lectin activity of the pneumococcal pilin proteins - day...n. structure rat4 raspec6b rbt4 rct4...
Post on 22-Jan-2021
0 Views
Preview:
TRANSCRIPT
1SCIentIfIC REPORTS | (2017) 7:17784 | DOI:10.1038/s41598-017-17850-9
www.nature.com/scientificreports
Lectin activity of the pneumococcal pilin proteinsChristopher J. Day1, Adrienne W. Paton2, Richard M. Harvey2, Lauren E. Hartley-Tassell1, Kate L. Seib1, Joe Tiralongo1, Nicolai Bovin3, Silvana Savino4, Vega Masignani4, James C. Paton2 & Michael P. Jennings1
Streptococcus pneumoniae is a leading cause of morbidity and mortality globally. The Pilus-1 proteins, RrgA, RrgB and RrgC of S. pneumoniae have been previously assessed for their role in infection, invasive disease and as possible vaccine candidates. In this study we have investigated the glycan binding repertoire of all three Pilus-1 proteins, identifying that the tip adhesin RrgA has the broadest glycan recognition of the three proteins, binding to maltose/cellobiose, α/β linked galactose and blood group A and H antigens. RrgB only bound mannose, while RrgC bound a subset of glycans also recognized by RrgA. Adherence of S. pneumoniae TIGR4 to epithelial cells was tested using four of the oligosaccharides identified through the glycan array analysis as competitive inhibitors. The blood group H trisaccharide provided the best blocking of S. pneumoniae TIGR4 adherence. Adherence is the first step in disease, and host glycoconjugates are a common target for many adhesins. This study has identified Pilus-1 proteins as new lectins involved in the targeting of host glycosylation by S. pneumoniae.
Streptococcus pneumoniae is one of the leading causes of morbidity and mortality worldwide1–3. S. pneumoniae causes a range of diseases including pneumonia, meningitis, septicemia and otitis media, and produces a range of virulence factors including the toxin pneumolysin, pneumococcal surface protein A and pilus2,4–6. The current S. pneumoniae vaccines target the capsular polysaccharide, but cover only a subset of the 97 known capsular sero-types. Differences in serotype distribution between developed and developing countries, and serotype replace-ment in response to widespread use of the vaccines, are reducing the overall impact of the vaccines on the burden of pneumococcal disease1,3.
Expression of the pneumococcal Pilus-1, composed of three proteins RrgA, RrgB and RrgC, has been linked to pneumococcal meningitis in mouse infection models5–7. Pilus-1 was found to be required for the bacteria to breach the blood brain barrier5. The Pilus-1 protein complex consists of RrgB as the shaft protein, with RrgA as the tip adhesin and RrgC, which serves as a pilus anchor at the cell surface6–8. The S. pneumoniae Pilus-1 protein complex has been proposed as a novel vaccine target9,10. The RrgA and RrgB proteins were found to produce cross-protecting antibodies that led to blocking of adherence of S. pneumoniae to cells in culture and resulted in the opsonophagocytosis of S. pneumoniae9,11. RrgA is also involved in regulation of the host immune response to S. pneumoniae by binding to both MAC-1 (complement receptor 3, CD11b/CD18)12 and Toll-like receptor 213. RrgA has also been shown to interact directly with cultured epithelial cells and extracellular matrix components including fibronectin and collagen10.
All of the known proteins that interact with RrgA are glycoproteins, indicating a potential role of the oligo-saccharides in the interactions. In this study we aim to identify glycan targets of the Pilus-1 protein complex of S. pneumoniae.
