mendelian and modern genetics vocabulary alleles: dominant: gene: genetics: genotype: ...

MENDELIAN AND modern genetics

Vocabulary

Alleles:Dominant:Gene:Genetics:Genotype:Heterozygous:Homozygous:Incomplete Dominance:Phenotype:Recessive:

What is genetics?•The study of heredity.

•Transferring information from 1 generation to the next.

Who is Gregor Mendel?1. A monk, gardener, scientist – 19th century

2. Conducted experiments of heredity using pea plants

3. Developed the principles of dominance, segregation, independent assortment

More about Gregor Mendel…..

4. He really loved math and statistics (you may ask yourself why??!!)

5. Mendel began to notice a pattern in his pea plants.

•In each generation some of the plants looked like the others, but some were different! (hmmm…)

•He came up with the laws of genetics.

Why use pea plants?•Easy to grow •Mature quickly

•Lots of offspring •Only 2 alleles/gene

What did he do first?

•Carried out a controlled, scientific study.

Seed Shape

Flower Position

Seed CoatColor

Seed Color

Pod Color

Plant Height

PodShape

Round

Wrinkled

Round

Yellow

Green

Gray

White

Smooth

Constricted

Green

Yellow

Axial

Terminal

Tall

Short

Yellow Gray

Smooth Green Axial Tall

POSSIBLE PEA PLANT ALLELES

Mendel’s Hypothesis

• There are alternative forms of the same gene; alleles

• Each organism has 2 alleles for each trait one from each parent; heterozygous and homozygous

• Dominant alleles can mask the expression of the “lesser” allele; dominant and recessive

• Alleles segregate during gametogenesis. Each gamete has only 1 allele; law of segregation

How many copies of each gene?

•2 -- 1 gene from mom & 1 gene from dad

Then what is an allele?

•The trait (characteristic) found on a gene.

Where do they come from?

•1 gene from mom & 1 gene from dad

2 alleles for color in pea plants:

2 alleles for height in pea plants:

•Green = G

•yellow = g

•Tall = T

•short = t

What does dominant mean?

What does recessive mean?

•One allele is more powerful than the other.

•TT or Tt

•One allele is overpowered by the other.

•tt

What does homozygous mean?

•Both alleles from the parents are the same.

Either: TT or tt

•The alleles from the parents are different.

Tt

What does heterozygous mean?

What is genotype?•The genetic makeup of an individual.

•The “letters” (ex: TT, Tt, tt)

What is phenotype?•The physical makeup of an individual.

•The description (ex: Tall or Short)

Name some possible genotypes and phenotypes for the height of a pea plant:

Genotype Phenotype

TT

Tt

tt

Tall

Tall

short

Mendel’s law of dominance:The dominant trait overpowers the recessive.

Law of Segregation and Recombination:

Mendel explained that “factors” which occur in pairs are separated from each other during gamete formation and recombined at fertilization.

Law of Independent Assortment:Mendel concluded that different traits are inherited independently of one another (genes for different traits are separated & distributed to gametes independently of one another when they are on different chromosomes).

B

b

b

B

Phenotypes:

% Brown

% whiteGenotypes:

% BB

% Bb

% bb

What will be the percentage of Phenotypes?

What will be the percentage of Genotypes?

ANSWER: Phenotypes:

75% Brown

25% whiteGenotypes:

25% BB

50% Bb

25% bb

B B B b

B b b b

B

b

b

B

What is a test cross?•Used to find out the genotype of an unknown individual.•Ex: a black dog—is it pure or hybrid?

BB or Bb? (B=Black b=brown)

What is incomplete dominance?•AKA Intermediate Inheritance•The result is a blending of traits.

What is codominance?•Both alleles are equally dominant

•The result is a streaking affect.

Test Cross:Consider a phenotypically tall organism. What is it’s genotype? Is it TT or Tt? To answer this question, you would do a test cross:

definition:

*By observing the phenotypes of the offspring, we can trace back to the genotype of the parent:

If the genotype If the genotype of the parent was of the parent washomozygous (TT), heterozygous (Tt),

all the offspring are tall: 50% of the offspring

are tall and 50% are short:

when an organism showing the dominant trait is crossed with a pure recessive to determine if that dominant organism is homozygous or heterozygous

TtTt TtTt

TtTt TtTt

TtTt tttt

TtTt tttt

T T

T t

t

t

t

t

What are multiple alleles?•When there are more than 2 alleles for a gene in an entire population.

