceae
Table 1: Identification/Determination of Gedi Leaves from Manado, North Sulawesi
Notes: GH = green leaf; GM = reddish green leaf; GH1= Bumi Nyiur; GH2 = Wanea; GH3 = Bumi
Beringin; GH4 = Teling; GH5 = Bahu; GH6 = Kleak; GM1 = Tingkulu; GM2 = Wanea.
flavonoids, saponins, tannins, triterpenoids/steroids, and
hydroquinone in five selected samples; using standard
procedures described by Harborne (1987), and one of the
five samples was performed for total flavonoid analysis.
Test for alkaloids
One gram of sample was homogenized, added
with chloroform and then with 3 ml of ammonia.
Chloroform fraction was separated and acidified using
H2SO4 2M for two minutes. The filtrate was separated
and added with few drops of Mayer, Wagner, and
Dragendorff’s reagent. The sample was contained
alkaloid if produced white sediment using Mayer
reagent, orange sediment using Dragendorff reagent, and
brown sediment using Wagner reagent.
Test for phenolic
Approximately 5 g powder was shaken and then
heated to boil and filtered. For testing the presence of
flavonoids, filtrate was added with Mg powder,
HCl:EtOH (1:1) and amyl alcohol. A yellow solution that
turned colorless within few minutes indicated the
presence flavonoids. For the evaluation of saponins,
filtrate was shaken with distilled water. The presence of
saponins was indicated by the appearance of bubbles. For
the evaluation of tannins availability, filtrate was added
with three drops of FeCl3 10%. The dark green solution
indicated the presence of tannins.
Test for steroids/triterpenoids
Four grams of sample were added with 2 ml hot
ethanol. Filtered and heated, and homogenized with 1 ml
Mandey et al., 2014
1279 Journal of Research in Biology (2014) 4(2): 1276-1286
Nutrients
Types of Gedi
GH1 GH2 GH3 GM1 GM2
Dry Matter (%) 81.72 87.33 87.14 86.70 84.76
Ash (%) 11.78 13.22 11.45 12.29 14.27
Crude Protein (%) 20.18 18.76 19.89 22.62 24.16
Crude Fiber (%) 17.53 14.37 15.68 14.37 13.06
Crude Fat (%) 1.06 3.80 2.96 1.63 4.51
N-free extract (%) 31.17 37.18 37.16 35.79 28.76
Ca (%) 3.29 3.70 2.92 3.33 3.36
P (%) 0.39 0.50 0.55 0.48 0.85
GE (Kkal/kg) 3419 3859 3850 3654 3699
Component of Fiber (%):
NDF 20.78 21.72 25.02 34.09 23.51
ADF 18.44 19.11 16.23 20.10 17.30
Hemicellulose 2.34 2.61 8.79 13.99 6.21
Cellulose 11.39 15.25 11.02 5.50 10.62
Lignin 5.88 3.02 4.54 13.17 6.50
Silica 1.15 0.84 0.66 1.18 0.16
Table 2: Nutrients composition and energy values of gedi leaf (dry weight basis)
Notes: GH = green leaf; GM = reddish green leaf
Mandey et al., 2014
Journal of Research in Biology (2014) 4(2): 1276-1286 1280
Figure 1: Eight accessions of gedi leaf collected from Manado, North Sulawesi. GH1= Bumi Nyiur area, GH2 =
Wanea area, GH3 = Bumi Beringin area, GH4 = Teling area, GH5 = Bahu area, GH6 = Kleak area, GM1 = Ting-
kulu area, GM2 = Wanea area
GM1
GH4 GH3
GH2 GH1
GH6
GM2
GH5
diethyl ether. It is added with one drop of H2SO4 and one
drop of CH3COOH anhydrate. The presence of steroids
was indicated by the alteration of violet to blue or green
color. The formation of reddish violet color to the
interface was formed that indicating positive sign for
triterpenoids.
Test for hydroquinons
One gram sample was boiled with methanol for
few minutes. The filtrate was allowed to cool and then
added with 3 drops of NaOH 10%. The appearance of
red color indicated the presence of hydroquinone.
Nutritional Analysis
The proximate analysis were carried out in
duplicates and the results obtained were the average
values. The proximate analysis (protein, crude fiber,
crude fat, carbohydrate and ash) of five types of gedi leaf
were determined by using the Association of Official of
Analytical Chemists (AOAC) methods (1980). Nutrient
contents were valued in percentage. The energy value
was determined by bomb calorie meter.
RESULTS AND DISCUSSION
Plant Identification
Two typical colors of gedi leaves (green and
reddish green leaves) growing at eight locations in
Manado area were presented in Figure 1. All leaves of
this plant do not have the same size or even appearance.
They vary in size, color, and even shape. The results of
plant identification of eight accessions of gedi leaf were
summarized in Table 1. Those have been recognized that
all of eight accessions of gedi leaf in this research were
species of Abelmoschus manihot (L.) Medik, tribe
Malvaceae. Breen (2012) reported that leaves are often
the basis for identifying plants since they are so easily
observed.
The boundaries of the eight accessions of gedi
from the different locations of Manado area were based
on morphological features of the species. The
phylogenetic hypotheses were tested using chloroplast
DNA sequence of ndhF. Total genomic DNA were
extracted from eight accessions of fresh leaf material,
and the ndhF gene was amplified in PCR using primer.
In this research, DNA fragments of the expected
size were amplified from five samples to obtain the
isolation product of electrophoresis, as shown
at Figure 2. Based on DNA fragments, according to their
molecular weights those products indicated that there
were no different chloroplast type of gedi leaf color
characteristics between green leaf (GH) and reddish
green leaf (GM) with bands of 1.3 kb (Figure 2).
Moreover, profile (external shape) of gedi leaf from the
two color types were analysed as shown in Figure 2. Two
samples of reddish green leaf (GM) and one sample of
green leaf (GH) were used in the analysis of gedi leaf
profile (Figure 3).
Mandey et al., 2014
1281 Journal of Research in Biology (2014) 4(2): 1276-1286
Figure 2: Electrophoresis of 5 samples of gedi
leaf isolation product
Figure 3: PCR amplification and electrophoresis product
for profiles of gedi leaf obtained from 3 samples
Mandey et al., 2014
Journal of Research in Biology (2014) 4(2): 1276-1286 1282
Query 29 CTACTTTTTCCGACGGCAACAAAAAATCTTCGTCGTAGGTGGGCTTTTCCCAATATTTTA 88
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1 CTACTTTTTCCGACGGCAACAAAAAATCTTCGTCGTAGGTGGGCTTTTCCCAATATTTTA 60
Query 89 TTGTTAAGTATAGTTATGATTTTTTCGGTCGATCTGTCTATTCAACAAATAAATGGAAGT 148
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 61 TTGTTAAGTATAGNTATGATTTTTTCGGTCGATCTGTCTATTCAACAAATAAATGGAAGT 120
Query 149 TCTATCTATCAATATGTATGGTCTTGGACCATCAATAATGATTTTTCTTTCGAGTTTGGC 208
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct 121 TCTATCTATCAATATGTATGGTCTTGGACCATCAATAATGATTTTTCTTTCGAGNTTGGC 180
Query 209 TACTTTATTGATTCACTTACCTCTATTATGTCAATATTAATCACTACTGTTGGAATTTTT 268
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||
Sbjct 181 TACTTTATTGATTCACTTACCTCTATTATGNCAATATTAATCACTACTGTTGGAATTTTT 240
Query 269 GTTCTTATTTATAGTGACAATTATATGTCTCATGATCAAGGCTATTTGAGATTTTTTGCT 328
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 241 GTTCTTATTTATAGTGACAATTATATGTCTCATGATCAAGGCTATTTGAGATTTTTTGCT 300
Query 329 TATATGAGTTTGTTCAATACTTCAATGTTGGGATTAGTTACTAGTTCGAATTTGATACAA 388
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 301 TATATGAGTTTGTTCAATACTTCAATGTTGGGATTAGTTACTAGTTCGAATTTGATACAA 360
Query 389 ATTTATATTTTTTGGGAATTAGTTGGAATGTGTTCTTATCTATTAATAGGGTTTTGGTTC 448
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 361 ATTTATATTTTTTGGGAATTAGTTGGAATGTGTTCTTATCTATTAATAGGGTTTTGGTTC 420
Query 449 ACACGACCCGCTGCGGCAAACGCTTGTCAAAAAGCGTTTGTAACTAATCGGATAGGCGAT 508
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 421 ACACGACCCGCTGCGGCAAACGCTTGTCAAAAAGCGTTTGTAACTAATCGGATAGGCGAT 480
Query 509 TTTGGTTTATTATTAGGAATTTTAGGTTTTTATTGGATAACGGGAAGTTTCGAATTTCAA 568
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 481 TTTGGTTTATTATTAGGAATTTTAGGTTTTTATTGGATAACGGGAAGTTTCGAATTTCAA 540
Query 569 GATTTGTTCGAAATATTTAATAACTTGATTTATAATAATGAGGTTCATTTTTTATTTGTT 628
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 541 GATTTGTTCGAAATATTTAATAACTTGATTTATAATAATGAGGTTCATTTTTTATTTGTT 600
Query 629 ACTTTATGTGCCTCTTTATTATTTGCCGGCGCCGTTGCTAAATCTGCGCAATTTCCTCTT 688
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 601 ACTTTATGTGCCTCTTTATTATTTGCCGGCGCCGTTGCTAAATCTGCGCAATTTCCTCTT 660
Query 689 CATGTATGGTTACCTGATGCCATGGAGGGGCCTACTCCTATTTCGGCTCTTATACATGCT 748
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 661 CATGTATGGTTACCTGATGCCATGGAGGGGCCTACTCCTATTTCGGCTCTTATACATGCT 720
Query 749 GCCACTATGGTAGCAGCGGGAATTTTTCTTGTAGCCCGCCTTCTTCCTCTTTTCATAGTT 808
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
> gb|AF384639.1| Abelmoschus manihot NADH dehydrogenase component NdhF (ndhF)gene, partial cds;
chloroplast gene for chloroplast product
Length=1257
Score = 2242 bits (1214), Expect = 0.0
Identities = 1223/1229 (99%), Gaps = 2/1229 (0%)
Strand=Plus/Plus
Based on DNA bands, the gedi leaf color type of
GH and GM had the same positions of bands of 1.3 bp
indicating the similar profiles. By sequencing the PCR
product, additional useful taxonomic and genome
information were successfully obtained from three
samples. The ndhF data sets have aligned lengths
of 1257 bases, and the sequence data were shown in
Figure 4.
