medical genetics "genetics" fields: heredity and its variation. subfields: - "human...

In the Name of AllahThe Most Merciful, The Most Beneficient

Medical Genetics

"Genetics" Fields:

Heredity and its variation.

Subfields:

- "Human Genetics”: denotes the science of heredity and

its variationin human.

- ”Medical Genetics”: deals with human genetic variations

of medical relevance / significance .

Medical Geneticssubgroups

Molecular and biochemical genetics -

the study of the structure and function of individual genes.

Cytogenetics - the study of the

structure of chromosomes.

Population genetics - the study of genetics

of populations.

.Genetic epidemiology -

the study of epidemiology of genetic disease.

Immunogenetics - the study of the genetics of the

immunesystem

Clinical Genetics- concerned with

Clinical manifestationOf genetic diseases

A brief History of Genetics

Historical

* Engravings (around 6,000 years) -Showed pedigree documenting the transmission of certain characteristics of some animals.*Aristotle and Hippocrates

-Human characteristics determined by the semen (utilising the menstrual blood as a culture medium and uterus as an incubator).

-Semen was thought to be produced by the whole body and hence it was explained that 'baldheaded fathers’ had 'baldheaded' sons. * 17th century -‘Sperm' and 'ovum' were recognised by Dutch scientists and it was explained that female could also transmit characteristics to her offspring.

(Contd)

Historical (Conti.)

* 18th and 19th centuries -There was a revival of interest in heredity and it was shown that several traits such as extra digits (polydactyly) were inherited in different ways.

* 19th century

-Joseph Adams published "A treatise on the Supposed Hereditary Properties" and indicated

different mechanisms of inheritance.

-This book was intended as a basis for genetic counselling.

* In 1865, Gregor Mendel

- An Austrian Monk, published his results

of breeding experiments on Garden Peas.

- His work can be considered as the discovery

of `genes' (traits) and how they are inherited.

- He put forward patterns of inheritance of various

characteristics and single gene disorders.

-These are known as ‘Mendels Laws of Inheritance.

Historical (Conti.)

* Mendel showed that some characteristics were: -"dominant" (e.g.tall height), - others were "recessive“ (e.g. short height). -each characteristic was controlled by a pair of "factors". * In 1909, a Danish botanist, Johannsen, named the hereditary factors as ‘genes’. - two identical genes was referred to as `homozygous', - two different genes for the same characteristic, were called `heterozygous'.

Historical (Conti.)

Multiple forms of the same gene that occupy the same loci

and give rise to different forms of the same characteristics

are referred to as allelomorphs"or alleles

Alleles

Homozygous Heterozygous

* The 20th century ( development of genetics):

- Mendels Laws were independently rediscovered by three workers:

- Hugo De Vries ( in Holland) - Carl Correns (in Germany) and - Erich Von Tschermakin (in Austria).

Historical (Conti.)

* In 1902 :

- Archibald Garrod and William Bateson (fathers of Medical Genetics), discovered `Alkaptonuria'

and recognized it as an inherited disorder involving chemical processes.

- Garrod called it an "Inborn Errors of Metabolism”

- Todate several thousand of such disorders have been identified.

Historical (Conti.)

* In 1903 : - Sutton and Boveri proposed that ‘chromosomes’ carry the hereditary factors. Chromosomes( Chroma=color; soma=body) were recognised as thread like structures, (so called because of their affinity for certain stains).

* In 1906 : - Bateson contributed the term "Genetics" for this new science. * In 1941: - Beadle and Tatum formulated the "one gene - one protein" theory. * In 1956 : - The correct number of chromosomes was established as 46.

Historical (Conti.)

* By late 1950's : - Excellent techniques for the study of chromosomes were developed. * In 1953: - James Watson and Francis Crick ( in Britain) described the structure of the genetic material i.e. DNA, and were awarded Nobel prize in 1962. * Mid 1970's : -The field of Medical Genetics has been transformed and significant new discoveries about the genes, their expression and genetic diseases have been made.

Historical (Conti.)

* The 'Human Genome Project‘: - An International project, to map the entire human genome, was initiated in 1990 to be completed by the year 2005( however, it was completed in 2003). * To-date: - extensive information has been gained about chromosomes, gene mapping, gene sequencing, functions and genetic disorders.

The genetic knowledge is increasing exponentially and has extensive

applications in clinical medicine

* During the last three decades:

- a decrease in frequency of infectious diseases.

- improved nutrition, antibiotics and immunization.

- almost one third of the patients in paediatric suffer from genetic defects.

It has become essential for all medical

personnel's to have a clear knowledge

of human and medical genetics.

Mendels Laws of Inheritance

Three Laws of Inheritance:

i) The Law of Unit Inheritance.

i) The Law of Segregation.

iii) The Law of Independent Assortment.

The Law of Unit Inheritance

The characteristics (traits i.e. genes) do not blend

( mix), but are inherited as units, which might not

be expressed in the first generation off-springs,

but may appear unaltered in later generations.

First Generation Second Generation TT t t Tt Tt

Tt Tt Tt Tt TT Tt Tt ttAll tall in the first generation 75% Tall and 25% short in 2nd (As t is recessive & does not appear) generation.( T= Tall, dominant gene; t = Short, recessive gene)

The Law of Segregation- The two members of a single trait (gene) i.e. alleles, are never found in the same gamete, but always segregate and pass to different gametes Gamete

Zygote

- The failure of two alleles to segregate due to chromosome Gamete

non-disjunction give rise to genetic defects(e.g. in Down’s syndrome)

The Law of Independent Assortment

* Members of different gene pairs assort to the gametes independently of one another i.e. random recombination of maternal and paternal chromosomes occur in gametes.

Maternal Paternal Crossing-over Gametes

The exceptions to Law of Independent Assortment (not recognised by Mendel) are closely "linked“ genes on the same chromosome, which do not assort independently.

Maternal Paternal Crossing-over Gametes

The Genetic Material

What is the Genetic Material?

Proteins ?RNA?DNA?

( Smooth &Virulent)- due to polysaccharide capsule

(Non-Virulent)Due to absence

of polysaccharidecapsule

(Non-Virulent)

What is the Transforming Factor?

(Non-Virulent)

(Non-Virulent) (Virulent)

Transformation

Griffith’s ExperimentIn live animal

Of rough to smooth form

Griffith’s Experiment

Conducted in 1928 On a bacteria that produces pneumonia:- R(Rough) strains were non-virulent(did not produce disease)- S(Smooth) strains were virulent (produced disease) - Heated R and S strains were both non-virulent

_The experiment:- R injected in rats No disease- Heated R injected in rats No disease- S injected in rats Disease (Rat Died)- Heated S injected in rats No disease- Heated S + live R injected in rats Disease (Rat Died) Some substance in heated S transformed the R to S

What was the Transforming Principle?

Experiment of Avery, Macleod and McCarty (1944)

(Culture) In culture

Growth of S colonies

What is the Transforming Factor?

No colonies

Smooth colonies

The Transforming Principle

Experiment of Avery, Macleod and McCarty (1944)

1. Took extract from virulent(S) cells + R cells S Colonies As the bacteria was destroyed, but DNA was not.

2. Treated the extract with: (a) Proteases---------Mixed with R cells S Colonies

(b) Ribonuclease----Mixed with R cells S Colonies

(c) DNase------------Mixed with R cells No Colonies of S Concluded that the transforming principle in the extract was DNA

(Mixing)

These and many other experiments provedthat DNA is the carrier of genetic

informationin all living organisms except RNA viruseswhich have RNA as the carrier of genetic

information

Genetic Material in the Living Cells *All living organisms are made

up of cells.

* Cells contain a nucleus surrounded by a nuclear membrane in eukaryotic cells, and a nuclear region in the

prokaryotic cells.

*Chromatin is made up of DNA and proteins (mainly histones(basic) and non-histone

(acidic) proteins.

Genetic material…contd•The study of chromosomes, their structure and

their inheritance is known as Cytogenetics.•Each species has a characteristic number of

chromosomes and this is known as karyotype.•Prior to 1950's it was believed that humans had

48 chromosomes but in 1956 it was confirmed that each human cell has 46 chromosomes (Tjio

and Levan, 1956).•The genes are situated on the chromosomes in

a linear order. Each gene has a precise position or locus.

Chromatin

Chromosomes(Metaphase)

Chromosomes

*One member of each chromosome pair is derived from each parent .

*Somatic cells have diploid complement of chromosomes i.e. 46.

*Germ cells (Gametes: sperm and ova) have haploid complement i.e 23.

*The chromosomes of dividing cells are most readily analyzed at the `metaphase' or

prometaphase stage of mitosis .

The Normal Human Chromosomes*Normal human cells contain 23

pairs of homologous chromosomes:

-22 pairs of autosomes (numbered as 1-22 in

decreasing order of size) -1 pair of sex chromosomes.*Autosomes are the same in

males and females*Sex chromosomes are: - XX in females

-XY in males . *Both X are homologous. Y is

much smaller than X and has only a few genes.

Chromosome Structure

*At the metaphase stage each chromosome consists of two

chromatids joined at the centromere or primary

constriction•The centromere divides

chromosomes into short (p i.e. petit) and long (q e.g. g=grand) arms. The tip of each

chromosome is called telomere.•The exact function of the

centromere is not clear, but it is known to be responsible for the movement of the chromosomes

at cell division.

Centromere

Telomere

Chromosomes … contd

•In a non-dividing cell the nucleus is filled with a thread-like material known as

"chromatin."

•Before cell division, the chromatin multiplies (replicates), loses the relatively homogenous appearances and condenses to form rod like

structures.

•"Genes",

are units of genetic information present on the DNA.