ResultsRrgA, RrgB and RrgC proteins bind glycans. Glycan array analysis of the three Pilus-1 proteins from S. pneumoniae TIGR4 and RrgA from strain SPEC6B revealed differential glycan recognition between the four proteins tested. S. pneumoniae TIGR4 RrgB bound the least number of glycans, with only an α-manno-biose recognized (Table 1 and Dataset S1). RrgA from S. pneumoniae TIGR4 and RrgA from S. pneumoniae
1Institute for Glycomics, Griffith University, Gold Coast, QLD 4222, Australia. 2Research Centre for Infectious Diseases, Department of Molecular and Cellular Biology, University of Adelaide, Adelaide, 5005, Australia. 3Shemyakin Institute of Bioorganic Chemistry, Russian Academy of Sciences, Moscow, Russia. 4GSK Vaccines, Via Fiorentina 1, Siena, Italy. Christopher J. Day and Adrienne W. Paton contributed equally to this work. Correspondence and requests for materials should be addressed to J.C.P. (email: james.paton@adelaide.edu.au) or M.P.J. (email: m.jennings@griffith.edu.au)
Received: 23 February 2017
Accepted: 30 November 2017
Published: xx xx xxxx
OPEN
www.nature.com/scientificreports/
2SCIentIfIC REPORTS | (2017) 7:17784 | DOI:10.1038/s41598-017-17850-9
SPEC6B bound to a set of overlapping glycans including terminal galactose structures with both α and β link-ages, glucose/maltose-related structures and blood group A (7 K and 392) and blood group H(O) (7 A) antigens (Table 1 and Dataset S1). No interactions with terminal galactose structures were observed when galactose was
No. Structure RrgA T4 RrgA SPEC6B RrgB T4 RrgC T4
MONOSACCHARIDES
3 Galβ-sp3 1587 ± 308 369 ± 188 108 ± 88.9 2165 ± 450
14 GlcN(Gc)β-sp4 157 ± 171 2112 ± 110 −37.5 ± 63.5 191.3 ± 124
18 Manβ-sp4 166.3 ± 198 2532 ± 436 −113.5 ± 68.8 600.5 ± 650
22 GlcNAcβ-sp4 1140 ± 302 55.5 ± 413 227 ± 190 57.5 ± 184
Terminal Galactose
76 Galα1-3Galβ-sp3 1918.3 ± 154 142 ± 120 −67.3 ± 347 284.5 ± 180
80 Galα1-3GlcNAcβ-sp3 90.75 ± 196 270.5 ± 379 40.5 ± 388 1627 ± 122
88 Galβ1-3GalNAcβ-sp3 1013 ± 101 1251 ± 87.0 15.3 ± 204 1402 ± 204
89 Galβ1-3GalNAcα-sp3 1098 ± 277 2495 ± 322 −7 ± 266 1033 ± 295
94 Galβ1-4Galβ-sp4 1218 ± 458 186 ± 248 73.5 ± 247 374.3 ± 190
100 Galβ1-6Galβ-sp4 2197 ± 486 1027 ± 149 144.8 ± 114 3443.5 ± 523
220 Galα1-3Galβ1-4Glcβ-sp2 142.9 ± 201 151.3 ± 152 63.75 ± 95.5 1283 ± 310
222 Galα1-3Galβ1-4GlcNAcβ-sp3 99.0 ± 237 150.5 ± 162 −107.8 ± 305 3108 ± 641
373 Galα1-3Galβ1-4GlcNAcβ1-3Galβ-sp3 1802.5 ± 276 1270 ± 194 62.3 ± 148 2374 ± 839
381 Galβ1-3GlcNAcβ1-6Galβ1-4GlcNAcβ-sp2 1985.4 ± 280 2600 ± 232 −72.3 ± 166 567.0 ± 259
383 Galβ1-4GlcNAcβ1-3Galβ1-4Glcβ-sp2 126.0 ± 279 −510.3 ± 557 157 ± 414 1799 ± 160
489 Galβ1-4GlcNAcβ1-3(GlcNAcβ1-6)Galβ1-4GlcNAc-sp2 78.25 ± 96.3 437.3 ± 435 188 ± 122 1107 ± 142
501 Galβ1-3GalNAcβ1-3Galα1-4Galβ1-4Glcβ-sp4 116.0 ± 166 1012 ± 77.5 57.3 ± 185 187.0 ± 155
504 (A-GN-M)2-3,6-M-GN-GNβ-sp4 197.8 ± 201 105.3 ± 76.31241 74.5 ± 78.5 1906 ± 180
1 G Galβ1-3GlcNAcβ1-3Galβ1-4Glc 4605 ± 171 1613 ± 150 14 ± 165 606.1 ± 738
2 G Galβ1-3GlcNAcβ1-3Galβ1-4GlcNAcβ1-6(Galβ1-3GlcNAcβ1-3)Galβ1-4Glc 1344 ± 583 2655 ± 197 −127 ± 128 301.3 ± 300
Terminal N-Acetylgalactosamine