Comparisons were done with a few selected
DNA sequences, using closest relationship in a BLAST
search. Analysis showed that this sequence was very
similar to Abelmoschus manihot (L.) Medik (99%), as
shown in Figure 4. The phylogenetic analysis was done
based on ndhF sequences from each of the available
three sample accessions of gedi (Figure 5). The three
samples were clearly obtained asa member of the species
Abelmoschus manihot (L.) Medik, tribe Malvaceae, and
the sample GH1 was 96% similar to Abelmoschus
manihot.(L.) Medik.
Nutritional Analysis
The proximate concentration of five samples of
gedi were expressed on dry basis listed in Table 2. The
proximate analysis showed that the gedi leaves contained
ash (11.45-14.27%), crude protein (18.76-24.16%), crude
fibre (13.06-17.53%), crude fat (1.06-4.51), N-free
extract (28.76-37.18%) and gross energy (3419-3859
Kkal/kg), and minerals were calcium (2.92-3.70%) and
phosphorous (0.39-0.85%). In terms of proximate
analysis, gedi leaves showed high crude protein (18.76 -
24.16 %) and calcium (2.92-3.70%) content. Also, it
showed high crude fiber (13.06-17.53%). In addition, the
component of fiber were NDF (20.78-34.09), ADF
Mandey et al., 2014
1283 Journal of Research in Biology (2014) 4(2): 1276-1286
Sbjct 721 GCCACTATGGTAGCAGCGGGAATTTTTCTTGTAGCCCGCCTTCTTCCTCTTTTCATAGTT 780
Query 809 ATACCTTACATAATGAATCTAATATCTTTGATAGGTATAATAACGGTATTATTAGGGGCT 868
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 781 ATACCTTACATAATGAATCTAATATCTTTGATAGGTATAATAACGGTATTATTAGGGGCT 840
Query 869 ACTTTAGCTCTTGCTCAAAAAGATATTAAGAGGGGGTTAGCCTATTCTACAATGTCCCAA 928
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 841 ACTTTAGCTCTTGCTCAAAAAGATATTAAGAGGGGGTTAGCCTATTCTACAATGTCCCAA 900
Query 929 CTGGGTTATATGATGTTAGCTTTAGGTATGGGGTCTTATCGAACCGCTTTATTTCATTTG 988
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 901 CTGGGTTATATGATGTTAGCTTTAGGTATGGGGTCTTATCGAACCGCTTTATTTCATTTG 960
Query 989 ATTACTCATGCTTATTCGAAAGCATTGTTGTTTTTAGGATCCGGATCAATTATTCATTCC 1048
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 961 ATTACTCATGCTTATTCGAAAGCATTGTTGTTTTTAGGATCCGGATCAATTATTCATTCC 1020
Query 1049 ATGGAAGCTGTTGTTGGGTATTCCCCAGAGAAAAGCCAGAATATGGTTTTGATGGGCGGT 1108
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1021 ATGGAAGCTGTTGTTGGGTATTCCCCAGAGAAAAGCCAGAATATGGTTTTGATGGGCGGT 1080
Query 1109 TTAAGAAAGCATGCACCTATTACACAAATTGCTTTTTTAATAGGTACGCTTTCTCTTTGT 1168
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct 1081 TTAAGAAAGCATGCACCTATTACACAAATTGCTTTTTTAATAGGTACGCTTTCTCTTTGT 1140
Query 1169 GGTATTCCACCCCTTGCTTGTTTTTGGTCCAAAGATGAAATTCTTAGTGACAGTTGGCTG 1228
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
Sbjct 1141 GGTATTCCACCCCTTGCTTGTTTTTGGTCCAAAGATGAAATTCTTAGTGACAGNTGGCTG 1200
Query 1229 TATTCACCGATTT--GCAATAATAGCTTG 1255
||||||||||||| ||||||||||||||
Sbjct 1201 TATTCACCGATTTTTGCAATAATAGCTTG 1229
Figure 4: DNA Sequence Alignment with BLAST Method
(16.23-20.10%), hemicellulose (2.34-13.99%), cellulose
(5.50-15.25%), lignin (3.02-13.17%), and silica (0.16-
1.18%). Prasad, et al., (2010) reported that the
biological effects of estimated proximate components
(moisture, protein, fiber, fat, ash, and energy) in living
system strongly depend on their concentration.
Therefore, it should be carefully controlled when herbs
are used as food component. Energy and nutrient values
of herb plant samples are mainly used to translate herb
samples intakes as intakes of food components.The result
of this study indicated that Abelmoschus manihot (L.)
Medik from The North Sulawesi might be the best
alternative source of nutrient. High protein and fiber
obtained in this study confirms that Abelmoschus
manihot can be used as good alternative source of protein
and crude fiber.
These results recommended high rank for the
leaves of Abelmoschus manihot as the best in terms of
essential nutrients composition if compared with those of
other edible leaves in the literature.
The results of phytochemical screening of five
types of gedi leaf were summarized in Table 3. Result
depicted that all samples had rich steroid but had no
tannin. Four samples contained saponin and flavonoid,
while three samples contained alkaloid. The result of this
study indicated that Abelmoschus manihot (L.) Medik
from Manado is a good alternative source of
phychemical steroid, flavonoid and saponin.
The phytochemical steroid was detected in all
types of gedi leaf, and this phytochemical was found in
maximum content. Alkaloids were detected with Wagner
reagent only in green leaves GH1, GH2, and GH3.
Flavonoids were found at the adequate amount in green
leaf GH1 and GH2 while flavonoids in reddish green leaf
were at the minimum amount. Quantification of total
phenolic content from sample GH1 showed its phenolic
content as 0.48% (w/w). The results suggested that all
samples of gedi had the potential in steroid, flavonoid
and saponin, and free of anti nutritional tannin.
Flavonoids had been reported in rat brain, and might
represent the potential bioactive component of
A. manihot and contributed to its anticonsulvant and anti
depressant-like activity in vivo (Guo et al., 2011). Jain
et al., (2011) reported that the phytochemical analysis
Mandey et al., 2014
Journal of Research in Biology (2014) 4(2): 1276-1286 1284
Phytochemicals
Qualitative Quantitative (%)
(w/w) (n=3) Green Reddish
green
GH1 GH2 GH3 GM1 GM2 GH1
Alkaloid
Wagner + + + - -
Meyer + - + - -
Dragendorf - + - - ++
Hidroquinon - - - - -
Tannin - - - - -
Flavonoid ++ ++ - + + 0.48
Saponin + ++ + - +
Steroid +++ +++ +++ +++ +++
Triterpenoid - - - - -
Table 3: Phytochemical screening of gedi leaf
Notes: - = nothing; + = weak positive; ++ = positive; +++ = strong positive
showed the presence of steroids, triterpenoids and
flavonoids in petroleum ether and methanol extract,
respectively which possesses analgesic, antioxidant and
anti-inflammatory activity. Saponins that were steroid or
triterpenoid glycosides are important in animal nutrition.