Mitosis

The Cell Cycle

Each species has a characteristic gene map i.e. the chromosomal location of the genes, and

it is the same in all normal individuals of each species

• Chromosomes are classified (analysed) accordig to:

•1. Shape and •2. Staining

1. Morphologically (shape)

According to the position of the centromere as:

(i) metacentric,

(ii) sub-metacentric,

(iii) acrocentric,

(iv) telocentric (with centromere at one end.

This occurs in other species, but not in man).

Classification Of Chromosomes

MetacentricChromosomes

Sub-MetacentricChromosomes

Centromere

Telomeresp

* Acrocentric chromosomes (13, 14, 15, 21 and

22) have a small mass of chromatin known

as satellite attached to their short arm by

narrow stalks (secondary constrict).

* The stakes contain genes for 18S and 28S rRNA.

Satellite

Staining Methods for cytogeneticanalysis of chromosomes

•There are several staining methods for cytogenetic analysis of chromosomes.

•Each stain produces specific banding patterns known as "Chromosome Banding "

-G banding , - Q banding ,

-R banding , -C banding.

•The pattern is specific for each chromosome, and is the characteristics utilized to identify each chromosome.

Staining Methods for Cytogenetic Analysis

G Banding:Treat with trypsin and then with Geimsa Stain.

R Banding:Heat and then treat with Geimsa Stain.

Q Banding:Treat with Quinicrine dye giving rise to

Fluorescent bands.

C Banding:Staining of the Centromere.

The G-Banding Pattern of

Chromosomes

DNA packing in the Chromosomes

Composition of Nucleosomes

DNA Histones

2( H2A,H2B,H3,H4)

The Genetic material-Deoxyribonucleic acid (DNA)

-Double strandof polynucleotide.-Coiled around each other forming double helix.-Strands are anti- Parallel.-Sugar phosphate backbone is outside & bases are inside.-A=T and G=C.-A/T=1 andG/C=1 (Cargaff Ratio)

Nitrogenous bases in DNA and RNA

Purines

Pyrimidines

Detailed view of DNA Structure

The Central Dogma

Replication-in nucleus

Transcription-in nucleus

Translation-in cytoplasm on ribosomes

DNA Replication -Replications occurs before cell division. During S Phase of cell cycle.-Entire DNA content

is doubled.-Replication is Semi-conservative.-Requires: -DNA polymerases -dNTPs(N=A,T,C,G) -RNA primer -Mg++ -DNA ligases - Primase - Helicase - SS DNA binding proteins

Major Steps in DNA Replication

Leading strand,continuous

Lagging strand

Transcription

Steps in transcription

Initiation

Elongation

•Binding of RNA polymerase causes opening of the DNA

strand and synthesis of the RNA

•RNA polymerase continues synthesis of RNA complementary

to DNA till termination site

Elongation -contd

Termination

Steps in transcription (contd)

•Rho factor binds to the termination site and when RNA polymerase

reaches this site, termination occurs

Translation

On ribosomes

Ribosomes- free and attached to endoplasmic reticulum

Codons on mRNA

Structure of tRNA

Steps in Translation

ii. Elongation

i. Initiation

iii. Termination

Polysomes

Mitochondrial DNA

•In the human mitochondria the chromosomes are present as 10 circular double helices of DNA.

•They are self replicative.•Contain: 16,596 bp, genes for 22 tRNAs and 2 types of

ribosomal RNA required for mitochondrial protein synthesis.

•They also have genes for 13 polypeptides, involved in cellular oxidative phosphorylation.

•Both strands of DNA are transcribed and translated.

Mitochondrial DNA

•The genes on mitochondrial DNA have no introns.

•The codon recognition pattern for several amino acids is different from the nuclear DNA.

•Mitochondria are transmitted in the egg from a mother to all of her children. Thus mitochondrial

DNA is only maternally derived.

The Cell Cycle

Mitosis

The Cell Cycle

•The cell cycle consists of 2 phases : Mitosis and Interphase.

•Mitosis (cell division) is the shortest phase.•Interphase The period between successive mitosis.•The G1, S and G2 phase constitute interphase .•In a typical growing cell this lasts 16-24 hours and

mitosis lasts 1-2 hours.•Some cells e.g. neurons and RBCs, do not divide

and enter the Go phase. Other cells may enter Go but eventually return to continue through the cell

cycle. (Contd..)

The Cell Cycle (Contd..)

•Immediately after mitosis, the cell enters G1 (Gap 1) phase, where there is no DNA synthesis. Some cells spend a few hours others up to years in this phase. At this phase

cells perform metabolic functions.

•S phase - the phase of DNA synthesis .

Each chromosome in G1 phase double, and forms two chromatids joined together. By the end of S phase the DNA content of cells is

doubled.

The Cell Cycle (Contd..)

•G2 phase - The chromatin condenses and forms chromosomes. Each chromosome consists of two identical sister chromatids. During this period the DNA synthesis is restricted, RNA and protein synthesis occur and cell enlarges, eventually doubling its total mass before

next mitosis.

Cell Division

- Occurs in Somatic cells.

- Division by which the body

grows, differentiates and repairs. - Results in two identical daughter Diploid cells with genes identical to parent cells. - Chromosomes are first doubled, followed by cell division in which the number in each cell is halved (diploid).

Mitosis: Meiosis:

- Occur in cells of germ line.

- Only once in generation. - Results in the formation of

haploid, reproductive cell (gametes: ova and sperms). - Chromosomes duplicates followed by 2 cell divisions resulting in cells with half the number of chromosomes (haploid).

Mitosis•At conception the human zygote consists of a

single cell. This undergoes rapid cell division leading ultimately to the mature human adult body. Each adult human being has

approximately 1x1014 cells in the body.

•In most organs and tissues e.g. bone marrow, skin etc. cells continue to divide

throughout life.

•This process of somatic cell division during which the nucleus divides to produce two

identical daughter cells is known as Mitosis.

Mitosis (contd..)

*Each chromosomes divides into two daughter chromatids, one of which

segregates into each daughter cells.

-The number of chromosomes per cell remains unchanged.

- Mitosis lasts 1-2 hours.

- It occurs in five distinct stages:

Prophase, prometaphase, metaphase, anaphase and telophase.

Phases of Mitosis:

Prophase: The chromosome condenses and mitotic spindle begins to form. Two centrioles form in each cell from which microtubules radiate as the centrioles move towards

opposite poles of the cell.

Prometaphase: The nuclear membrane begins to disintegrate and chromosome spread around the cells. Each chromosome becomes attached at its centromere to a microtubule of the mitotic spindle by a specialised structure called

Kinetochores.

Phases of Mitosis (Contd..):

•Metaphase: The Chromosomes are maximally contracted and most easily visible. The Chromosomes become oriented along the equatorial plain and each chromosome is attached to the centriole by a microtubule

forming the mature spindle.•Anaphase: The centromere of each

chromosome divides longitudinally and the two daughter chromatids separate to opposite poles

of the cell.

Telophase: The chromatids separate completely

and a new nuclear membrane is formed around

each set of chromosomes. The cytoplasm

separates (cytokinesis) to form two daughter

cells.

Phases of Mitosis (Contd..):

Mitotic Cell Cycle:

•The type of cell division by which the diploid cells of the germline give rise to haploid gamets, i.e. oocytes

and sperms.•The process involves two successive meiotic

divisions:•Meiosis I: This is the reduction division and the

chromosome number is reduced from diploid to haploid.

•Meiosis II - follows Meiosis I without an intervening stage of DNA replication. The chromosomes disjoin, and one chromatid of each chromosome

passes to each daughter cell.

Meoisis:

•Meiosis I:This stage has: Prophase I, Prometaphase I,

Metaphase I, Anaphase I & Telophase I, just like mitosis.

•Meiosis II: has :

Metaphase II and telophase II and results in formation of ova in

female and sperms in males.

Meoisis:

Meiotic

Cell Cycle:

- Reduction of chromosome number from diploid to haploid, the essential step in the formation of gametes.

- Segregation of alleles, at either meiosis I or meiosis II, in accordance with Mendel’s First Law.

- Shuffling of the genetic material by random assortment.

- Additional shuffling of genetic material by crossing-over mechanism substantially increasing genetic variation.

Genetic Consequence of Meiosis

Gametogenesis:

There are differences in female and males gametogenesis

.1Oogenesis: Mature ova develops from oogonia by a complex series of

intermediate steps:•During the first few months of embryonic life:

Oogonia originate from primodial germ cells

by a process involving 20-30 mitotic divisions. •At completion of embryogenesis at 3 months of intra-

uterine life :

The oogonia mature to primary oocytes which start to undergo meiosis.

Gametogenesis:

•At birth, all primary oocytes have entered dictyotene, a phase of maturation arrest at which they remain resuspended until meiosis is completed at the time of

ovulation. •At the time of ovulation, a single secondary oocyte is

formed. Most of the cytoplasm is received by the daughter cell from the 1st meiotic division consists largely

of a nucleus known as a polar body.•Meiosis II then commences during which fertilization can

occur. A second polar body is formed.

Gametogenesis:

2 .Spermatogenesis: Rapid process - average duration of 60-65 days.

•At puberty, spermatogonia (which have already undergone 30 mitotic divisions) begin to mature into

primary spermatocytes.•These enter meiosis 1 and emerge as haploid secondary

spermatocytes.•These undergo second meiotic division to form

spermatids, which change to mature spermatozoa

- Increase or decrease in the amount of gene products (proteins).- Decrease in the amount of one protein.- Defective function of the protein.

- Increased function.- Decreased or complete loss of function.