2 F GalNAcα1-3Galβ1-4Glc 1221.5 ± 204 2988 ± 200 144.3 ± 246 595.6 ± 614
Fucosylated
392 Fucα1-2(GalNAcα1-3)Galβ1-3GalNAcα-sp3 1366 ± 296 2274 ± 208 140.6 ± 165 2350 ± 329
480 Fucα1-2Galβ1-3GlcNAcβ1-3Galβ1-4GlcNAcβ-sp2 315.25 ± 272.0421 122.5 ± 399 264 ± 427 21.5 ± 227
483 Fucα1-3(Fucα1-2 (Galα1-3)Galβ1-4)GlcNAcβ-sp3 327.3 ± 438 −17.5 ± 311 170.5 ± 230 1178 ± 258
496 Fucα1-2Galβ1-3(Fucα1-4)GlcNAcβ1-3Galβ1-4Glcβ-sp4 274.5 ± 331 286 ± 105 38.5 ± 75.5 1192 ± 322
538 Lex1-6′(Lec1-3′)Lac-sp4 1261.5 ± 346 118.3 ± 206 93.6 ± 114 131.3 ± 204
539 LacNAc1-6′(Led1-3′)Lac-sp4 206.8 ± 210 1393 ± 160 59.3 ± 247 −49.0 ± 602
7A Fucα1-2Galβ1-3GlcNAcβ1-3Galβ1-4Glc 1897.3 ± 295 2619 ± 95.1 −41.8 ± 91.7 130.3 ± 283
7K GalNAcα1-3(Fucα1-2)Gal 1159.0 ± 162 2302 ± 149 69.8 ± 176 472.8 ± 587
8A SO3-3Galβ1-3(Fucα1-4)GlcNAc 918.5 ± 84.6 1638 ± 272 101.5 ± 142 29.0 ± 112
8J Fucα1-2Galβ1-4(Fucα1-3)GlcNAcβ1-3(Fucα1-2)Galβ1-4Glc 1692.3 ± 305 138 ± 338 −120.8 ± 125 245.3 ± 265
8K Galβ1-4(Fucα1-3)GlcNAcβ1-6(Galβ1-4GlcNAcβ1-3)Galβ1-4Glc 170.0 ± 177 7622 ± 1317 2 ± 141 807.5 ± 791
Mannose
120 Manα1-3Manβ-sp4 18.0 ± 406 90 ± 222 1332 ± 275 41.1 ± 54
Terminal N-Acetylglucosamine
117 GlcNAcβ1-4GlcNAcβ-sp4 145.6 ± 238 5714 ± 1240 −73 ± 113 226.5 ± 179
118 GlcNAcβ1-6GalNAcα-sp3 1322.5 ± 336 −61 ± 175 −56.3 ± 99.6 122.3 ± 31
253 GlcNAcβ1-6Galβ1-4GlcNAcβ-sp2 54.75 ± 212 25.8 ± 60.1 −160 ± 74.9 1641 ± 117
505 (GN-M)2-3,6-M-GN-GNβ-sp4 244.5 ± 183 2695 ± 351 28.0 ± 214 106.3 ± 180
Glucose
112 Glcβ1-6Glcβ-sp4 1284.8 ± 445 1863 ± 44.6 −154.5 ± 176 506.5 ± 418
390 (Glcα1-4)4β-sp4 930.5 ± 94.7 1700 ± 311 89.3 ± 413 187.3 ± 154
High molecular weight Carageenan and Glycoaminoglycans (GAGS)
14I HA 1600000 da 2.5 mg/ml 985 ± 884 187.8 ± 164 422.5 ± 698 1270 ± 147
Table 1. Glycans bound by Rrg proteins in glycan array analysis. Values are global background subtracted. Red indicates binding. Binding is determined by positive interaction in three replicate array experiments. Positive interactions are determined by a background subtracted fluorescence value significantly above background subtracted fluorescence of negative control spots (average background fluorescence from 20 spots + 3 standard deviations).
www.nature.com/scientificreports/
3SCIentIfIC REPORTS | (2017) 7:17784 | DOI:10.1038/s41598-017-17850-9
directly linked to glucose. S. pneumoniae SPEC6B RrgA also had binding to β-linked mannose and β-linked N-acetylglucosamine structures not bound by the TIGR4 RrgA. RrgC bound to structures that are the same or very similar to RrgA from TIGR4 with additional recognition of blood group B antigen (483), Lewis B (496) and hyaluronic acid (14I) (Table 1 and Dataset S1).
Surface Plasmon Resonance analysis of RrgA and glycans identified by array analysis. To val-idate the glycan array results and to determine the dissociation equilibrium constant (KD) of the interactions, surface plasmon resonance was performed between free oligosaccharides and captured RrgA proteins (Table 2). The highest affinity (smallest KD) interaction was between RrgA proteins from both S. pneumoniae TIGR4 and SPEC6B and the H trisaccharide type 3/4 (Table 2).