Some saponins increase the permeability of intestinal
mucosal cells in vitro, inhibit active mucosal transport
and facilitate uptake of substances that are normally not
absorbed (Francis et al., 2002).
CONCLUSION
The characterization, nutritional analysis and
phytochemical analysis of Abelmoschus manihot leaf by
genetical and chemical analysis recommended the
potential value of these feedstuff to those populations
who rely upon them as poultry feed or supplements to
poultry diet. The next step is to assess the bioavailability
of the essential nutrients and phytochemicals in these
plants. Further study have to focus on the digestibility of
protein, fibre, and lipid, and phytochemicals.
REFERENCES
Association of Official of Analytical Chemist
(AOAC). 1980. Official methods of analysis of the
Association of Official Analytical Chemists. 13th Ed.
Washington DC., USA.
Al-Sultan SI and Gameel AA. 2004. Histopathological
changes in the livers of broiler chicken supplemented
with Turmeric (Curcuma longa).Intern. J. of Poult. Sci.,
3(5):333-336.
Ashayerizadeh O, Dastar B, Shams Shargh M,
Rahmatnejad E and Ashayerizadeh A. 2009. Influence
of prebiotic and two herbal additives on interior organs
and hematological indices of broilers. J. of Animal and
Veterinary Advances. 8(9):1851-1855.
Breen P. 2012. Plant Identification: Examining Leaves.
Oregon Sta te Universi ty Department of
Horticulture.http://oregonstate.edu/dept/Idplants/PlantID
-leaves.htm.
Cross DE, McDevitt RM, Hillman K and Acamovic T.
2007. The effect of herbs and their associated essential
oils on performance, dietary digestibility and gut
microflora in chickens from 7 to 28 days of age. British
P o u l t . S c i . , 4 8 ( 4 ) : 4 9 6 - 5 0 6 . U R L : h t t p : / /
mc.manuscriptcentral.co./cbps.
Francis G, Kerem Z, Makkar HPS, Becker K. 2002.
The biological action of saponins in animal systems: a
review. British J. of Nutrition. 88(6):587-605. DOI:
10.1079/BJN2002725.
Guo J, Xue C, Duan Jin-ao, Qian D, Tang Y and
You Y. 2011. Anticonvulsant, antidepressant-like
activity of Abelmoschus manihot ethanol extract and its
potential active components in vivo. Phytomedicine:
Intern. J. of Phytotherapy & Phytopharmacology.
18(14):1250-1254.DOI: 10.1016/ j. phymed.
2011.06.012.
Mandey et al., 2014
Figure 5: The phylogenetic tree of gedi leaves based
on ndhF-gen with Kimura-2 model parameter. Data
on the branch are bootstrap maximum likelihood
values
1285 Journal of Research in Biology (2014) 4(2): 1276-1286
Harborne JB. 1987. Metode Fitokimia, Penuntun Cara
Modern Menganalisis Tumbuhan.Translater:
Padmawinata K dan I. Sudiro I. Institut Teknologi
Bandung, Bandung.
Jain PS, Bari SB and Surana SJ. 2009. Isolation of
stigmasterol and ý-sitosterol from petroleum ether
extract of woody stem of Abelmoschus manihot.Asian J.
of Biological Sci. 2(4):112-117, from http://
w w w . s c i a l e r t . n e t / q d i r e c t . p h p ? /
doi=ajbs.2009.112.117&linkid=pdf.
Jain PS and Bari SB. 2010. Anti-inflammatory activity
of Abelmoschus manihot extracts. Intern. J.
ofPharmacology. 6 (4):505-509. http://www.scialert.net/
qdirect.php?.doi=ijp. 2010.505.509&linkid=pdf.
Jain PS, Todarwal AA.Bari SB, Sanjay JS. 2011..
Analgesic activity of Abelmoschus manihot extracts.
Intern. J. of Pharmacology. 7(6):716-720.http://
w w w . s c i a l e r t . n e t / f u l l t e x t / ?
doi=ijp.2011.716.720&org=11.
Khatun MH, Rahman MA, Biswas M, Ul Islam MA.
2010. In vitro study of the effects of viscous soluble
dietary fibers of Abelmoschus esculentus L in lowering
intestinal glucose absorption. Bangladesh Pharmaceutical
J., 13(2):35-40.
Prasad K, Janve B, Sharma RK, Prasad KK. 2010.
Compositional characterization of traditional medicinal
plants: Chemo-metric approach. Archives of Applied
Sci. Research. 2(5):1-10.
Preston SR. 1998. Aibika/Bele. Abelmoschus manihot
(L.) Medik. International Plant Genetic Resources
Institute. Rome, Italy.97 pages.
Puel C, Mathey J, Kati-Coulibaly S, Davicco MJ,
Lebecque P, Chanteranne B, Horcajada MN,
Coxam V. 2005. Preventive effect of Abelmoschus
manihot (L.) Medik. on bone loss in the ovariectomised
rats. J. Ethnobotanical. 99(1):55-60.
Sarwar M, Attitallia IH, Abdollahi M. 2011. A review
on the recent advances in pharmacological studies on
medicinal plants; animal studies are done but clinical
studies needs completing. Asian J. of Animal and
Veterinary Advances. 6(8):867-883.
Wang XR, Wang ZQ, Li Y. 1981. Studies on the
chemical constituents of Abelmoschus manihot L. Medic.
Acta Bot. Sin., 23(3):222-227.
Wang XR, Zhou ZH, Du AQ, Huang ZM. 2004.
Studies on the flavonol constituents of
Abelmoschusmanihot L. Medic. Chin. J. Nat. Med.,
2(2):91-93.
Windisch W, Schedle K, Plitzner C, Kroismayr A.
2008. Use of phytogenic products as feed additives for
swine and poultry. J. of Animal Sci.86(14Suppl.):E140-
E148 .ht tp : / / www.jo urna lofanima lsc ience .org/
content/86/14Suppl/E140.
Yang CJ, Yang IY, Oh DH, Bae IH, Cho SG, Kong
IG, Uuganbayar D , Nou IS, Choi KS. 2003. Effect of
green tea by-product on performance and body
composition in broiler chicks. Asian-Australian J. of
Anim. Sci., 16(6):867-872. From http://www.ajas.info/
Editor/manuscript/upload/16_128.pdf.
Mandey et al., 2014
Journal of Research in Biology (2014) 4(2): 1276-1286 1286
Submit your articles online at www.jresearchbiology.com
Advantages
Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright
submit@jresearchbiology.com
www.jresearchbiology.com/Submit.php.
Article Citation: Ekokotu Paterson Adogbaji and Nwachi Oster Francis. The growth performance of Clarias gariepinus fries raised in varying coloured receptacles. Journal of Research in Biology (2014) 4(2): 1287-1292 Jou
rn
al of R
esearch
in
Biology
The growth performance of Clarias gariepinus fries raised in varying
coloured receptacles.
Keywords: Receptacle, growth coloured, cultured, vessel and Clarias gariepinus.
ABSTRACT: This study was conducted to access the effect of various background colors of cultured vessel on growth performance and response in the production of Clarias gariepinus fry. A total of two female (800 g) and one male (1 kg) of test fish was used. During the eight weeks of the experimental period, the C. gariepinus fry were reared in three tanks in duplicates with different background colors (green, blue and white). Body weight and total length of C. gariepinus were recorded for the eight weeks and mean variance of the collected data were analyzed for significant difference. Mean weight and Mean length values were separated using Duncan multiple range test (DMRTS). Background color did not significantly affect the growth performance of C. gariepinus fry. The length and weight of the sample were measured weekly. Data collected were used to determine the specific growth rate. at week one green tank was 0.19 g with a length of 1.02 cm with a survival rate, mean weight and length of 86%, 0.56 g and 4.26 cm, blue tank was 0.14 g with a length of 1.02 cm with a survival rate, mean weight and length of 84%, 0.64 g and 4.38 cm and white tank 0.16 g with a length of 1.02 with a survival rate, mean weight and length of 82%, 0.53 g and 3.38 cm and general hatchability rate 82% respectively. At the final week (8) of the experiment blue tank had the highest weight and length 0.78 g and 5.9 cm respectively while green tank has 0.74 g and 5.2 cm, white tank has the least 0.69 g and 4.4 cm at a significant difference of 0.05.
1287-1292 | JRB | 2014 | Vol 4 | No 2
This article is governed by the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.
www.jresearchbiology.com Journal of Research in Biology
An International
Scientific Research Journal
Authors:
Ekokotu Paterson1
Adogbaji and Nwachi
Oster Francis2.