- Decrease or increase in the amount of genetic material- Abnormal genetic maerial

Mutations in the: * Genome,

* Chromosome or * Gene

Genetic Disorders

Genetic Disease

Genetic Diseases

Classification of Genetic Diseases

Single GeneDisorders

Chromosomal Disorders

Multifactorial Disorders

Acquired Somatic Genetic Diseases

MitochondrialDisorders

Single Gene Disorders

• Caused by mutation in or around a gene.• Can lead to critical errors in the genetic information.• Exhibit characteristic pedigree pattern of inheritance (Mendelian Inheritance)• Occur at a variable frequency in different population•Over 7,000 single gene disorders have been identified.• May be: - Autosomal - Sex linked

• Result from defect in the number (i.e. Numerical disorders) or structure (i.e. Structural disorders) of chromosomes.• The first chromosomal disorder was Trisomy 21 (Downs syndrome) and was recognised in 1959.• These disorders are quite common and affect about 1/800 liveborn infants.• Account for almost half of all spontaneous first-trimester abortions.• Do not follow a Pedigree pattern of inheritance.

• Result from interaction between environmental and genetic factors.• Often polygenic in nature, no single error in the genetic information.• Environmental factors play a significant role in precipitating the disorder in genetically susceptible individuals.•Tend to cluster in families.• Do not show characteristic pedigree pattern of inheritance.

Congenital malformations Common disorders

of adult life.

* The defective gene is present on the mitochondrial chromosomes.* Effect generally energy metabolism.* Effect those tissues more which require constant supply of energy e.g muscles.* Shows maternal inheritance: -effected mothers transmit the disorder equally to all their children. -affected fathers do not transmit the disease to their children.

Mitochondrial Disorders

• Recent advances in Molecular Biology techniques have shown that mutations occur on a regular basis throughout the life of the somatic cell.• These somatic mutations account for 1. A large proportion of malignancy and 2. possibly involved in events such as 'senescence' and the 'ageing process'.

Single Gene Disorders

May be: - Autosomal - Sex linked: Y- linked , holanderic, hemizygote X- linked , dominant or recessive

Modes of Inheritance of Single gene Disorders

Sex Linked

X LinkedDominantRecessive

Autosomal

Y Linked

Recessive DominantNormal

homozygousHeterozygous

Abnormalhomozygous

Normal

Abnormal

- This is the inheritance of the gene present on the Autosomes.- Both sexes have equal chance of inheriting the disorder. - Two types:

Autosomal dominant inheritance, if the gene is dominant.Autosomal recessive inheritance, if the gene is recessive.

Autosomal Inheritance

Normalhomozygous

HeterozygousAbnormal

homozygous

- Autosomal dominant inheritance, if the gene is dominant.

- The trait (characteristic, disease) appears in every generation.

- The trait is transmitted by an affected person to half the children.

- Unaffected persons do not transmit the trait to their children.

- The occurrence and transmission of the trait is not affected by sex.

Autosomal Dominant Inheritance

Normal male

Normal female

Disease male

Disease female

Examples of Autosomal dominant disorders

DisorderApproximate Frequency/1000

Familial hypercholesterolemia 2

Von Willebrand disease 1

Adult polycystic kidney disease 1

Huntington disease 0.5

Myotonic dystrophy 0.2

Acute intermittent porphyria Rare

Dominant blindness 0.1Dominant deafness 0.1

- Expressed in heterozygotes and homozygotes.

- Uroporphyrinogen synthetase deficiency.

- Increased urinary excretion of 5-amino levulinic acid and porphobilinogen (diagnostic ) .

- Characterized by neurological symptoms that include severe abdominal pain, peripheral neuropathy and psychosis.

Acute Intermittent Porphyria

D DD dD

d dD dd

Affected Mother

Affected

Father

d dD dd

Affected

Mother

Normal

Father

Punnet Square

50% Normal50% Affected

25% Normal75% Affected

- The trait (characteristic, disease) is recessive.

- The trait expresses itself only in homozygous state.

- Unaffected persons (heterozygotes) may have affected

childrens (if the other parent is heterozygote) .

- The parents of the affected child maybe consanguineous.

- Males and female are equally affected.

Autosomal Recessive Inheritance

Punnett square showing autosomal recessive inheritance:

(1) Both Parents Heterozygous:

25% offspring affected Homozygous”

Female 50% Trait “Heterozygous normal but carrier”

25% Normal

Contd.

(2) One Parent Heterozygous:

Female 50% Off springs normal but carrier “Heterozygous”

50% Normal

_________________________________________________________________________(3) If one Parent Homozygous:

100% of springs carriers.

Female

Family tree of an Autosomal recessive disorderSickle cell disease (SS)

A family with sickle cell disease -Phenotype

AA AS SS

Hb Electrophoresis

DiseaseApproximate Frequency/100

Cystic fibrosis 0.5

Recessive Mental retardation

Congenital deafness 0.2

Phenyketonuria 0.1

Sickle cell anaemia 0.1-5

-Thalassaemia 0.1-5

Recessive blindness 0.1

Spinal muscular atrophy 0.1

Mucopolysaccharidosis 0.1

Examples of Autosomal Recessive Disorders

- Most frequent autosomal recessive (AR) disorder (1 in 200

births in Caucasians)

- Expressed only in homozygotes.

- Heterozygote carriers are normal phenotypically

- If both parents are heterozygote to abnormal gene than there is 1 in 4 (25%) chance of having child with cystic fibrosis (homozygous).

- If one parent has cystic fibrosis (homo) while the other parent is normal, then all childrens will be carriers of the abnormal gene.

Cystic fibrosis

- This is the inheritance of a gene present on the sex chromosomes.

- The Inheritance Pattern is different from the

autosomal inheritance.

- Inheritance is different in the males and females.

Sex – Linked Inheritance

Sex – linked inheritance

X-Linked

Dominant

Recessive

Y- Linked

- The gene is on the Y chromosomes.

- Shows Holandric inheritance. i.e.

The gene is passed from fathers to sons only.

- Daughters are not affected.

e.g. Hairy ears in India.

- Male are Hemizygous, the condition exhibits itself whether dominant or recessive.

Female

XXXXY*

Y – Linked Inheritance

- The gene is present on the X - chromosome.

- The inheritance follows specific pattern.

- Males have one X chromosome, and are hemizygous.

- Females have 2 X chromosomes, they may be

homozygous or heterozygous.

- These disorders may be : recessive or dominant.

X – Linked Inheritance

- The incidence of the X-linked disease is higher in male than in female.

- The trait is passed from an affected man through all his daughters to half their sons.

- The trait is never transmitted directly from father to sons.

- An affected women has affected sons and carrier daughters.

(1) Normal female, affected male

All daughters carriers “not affected, All sons are normal

X*X*XX*X

X – Linked Recessive Inheritance

(2) Carrier female, normal male:

50% sons affected,

50% daughters carriers,

(3) Homozygous female, normal male:- All daughters carriers.- All sons affected.

XXX*XX

YX * YXY

- Albinism (Ocular).- Angiokeratoma (Fabry’s disease).- Chronic granulomutous disease.- Ectodermal dysphasia (anhidrotic).- Fragile X syndrome.- Hemophilia A and B.- Ichthyosis (steroid sulphatase deficiency).- Lesch–Nyhan syndrome.- Menkes’s syndrome.- Mucopoly Sacchuridosis 11 (Hunter’s syndrome)- Muscular dystrophy (Duchenne and Beeker’s).- G-6-PD- Retinitis pigmentosa.

X - Linked Recessive Disorders

- X – linked recessive disease.

- Due to deficiency of hypoxanthine guanine phosphoriboyl transferase - Purine salvage pathway is impaired.

- Symptoms include:

- Self mutilation tendency.

- Mental retardation.

- Cerebral palsy.

- Uric aciduria.

- Gout and kidney stones.

Lesch – Nyhan Syndrome

- X – linked recessive disease.

- Expressed in males, very rare in females

(homozygotes) [ 1 in 10,000 male births ].

- In this abnormality, the blood fails to clot due to

abnormality of antihemophilic globulin.

- Clinical features include severe arthritis.

The Hemophilias

X-Linked Dominant Disorders

- The gene is on X Chromosome and is dominant.

- The trait occurs at the same frequency in both males and females.

- Hemizygous male and heterozygous females express the disease.

** Punnett square showing X – linked dominant type of Inheritance:

(1) Affected male and normal female:

All daughters affected, all sons normal.

(2) Affected female (heterozygous) and normal male:

50% sons and 50% daughters are affected. 50% of either sex normal.

Contd.

X*X*XX*X

XXX*XX

YX*YXY

(3) Affected female (homozygous) and normal male:

All children affected..

XX*XXX*

YX*YX*Y

- These defects result from defects in the chromosomes.

- Two groups:

* Structural defects– defects in structure of chromosome.

* Numerical defects– Increase or decrease in number of chromosomes

- These defects are quite common (7 in 1000 live births).

- Chromosomal defects do not obey specific pattern of inheritance.

- These defects account for over half of all spontaneous abortions in first trimester.

Chromosomal disorders

Increase or decrease in the number of chromosomes

Change in the structure of chromosomes

Numerical Structural

Euploidy Aneuploidy

Euploidy

Increase in the totalset of chromosomes

e.g 3N or 4N

Increase or decrease in one or more chromosomes.

e.g 2N+1, 2N-1

Aneuploidy

-Triploidy (69 chromosomes)found in cases of

spontaneous abortions

-Trisomy (46+1) chromosomes(Down Syndrome)

-Monosomy (46-1) chromosomes(Turner Syndrome)

Non-Disjunction

Triploidy (69, XXY)

Structural Abnormalities

Duplication

Translocation

IsochromosomesInversion

Insertion

Ring Chromosomes

The Philadelphia Chromosome*

* Mutation found in all cases of chronic myeloid leukemia* The ABL & BCR fuse due to translocation and form an oncogene

* Effect generally energy metabolism.* Effect more those tissues which require constant supply of energy e.g muscles.* Shows maternal inheritance: -affected mothers transmit the disorder equally to all their children. -affected fathers do not transmit the disease to their children.

Mitochondrial Disorders

Lebers hereditary optic neuropathy

Mitochondrial Inheritance

- Affected females transmit the disease to all their children.- Affected males have normal children.- Males cannot transmit the disease as the cytoplasm is inherited only from the mother, and mitochondria are present in the cytoplasm.