Inhibition of adherence of RrgA-expressing S. pneumoniae TIGR4 using free oligosaccha-rides. S. pneumoniae TIGR4 and S. pneumoniae TIGR4ΔrrgA were tested for adherence differences using A549 human lung carcinoma and Detroit 562 pharyngeal carcinoma cell lines. These cell lines are represent-ative of the two most important sites for colonization/infection of humans by S. pneumoniae. S. pneumoniae TIGR4ΔrrgA was significantly less adherent to both cell lines, with RrgA contributing to around 50% of the adherence of S. pneumoniae TIGR4 to A549 cells and 70% of the adherence to Detroit 562 cells (Table 3).
The Detroit 562 and A549 cell lines were examined for the presence of RrgA target glycans using lectin array analysis (see Dataset S2). Lectins recognizing terminal β-linked galactose were observed for both cells. The A549 cells were recognized by the lectins AAA and RSL, both of which recognize structures containing α1-2 linked fucose, while the Detroit 562 cells did not (Dataset S2). Lectins with α1-2 linked fucose specificity recognize blood group antigens, particularly the H (O) blood group antigens.
Adherence of S. pneumoniae TIGR4 to A549 cells was then re-examined using four of the oligosaccharides identified through the glycan array analysis as competitive inhibitors. The blood group H type 3/4 trisaccharide provided the best blocking of S. pneumoniae TIGR4 adherence, with 67.7% inhibition (Table 4; P < 0.001). In addition, maltose, cellobiose and blood group A tetrasaccharide all reduced adherence by around 56% (Table 4; P < 0.001 in all cases). Interestingly, the residual A549 adherence observed for TIGR4ΔrrgA (approximately 50% relative to wild type TIGR4) could also be competitively inhibited by a further 30–46% by cellobiose and blood group A tetrasaccharide and H trisaccharide (Table 4; P < 0.001).
DiscussionAdherence to host tissues is the first step in disease and host glycoconjugates are a common target for numer-ous bacterial adhesins14–16, including pili/fimbriae17,18. Pilus-1 of S. pneumoniae has been shown to interact with Toll-like receptor 2 and MAC-112,13 and epithelial cells and ECM components10, all of which are glycosylated.
The glycan array analysis of RrgA from S. pneumoniae TIGR4 and SPEC6B identified a cluster of oligosaccha-ride binding that was consistent between the two proteins. These proteins have previously been shown to bind to both cells and ECM components equally, indicating recognition of uncapped β-linked galactose. Binding of S. pneumoniae RrgA to β-linked galactose and blood group A glycan is consistent with interactions between S. pneumoniae and a wide variety of cell surfaces in the human host.
Oligosaccharide RrgA TIGR4 RrgA SPEC6B
Blood group A tri 916.5 nM ± 66.4 1.4 μM ± 0.29
Blood group A type3/4 870.7 nM ± 286 643.6 nM ± 157
Blood group H type 3/4 89.4 nM ± 16 358.1 nM ± 51
Lewis X 434.0 nM ± 118 363.3 nM ± 107
Lacto-N-tetraose 1.03 μM ± 0.05 868.6 nM ± 454
maltobiose 1.16 μM ± 0.09 964.0 nM ± 226
cellobiose 1.48 μM ± 251 582.8 nM ± 155
chitobiose 409.3 nM ± 160 426.2 nM ± 144
lactose NCDI NCDI
Table 2. Surface plasmon resonance results for RrgA proteins and glycansa. aData are dissociation equilibrium constants (KD) of the interactions between free oligosaccharides and captured RrgA proteins; NCDI: no concentration-dependent interaction detected.
A549 adherence (% TIGR4 ± SEM)a Detroit 562 (% TIGR4 ± SEM)b
TIGR4 100 ± 5.4 100 ± 19.8
TIGR4ΔrrgA 52.7 ± 3.9 27.1 ± 7.4
Significance P < 0.001 P < 0.01
Table 3. Adherence of TIGR4 vs TIGR4ΔrrgA. Data are the average of two separate experiments consisting of 4 individual wells (experiment 1) and 5 individual wells (experiment 2) (n = 9). a100% = 1.97 × 107 CFU per well. b100% = 8.70 × 106 CFU per well.
www.nature.com/scientificreports/
4SCIentIfIC REPORTS | (2017) 7:17784 | DOI:10.1038/s41598-017-17850-9
The array binding was investigated further using surface plasmon resonance analysis. Binding to blood group antigens, β-galactose, maltose, cellobiose and GlcNAc were confirmed through SPR analysis, with the highest affinity interaction observed occurring between RrgA from TIGR4 with the H-type 3/4 oligosaccharide (Table 2). As observed in the array experiment, no concentration dependent interaction was observed using SPR for ter-minal galactose with underlying glucose (lactose; Table 2). The SPR analysis found high affinity binding between RrgA and Lewis X (KD < 500 nM; Table 2).