Institution:
Department of Fisheries,
Delta State University,
Asaba Campus, Nigeria.
Corresponding author:
Nwachi Oster Francis.
Email Id:
fish2rod@yahoo.com
Web Address: http://jresearchbiology.com/
documents/RA0392.pdf.
Dates: Received: 29 Nov 2013 Accepted: 17 Dec 2013 Published: 20 May 2014
Journal of Research in Biology
An International Scientific Research Journal
Original Research
ISSN No: Print: 2231 – 6280; Online: 2231 - 6299
INTRODUCTION
Fresh water fishes have the ability to vary their
growth rate in the present of changing environmental
conditions (Dahle et al., 2000). This suggests that
characteristics pattern of growth exist whose analysis
may provide a better understanding of their adaptation to
the environment. An analysis of this kind must be
accompanied by an appreciation of the fact that growth
pattern may change throughout the life history of the fish
Light acting through photoperiodicity is becoming
accepted as playing a major role in influencing the
timing of seasonal reproductive activating, feeding body
coloration, survival and specific growth rate rather than
other factors such as temperature, pH etc. The African
catfish, Clarias gariepinus is one of the most important
species of the family Clariidae which is commonly
farmed in Nigeria. Clarias gariepinus is a native of
tropical and sub-tropical waters outside its natural range
(Hecht and Appelbaum, 1988). Clarias gariepinus is a
well sort fish for the people of tropical and subtropical
region it has the ability to live and thrive in fresh water
lakes and tropical swamp, it has the ability to take in air
from the atmosphere with a remarkable ability to resist
endemic disease prevailing in the region, its ability to
reproduce in confine water with the aid of insemination
increases the ease in which the fingerlings can be made
available (Van de Nieuwegiessen et al., 2009). Catfishes
also have the unique characteristics of consuming both
plant and animal matter. They can feed on insects
plankton and even snail found in the water, they can also
cannibalize on smaller fishes depending on its ability
hence is known to feed on any available palatable feed.
The reproductive activity of Clarias gariepinus
in its natural environment increases during the period of
heavy rains in West Africa (June and July) again in
October and November produces deeper and more turbid
water which has the effect of reducing illumination
breeding activity. Also due to flooding of the lowland
coastal areas, the fish spread into waters with dense
vegetation which again diminishes light intensity.
Lam and Soh (1995) carried out experiment on
the effect of photoperiod on gonadal maturation in the
rabbit fish Siganus canaliculates and discovered that a
long photoperiod of 18 hours light alternation with
6 hours darkness (18L, 6D), retarded gonadal
development in contrast with the normal photoperiod of
12 hours light and 12 hours darkness (12L, 12D). Thus a
long photoperiod may be used to delay the breeding
season of this fish. Histophysiological studies linking
external factor with gonadal development have been
reported by Hyder (1990) that light intensity are
probably the primary cause of the great intensity of
reproductive activity. According to Lofts (1970) light
can affect the reproductive organs of fishes in terms of
ability to reproduce and the size of the organ it can
course degeneration of the organ on continuous exposure
of gonads. The main purpose of every culturist is to
produce fingerlings that would attract farmers;
experience has shown that farmers sometimes based the
choice of fish seed to be purchased on the colour of the
seed which is mainly influenced by the colour of the
receptacle used in raising the fish. This work is aimed at
examining the effect of different type of colour on the
fries cum fingerlings of Clarias gariepinus.
MATERIAL AND METHODS
This research work was conducted at the wet
laboratory of the Teaching and Research farm of Delta
State University Abraka Asaba campus, between the
months of October and January, 2013. Data was
collected for a period of eight weeks.
Spawning of fish
Spawning refers to the natural procedure the
fishes go through in order to give birth to their fry. The
broodstock used for the spawning was procured from a
well-established farm. After the procurement, the
broodstock was disinfected using saline solution (30 g of
Nacl per 10 liters of water). The sexes were kept
Ekokotu and Nwachi, 2014
1288 Journal of Research in Biology (2014) 4(2): 1287-1292
separately to avoid indiscriminate spawning, and were
allowed to acclimatize for 24 hours
Broodstock Selection
The male broodstock selected weigh 1.5-2 kg at
the age of 13-15 months, the reproductive organ of the
male extend to the anterior papilla and the fish shows
element of aggressiveness. The female fish selected
weigh 2-2.5 kg at the age of 13-15 months of age, the
female fish has swollen soft stomach, reddish to pinkish
reproductive organ with the ability to release egg on
slight touch.
Administration of Hormone
Reproductive hormone (ovaprim) was injected
intramuscularly above the lateral line just below the
dorsal fin at the rate of 0.5 ml to 1 kg of body weight of
test fish. All the broodstock were returned to solitary
confinement for a latency period of 9 hrs at a room
temperature (25°)
Stripping
The male fish was sacrificed and dissected to get
the milt. After a latency period of nine hours and at a
time egg were freely oozing out on slight touch. The
eggs were stripped into a clean receptacle and care was
taken while stripping to guard the egg and the milt that
not to get contact with water.
Fertilization
Milt solution was prepared by macerating milt
with mortar and pestle, and mixing the extract with
saline solution (0.09% salt). The milt solution was mixed
with the eggs and mechanically shaken for a minute. The
eggs were then spread on the hatching mat
Hatching
Hatching involve breaking the eggs shell and the
releasing of the larvae. Hatchings of the eggs occurred
after a fertilization process of about 26 hours after
incubation. The hatchling has the yolk sac attached to it
for a period of 4 days when they became swim up fry.
They were kept for 10 days in the nursery and fed with
artemia
Experimental design
The already acclimatized fish were counted (200) and
stocked in duplicates in colored receptacles of 100 litres
capacity of color blue, white and green (B1, B2, W1,
W2, G1 and G2). The fishes were fed with artemia for
7 days.
Ekokotu and Nwachi, 2014
Journal of Research in Biology (2014) 4(2): 1287-1292 1289
Table 1: Mean variation of weekly Body Weight of
(twenty) Clarias gariepinus species per tank
reared under different colour.
Week Green Blue White
Week 1 0.19±0.00a 0.14±0.00a 0.16±0.00a
Week 2 0.05±0.01a 0.07±0.01a 0.06±0.01a
Week 3 0.06±0.01a 0.07±0.01a 0.11±0.00a
Week 4 1.90±0.00a 1.98±0.00a 2.01±0.01a
Week 5 0.68±0.01b 0.12±0.01a 0.72±0.00a
Week 6 0.68±0.00a 0.67±0.00a 0.50±0.00a
Week 7 0.65±0.00a 0.89±0.01a 0.66±0.00a
Week 8 0.74±0.00a 0.78±0.01a 0.69±0.01a
Mean: Mean ± SE (standard Error of mean)
X = 0.05 (95% level of significant)
Week Green Tank Blue Tank White Tank
Week 1 1.02±0.00a 1.02±0.00a 1.02±0.01a
Week 2 2.00±0.00a 1.82±0.00a 2.44±0.00b
Week 3 1.96±0.00a 1.99±0.01a 1.91±0.01a
Week 4 1.91±0.00a 1.98±0.00a 2.01±0.01a
Week 5 4.50±0.01b 2.40±0.00a 2.57±0.00a
Week 6 5.12±0.00b 4.66±0.00ab 4.30±0.00a
Week 7 5.01±0.00ab 5.14±0.00b 4.55±0.01ab
Week 8 5.280.00b 5.90±0.01b 4.40±0.01a
Table 2: Mean variation of weekly Total Length of
twenty Clarias gariepinus species per tank under
different tank colour
Mean: Mean ± SE (standard Error of mean)
X = 0.05 (95% level of significant)
Fish sampling
The initial mean weight and total length of the
fry were taken using a sensitive analytical balance and
meter rule before commencement of feeding.
Subsequently, weight and total length of experimental
fishes were observed at weekly basis throughout the
culture period of two weeks.
Weight determination
Samples to be weighed were randomly removed
from each experimental bowls and kept alive in a small
plastic bowl and weighed collectively on weighing days,
fish were not fed until the whole exercise was completed.
After measurements, the fish were put in fresh water and
then returned to the rearing bowls while subsequent
weighing were done individually and mean weight gain
were determined.
Where:
Wf = final mean weight gain (mg)
W1 = initial mean weight gain (mg)
d = nursing period in days.
Specific Growth Rate.
The logarithm of difference in final and initial
mean weights test fish was determined by:
Where;
W2 = Final weight of fry
W1 = Initial weight of fry
T2 = Final time
T1 = Initial time
Survival rate
At the end of each trial (14 days), all the survived
fish were harvested totally, counted and divided by the
total number stocked.
Determination of water quality parameters.