• Result from interaction between environmental and genetic factors.• Often polygenic in nature, no single error in the genetic information.• Environmental factors play a significant role in precipitating the disorder in genetically susceptible individuals.•Tend to cluster in families.• Do not show characteristic pedigree pattern of inheritance.

Congenital malformations Common disorders

of adult life.

• Recent advances in Molecular Biology techniques have shown that mutations occur on a regular basis throughout the life of the somatic cell.• These somatic mutations account for a large proportion of malignancy and are possibly also involved in events such as 'senescence' and the 'ageing process'.

Examples of Genetic Diseases

A.Single-gene Disorders- Adenosine deaminase deficiency

- Alpha-1-antitypsin deficiency - Cystic fibrosis - Duchenne muscular dystrophy - Familial hypercholesterolemia - Fragile X-syndrome - Hemophilia A and B - G-6-PD deficiency - Phenylketonuria - Sickle cell anaemia - Thalassaemia

B. Examples of Numerical ChromosomalAberrations

Karyotype Example

92 ,XXYYTetraploidy

69 ,XXYTriploidy

47 ,XX+21Trisomy 21(Down Syndrome)

47,XX+18Trisomy 18

47 ,XX+13Trisomy 13

47,XXYKlienfelter Syndrome

47,XXXTrisomy X

45 ,XTurners Syndrome

* Examples of significant genetic disorders: (Chromosomal disorder):

DisorderDefectIncidence

– Down Syndrome

– Trisomy 18– Trisomy 13– Klinefelter

Syndrome– XXX Syndrome– XYY Syndrome

Trisomy 21

Trisomy 18

Trisomy 13

47 ,XXY

47 ,XXX

47 ,XYY

–1/800–1/25000–1/1000) Males(–1/5000

)Females(

–1/1000 )Females(–1/1000) Males(

C. Multifactorial Disorders (i) Congenital malformation - Cleft lip and cleft palate - Congenital heart disease - Neural tube defects(ii) Adult onset disease - Cancer (some) - Coronary artery disease - Diabetes mellitus

DisorderIncidence

Cleft lip/ Cleft palate1/250 – 1/600

Congenital heart disease

1/125 – 1/250

Neural tube defects1/100 – 1/500

Coronary heart disease1/15 – Variable

Diabetes mellitus1/10 – 1/20

Cancervariable

Examples of Multifactorial disorder

D.Mitochondrial Disorders

Lebers hereditary optic neuropathy

E. Acquired somatic genetic disorders

Some forms of cancer

Genotype-Phenotype correlations

Genotype

- The genetic constitution (genes on the pair of homologous chromosomes).

- The alleles present at one locus. e.g..

(a) TT or Tt or tt i.e genes for height.

Where T is the “tall” gene and t is the gene for “short” height

(b) A A, A S, or S S

Where A is for HbA and S for HbS.

PhenotypeThe observed biochemical, physiological and morphological characteristics of an individual as determined by his/her genotype and the environment in which it is expressed. e.g.

Genotype Phenotype TT or Tt Tall tt Short AA HbA (normal)

Hetero A S HbAS SS HbS (SCA)

( Homo = Identical , Hetero = different) Dominant

* Hetero Recessive

Genotype – Phenotype relationship

Genotype (i.e. genetic make up) determines phenotype (i.e. appearance etc.), though environmental factors may modify the phenotypic expression:

e.g. TT (Proper nutrition) Tall TT (Poor nutrition) Stunted growth

and poor development.

- The Genotype determines the phenotype, but is affected by presence of Recessive or Dominant Gene, e.g. (Conti..)

e.g:(i) As T is dominant, it is expressed in Homozygotes and Heterozygotes, but t is recessive and is expressed only in Homozygotes.

TT and Tt tall tt short

(ii) s is recessive, it is expressed only in Homozygotes while Heterozygotes are carriers but normal:

A A HbA – Normal A S HbAS – Normal S S HbS – Abnormal “Sickle cell

anemia”

- Genotype differ in the degree of their expression of: Clinical severity, onset age, or both.(Variable expressivity).

- Expression of abnormal genotype maybe modified by: Other genetic loci, environmental factors or both

- Reduced Penetrance: in some heterozygous individuals with a dominant disorder, the presence of the mutation is reduced.

- Non-Penetrance: when a heterozygous individuals with a dominant disorder has no features of the disorder.

- “Pleiotropy” – multiple phenotypic effects of a single basic gene defect on multiple organs (genetic heterogeneity) e.g Tuberous sclerosis(AD) : learning disability, epilepsy, facial rash.

- New Mutations: A sudden appearance of a dominant disorder in the offspring with normal parents.

- Codominance: When two allelic traits are both expressed equally in a heterozygote e.g ABO blood groups.

- Pseudodominance: If a homozygous for AR mutation marries a carrier for the same mutation, their children have 1 in 2 chance of being affected (homo). This pattern is like dominant inheritance.

Genetic Polymorphism

Mutations Mutations

Genetic diversity among individuals Genetic diversity among individuals

Over generations, the influx of new nucleotide variations has ensured a high

degree of genetic diversity and individuality.

Over generations, the influx of new nucleotide variations has ensured a high

degree of genetic diversity and individuality.

Deleterious mutations not deleterious mutation

Disease May effect phenotype

Genetic Variation* Genetic Variation*

Some mutations in the gene(coding sequence)

Variant protein

Altered structure and

Altered properties

Some mutation in the gene DNA (coding sequence)

Variant protein ,but not critical for the function

Some mutations in DNA (non-coding regions)

Normal properties

No effect on proteins structure

*Polymorphisms are common, particularly in non-coding regions of DNA

Genetic Polymorphism* Genetic Polymorphism*

Many genetic loci are characterised by a number of relatively common alleles, thus producing many phenotypes in normal

population

Alleles that occur at a frequency of > 1% are said

to be polymorphic variants

Alleles that occur at a frequency of < 1% are said

to be rare variants

If there are two or more alleles(several forms of the same genes occupy the same locus) and

the rarest occurs at a frequency of more than 1%

then this loci will be considered polymorphic.

Wild type Alleles

Gene polymorphisme.g. Gene for hair colour

If there are two or more alleles(several forms of the same genes occupy the same locus) and

the rarest occurs at a frequency of more than 1%

then this loci will be considered polymorphic.

Types of Polymorphisms (Defined by the method of detection)

DNA Polymorphism

- Restriction Fragment Length Polymorphism (RFLPs):- Inherited variations in DNA sequence, - Results in gain or loss of a site recognised by restriction endonuclease

- Variable number of tandem repeats (VNTRs): - Variations in the number of short, repeated nucleotide sequences (eg GC) between restriction sites - VNTRs are extremely polymorphic - Valuable in forensic medicine

Detected by altered DNA sequences

Protein Polymorphism

Altered physical features

Chromosome heteromorphisms

Contd…..

Contd…

- Enzyme variant: altered enzyme activity, electrophoretic mobility, thermostability or other physical properties e.g.G-6-PD deficiency.

- Antigenic variants: altered antigenic properties e.g. ABO blood groups.

Contd…..Detected by:

ElectrophoresisAltered activity,

Altered physical properties

- Several proteins exist in two or more relatively

common,

genetically distinct , structurally

different & functionally identical.- The causes of polymorphic forms:

Mutation in or around gene

- Examples :

ABO Blood groups, Transferrin, Hb, 1 antitrypsin.

Not all variant proteins have clinical consequences

Contd…

Altered physical features e.g. polydacytyly, gagantism, dwarfs, hair on ears, baldness.

Detected by:Physical appearence

Contd…

Heritable differences in chromosomal appearances from one person to another, e.g.

Variations in the size of the Y chromosome long arm. Variation in the size of the centromere . Variation in satellite size and structure. The occurrence of fragile sites.

Chromosome heteromorphismsDetected by:

Cytogenetic studiesFISH

Genetic diversity among individuals Genetic diversity among individuals

• Generally, the karyotype of normal persons of the same sex are quite similar.

•Occasional variants are seen on staining. These are called

heteromorphisms.

•These reflect difference in amount or type of DNA sequence at a particular location along a chromosome.

• Almost 25% are silent mutation with no effect on protein structure.

• Most mutations alter amino acid sequence but do not have phenotypic effect (e.g. ABO blood groups).

•Rare mutations produce severe phenotype effect or influence survival (e.g. phenylketonuria)

• In long arm of chromosome.• In chromosomes 1, 9, 16.• In short arm of acrocentric chromosomes

Protein variations

As genetic “Markers”

- To distinguish inherited forms of a gene in a family.

- Mapping gene to individual chromosomes by likage analysis.

- Presymptomatic and prenatal diagnosis of genetic disease.

- Evaluation of high and low – risk persons.

- Paternity testing and forensic applications.

- Matching of donor-recipient pairs of tissue and organ transplantation.

Uses of Polymorphism

- Polymorphic forms are produced as result of

mutation in the genetic loci.

- The advantages are possibly:

- Production of more stable forms.

- Production of such forms that give resistance

against disease:

e.g. Hb S Trait are resistance to malarial plasmodia.

- Natural selection for survival of the fittest.

Advantages of Polymorphism

Area of Significance of Polymorphism

- Blood transfusion.

- Tissue typing.

- Organ Transplantation.

- Treatment of Haemolytic disease of new born.

ABO System- First identified by Landsteiner in 1900.

- Human blood can be assigned to one of four types according to presence of two antigens, A and B, on the surface of Red Blood Cell and

the presence of two corresponding antibodies, Anti A and Anti B in the plasma.

* RBC Antigen Polymorphism:

- Useful marker for:

- Family and population studies.

- Linkage analysis.

- Different frequencies in different population.

Contd.

* Blood Group Substances:

- Blood group substances are encoded by allelic genes A and B.