The significance of these interactions in terms of interaction with host surfaces was further confirmed by com-petitive inhibition of TIGR4 adherence to A549 cells by exogenous maltose, cellobiose, blood group A type 3/4 and blood group H type 3/4 oligosaccharides. Interestingly, although RrgA is thought to be the most important component of the Pilus-1 structure in terms of mediating adherence, the residual A549 adherence exhibited by TIGR4ΔrrgA could be inhibited further, albeit to a slightly lesser extent, by the three exogenous oligosaccharides that were most effective against TIGR4. There are multiple S. pneumoniae surface proteins that have been shown to have a role in adherence to host epithelial cells, most notably CbpA, which is known to bind to cell surface gly-coconjugates19, indicating that the residual binding observed in the TIGR4ΔrrgA is likely to be another adhesin.
The direct interaction between RrgA and Lewis X was not seen on the array, but Lewis X was a terminal group on several of the larger fucosylated structures identified (Table 1; 8 J and 8 K). This may indicate that the binding of Lewis X requires a specific presentation that is available in solution, but not available on the array except as a part of a larger structure. Lewis X is a member of the Lewis system histo-blood group antigens, which were orig-inally identified on RBCs where they are acquired from the plasma as glycolipids20 and is expressed on most cell types but is over-expressed by human tumor cells from various sites21.
S. pneumoniae is a host-adapted pathogen that infects humans so it is unexpected to observe the binding of the Rrg proteins to many non-human and non-mammalian glycans. Rrg proteins recognised maltose and cellulose saccharides, repeating units of glucose typically produced by plants, algae and some bacteria22. This interaction may allow S. pneumoniae to interact with other bacterial species either directly or to the matrix of bacteria in biofilm communities.
RrgC and RrgA also bound to the non-human terminal α1-3-linked galactose structures. RrgC bound four of the 11 terminal α1-3-linked galactose structures present on the array, while RrgA only bound 1-2 terminal α1-3-linked galactose structures on the array (Table 1). This binding does not correlate with the host adapted nature of S. pneumoniae with α1-3-linked galactose widely expressed in non-human mammals but not in humans. The expression of α1-3-linked galactose is only observed in humans that produce blood group B anti-gens, structures not recognised on the array by the Rrg proteins.
The Pilus-1 complex of S. pneumoniae is known to be an important mediator of adherence of S. pneumoniae to host epithelial cells. This binding appears to be glycan related, as RrgA was found to have lectin activity, recog-nising a range of common host cell surface glycans. All three proteins that make up the Pilus-1 complex recognise glycans as recombinant soluble proteins. Thus, we have identified three new lectins produced by S. pneumoniae, with the pilius tip protein RrgA directly involved in interactions between pathogen and host.
Materials and MethodsCloning, expression and purification of Rrg proteins. Genes were cloned into pET protein expression vectors and proteins were expressed and purified as previously described10.
Glycan Array. Glycan array slides were printed using SuperEpoxy 3 activated substrates as previously described23 using an ArrayIt Spotbot Extreme 3 contact printer with solid metal pins. The Glycan array binding experiments were performed and analysed as previously described16. Briefly 1 μg of protein in 1xPBS containing 1 mM MgCl2 and 1 mM CaCl2 was pre-complexed with mouse anti-His antibody (Cell signaling), Alexa555 rab-bit anti-mouse IgG and Alexa555 goat anti-rabbit IgG and allowed to bind to a pre-blocked (1% bovine serum albumin in PBS) for 15 minutes. Slides were washed three times for 2 minutes in 1xPBS, dried by centrifugation and scanned and analysed using the Scan Array Express software package (Perkin Elmer) and Microsoft Excel for statistical analysis (Student’s unpaired t-test of fluorescence of background spots vs fluorescence of glycan printed spots).
