mapping ngs sequences to a reference genome. why? resequencing studies (dna) – structural...
Post on 25-Dec-2015
223 Views
Preview:
TRANSCRIPT
Mapping NGS sequences to a reference genome
Why?
• Resequencing studies (DNA)– Structural variation– SNP identification
• RNAseq– Mapping transcripts to a genome sequence• Genome annotation• Transcript enumeration• Identification of splice junctions/variants
Blast is too slow
• Different alignment algorithms are necessary• Burrows Wheeler Alignment– sequence database (genome) is transformed to
produce an index– Individual sequence reads are searched against
this index• STAR Aligner (Dobin et al. 2012) Bioinformatics
– Uncompressed Suffix trees
BWT of “banana”
Tophat2
• Based on the Bowtie alignment engine– Bowtie, matching with no gaps– Tophat2, gapped matches
• Aligns reads to a Burrows Wheeler transformed index of the genome
• 1st pass non-gapped matches• 2nd pass splits unmapped reads and
attempts to align the fragments
• Start at the first base of sequence read• Find Maximal Mappable Prefix (MMP)• Repeat process using unmapped portion of read
• 50x faster than other aligners
The STAR Aligner
OUTPUTS
• TopHat (Bowtie)– .bam file (binary alignment/map)– .sam (sequence alignment/map)
– Single .sam file entry:
I8MVR:53:837 0 17_dna:chromosome 14090858 25521M * 0 0 TAACTACGAATACCTGTCGAT **%-**,00%-*-%---*-*-
NM:i:7 XX:Z:C5T3C2T2CT2C XM:Z:h..H......h.H...x...hXR:Z:CT XG:Z:CT
.sam fields
.sam flags
1. 12. 23. 1+24. 0+45. 1+46. 0+2+47. 1+2+48. 0+89. 1+810. 0+2+811. 1+2+812. 0+4+813. 1+4+814. 0+2+4+815. 1+2+4+816. …etc.
CIGAR format
I8MVR:104:144 0 7_dna:chromosome 120102744 255 62M1I14M * 0 0 GGTTTTTTGGAAGAGTAGTTCGCGTTTCATTAATTAGTTATTTTTTAGTTTTTAAATAAAATAAAATTTTAAAAAAA
Quantifying alignments
• How many reads overlap a given interval on a chromosome (scaffold)?
• How do these regions correspond to known genes?– .gtf file
• How many transcripts from my gene of interest?
• How confident can I be about a variant call?
Annotate regions - GTF files1 2 3 4 5 6 7 8 9
Chromosome_8.1 Cufflinks transcript 90162 90766 1000 + .
gene_id "CUFF.1"; transcript_id "CUFF.1.1"; FPKM "110.6292802224"; frac "1.000000"; conf_lo "41.668327";
conf_hi "132.581041"; cov "6.415537";
Chromosome_8.1 Cufflinks exon 90162 90231 1000 + .
gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "1"; FPKM "110.6292802224"; frac "1.000000"; conf_lo
"41.668327"; conf_hi "132.581041"; cov "6.415537";
Chromosome_8.1 Cufflinks exon 90314 90766 1000 + .
gene_id "CUFF.1"; transcript_id "CUFF.1.1"; exon_number "2"; FPKM "110.6292802224"; frac "1.000000"; conf_lo
"41.668327"; conf_hi "132.581041"; cov "6.415537";
Chromosome_8.1 Cufflinks transcript 90889 91620 1000 . .
gene_id "CUFF.2"; transcript_id "CUFF.2.1"; FPKM "49.8117204717"; frac "1.000000"; conf_lo "21.651798";
conf_hi "73.074820"; cov "2.193724";
GTF fields1. Sequence ID2. Source3. Feature4. Start5. End
6. Score7. Strand8. Frame9. Attribute
Variant Calling
• .bam/.sam file contains all of the information required to call variants
• Variant calls can’t be extracted from the .bam file• Must provide the genome sequence
I8MVR:53:837 0 17_dna:chromosome 14090858 25521M * 0 0 TAACTACGAATACCTGTCGAT **%-**,00%-
*-%---*-*- NM:i:7 XX:Z:C5T3C2T2CT2C XM:Z:h..H......h.H...x...h XR:Z:CT XG:Z:CT
Today’s exercises
Variant Analysis
• Extract variant information from provided .bam file
• Examine output file and learn about the information contained in the various fields
Introducing… Dr. Eric Rouchka
• Bioinformatics Core Director• Department of Computer Engineering and
Computer Science• University of Louisville• Kentucky Biomedical Research Infrastructure
Network
top related