- Blood group substances exhibit polymorphism.

Polymorphic System

Chromosomal Location

Common Alleles

4q28 – 31

Xp 22.3

A, B and O

M and N;S and s

Xga and Xg.

ABO Blood groups and Reaction with Antibodies

Anti AAnti BCellular Antigen

Serum AntiFrequencies

Anti A+B

Anti B

Anti A

Neither

Clinical Importance of Polymorphism Clinical Importance of Polymorphism

e.g.- HbS in African, Saudi

Arabia- Thalassaemia in Mediterranean region Saudi Arabia- Cystic fibrosis in Europeans

Some disease genes occur with

polymorphic frequencies

Genetic polymorphisms

may produce disease

Some polymorphisms determine antigenic

differences

e.g.On exposure to drugs or environmental factor - G-6-PD deficiency- Malignant hyperthermia.

e.g.- Blood group- HLA antigen for tissue typing.

Clinical Importance of PolymorphismContd…..

e.g.DNA fingerprint of each individual differs due to polymorphic sites in many non-coding sequences

Forensic Medicine As genetic markers

e.g.Predisposing to a disease within families or populations

Genetic Linkage Genetic Linkage

The occurrence of two or more genetic loci in such close physical proximity on a

chromosome that they are more likely to assort (linked) together

Crossing over does not take place between closely situated loci – So they are said to be linked

Linked Not linked

CrossingDuring meiosis

Concept of Genetic Linkage Concept of Genetic Linkage

Loci separated by crossing over

in 1% of gametes are 1

cM apart

Linkage refers to loci, not to alleles

(which occupy different

chromosomes

Measurement of genetic linkage can only take place in

family studies

Statistical method of measuring linkage is by

calculation of

lod score

Closeness of a genetic linkage is expressed in Cente Morgans (cM) or percent recombination

Unlinked loci are separated by a genetic distance of 50 cM at a given allele at one locus has a 50% of being

transmitted with either allele at an unlinked loci.

Loci close to each other, so they never separate are linked

at a genetic distance of zero

Contd….

Concept of Genetic LinkageContd…..

- Lod score is a acronym for “Logarithm of the Odds” ( Logrithm of the likelihood ratio).- Lod score of +3 or greater at recombination distance of less than 50 cM between two loci is considered to be a strong evidence of linkage (1000 : 1 odds for linkage.- Lod score of 2 or less is taken as a strong evidence there is no linkage (100: 1 odds against linkage).

Lod Score

Concept of Genetic LinkageContd…..

This is the tendency for certain alleles at two linked loci to occur together more often than expected by chance. e.g.

Linkage disequilibrium Measure in populations, not in families

If the mutant allele at D occurs on the same chromosome as Mb more often than expected within a certain populationlinkage disequilibrium is said to exist.

Distance=5cM

Disease locus = DMarker = MAlleles of Marker Ma and Mb.

centi Morgan centi Morgan

It gives a rough unit of distance along the chromosome

Defines the distance between two gene loci

If two loci are IcM apart, there is a 1% change of recombination between these loci as the chromosome is

passed from parent to child

- Different chromosomes have different sizes.- Average chromosomes contain about 150 cM.- There are about 3300 cM in the whole human genome.

This corresponds to 3x109 bp.- On average IcM is about 1 million bp (1000 kb).

Markers tightly linked to a disease Markers tightly linked to a disease

- The marker linked to a disease gene, must be on the same region on the chromosome (within < 1 cM distance).

Markers that are a long distance away on the

same chromosome may not appear to be linked, because recombination between the two loci is

Clinical Applications of Linkage Clinical Applications of Linkage

Linkage is clinically useful as it may permit

Used in

More precise determination of the

genotype at an unidentified gene locus on the basis of readily

identified linked markers

Determination of the pattern of inheritance or specific for disease that

exhibits genetic heterogeneity

Gene mapping by determining the

recombination distance between two genes on a

chromosome

Prenatal diagnosis

Carrier detection

Presymptomatic diagnosis

Elucidation of genetic factors in multifactorial

disorders

Gene Mapping Gene Mapping

Somatic cell genetic method to show that two loci are not linked

(demonstrate synteny) or that

an unmapped loci resides on a chromosome

Family studies to

demonstrate linkage

between loci

This is the assignment of genes to specific chromosomal locations.

Mapping is done by:

Cytogenetic techniques e.g. in situ hybridization

Gene dosage studies

Indirect means of identifying location of a

Importance of Gene Mapping Importance of Gene Mapping

The gene map is the anantomy of the

human genome

Analysis of heterogeneity

and segregation of human genetic

diseases

To develop optimal strategy for gene therapy by improved knowledge of

genomic organization

Provides information about

linkage

Haemoglobinopathies and Thalassaemias

Genetic Disorders

of Haemoglobin

Haemoglobinopathies and Thalassaemias

- A conjugated protein consisting of iron-containing heme and protein (globin).- Globin chains are of different types: -chains and non -chains - Each molecule is a tetramer of two - and non - chains. - Each globin binds a haem in a haem binding site.

Haemoglobin binds and transports oxygen fromlungs to the tissues, while it transports CO2 from

tissues to the lungs.

- A conjugated protein consisting of iron-containing heme and protein (globin).- Globin chains are of different types: -chains and non -chains - Each molecule is a tetramer of two - and non - chains. - Each globin binds a haem in a haem binding site.

Haemoglobin binds and transports oxygen fromlungs to the tissues, while it transports CO2 from

tissues to the lungs.

Haemoglobin

Types of Hemoglobin in adultsGlobin genes Gene product Tetramers Name of Conc. in

Chromosome (globin) in RBCs haemoglobin adult16 11

, -chain 2 2 Hb A 96-97

, -chain 2 2 Hb A2 2.3-3.5

,-chain 2 2 Hb F <1.0-----------------------------------------------------------------Emberyonic Hb: , -chain 2 2 Hb-Gower II 0

, -chain 2 2 Hb-Gower I 0

, -chain 2 2 Hb-Portland 0

Chromosome 11

2 1 2 1

Chromosome 16

Structure of each Globin gene

Exon 1 Intron 1 Exon 2 Intron 2 Exon 3

5’ 3’

3’5’

Disorders of Haemoglobin

Haemoglobinopathies(Structural disorder

of Hb)

Co-existingstructural /

biosyntheticdisorders

Thalassaemias(Biosynthetic

disorderof Hb)

Constitute a major health problem in severalpopulations of the world

(particularly those residing in malariaendemic region)

HaemoglobinopathiesHaemoglobinopathies

• Genetic structural disorder.• Due to mutation in the globin gene of haemoglobin.• Mostly autosomal recessive inheritance.• Result in haemoglobin variants with altered structure

and function.• Altered functions include:

• Reduced solubility• Reduced stability• Altered oxygen affinity- increased or decreased• Methaemoglobin formation

• Genetic structural disorder.• Due to mutation in the globin gene of haemoglobin.• Mostly autosomal recessive inheritance.• Result in haemoglobin variants with altered structure

and function.• Altered functions include:

• Reduced solubility• Reduced stability• Altered oxygen affinity- increased or decreased• Methaemoglobin formation

*Types of Mutations in Haemoglobin *Types of Mutations in Haemoglobin

• Point mutation: a change of a single nucleotide base in a DNA giving rise to altered amino acids in the polypeptide chains

(e.g. Hb S , Hb Riyadh, Hb C)

• Deletions and additions: Addition and deletion of one or more bases in the globin genes

(e.g. Hb-constant spring which is associated with mild -thalassaemia).

• Unequal crossing over: as in Hb-lepore and Hb-antilepore associated with -thalassaemias.

________________________________________________________*Most abnormal Hbs are produced by mutations in the structural genes which determine the amino acid sequence of the globin chains of the Hb molecule.

• Point mutation: a change of a single nucleotide base in a DNA giving rise to altered amino acids in the polypeptide chains

(e.g. Hb S , Hb Riyadh, Hb C)

• Deletions and additions: Addition and deletion of one or more bases in the globin genes

(e.g. Hb-constant spring which is associated with mild -thalassaemia).

• Unequal crossing over: as in Hb-lepore and Hb-antilepore associated with -thalassaemias.

________________________________________________________*Most abnormal Hbs are produced by mutations in the structural genes which determine the amino acid sequence of the globin chains of the Hb molecule.

Geographical distribution of common Hb variantsGeographical distribution of common Hb variants

Variant Occurrence predominantly in: Hb S (6GluVal) Africa, Arabia, Black

Americans

Hb C (6Glulys) West Africa, China

Hb E (26Glulys) South East Asia

Hb D (121GluGln) Asia

Hb O (121GluVal) Turkey and Bulgury

Variant Occurrence predominantly in: Hb S (6GluVal) Africa, Arabia, Black

Americans

Hb C (6Glulys) West Africa, China

Hb E (26Glulys) South East Asia

Hb D (121GluGln) Asia

Hb O (121GluVal) Turkey and Bulgury

His Lys Tyr His

CAC AAG UAU CAC Normal

Shorter chain

His Lys Mutation

CAC AAG UAA

His Lys Tyr His

CAC AAG UAU CAC Normal

Shorter chain

His Lys Mutation

CAC AAG UAA

Other examples of Haemoglobin variants

Longer chains, e.g.

(Lys) (Glu)A G

2 gene AUG --- ----- UAA --------- UAA

C C(Gln) (Ser)

globin Gln LysGluSer 142

Longer chains, e.g.