Water quality data collected during the study
include temperature, dissolved oxygen (DO) hydrogen
concentration (pH) and other physiochemical
requirement were monitored and stabilized. These were
observed routinely, Water temperature was maintained at
28 – 30°C, pH at 7.5 – 7.8 and dissolved oxygen (DO) at
7.5 – 8.8 mg\l.
Statistical Analysis
One-way ANOVA was used to compute
collected data while Duncan Multiple Range Test
(DMRT) was used to separate the mean the at 5% level
of significance.
A total of twenty fish was sample from the
culture tank on a weekly basis.
The effect of fish environment is important in
fish culture fish react positively or negatively to its the
natural habitats of fish may negatively affect fish also on
fish response under the effect of acute or feeding
activity, health, welfare and growth. (Papoutsoglou et al.,
2000, and Green and Baker et al., 1991) The effect of
this stressors may affect the performance of the fish.
According Strand et al., (2007). Fishes maintained in the
blue tanks shows a positive increase in both size and
weight this opinion was expressed by Sumner and
Ekokotu and Nwachi, 2014
Treatment Initial weight (g) Final weight (g) Survival rate (%) Mean weight (g)
Green (T1) 0.19 0.74 86 0.56
Blue (T2) 0.14 0.78 84 0.64
White (T3) 0.16 0.69 82 0.53
Table 3: Mean Weight
W1—Wf
Weight gain (WG) =
d
LogW2/T2 - Log W1
SGR =
T1.100
No of fish harvested
Percentage survival =
No of fish stocked. 100
1290 Journal of Research in Biology (2014) 4(2): 1287-1292
Doudoroff (1938). In the present study, no contrast was
observed as there was no specific significant disparities
in the growth reaction to background colour.
Performance was observed for three colors and the
mean growth rate of fish in the three treatment was
obtained as 0.78 ± 0.01 (g) for blue tank, 0.74 (g) ± 0.0
for Green tank and 0.69 ± 0.01 for white tank. (Table-1).
This finding was similar to the study of Martinez
and Purser, (2007). In clear, white, green tanks expressed
no Support for the latter metabolic effect of background
color differences in growth performance of fry Clarias
gariepinus, as the length of fish ranges from 4.00 to
7.50 cm for blue tank, 4.00 to 6.50 cm for Green tank
and 2.80 to 6.50 cm for White tank. (Table-2).
The hatchability rate was uniform for the three
colure tanks due to the fact that the incubator was in one
receptacle the hatching rate of 82% (Table-4) was
observed for the three tanks but there was significance
difference in the survival rate of fish across the three
tank as 86% was observed in green tank and 84% rate
was observed in Blue tank and 82% rate in white Tank.
(Table-3). The high survival rate of Clarias gariepinus
fry could be due to proper water management during the
period of study.
REFERENCES
Dahle R, Taranger GL and Norberg B. 2000. Sexual
maturation and Growth of Atlantic cod (Gadus morhua
L) reared at different light intensities. In Norberg B;
Kjesbu OS; Taranger GL; Anderson E; Stefansson SO.
(Eds)(2000) proceeding of the sixth International
Symposium on the Reproductive Physiology of Fish.
Institute of Marine Research and University of Bergen.
Norway, July 4-9 1999. P 336.
Green JA and Baker BI. 1991. The influence of
repeated stress on the release of melanin-concentrating
hormone in the rainbow trout. J Endocrinol., 128(2):
261-266.
Hecht T and Appelbaum S. 1988. Observations on
intra-specific aggression and coeval sibling cannibalism
by larval and juvenile Clarias gariepinus (Clariidae
pisces) under controlled conditions. Journal of zoology.
214(1): 21-44.
Hyder M. 1990. Endocrine regulation of reproduction
in Tilapia. Gen comp: Endocine 3(Supplement):729-740.
Lam TJ and Soh CL. 1995. Effect of photoperiod on
gonadal maturation in the rabbit fish. Signanus
canaliculatus, park 1797. aquaculture. 5 (4): 407-4 10.
Lofts B. 1970. Animal photoperiodism; Edward Arnold
publishers limited p. 62
Martinez-Cardenas L and Purser GJ. 2007. Effect of
tank colour on Artemia ingestion, growth and survival in
cultured early juvenile pot-bellied seahorses
(Hippocampus abdominalis). Aquaculture. 264(1-4):
92-100.
Papoutsoglou SE, Mylonakis G, Miliou H,
KaraKatsouli NP and Chadio S. 2000. Effects of
background color on growth performances and
physiological responses of scaled carp (Cyprinus carpio
L.) reared in a closed circulated system. Aquacult. Eng.
Ekokotu and Nwachi, 2014
Treatment Initial length (g) Final length (g) Hatchability (%) Mean lenght (g)
Green (T1) 1.02 5.3 82 4.26
Blue (T2) 1.02 5.4 82 4.38
White (T3) 1.02 4.4 82 3.38
Table 4: Mean Length
Journal of Research in Biology (2014) 4(2): 1287-1292 1291
22(4): 309-318.
Strand A, Alanara A, Staffan F and Magnhagen C.
2007. Effects of tank colour and light intensity on feed
intake, growth rate and energy expenditure of juvenile
Eurasian perch, Perca fluviatilis L. Aquaculture.
272(1-4): 312-318.
Sumner FB and Doudoroff P. 1938. The effects of light
and dark backgrounds upon the incidence of a seemingly
infectious disease in fishes. Proceedings of National
Academy of Science of the United States of America. 24
(10): 463-466.
Van de Nieuwegiessen PG, Olwo J, Khong S, Verreth
JAJ and Schrama JW. 2009. Effects of age and
stocking density on the welfare of African catfish
Clarias gariepinus. Burchell aquaculture. 288(1-2):69-
75.
Ekokotu and Nwachi, 2014
Submit your articles online at www.jresearchbiology.com
Advantages
Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright
submit@jresearchbiology.com
www.jresearchbiology.com/Submit.php.
1292 Journal of Research in Biology (2014) 4(2): 1287-1292
Article Citation: Purushottam Lal, Sher Mohammed and Pawan K. Kasera. High adaptability of Blepharis sindica T. Anders seeds towards moisture scarcity: A possible reason for the vulnerability of this medicinal plant from the Indian Thar desert Journal of Research in Biology (2014) 4(2): 1293-1300 Jou
rn
al of R
esearch
in
Biology
High adaptability of Blepharis sindica T. Anders seeds towards moisture scarcity: A
possible reason for the vulnerability of this medicinal plant from the
Indian Thar desert
Keywords: Thar desert, medicinal plant, vulnerable, hygroscopic hairs, moisture, seedling collapse.
ABSTRACT: The seeds of Blepharis sindica T. Anders (Acanthaceae) are the official part of the plant for its medicinal values and also as the promise of its future. Dunes of the Thar desert with high percolation capabilities are the most preferred habitat of this vulnerable medicinal plant. It produces 1337.26 seeds/plant as an average and shows high viability and germination percentage under in-vitro conditions, but efficiency of seedling establishment was observed poor at natural sites. Occurrence of seed coat layers as sheath of hygroscopic hairs is a sign of its extreme capabilities to initiate life under lesser soil moisture availabilities in desert. Seeds with 0.5 to 1.0 ml distilled water were observed most suitable for the production of maximum shoot and root lengths under controlled conditions. Maximum biomass of shoot and root modules were observed in 0.5 ml distilled water. Maximum amount of non-soluble sugar was found in intact seeds devoid of any imbibition. Seeds with 0.5 ml distilled water produced maximum amount of shoot biomass and soluble sugar, while seedlings with 1.0 ml had maximum root biomass. Seedlings treated with >1.5 ml of distilled water showed a decreasing trend in all parameters. Excessive water always found to cause seedling collapse and failure of its establishment.
1293-1300 | JRB | 2014 | Vol 4 | No 2
This article is governed by the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which gives permission for unrestricted use, non-commercial, distribution and reproduction in all medium, provided the original work is properly cited.
www.jresearchbiology.com Journal of Research in Biology
An International
Scientific Research Journal
Authors:
Purushottam Lal1,
Sher Mohammed2* and
Pawan K. Kasera3.
Institution:
1,2. Department of Botany,
Government Lohia PG
College, Churu-331001,
Rajasthan, India.
3. Department of Botany,
J.N.V. University, Jodhpur-
342 033, Rajasthan, India.
Corresponding author:
Sher Mohammed.
Email Id:
Web Address: http://jresearchbiology.com/
documents/RA0407.pdf.
Dates: Received: 02 Jan 2014 Accepted: 04 Feb 2014 Published: 22 May 2014
Journal of Research in Biology
An International Scientific Research Journal
Original Research
ISSN No: Print: 2231 – 6280; Online: 2231 - 6299.