Strain/glycan A549 adherence (% control ± SEM)a Significance vs untreated
TIGR4a 100 ± 9.2 —
TIGR4 + 200 μM lactose 85.5 ± 11.0 Not significant
TIGR4 + 200 μM maltose 43.7 ± 9.2 P < 0.001
TIGR4 + 200 μM cellobiose 44.6 ± 3.1 P < 0.001
TIGR4 + 200 μM BGA type 3/4 44.0 ± 2.5 P < 0.001
TIGR4 + 200 μM BGH type3/4 32.3 ± 2.7 P < 0.001
TIGR4ΔrrgAb 100 ± 3.9 —
TIGR4ΔrrgA + 200 μM cellobiose 62.4 ± 4.2 P < 0.001
TIGR4ΔrrgA + 200 μM BGA type 3/4 69.6 ± 2.1 P < 0.001
TIGR4ΔrrgA + 200 μM BGH type3/4 53.5 ± 1.6 P < 0.001
Table 4. Effect of glycans on adherence of TIGR4 to A549 cells. Data are the average from four individual wells performed as replicates (n = 4). a100% = 3.50 × 107 CFU per well. b100% = 1.97 × 107 CFU per well. BGA: Blood group A, BGH: Blood group H.
www.nature.com/scientificreports/
5SCIentIfIC REPORTS | (2017) 7:17784 | DOI:10.1038/s41598-017-17850-9
Surface Plasmon Resonance analysis. The interactions between the Rrg proteins and test glycans were analysed using surface plasmon resonance (SPR) using a Biacore T100 system as described Shewell et al.16 with the following modifications. Proteins were immobilised onto a CM5 chip at pH 4.5, flow rate of 10 µL/min for 420 seconds with an ethanolamine blank flow cell as a control. Glycans were tested between 160 nM and 100 µM. All data was double reference subtracted.
Mutagenesis of rrgA in S. pneumoniae TIGR4. The rrgA gene in TIGR4 was deleted in-frame and replaced with an erythromycin resistance cassette (erm) by direct transformation with a linear DNA fragment constructed by overlap-extension PCR, essentially as previously described24. This involved using primer pairs rrgAF/rrgAermR and rrgAermF/rrgAR to amplify 5′ and 3′ regions flanking rrgA from TIGR4 template DNA, and J214/J215 to amplify erm from pVA838 (Table 5). Primers included overlapping sequences such that the three PCR products could be fused in a second round of PCR using primer pair rrgAF/rrgAR Erythromycin-resistant transformants were screened by PCR for deletion of rrgA, confirmed by DNA sequencing and designated TIGR4ΔrrgA.
Competitive inhibition of adherence of S. pneumoniae with free glycans. Adherence assays on A549 (human type II pneumocyte) and Detroit 562 (human nasopharyngeal carcinoma) cells were carried out as previously described25. A549 and Detroit 562 cells were grown in Dulbecco’s Modified Eagle Medium (DMEM; Gibco), or a 1:1 mix of DMEM and Ham’s F-12 Nutrient Mixture (Gibco), respectively, supplemented in both cases with 5% fetal bovine serum, 2 mM L-glutamine, 50 IU of penicillin and 50 μg/ml streptomycin. Confluent monolayers in 24-well plates were washed with PBS and infected with pneumococci (approximately 5 × 105 CFU per well) in a 1:1 mixture of the respective culture medium (without antibiotics) and C + Y medium, pH 7.423. Plates were centrifuged at 500 × g for 5 min, and then incubated at 37 °C in 5% CO2 for 2.5 h. Monolayers were washed 3 times in PBS, and adherent bacteria were released by treatment with 100 μl trypsin/EDTA, followed by 400 μl 0.025% Triton X-100. Lysates were serially diluted and plated on blood agar to enumerate adherent bacteria. Total adherence (mean ± SEM for 4-9 replicates) was expressed as a percentage of that for TIGR4 (or TIGR4ΔrrgA where appropriate) without additives. For inhibition assays, free oligosaccharides were used at a final concentration of 200 μM (>100 × KD) throughout the adherence assay. Data were analysed using Student’s un-paired t-test (two-tailed).
Lectin array analysis of Detroit 562 and A549 cells. The two cells lines used for adherence assays, A549 and Detroit 562, were analysed for cell surface glycans using lectin arrays. Lectin arrays were printed using an ArrayJet Argus Marathon Inkjet Bio-Printing System on Arrayit SME3 substrates. The lectins are immobilized to the epoxy activated substrate through non-specific amine coupling through free amines on the lectin proteins and the epoxide groups on the glass. Arrays were neutralized and performed as previously described26, with the excep-tion that Bodipy 558/568 succinimidyl ester (Thermo Scientific) was used in place of CFDA-SE. Briefly, cells were collected and washed in 1xPBS prior to being labelled for 30 minutes at 37 °C with Bodipy 558/568 succinimidyl ester. Cells were washed three times with PBS and resuspended in PBS containing 1 mM MgCl2 and 1 mM CaCl2 at 107 cells/mL and 300 µL was applied to the array in a 125 µL frame without a coverslip. Cells were allowed to interact with the lectins on the array for 30 minutes and then the slides were washed three times with PBS, fixed in 4% formaldehyde and dried by centrifugation. Slides were scanned on an Innopsys InnoScan 1100AL to acquire the data of which lectins bound to the cells and analysed using Innopsys Mapix data acquisition and analysis software and Microsoft Excel for statistical analysis (Student’s unpaired t-test of fluorescence of background spots vs fluorescence of lectin printed spots).