(Lys) (Glu)A G

2 gene AUG --- ----- UAA --------- UAA

C C(Gln) (Ser)

globin Gln LysGluSer 142

Sickle Cell Haemoglobin

GAG GTG

Haemolysis

Sickle Cell

Inheritance of Sickle Cell Anaemia

SSAAAS AS

LungspO2

TissuespO2

Red cell sickling

- Sickling of the red cell during deoxygenation, as the HbS has low solubility at low O2 partial pressure and precipitates.- Chronic haemolytic anaemia due to repeated sickling in tissues and unsickling in the lungs.- Plugging of microcapillaries by rigid sickled cells leading to sickle cell crises i.e severe pain and edema. This causes significant damage to internal organs, such as heart, kidney, lungs and endocrine glands.- Repeated infections.- Frequent cerebrovascular accidents.- Hand-foot syndrome (in small,i.e.around age of 3y)- Bone deformation – bossing of the forehead.- Hepato-spleenomegaly.- Growth retardation.- Frequent blood transfusion requirements.- Psychosocial problems.

Major abnormalities & problems in SCA

Thalassaemias

Genetic disorders resulting fromdecreased biosynthesis of globin chains

of haemoglobin.

Thalassaemias• A group( not single identity) of Genetic defects.• Due to mutations in and around the globin genes.• Decreased production of one or more of the globin

chains.• Result in an imbalance in the relative amounts of the -

and non -chains. Altered /non- ratio.• A few rare Hb variants are effectively synthesized but

are highly unstable, and thus cause thalassaemias as the : chain ratio is altered.

• As a consequences of thalassaemias there is excess production of the other chains, and a decreased over all haemoglobin synthesis.

Thalassaemias• A group( not single identity) of Genetic defects.• Due to mutations in and around the globin genes.• Decreased production of one or more of the globin

chains.• Result in an imbalance in the relative amounts of the -

and non -chains. Altered /non- ratio.• A few rare Hb variants are effectively synthesized but

are highly unstable, and thus cause thalassaemias as the : chain ratio is altered.

• As a consequences of thalassaemias there is excess production of the other chains, and a decreased over all haemoglobin synthesis.

Types of Thalassaemias

- Thalassaemia* -Thalassaemia*

- Thalassaemia - Thalassaemia

- Thalassaemia * Most common

- Thalassaemia

Hb In - Thalassaemia Decreased production of - chains

- Decreased / ratio

- Thalassaemia

Normal =

Accumulation of

Point Mutation producing - Thalassaemia

Less Frequent

exon1 exon2 exon3Chromosome 16Introns

5’ 3’

2bp del

5bp del

Base Substitution

Chain TerminationDefect

Poly A signalMutation

Mutations Producing - Thalassaemia

Deletions Most frequent:

/ -/- --/ --/----/--/-thal 2hetero

-thal 1hetero

HbHDisease

Hydropsfetalis

-thal 2homo

Normal

Chromosome 16

-thalassaemia -2

• One -gene deletion.

-chain production is only about 75% of normal.

• May be homo- (- /- ) or heterozygous (- / )

• The patient usually shows a normal phenotypic appearance but there might be mild thalassaemia symptoms.

• Hypochromic-microcytic RBC’s due to partial reduction of -chain.

-thalassaemia -2

• One -gene deletion.

-chain production is only about 75% of normal.

• May be homo- (- /- ) or heterozygous (- / )

• The patient usually shows a normal phenotypic appearance but there might be mild thalassaemia symptoms.

• Hypochromic-microcytic RBC’s due to partial reduction of -chain.

-thalassaemia- 1

• Two -genes deletion- (o )thal.

• The patient synthesizes -chain but it is decreased to about 50% of normal.

• Anaemic symptoms- hypochromic microcytic anaemia.

• May be homozygous (- -/- -) or heterozygous(--/ ). If the patient is homozygous than there is no -chain synthesis, and if heterozygous then there is decreased synthesis of the -chain to half normal level.

-thalassaemia- 1

• Two -genes deletion- (o )thal.

• The patient synthesizes -chain but it is decreased to about 50% of normal.

• Anaemic symptoms- hypochromic microcytic anaemia.

• May be homozygous (- -/- -) or heterozygous(--/ ). If the patient is homozygous than there is no -chain synthesis, and if heterozygous then there is decreased synthesis of the -chain to half normal level.

Hb H Disease

• Three -gene deletion.

• The Hb present during foetal life is “Hb Bart’s” (4), while during adulthood the Hb present is “Hb H” (4).

• Some of the symptoms include: hepatosplenomegally, impairment of erythropoisis, and hypochromoc-microcytic haemolytic anaemia.

Hb H Disease

• Three -gene deletion.

• The Hb present during foetal life is “Hb Bart’s” (4), while during adulthood the Hb present is “Hb H” (4).

• Some of the symptoms include: hepatosplenomegally, impairment of erythropoisis, and hypochromoc-microcytic haemolytic anaemia.

Hydrops foetalis

• Homozygous o-thalassaemia.

• There is a complete absence of -chain (all -genes are deleted).

• The Hb produced at birth is Hb Barts (4).

• Hydrops foetalis is lethal and the baby is born dead.

• Symptoms include: Hepatosplenomegaly, severe hypochromic- microcytic anaemia.

Hydrops foetalis

• Homozygous o-thalassaemia.

• There is a complete absence of -chain (all -genes are deleted).

• The Hb produced at birth is Hb Barts (4).

• Hydrops foetalis is lethal and the baby is born dead.

• Symptoms include: Hepatosplenomegaly, severe hypochromic- microcytic anaemia.

- Thalassaemia

HbIn - Thalassaemia Decreased

production of - chains

Increased / ratio

- Thalassaemia

Normal =

Accumulation of

-Thalassaemia

• It is characterized by either no -chain synthesis (i.e. o) or decreased synthesis of -chain (+).

• Excess -chains precipitate in RBC’s causing severe ineffective erythropoiesis and haemolysis.

• The greater the -chains, the more severe the anaemia.

• Production of -chains helps to remove excess -chains and to improve the -thalassaemia. Often HbFlevel is increased.

• Majority of -thalassaemia is due to point mutation.

-Thalassaemia

• It is characterized by either no -chain synthesis (i.e. o) or decreased synthesis of -chain (+).

• Excess -chains precipitate in RBC’s causing severe ineffective erythropoiesis and haemolysis.

• The greater the -chains, the more severe the anaemia.

• Production of -chains helps to remove excess -chains and to improve the -thalassaemia. Often HbFlevel is increased.

• Majority of -thalassaemia is due to point mutation.

o-Thalassaemia

• The -chain is totally absent.• There is increase in HbF with absence of HbA.• This is combined with ineffective erythropoisis.• In majority of the cases, -gene is present but there is complete

absence of mRNA.• Characteristics of this disorder are:

• Skeletal deformities (e.g. enlargement of upper jaw, bossing of skull and tendency of bone fractures).

• Severe hypochromic- microcytic anaemia.• Survival depends on regular blood transfusion.• This leads to iron overload (iron accumulates in the blood and

tissues, causing tissue damage). • Death usually occurs in the 2nd decade of life (i.e. at age of

about 20 years) if measures are not taken to avoid iron overload by chelation therapy.

o-Thalassaemia

• The -chain is totally absent.• There is increase in HbF with absence of HbA.• This is combined with ineffective erythropoisis.• In majority of the cases, -gene is present but there is complete

absence of mRNA.• Characteristics of this disorder are:

• Skeletal deformities (e.g. enlargement of upper jaw, bossing of skull and tendency of bone fractures).

• Severe hypochromic- microcytic anaemia.• Survival depends on regular blood transfusion.• This leads to iron overload (iron accumulates in the blood and

tissues, causing tissue damage). • Death usually occurs in the 2nd decade of life (i.e. at age of

about 20 years) if measures are not taken to avoid iron overload by chelation therapy.

+-Thalassaemia

• There is a variable amount of -chain production.• There is decreased HbA level, and increased Hb A2,

level with normal or increased Hb F level (and there is an increased number of -chains in the free form).

• The -chain is present but there is decreased numbers of mRNA or there is an abnormality in the mRNA.

+-Thalassaemia

• There is a variable amount of -chain production.• There is decreased HbA level, and increased Hb A2,

level with normal or increased Hb F level (and there is an increased number of -chains in the free form).

• The -chain is present but there is decreased numbers of mRNA or there is an abnormality in the mRNA.

1. Mutations affecting transcription initiation2. Mutations affecting RNA splicing3. Mutations affecting translation initiation4. Non-sense Mutations.5. Mutations of polyadenylation site.

Mutations affecting the -Globin gene.

>200 -Thalmutations reported

to-date Worldwide

Chromosome 11

Clinical Classification of Thalassaemias

1. Thalassaemia major:The patient depends on blood transfusions especially if he

is homozygous.

2. Thalassaemia intermediate:• Homozygous mild +-thalassaemia. • Co-inheritance of -thalassaemia.• Heterozygous -thalassaemia.• Co-inheritance of additional -globin genes. -thalassaemia and hereditary persistence of foetal Hb• Homozygous Hb lepore• Hb H disease.

3. Thalassaemia minor (trait): o-thalassaemia trait. +-thalassaemia trait.• Hereditary persistence of foetal Hb only. -thalassaemia trait. o- and +-thalassaemia trait.

Clinical Classification of Thalassaemias

1. Thalassaemia major:The patient depends on blood transfusions especially if he

is homozygous.

2. Thalassaemia intermediate:• Homozygous mild +-thalassaemia. • Co-inheritance of -thalassaemia.• Heterozygous -thalassaemia.• Co-inheritance of additional -globin genes. -thalassaemia and hereditary persistence of foetal Hb• Homozygous Hb lepore• Hb H disease.

3. Thalassaemia minor (trait): o-thalassaemia trait. +-thalassaemia trait.• Hereditary persistence of foetal Hb only. -thalassaemia trait. o- and +-thalassaemia trait.

Hb-Lepore

• This is an abnormal Hb due to unequal crossing-over of the - and -genes to produce a polypeptide chain consisting of the - chain at its amino end and - chain at its carboxyl end.

• The -fusion(hybrid) chain is synthesized inefficiently and normal and -chain production is abolished.