INTRODUCTION:
Indian Thar desert is characterised by scanty
rainfall and long dry periods throughout the year, which
pushes the typical scrub vegetation to firm adopt specific
life sustaining adaptabilities (Sen, 1982). In desert
ecosystems, long dry periods and scanty rainfall impose
severe water deficit in natural vegetation (Sen, 1982;
Raghav and Kasera, 2012). Biodiversity of desert areas is
a better reflection of highly synchronised life patterns of
living beings against the environmental entities which
always restrict the life to express beyond their biotic
potentials. The Indian Thar desert has a unique
vegetation cover as compared to other deserts around the
world. Besides harsh climatic conditions and much
constrains on growth potentials, the plant species of arid
zone synthesise and accumulate a variety of bioactive
compounds which have different values to serve
mankind. Due to their medicinal as well as economic
importance, the medicinal plants and their different parts
are being exploited largely from natural habitats. Habitat
destruction, unscientific collection, ecological
limitations, etc. are crucial factors to push valuable
medicinal plants under verge of extinction. UNDP
(2010) have published Red List Categories for 39
medicinal plants of Rajasthan State, of which Blepharis
sindica is considered as “Vulnerable”. Thus, it is quite
important to know its adaptability to conserve in natural
habitat.
B. sindica is a lignified annual plant with
characteristically dichotomously branching habit. It is
locally known as Billi khojio, Bhangara and Unt-katalo
(Bhandari, 1990). It grows on loose soils, along the crop
fencings and much especially on dune slopes. Sandy soil
with heavy percolation is much preferred by this plant.
After a successful completion of life cycle (July to
December), capsules loaded spikes remain attached to
the dried plant and provide a special distinguishable
appearance to the species. Seeds within capsules remain
open to face the extreme of winter and summer
temperatures till their first imbibition. Habitat limitation
plays an excellent role for this species as sand shifting
and eolian deposition cause to bury the spikes which
trigger microbial decomposition of lignified bracts. The
plant emerge through seeds after first rain as soon as fruit
wall split explosively from distal tapered end and release
seeds to imbibe (Fig. 1).
Compressed seeds with densely clothed
hygroscopic hairs are used in the preparation of herbal
medicines and it is used as aphrodisiac (Shekhawat,
1986; Singh et al., 1996; Mathur, 2012). Its roots are
used for urinary discharge and dysmenorrhoea.
Powdered plant is applied locally on the infections of
genitals and on the burns (Khare, 2007). Seeds contain
flavonoides (apigenin, blepharin, prunine-6″-O-
coumarate, and terniflorin), steroid (β-sitosterol) and
triterpinoide-oleanolic acid (Ahmad et al., 1984).
Lal et al., 2014
1294 Journal of Research in Biology (2014) 4(2): 1293-1300
a b c d
Fig. 1: Blepharis sindica: One-year-old plant after first rains, showing spreading of seeds to initiate
germination (a), freshly fallen seed after moisture uptake by hygroscopic hairs at sandy surface of
dune (b), single young seedling (c), and seedlings in association (d).
Hence in the present study, an attempt has been
made to identify a correlation between availed moisture
and seedling establishment in B. sindica germplasm
collected from different localities of the Churu district, a
part of Indian Thar desert.
MATERIALS AND METHODS:
The germplasm of this species was collected
during 2011-2012 from two different sites, viz.,
Shyampura village (Site-I; 12 km away towards west-
south direction from the College Campus) and Buntia
village (Site-II; 10 km towards north-east), a part of the
Indian Thar desert. The seed size was measured with the
help of vernier caliper and graph paper. Seed volume and
density estimations were based on water displacement
method (Misra, 1968). Values were calculated for 100
seeds in triplicate and confirmed twice. Arithmetic mean
and standard deviation were computed for each
parameter. Seed viability was tested by T.T.C. method
(Porter et al., 1947). The seed germination experiments
were performed in seed germinator at 28°C. Seeds were
placed in the sterilized petri dishes lined with single layer
of filter paper to evaluate germination behaviour. To
evaluate moisture response, the filter paper in each
experiment was moistened with 0.5, 1.0, 1.5, 2.0, 5.0 and
10.0 ml volume of distilled water separately. Each petri
dish containing 10 seeds in triplicate was used and
experiment was repeated for two times for the
confirmation of results. After one week of setting the
experiments, germination percentage (%) and root &
shoot lengths of seedlings were measured with the help
of a graph paper. Shoot and root biomass values of
seedlings against different moisture regimes were
estimated by oven-dried weight basis. Amount of sugars
in seedlings after varied doses of distilled water was
estimated by using anthrone reagent method (Plummer,
1971). Differences in biomass & sugar contents of
seedlings from various moisture regimes were compared
with the values for intact seeds and measured in
percentage basis. The relation between total biomass %
and total sugars % in comparison to intact seeds were
expressed as metabolic efficiencies of seedlings at
particular moisture regime. The pooled data of entire
season were analyzed statistically as per the methods of
Gomez and Gomez (1984), presented in tabular and
figure forms.
RESULTS:
The data on various morphological parameters,
viz. weight, size, volume, density and viability of seeds
collected from different sites are given in Table 1.
Morphological variations provide understanding about
germplasm variability, which is an important adaptation
skill of desert plants. Seed length and density values
were observed higher at site-I, whereas other parameters
at site-II.
Morphological parameters revealed that higher
(5.73 x 4.13 x 0.10 mm) values of seed size were
observed at site-II, while lower (5.75 x 4.11 x 0.07 mm)
at site-I. Weight of 100 seeds was greater (1.33 g) at site-
II than site-I (1.16 g). Volume of 100 seeds was more
(1.57 ml) at site-II, whereas less (1.13 ml) at site-I.
Lal et al., 2014
Journal of Research in Biology (2014) 4(2): 1293-1300 1295
Table 1. Variation in morphological parameters of B. sindica seeds collected from sites- I & II.
Parameters
Sites
Weight of
100 seeds (g)
Seed size (mm) Volume of
100 seeds
(ml)
Density (g ml-1)
Viability (%) Length Breadth Thickness
I 1.16±0.015 5.75±0.010 4.11±0.006 0.07±0.0004 1.13±0.028 1.02±0.057 100.00±0.00
II 1.33±0.022 5.73±0.010 4.13±0.006 0.10±0.0004 1.57±0.028 0.85±0.021 100.00±0.00
± = Standard deviation
Freshly collected seeds from both sites exhibited cent
percent viability.
To evaluate the significance of moisture regimes
on germination process, 0.5 ml to 10.0 ml range of
distilled water was provided to seeds. Under controlled
laboratory conditions, cent percent germination was
observed in 0.5, 1.0, 1.5 and 2.0 ml moisture regimes for
both sites. 5.0 and 10.0 ml moisture regimes caused
deterioration for seed germination.
Shoot length parameter was found to have
increasing trend from 0.5 ml to 2.0 ml range, afterwards
it gets decreased (Table 2). Maximum shoot length
(10.47 mm) was observed at 2.0 ml moisture for site-II,
while at 0.5 ml moisture slight expansion in cotyledons
was occured without shoot development for both sites.
Higher values of root length were observed at 1.0 ml
moisture for both sites, being maximum (61.97 mm) for
site-I.
At 0.5 ml level, only radicle emerged out
without any shoot elongation; whereas at 5.0 & 10.0 ml
levels shoot and root axies collapsed after a short growth
(Fig. 2). The expression of comparative relation between
shoot and root lengths as R/S ratio was found significant
at 1.0, 1.5 & 2.0 ml regimes. It was observed maximum
(45.23) at 1.0 ml moisture for both sites, while minimum
(0.82) at 10.0 ml for site-I. Seedlings from site-I showed
a rapid decline in R/S ratio along with increasing
moisture levels as compared to site-II.
Anabolic efficacy of germinating seeds was
measured in the form of over-dried biomass of seedlings.
Shoot biomass was found more as compared to root
ones. Maximum (0.28 g d. wt.) shoot biomass was
estimated at 0.5 ml moisture for site-II, while minimum
(0.09 g d. wt.) at 10.0 ml for site-II. Maximum extension
of root axis was observed at 1.0 ml levels, while
maximum (0.05 g d. wt.) root biomass were found at 1.0,
1.5 & 2.0 ml levels for site-II. Total biomass was
increased after seeds were permitted to imbibing and
found maximum (0.31 g d. wt.) with 0.5 ml and 1.0 ml
moisture for site-II. Total biomass values exhibited
declining trend along with increasing moisture regimes
(Fig. 3).
Lal et al., 2014
1296 Journal of Research in Biology (2014) 4(2): 1293-1300
Table 2. Effect of different amount of distilled water on seed germination (%), seedling growth (mm), seedling biomass
(g) and sugar contents (mg g-1 d. wt.) during seedling establishment in B. sindica seeds under laboratory conditions at
sites- I & II (Observations taken after 7 days).