References 1. Alderson, M. R. Status of research and development of pediatric vaccines for Streptococcus pneumoniae. Vaccine 34, 2959–2961,
https://doi.org/10.1016/j.vaccine.2016.03.107 (2016). 2. Feldman, C. & Anderson, R. Epidemiology, virulence factors and management of the pneumococcus. F1000Research 5, 2320,
https://doi.org/10.12688/f1000research.9283.1 (2016). 3. Rodgers, G. L. & Klugman, K. P. The future of pneumococcal disease prevention. Vaccine 29(Suppl 3), C43–48, https://doi.
org/10.1016/j.vaccine.2011.07.047 (2011). 4. Barnett, T. C. et al. Streptococcal toxins: role in pathogenesis and disease. Cellular microbiology 17, 1721–1741, https://doi.
org/10.1111/cmi.12531 (2015). 5. Iovino, F. et al. Pneumococcal meningitis is promoted by single cocci expressing pilus adhesin RrgA. The Journal of clinical
investigation 126, 2821–2826, https://doi.org/10.1172/JCI84705 (2016). 6. Nelson, A. L. et al. RrgA is a pilus-associated adhesin in Streptococcus pneumoniae. Molecular microbiology 66, 329–340, https://doi.
org/10.1111/j.1365-2958.2007.05908.x (2007).
Primer Sequence 5′-3′
rrgAF CAGAAACTAGAGAGCAGAAGTG
rrgAR CTGACGGCTAGTTAGTAATGC
rrgAermR TTGTTCATGTAATCACTCCTTCTATTCATAGAACAAGTTAATCCTTC
rrgAermF CGGGAGGAAATAATTCTATGAGAGTGTAGAAATGATATCTATGTTC
J214 GAAGGAGTGATTACATGAACAA
J215 CTCATAGAATTATTTCCTCCCG
Table 5. Oligonucleotide primers.
www.nature.com/scientificreports/
6SCIentIfIC REPORTS | (2017) 7:17784 | DOI:10.1038/s41598-017-17850-9
7. LeMieux, J., Hava, D. L., Basset, A. & Camilli, A. RrgA and RrgB are components of a multisubunit pilus encoded by the Streptococcus pneumoniae rlrA pathogenicity islet. Infection and immunity 74, 2453–2456, https://doi.org/10.1128/IAI.74.4.2453-2456.2006 (2006).
8. Hilleringmann, M. et al. Molecular architecture of Streptococcus pneumoniae TIGR4 pili. The EMBO journal 28, 3921–3930, https://doi.org/10.1038/emboj.2009.360 (2009).
9. Ahmed, M. S. et al. Immune responses to pneumococcal pilus RrgA and RrgB antigens and their relationship with pneumococcal carriage in humans. The Journal of infection 68, 562–571, https://doi.org/10.1016/j.jinf.2014.01.013 (2014).
10. Moschioni, M. et al. The two variants of the Streptococcus pneumoniae pilus 1 RrgA adhesin retain the same function and elicit cross-protection in vivo. Infection and immunity 78, 5033–5042, https://doi.org/10.1128/IAI.00601-10 (2010).
11. Amerighi, F. et al. Identification of a monoclonal antibody against pneumococcal pilus 1 ancillary protein impairing bacterial adhesion to human epithelial cells. The Journal of infectious diseases 213, 516–522, https://doi.org/10.1093/infdis/jiv461 (2016).
12. Orrskog, S. et al. Pilus adhesin RrgA interacts with complement receptor 3, thereby affecting macrophage function and systemic pneumococcal disease. mBio 4, e00535–00512, https://doi.org/10.1128/mBio.00535-12 (2012).
13. Basset, A. et al. Toll-like receptor (TLR) 2 mediates inflammatory responses to oligomerized RrgA pneumococcal pilus type 1 protein. The Journal of biological chemistry 288, 2665–2675, https://doi.org/10.1074/jbc.M112.398875 (2013).
14. Day, C. J. et al. Glycan:glycan interactions: High affinity biomolecular interactions that can mediate binding of pathogenic bacteria to host cells. Proceedings of the National Academy of Sciences of the United States of America 112, E7266–7275, https://doi.org/10.1073/pnas.1421082112 (2015).