• The homozygotes show thalassaemia intermediate and heterozygotes show thalassaemia trait.

• Unequal crossing-over can be explained as crossing over between similar DNA sequence that are misaligned resulting in sequences with deletions or duplications of DNA segments; a cause of a number of genetic variants.

• The adjacent and -genes differ at only 10 of their 146 a.a. residues, if mispairing occurs followed by intergenic crossing over, two hybrid genes result: one with a deletion of part of each locus (lepore gene) and one with a corresponding duplication (anti-lepore gene).

Hb-Lepore

• This is an abnormal Hb due to unequal crossing-over of the - and -genes to produce a polypeptide chain consisting of the - chain at its amino end and - chain at its carboxyl end.

• The -fusion(hybrid) chain is synthesized inefficiently and normal and -chain production is abolished.

• The homozygotes show thalassaemia intermediate and heterozygotes show thalassaemia trait.

• Unequal crossing-over can be explained as crossing over between similar DNA sequence that are misaligned resulting in sequences with deletions or duplications of DNA segments; a cause of a number of genetic variants.

• The adjacent and -genes differ at only 10 of their 146 a.a. residues, if mispairing occurs followed by intergenic crossing over, two hybrid genes result: one with a deletion of part of each locus (lepore gene) and one with a corresponding duplication (anti-lepore gene).

High Persistence of Foetal Hb (HPFH)

A group of disorders due to deletions or cross over abnormalities which affect the production of and

chains in non-deletion forms to point mutations upstream from the -globin genes.

High Persistence of Foetal Hb (HPFH)

A group of disorders due to deletions or cross over abnormalities which affect the production of and

chains in non-deletion forms to point mutations upstream from the -globin genes.

Double heterozygous indicates the presence of combinations of the following:

• Hb S + O-thalassaemia.

• Hb S + --thalasaemia.

• Hb S + -thalasaemia.

• Hb S + HbC disease

• Hb S + HbE disease

Double heterozygous indicates the presence of combinations of the following:

• Hb S + O-thalassaemia.

• Hb S + --thalasaemia.

• Hb S + -thalasaemia.

• Hb S + HbC disease

• Hb S + HbE disease

Diagnosis of Genetic Diseases

Family History*

ClinicalPresentation*

Estimation of Haematological

parameters

Estimation of Biochemical Parameters

ChromosomalAnalysis

RecombinantDNA

Technology

Determination ofEnzyme Activity

or Specific Protein

* Important for all genetic diseases

1. Family History

• Consanguinity of parents.

• Presence of other siblings with the same disorder.

• Occurrence of the disorder in other members of the family.

• Repeated abortions or still births,

• mother and fathers ages.

• Drawing punnet square helps to determine the mode of inheritance of the genetic disorders.

• Autosomal or X-linked

• Dominant or recessive

2. Clinical PresentationCertain clinical features are specific for a disease:• Chronic anaemia:

• Haemoglobinopathies• Thalassaemia• Other genetic anaemias

• Acute anaemia, under certain stressful conditions.• G-6-PD deficiency

• Hypoxia – sickle cell disease.• Dependence on blood transfusion - -thalassaemia (major)• Severe immune deficiency – ADA deficiency.• Emphysema - 1 anti-trypsin deficiency.• Hypercholesterolaemia – familial hypercholesterolaemia.• Delayed blood coagulation – Haemophilia (decrease in factor VIII or

IX).• Mental retardation – Fragile syndrome (in X chromosome) or

phenylketonuria (PKU).• Muscular weakness and degeneration – Duchenne muscular

dystrophy.

Recombinant DNA Technology( Genetic Engineering)

Techniques for cutting

and joining DNA

Requirements for DNA technology

Restriction endonucleases

Vectors

Probes

Other enzymese.g ligases,

Taq polymerases

Primers

Special chemicals and equipment

• Endonucleases.• Synthesized by procaryotes. Do

not restrict host DNA.• Recognize and cut specific base

sequence of 4-6 bases in double helical DNA.

• The sequence of base pairs is palindromic i.e. it has two fold symmetry and the sequence, if read, from 5’ or 3’ end is the same.

• Endonucleases.• Synthesized by procaryotes. Do

not restrict host DNA.• Recognize and cut specific base

sequence of 4-6 bases in double helical DNA.

• The sequence of base pairs is palindromic i.e. it has two fold symmetry and the sequence, if read, from 5’ or 3’ end is the same.

Restriction Endonuclease

5’-GAATTC-3’3’-CTTAAG-5’

Produce either Blunt Ends or Staggered ends: Produce either Blunt Ends or Staggered ends:

Restriction Endonuclease

5’-GAA TTC-3’ 3’-CTT AAG-5’

5’-G AATTC-3’3’-CTTAA G-5’

Blunt Ends

Staggered Ends

• Obtaining DNA fragments of interest.• Gene mapping.• Sequencing of DNA fragments.• DNA finger printing• Recombinant DNA technology• Study of gene polymorphism.• Diagnosis of disease.• Prenatal diagnosis

Uses of Restriction Endonuclease

Sources of DNA

GenomicDNA

Synthesis of DNA

Using DNA synthesiser

Synthesised frommRNA using reversetranscriptaseDNA extracted

from cells

cDNA Synthesis

Poly A tailAAAAAAAAA

Viral reverse transcriptase

AAAAAA

NaOH( Hydrolysis of RNA)

DNA polymerase

Hair pin loop

DNA nuclease (single-strand specific)

Double strand cDNA

• DNA molecules.

• Can replicate in a host e.g bacterial cells or yeast.

• Can be isolated and re-injected in cells.

• Presence can be detected.

• Can be introduced into bacterial cells e.g. E. coli.

• May carry antibiotic resistance genes.

• DNA molecules.

• Can replicate in a host e.g bacterial cells or yeast.

• Can be isolated and re-injected in cells.

• Presence can be detected.

• Can be introduced into bacterial cells e.g. E. coli.

• May carry antibiotic resistance genes.

Vectors

Cloning vesicles

TypeI. Plasmid : circular, double

stranded cytoplasmic DNA in procaryotic e.g. PBR 3 of Ecoli.

II. Bacteriophage lambda: a bacterial virus infects bacteria.

III. Cosmids: a large circular cytoplasmic double stranded DNA similar to plasmid.

IV. Yeast Artificial Chromosomes (YAC)

TypeI. Plasmid : circular, double

stranded cytoplasmic DNA in procaryotic e.g. PBR 3 of Ecoli.

II. Bacteriophage lambda: a bacterial virus infects bacteria.

III. Cosmids: a large circular cytoplasmic double stranded DNA similar to plasmid.

IV. Yeast Artificial Chromosomes (YAC)

Types of vectors

Insert size• <5-10 kb.

• Upto 20kb.

• Upto 50kb.

•~100-1000kb.

Cloned or synthetic nucleic acids used for DNA:DNA or DNA:RNA hybridization reactions to hybridize to

DNA of interest. • DNA or RNA.

• cDNA.

• Labeling of probes:• 3H Radioactive• 32P

Cloned or synthetic nucleic acids used for DNA:DNA or DNA:RNA hybridization reactions to hybridize to

DNA of interest. • DNA or RNA.

• cDNA.

• Labeling of probes:• 3H Radioactive• 32P

Probes

Hybridization

DNA cloningDNA cloning

Recombinant DNA Technology

Polymerase chain reaction

Amplification of DNA Study of DNA structureand functions

DGGEDGGE

RT PCRRT PCR

Dot blot analysisDot blot analysis

ARMSARMS

DNA sequencingDNA sequencing

OthersOthers

Principles of Molecular Cloning

Involves:

• Isolation of DNA sequence of interest.

• Insertion of this DNA in the DNA of an organism that grows rapidly and over extended period e.g. bacteria.

• Growing of the bacteria under appropriate condition.

• Obtaining the pure form of DNA in large quantities for molecular analysis.

Involves:

• Isolation of DNA sequence of interest.

• Insertion of this DNA in the DNA of an organism that grows rapidly and over extended period e.g. bacteria.

• Growing of the bacteria under appropriate condition.

• Obtaining the pure form of DNA in large quantities for molecular analysis.

• Method to amplify a target sequence of DNA or RNA several million folds.

• Developed by Saiki et al in 1985.

• Based on Enzymatic amplification of DNA fragment flanked by primers i.e. short oligonucleotides fragments complimentary to DNA. Synthesis of DNA initiates at the primers.

• Method to amplify a target sequence of DNA or RNA several million folds.

• Developed by Saiki et al in 1985.

• Based on Enzymatic amplification of DNA fragment flanked by primers i.e. short oligonucleotides fragments complimentary to DNA. Synthesis of DNA initiates at the primers.

Polymerase Chain Reaction (PCR)

5’ ATCAGGAATTCATGCCAAGGTTGATCGATGATCGATCGATCGATTGAT 3’ 3’AGCTAGCTAGCT 5’

Primer

Application of PCR

• Diagnosis of genetic disease by amplification of the

gene of interest, followed by detection of mutation.

• Detection of infectious agent e.g. bacteria and viruses.

• DNA sequencing.

• In forensic medicine.

Application of PCR

• Diagnosis of genetic disease by amplification of the

gene of interest, followed by detection of mutation.

• Detection of infectious agent e.g. bacteria and viruses.

• DNA sequencing.

• In forensic medicine.

1. Clinical Chemistry:• Diagnosis of disease e.g. sickle

cell anaemia by Mst II.• Prenatal diagnosis,• Premarital “• Presymptomatic “• Neonatal screening

1. Clinical Chemistry:• Diagnosis of disease e.g. sickle

cell anaemia by Mst II.• Prenatal diagnosis,• Premarital “• Presymptomatic “• Neonatal screening

Application of Recombinant DNA Technology

Southern Blotting

BamHI BglII

14.5Kb

7.0Kb12.5Kb

Pathogenesis of -Thalassaemia

Extract DNA

Treat with BglII

Electrophoresis

Visualize

Withdrawblood

Southern Blotting

2. Human Genetics• Mutations in genes causing hereditary disease e.g.

diagnosis of fibrosis Channes disease.