Site-I
Amount of distilled water provided (moisture regime)
CD Seed 0.5 ml 1.0 ml 1.5 ml 2.0 ml 5.0 ml 10.0 ml
Germination - 100.00 100.00 100.00 100.00 36.67 6.67 1.4684 ns
Shoot length - 0.00 1.37 4.60 8.20 2.53 1.67 0.1457ns
Root length - 8.73 61.97 44.53 50.73 5.90 1.37 0.7204*
R/S ratio - # 45.23 9.68 6.19 2.33 0.82 1.3604ns
Shoot biomass - 0.26 0.23 0.23 0.22 0.13 0.11 0.0071ns
Root biomass - 0.02 0.04 0.04 0.04 0.01 0.01 0.0021ns
Total biomass 0.12 0.28 0.27 0.27 0.26 0.14 0.12 0.0047ns
Soluble sugar 28.87 29.12 28.87 28.25 27.08 18.61 5.62 0.6669*
Non-soluble sugar 2.34 1.91 1.92 1.78 1.91 1.59 1.21 0.1132*
Site-II
Germination - 100.00 100.00 100.00 100.00 50.00 50.00 1.5604ns
Shoot length - 0.00 1.50 8.77 10.47 7.53 6.27 0.0092ns
Root length - 13.77 51.03 50.93 46.60 11.63 8.60 0.4439 ns
R/S ratio - # 34.02 5.81 4.45 1.54 1.37 1.2667ns
Shoot biomass - 0.28 0.26 0.25 0.25 0.17 0.09 0.0054ns
Root biomass - 0.03 0.05 0.05 0.05 0.02 0.01 0.0026ns
Total biomass 0.13 0.31 0.31 0.30 0.30 0.19 0.10 0.0065ns
Soluble sugar 29.12 29.75 29.27 28.42 26.42 17.87 7.87 0.1553ns
Non-soluble sugar 2.41 2.03 2.02 1.81 2.06 1.81 1.38 0.1307ns
- = Values are not applicable, # = Values are infinitive, *= Significant at (P < 0.05) level, and ns = non-significant
Amounts of soluble and non-soluble sugars were
estimated in oven-dried seedlings obtained after response
of varied moisture regimes. Soluble sugar was maximum
(29.75 mg g-1 d. wt.) at 0.5 ml moisture level for site-II,
while minimum (5.62 mg g-1 d. wt.) at 10.0 ml for site-I.
Amount of non-soluble sugar was more in intact seeds as
compared to seedlings. Its maximum (2.41 mg g-1 d. wt.)
value was estimated in seeds from site-II. Seedlings with
10.0 ml moisture exhibited minimum values for site-I. In
this species, intact seeds were found to have maximum
amount of total sugars (soluble & non-soluble) and
showed a decreasing trend with increasing moisture
regime. On using intact seeds as reference, the total
sugars loss occurred on different moisture regimes are
expressed on percentage basis (Fig. 3). As compared to
site-I, seedlings from site-II exhibited more sugar loss
percentage at all moisture regimes, except in 10.0 ml.
Maximum (78.12 %) sugar loss was occurred at 0.5 ml
moisture for site-II, whereas minimum (0.58 %) at 10.0
ml for site-I. Production of total biomass (g d. wt.) in
relation to total sugars loss (% mg g-1 d. wt.) can be used
to express the metabolic efficiency (% d. wt. / % mg g-1
d. wt.) of seedling establishment (Fig. 4). Highest (229)
value for metabolic efficiency of germinating seeds were
observed at 0.5 ml moisture level for site-I, whereas
minimum (-0.32) at 10.0 ml for site-II. A decline in
metabolic efficiency was observed on increasing
moisture regimes during seed germination. Metabolic
fluctuations (percentage sugar loss & percentage biomass
growth in comparison to intact seeds) and metabolic
efficiency values against various moisture regimes were
found non-significant (P > 0.05) for both sites.
DISCUSSION:
Seed germination is a crucial step of life cycle in
higher plants as it determines the future of the species as
well as it offers the availability of plant resources for all
living beings. Most of arid plants produce seeds with
hard seed coats that enable the species to cope drought
constrains (Sen et al., 1988). In this species, seeds
completely lacking of hard coverings and embryos found
directly encapsulated within hygroscopic membrane
which further extends in hygroscopic hairs. The seeds
collected from both sites showed morphological
variability, which influenced the response of seeds
against different moisture regimes during in-vitro
germination. Freshly collected seeds exhibited cent
percent viability without any dormancy barrier.
Germplasm tolerance against extreme aridity of
the area is solely paid by its hard capsule (fruit)
coverings whereas the hygroscopic sheath (seed coat
layer) has the most prominent contribution for rapid
uptake of soil moisture and subsequent imbibitions. The
present investigation reveals that this part,
Lal et al., 2014
Journal of Research in Biology (2014) 4(2): 1293-1300 1297
Fig.2: In-vitro seedlings of B. sindica after 07 days response against varied amount of moisture
regimes (0.5 to 10.0 ml distilled water per petridish) from site-I (a) and site-II (b). Fully expand
hygroscopic hairs at 0.5 & 1.0 ml and collapsed seedlings at 5.0 & 10.0 ml.
i.e. hygroscopic sheath has some short of limitations in
sense of its carrying capacity of soil moisture contents.
Field study of the area revealed that in spite of
having cent percent viability and germination percentage,
a limited number of seedlings develop in-vivo at its
preferred sand dune surfaces during early monsoon
period. Observations are in the record that mucilaginous
sheathing on seeds and its other parts which provide
adequate water, leds to improved germination in Cactus
(Bregman and Graven, 1997; Gorai et al., 2014).
Excessive moisture was found to inhibit seed
germination in B. sindica, as observed by Mathur (2012)
but the present investigations point out that at particular
stage of early seed germination physiology, water
amount works as a master factor but interestingly it is
positive for a very short range, i.e. 0.5 to 1.0 ml. The
amount of first rain fall over detached seeds and the rate
by which rain water get percolated through inter-particle
spaces, which determine the value of availed moisture
for seeds to imbibe. For better understanding the role of
moisture amount in seed germination process; this
unique experiment was designed and the results illustrate
the comparative effect of different levels of moisture in
sense of seedling growth, biomass production,
consumption rate of reserve food contents and
comparative efficiency of seedling establishment.
Higher values of seedling length and biomass
production (shoot & root modules) were observed in 0.5
to 2.0 ml moisture regimes. Seed germination percentage
as well as seedling vigour (length & biomass) values
showed a clear decline on excessive moisture contents
(5.0 & 10.0 ml). The values for biomass growth (%) in
comparison to dry weight of intact seeds were found
highest at minimum moisture level, i.e. 0.5 ml. Amount
of soluble sugars, a part of nourishment ready to
consume during germinating seedlings; also estimated
maximum at 0.5 ml moisture level. Metabolic efficiency
of germinating seeds (dry weight increase per unit
reserve food loss) was also estimated highest at
minimum moisture regimes, while its negative value was
estimated at highest regimes of the performed
experiment.
CONCLUSIONS:
Seeds of B. sindica are highly adjusted structures
toward moisture limitations in arid habitat. The seeds
exhibited absolute requirement of 0.5 ml moisture level
Lal et al., 2014
1298 Journal of Research in Biology (2014) 4(2): 1293-1300
a
b
Fig. 3: Total sugar loss (a) and total biomass growth
(b) in seedlings against varied amount of moisture
regimes as compared to intact seeds for sites- I & II.
Fig. 4: Metabolic efficiency of germinating seeds under
varied amount of availed moisture levels (% d. wt.
total biomass / % total sugar loss) from sites- I & II
(Data are average of three replicates).
for the better establishment of in-vitro seedlings.
Primarily, the species has high biotic potential (1337.26
seeds / plant with 100 percent viability and germination
efficiencies) and secondly the species has absolutely free
from any type of grazing & fruit collection pressures. In
spite of this, the number of well established seedlings
and consequent mature plants were found restricted at
both sites. This condition marks a clear threat at the point
when its life moulds from seed to seedling phase.
Metabolic diagnosis of germinating seeds, i.e. total sugar
loss (%), total biomass growth (%) and the rate of
metabolic efficiency (% d. wt. total biomass /% total
sugars loss) provides ample insight into compensation
efficacy of germinating seeds against a particular
moisture level. Seedling collapsing at 5.0 & 10.0 ml
regimes indicates the seed tissue incompatibility at
excessive moisture regimes. Our results could make an
excellent way to define this natural problem with this
species and assessment of threat in the arid habitats of
Indian desert. The entire cascade of this pioneer work
justifies the esteem love of B. sindica seeds with that of
Thar desert aridity. Such type of findings may also be
helpful for conservation strategies related to different
plant species of the area.