15. Lehmann, F., Tiralongo, E. & Tiralongo, J. Sialic acid-specific lectins: occurrence, specificity and function. Cellular and molecular life sciences: CMLS 63, 1331–1354, https://doi.org/10.1007/s00018-005-5589-y (2006).
16. Shewell, L. K. et al. The cholesterol-dependent cytolysins pneumolysin and streptolysin O require binding to red blood cell glycans for hemolytic activity. Proceedings of the National Academy of Sciences of the United States of America 111, E5312–5320, https://doi.org/10.1073/pnas.1412703111 (2014).
17. Abraham, S. N., Sun, D., Dale, J. B. & Beachey, E. H. Conservation of the D-mannose-adhesion protein among type 1 fimbriated members of the family Enterobacteriaceae. Nature 336, 682–684, https://doi.org/10.1038/336682a0 (1988).
18. Wurpel, D. J. et al. F9 fimbriae of uropathogenic Escherichia coli are expressed at low temperature and recognise Galbeta1-3GlcNAc-containing glycans. PloS one 9, e93177, https://doi.org/10.1371/journal.pone.0093177 (2014).
19. Rosenow, C. et al. Contribution of novel choline-binding proteins to adherence, colonization and immunogenicity of Streptococcus pneumoniae. Molecular microbiology 25, 819–829 (1997).
20. Marcus, D. M. & Cass, L. E. Glycosphingolipids with Lewis blood group activity: uptake by human erythrocytes. Science 164, 553–555 (1969).
21. Yuriev, E., Farrugia, W., Scott, A. M. & Ramsland, P. A. Three-dimensional structures of carbohydrate determinants of Lewis system antigens: implications for effective antibody targeting of cancer. Immunol Cell Biol 83, 709–717, https://doi.org/10.1111/j.1440-1711.2005.01374.x (2005).
22. Lee, Y. C. Isolation and characterization of lipopolysaccharides containing 6-O-methyl-D-glucose from Mycobacterium species. The Journal of biological chemistry 241, 1899–1908 (1966).
23. Waespy, M. et al. Carbohydrate recognition specificity of trans-sialidase lectin domain from Trypanosoma congolense. PLoS neglected tropical diseases 9, e0004120, https://doi.org/10.1371/journal.pntd.0004120 (2015).
24. Iannelli, F. & Pozzi, G. Method for introducing specific and unmarked mutations into the chromosome of Streptococcus pneumoniae. Molecular biotechnology 26, 81–86, https://doi.org/10.1385/MB:26:1:81 (2004).
25. Harvey, R. M. et al. The variable region of pneumococcal pathogenicity island 1 is responsible for unusually high virulence of a serotype 1 isolate. Infection and immunity 84, 822–832, https://doi.org/10.1128/IAI.01454-15 (2016).
26. Arndt, N. X., Tiralongo, J., Madge, P. D., von Itzstein, M. & Day, C. J. Differential carbohydrate binding and cell surface glycosylation of human cancer cell lines. Journal of cellular biochemistry 112, 2230–2240, https://doi.org/10.1002/jcb.23139 (2011).
AcknowledgementsThis work was supported by a Smart Futures Fund Research Partnerships Program Grant (MPJ) and National Health and Medical Research Council (NHMRC) Program Grant 1071659 (to JCP and MPJ), Russian Science Foundation grant # 14-50-00131 (NB). JCP is a NHMRC Senior Principal Research Fellow. KLS is a NHMRC Career Development Fellow.
Author ContributionsConceived and designed the experiments: L.E.H., A.W.P., J.C.P., J.T., M.P.J., C.J.D., K.L.S. Performed the experiments: S.S., V.M., A.W.P., L.E.H., C.J.D., N.B., R.M.H. Analyzed the data: L.E.H., A.W.P., C.J.D., J.C.P., M.P.J. Wrote the paper: C.J.D., A.W.P., J.C.P., M.P.J. Reviewed and approved the final version of the manuscript: C.J.D., A.W.P., R.M.H., L.E.H., K.L.S., J.T., N.B., S.S., V.M., J.C.P., M.P.J.
Additional InformationSupplementary information accompanies this paper at https://doi.org/10.1038/s41598-017-17850-9.Competing Interests: This work was cosponsored by Novartis Vaccines, now acquired by the GSK group of companies.Publisher's note: Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or
format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Cre-ative Commons license, and indicate if changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative Commons license and your intended use is not per-mitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. © The Author(s) 2017
top related