3. Forensic Medicine• Analysis of stains of blood, semin.

4. Virology• Detection of viral diseases e.g. hepatitis

5. Microbiology• Using specific gene probes for detection of E.coli

6. Cytology, Histology and Pathology• Used in detection of tumor.

7. Synthesis of protein in bacterial• Insulin• GH• Somatostatin• Interferon

8. Transgenic animal production

2. Human Genetics• Mutations in genes causing hereditary disease e.g.

diagnosis of fibrosis Channes disease.

3. Forensic Medicine• Analysis of stains of blood, semin.

4. Virology• Detection of viral diseases e.g. hepatitis

5. Microbiology• Using specific gene probes for detection of E.coli

6. Cytology, Histology and Pathology• Used in detection of tumor.

7. Synthesis of protein in bacterial• Insulin• GH• Somatostatin• Interferon

8. Transgenic animal production

Genetic Counselling

• Genetic disorders:• Chromosomal• Single gene• Multifactorial• Mitochondrial• Acquired somatic

• Only single disorders follow a clearly defined pedigree pattern of inheritance “Mendelian Pattern”.

• During genetic counselling it is essential to establish whether or not the disorder is Mendelian and

to calcualte the precise risk of recurrence.

Genetic Counselling for Mendelian Disorders

Essential Components of Genetic Counselling

History and pedigree

construction

Clinical Examination

Confirmatorydiagnosis

Counseling

Availableoptions

Calculation ofrecurrence risk

Follow-up

- History findings- Clinical examination findings- Radiology findings- Laboratory parameter results- DNA studies results- Others

Recurrence Risk

ETHICAL PRINCIPLESETHICAL

PRINCIPLES

BeneficenceBeneficence

AutonomyAutonomy

JusticeJustice Non-MaleficenceNon-Maleficence

VeracityVeracity

FidelityFidelity

Arabic/Islamic Communities

Unique featuresStrong Religious believes

Combined family Living style

Strong link to traditions and

customs

High rate of Consanguinous

marriages

Possibility of polygamy

Large family sizeReligious

And culturalcohesion

Special views on Reproductive issues

Familyplanning

AbortionIn-vitro

fertilizationAdoption

Artificialinsemination

Fetalrights

• Pattern of transmission judged from family tree. For several diseases the family tree may be

conclusive even if accurate diagnosis is not made.

• For some diseases pedigree pattern is not helpful and only clinical diagnosis is used

• For some disorders the pattern looks complicated and the exact diagnosis cannot be made.

• More common by combination of clinical diagnosis and comparable pedigree pattern.

Establishment of Mendelian Inheritance

Premarital Screening*Man -History

-(Physical Examination) BloodSample

Genetic Screening (Laboratory)

Carrier affected Normal

No Problem from marriage from

any Women

Safe Marriage

**Women –History -(Physical examination)

BloodSample

Genetic Screening (Laboratory)

Carrier affected NormalNo Problem from

marriage from any man

Safe Marriage

Genetic Counseling(advise no marriage with carrier or affected)

Not safe Marriage

Complexities in AD Disorders

1. Late or variable onset of the disease. How old will the family members be, to be certain of not

developing the disease, e.g.• Huntington’s disease, adult onset polycystic kidney

disease, myotonic dystrophy.• For some conditions life tables have been prepared.

2. Lack of penetrance

• Penetrance: - Is the index of the proportion of individuals with the

affected gene who present the disease. - Some disorders show lack of penetrance I.e. biochemical

defect is present, but clinical features are absent, e.g.• Huntington disease – Penetrance decreases with age.• Retinoblastoma: Lack of penetrance unrelated to age.

Complexities in AD Disorders

3. Variation in Expression:

Several AD disorders show variation in clinical expression and hence the disorders cannot be ruled out unless careful examination is carried out.

Mild Moderate Severe expression

*Problems in G.C. since those who reproduce are least severely affected, but may have severely affected childrene.g. Tuberousclerosis, Myotonic dystrophy, Huntingtonsdisease.

*Disease severity may depend on sex of the transmitting parent.

“Anticipation: refers to the state that a genetic disease worsens with successive generation.

Factors underlying variability in AD disordersFactors Effect

• Genomic imprinting Phenotype varies accordingly

• Anticipation due to unstable More severe phenotype in DNA successive generation

• Mosaicism Mild or non-penetran phenotype

• Modifying alleles Influence of unaffected parent

• Somatic mutations also Variable penetrancerequired for presentation(e.g. familial cancers)

• New mutations Sudden appearance of (AD)disorder in normal parent

II. Complexities in AR Disorders• Difficult to confirm as homozygote born to phenotypically normal

(carrier) parents, who may not have an affected relative.• Horizontal transmission ( sudden appearance of a disorder in a generation)

• Diagnosis makes the mode of inheritance certain.

Risk Very lowLow

Problems with AR disorders• Genetic heterogeneity.

• Lack of penetrance and variation in expression are much less.

• If consanguinity present the risk is increased:

(a) Rare disorder increase in the number of effected children due to consanguinity

(c) Extensive consanguinity Appear like AD inheritance (pseudo AD)

Population Risk

Can be calculated from:

• Hardy Weinberg Equilibriump + q = 1 [p2 + q2 = 2pq = 1]

q2 = Abnormal homozygote p2 = Normal

2pq = Heterozygote

e.g. 2 patients of PKU in 10000 screened.

q2 = 2; q = 0.0002 = 0.014

p = 1 – q = 0.986

(hetero)2pq = 0.0276

Risk of transmitting an AR disorder in relation to disease incidences (the spouse is healthy)

Disease Gene Carrier Risk for Risk for

frequency frequency frequency offspring offspring(q2)/10000 (q) (%) =2pq(%) homo. (%) healthy

(affected sib) sib

100 10.1 18.0 9.0 3.0 50 7.1 13.2 6.6 2.2 20 4.5 8.6 4.3 1.4 10 3.3 6.2 3.1 1.0 8 2.8 5.4 2.7 0.9 6 2.4 4.7 2.3 0.78 5 2.2 4.3 2.1 0.72 4 2.0 3.9 2.0 0.65 2 1.4 2.8 1.4 0.46 1 1.0 2.0 1.0 0.33

0.5 0.71 1.4 0.7 0.23 0.1 0.32 0.64 0.32 0.110.05 0.22 0.44 0.22 0.070.01 0.10 0.2 0.10 0.03

X-Linked Disorders

• Occupy a prominent place in genetic counselling.

• >100 X-linked disorders recognised.

• Majority XR; some dominant (often lethal in hemizygous male).

• X-chromosomes inactivation (lyonns phenomenon). applies to almost all human X-chromosomes.

Recognition of X-Linkage

• No male-to-male transmission.• Affected male All daughters carriers (XR).

All daughters affected (XD).• Unaffected males never transmit disease to either sex.• A definite carrier women risk ½ sons affected.• Carrier women ½ daughters carrier (XR)

½ daughters affected (XD).

• Homozygous affected women are few affected male are much more.

These guidelines will cover most genetic counseling problems.

Mitochondrial Inheritance

• No transmission in descendents of males, affected or not.

• Both sexes may be affected.

• Females may be symptomless carriers.

• All daughters of an affected or carrier female are at risk of transmitting the disorders or of becoming affected.

• All sons may become affected, but do not transmit it to their children

Degree of Relationship to patients Proportion of gene shared

• First degree……………………………………. 1/4• Sibs (brothers & sisters)• Dizygotic twins• Parents• Child

• Second degree …….. ………………………….. 1/4 • Half sibs• Uncles, aunts• Nephew, nieces• Double first cousins

• Third degree: ……………………………………. 1/8 • First cousins• Half uncles, aunts• half nephew, nieces

Gene Chance Degree of

Relation shared of Homo.

Monozygotic twin - 1 -

Dizytotic twin 1st 1/2 1/4

Sibs 1st 1/2 1/4

Uncle-nephew (aunt-niece) 2nd 1/4 1/8

Half-sibs 2nd 1/4 1/8

Double 1st cousin 2nd 1/4 1/8

First cousin 3rd 1/8 1/16

Consanguinity

• Only relevant to genetic risks if it involves both parental lives not just one.

Consanguinity relevant Not relevant

• The rarer the disorder the higher the proportion of affected individuals from consanguineous marriages.

• Consanguinity must be seen in the context of particular community. An apparent relationship of a particular disorder is much less certain if 30% cousin marriages, compared to non-consanguineous mating.

• Extensive consanguinity (AR) appears like AD.

medical genetics "genetics" fields: heredity and its variation. subfields: - "human...

study of genetics

human genetics

biochemical genetics

genetics fields

population genetics

contd slide

brief history of genetics

different genes

Documents

unit 6: genetics & heredity ch 8: heredity & ch 11: human...

genetics is study of - karnataka · 2013-04-02 · genetics...

genetics and heredity

genetics genetics is the scientific study of heredity and...

unit-vii chapter-8 heredity and variation ug... · 386...

genetics genetics. what is genetics ? genetics is the study...

heredity and genetics

genetics is the science of genes, heredity, and variation in...

genetics. mendelian genetics genetics – the branch of...

heredity & genetics

genetics genetics genetics- the scientific study of...

genetics and heredity. history genetics is the scientific...

genetics. 11.1 – gregor mendel heredity inheritance of...

genetics transmission of traits – heredity variation...

a’s of genetics - model high...

genetics & heredity

aquaculture: genetics dr. craig kasper fas 1012. genetics:...

genetics. genetics is the study and understanding of the...

genetics & heredity

genetics, heredity, and biotechnology unit 5. genetic...