ACKNOWLEDGEMENTS:
Financial assistance received from CSIR, New
Delhi in the form of SRF-NET (File No.: 08/544
(0001)/2009-EMR-I, 27.06.2009) to first author is
gratefully acknowledged. Thanks are due to the
Principal, Govt. Lohia PG College, Churu for providing
necessary facilities. The authors are also thankful to Dr.
David N. Sen (Retd. Professor & Head), Department of
Botany, J.N.V. University, Jodhpur for valuable
suggestions in improvement of this paper.
REFERENCES:
Ahmad VU, Burki AM, Mahmood I and Smith DL.
1984. Chemical constituents of Blepharis sindica seeds.
Chem. Soc. Pak., 6(4): 217-223.
Bhandari MM. 1990. Flora of the Indian Desert. MPS
REPROS, Jodhpur, p. 435.
Bregman R and Graven P. 1997. Subcuticular secretion
by cactus seeds improves germination by means of rapid
uptake and distribution of water. Annals of Botany. 80
(4): 525-531.
Gomez KA and Gomez AA. 1984. Statistical
Procedures for Agricultural Research, 2nd ed. John Wiley
& Sons, New York, p. 294.
Gorai M, El Aloui W, Yang X and Neffati M. 2014.
Toward understanding the ecological role of mucilage in
seed germination of desert shrub Henophyton deserti:
interactive effects of temperature, salinity and osmotic
stress. Plant Soil 374 (1-2): 727-738.
Khare CP. 2007. Indian Medicinal Plants - An
Illustrated Dictionary. Springer-Verlag, Berlin, New
York, USA, p. 812.
Mathur M. 2012. Phytosterol composition in seeds of
Blepharis sindica and its relation with bottom up, top
down and plant metabolites factors. Medicinal plants -
International Journal of Phytomedicines and Related
Industries 4(3): 126-132.
Mathur M and Sundaramoorthy S. 2012. Studies on
distribution patterns for an endangered semi-arid plant-
Blepharis sindica. Vegetos 25(2): 66-75.
Misra R. 1968. Ecology Work Book. IBH Publishing
Company, Oxford, New Delhi, p. 242.
Plummer DT. 1971. An Introduction to Practical
Biochemistry. Tata McGraw Hill Publishing Co Ltd,
New Delhi, p. 369.
Porter RH, Durrell M and Romm HJ. 1947. The use
of 2, 3, 5-triphenyl tetrazolium chloride as a measure of
seed germinability. Plant Physiol., 22(2): 149-159.
Lal et al., 2014
Journal of Research in Biology (2014) 4(2): 1293-1300 1299
Raghav A and Kasera PK. 2012. Seed germination
behaviour of Asparagus racemosus (Shatavari) under in-
vivo and in-vitro conditions. Asian Journal of Plant
Science & Research. 2 (4): 409-413.
Sen DN. 1982. Environment and Plant Life in Indian
Desert. Geobios International, Jodhpur, p. 249.
Sen DN, Mohammed S and Kasera PK. 1988. Report
on weed seed longevity in arid zone-Test of seed bank.
Geobios new Reports. 7: 98-100.
Shekhawat GS. 1986. Ethnobotanical survey of desert
area of Rajasthan. Ph D Thesis, University of Jodhpur,
Jodhpur, India.
Singh U, Wadhwani AM and Johri BM. 1996.
Dictionary of Economic Plants in India. ICAR, New
Delhi, p. 288.
UNDP 2010. Rajasthan Red Listed Medicinal Plants,
http://envis.frlht.org/documents/rajasthan-medicinal-
plants-conservation.pdf
Submit your articles online at www.jresearchbiology.com
Advantages
Easy online submission Complete Peer review Affordable Charges Quick processing Extensive indexing You retain your copyright
submit@jresearchbiology.com
www.jresearchbiology.com/Submit.php.
1300 Journal of Research in Biology (2014) 4(2): 1293-1300
Lal et al., 2014
Guidelines for Authors
The article should be addressed to "The Editor".
Submission of an article implies that it has never been published in any other journals and if accepted, it will not be published
elsewhere.
All papers are first reviewed by the editor. Papers found lacking will not be considered. Others will be sent for a detailed peer-review
process.
Journal Manuscript Format
The manuscript should be typed in “Times new Roman” font with font size 11 and 1.5 line spacing. The page size should be strictly A4. All images should be in JPEG format. The article is to be submitted should accompany a covering letter with name and complete address
(including Telephone Number and e-mail ID) of the author/s. The completed article should be sent to submit@jresearchbiology.com
Title
The title should briefly identify the subject and indicate the purpose of the document. The title should supply enough information for the reader to make a reliable decision on probable interest. Do not use all caps; instead use caps only at the first word of the title and/or at
scientific names, abbreviations etc., Center the authors' initials and last names directly below the title.
Abstract
The abstract should include a hypothesis or rationale for the work, a brief description of the methods, a summary of the results, and a conclusion: The abstract should be less than 250 words. Do not include literature citations or references to tables, figures or equations.
Keywords
A short list of keywords or phrases should be included immediately after the abstract as index words. Choose keywords that reflect the content of your article. Note that words in the title are not searchable as keywords unless they are also included in the keyword list.
Body of the Article
The introductory section of the text should include a brief statement of why the research was conducted. It should also define the
problem and present objectives along with a plan of development of the subject matter. The introductory section also usually includes a brief
survey of the relevant literature on the topic.
Materials and Methods
Provide sufficient detail so that the work may be repeated. Do not give details of methods described in readily available sources.
Instead, refer to the source and describe any modification. Figures that illustrate test apparatus and tables of treatment parameters or equipment specifications are appropriate here.
Results and Discussion
This section describes the solution to the problem stated in the introductory section. Use figures and tables to visually supplement the
presentation of your results. The text must refer explicitly to all visuals, and you must interpret the visual elements to emphasize the evidence on which your conclusions are based. Do not omit important negative results.
In addition, relate your findings to previous findings by identifying how and why there are differences and where there is agreement. Speculation
is encouraged, but it must be identified.
Conclusion
This is a summary of your results. In this section, state any conclusions that can be drawn from your data. You may also include
suggestions for future research. The conclusion may be a subsection of the Results and Discussion section, or it may be a separate section. Data
or statements cited in your conclusion must have been stated previously in the article. Do not introduce new information in the conclusion.
Acknowledgement
Acknowledgements are optional. Use them to thank individuals or organizations that provided assistance in materials, expertise, or
financing. The acknowledgements will appear at the end of the text and should be limited to one or two sentences.
References
All sources cited in the text must be listed in the References, and all documents listed in the References must be cited in the text. Accuracy of citation is the author's responsibility.
Reference Style
References should be cited in the text in the form (Author et al, 1987) and listed in alphabetical order at the end of the article as follows:
Schernewski G, Neumann T. The trophic state of the Baltic Sea a century ago: a model simulation study. J Mar Sys., 2005;53:109–124.
Kaufman PD, Cseke LJ, Warber S, Duke JA and Brielman HL. Natural Products from plants. CRC press, Bocaralon, Florida. 1999; 15-16.
Kala CP. Ecology and Conservation of alphine meadows in the valley of flowers national park, Garhwal Himalaya. Ph.D Thesis, Dehradun: Forest Research Institute, 1998; 75-76.
http://www.ethnobiomed.com/content/pdf/1746-4269-1-11.pdf.
Appendix
Use an appendix for material that is too long to include in the text of the article.
Manuscript Charges
Journal of Research in Biology is an International Research Journal. This Journal provides immediate access to all published full-text
articles to interested readers from all around the world. The availability of the author’s paper makes the scientific community to understand and develop an impact in the concerned research field. It also increases the chance of more citations of the published work, which in turn can be
translated into more recognition of research. This journal also accelerates research and knowledge building worldwide.
Publishing an article in Journal of Research in Biology requires payment of the manuscript processing charges, once the manuscript is
accepted for publication. The payment is to be made by one of the authors, their university/organization, or funding entity. The manuscript
processing charges are fixed so as to allow publishers to recover manuscript processing expenses and the cost of making the full-text available on the Internet to all interested researchers.
For Indians
The charges for submission of a Research article is Rs 2100, up to 8 pages and for more pages, each page costs Rs 250.
For Foreign nationals
The charges for submission of a Research article is USD 100, up to 8 pages and for more pages, each page costs 15 USD.
Copyright
Authors who publish in Journal of Research in Biology retain the copyright of their work which allows the unrestricted use,
distribution, and reproduction of an article in any medium, provided that the original work is properly cited.
If you have any queries kindly contact us at contact@jresearchbiology.com
top related