•Ex: hair color, eye color, blood type

AllelesABO

Multiple Alleles:~when there are more than 2 (“multiple”) alleles

for a trait~example: Human blood groups

have 3 alleles: IA where I is dominantIB and i is recessivei

~the possible combinations of these 3 blood alleles are as follows:

Blood type genotypePhenotype

A

B

AB

O

IAIA or IAi

IBIB or IBi

IAIB

ii

Polygenic Inheritance•Poly = “Many”

• More than one gene influences a single trait

•Genic = “Genes”

• Ex) Height & skin color

Does the environment influence the expression of a phenotype?

1. Available Nutrition• Affects growth & health

2. Exercise / Activity• Affects growth & health

3. Temperature• Affects many characteristics

• Skin color, health, etc

Mendel’s Principles

Meiosis explains Mendel’s principles

• Genes are located on chromosomes

• The behavior of chromosomes during meiosis & fertilization explains inheritance patterns

Chromosome Theory of Inheritance

What is gene linkage?•When 2 genes are found on the same chromosome. (Genes A-E are linked)

What does this tell you about inheritance of traits A & E?

Crossing over

To recombine the alleles when the genes are far apart

The exchange of genetic material between homologous chromosomes

How is gender determined?•It is a 50/50 chance to get a boy or a girl

Girls = XX Boys = XY

XX x XY

Mom x Dad

Punnett Squares Gender Determination

Sex Determination:~there are 2 types of chromosomes: sex chromosomes (1 pair)

autosomes (all other pairs)

~in each diploid human cell this looks like: sex chromosomes 1 pair autosomes 22 pairs

23 homologous pairs or _____chromosomes~The genotype XX represents a _______________

~The genotype XY represents a _______________

~The sex of an individual is determined by the _______________ at the time of________________________.

~The human egg contains only ______ chromosomes while the human sperm can contain either ______ or _______ chromosomes.

XXXX XXXX

XYXY XYXY

X X

X

Y

Every time a man and woman have a child there is a ________ chance it will be a boy or girl.

50 / 50

46female

male

spermfertilization

XX Y

Sex Linkage:~sex-linked traits are caused by genes found on the X chromosome~sex-linked traits are recessive~since they are recessive, fewer females are afflicted with these traits because they have another X chromosome which is dominantly normal. Males have only one X chromosome so when they have a sex-linked gene, they’ll display the trait.~the genotype of a sex-linked trait is represented as_________~females with one gene for the trait ( X X ) are called_____________~examples of sex-linked traits: hemophilia, color- blindness

X or X (can also be represented as Xh, where h is the trait)

carriers

Pedigree charts: used to show he presence or absence of a certain trait in families through

several generations.**they’re kind of like a “genetic family tree”

Bb

bbbb

BbBb

bb

Bb

Monohybrid Cross

What is a hybrid? Offspring of parents that have different forms of a trait- ex). Tall and short.

Dihybrid Cross- cross with two traits

Modern Genetics

• Name some foods that you eat.

• How many of them do you think are genetically altered?

How is Genetics used in everyday life?

(not in notes)

Not in notes

Genetically Modified Foods

What are the Benefits?

What are the Risks?

Believe It or Not,

YOU are the generationthat will decide

how to use this technology!!!!

Genome

Is the complete set of genetic material in an organism- the order of the bases in the DNA

Can fit into the nucleus of a single cell because of the “packing system”

The Human Genome ProjectThe Human Genome Project

• Mapping the sequence of nucleotides…• ACCGTTTAACCGTATAGGACCACT…• for the entire amount of DNA in our cells

• This info is then entered into a computer database

• Researchers then compare the data to find genes, evolutionary links, and more

Recombinant DNA

• Combines genes from different sources into a single DNA molecule

Examples:1. Bacteria that could clean up oil spills or toxic waste sites2. Vaccine production3. Insulin production – Pure human form 4. Gene cloning 5. Genetically modified plants and animals

Why is this useful?• Organisms can be modified to produce

products that benefit everyone

Biotechnology• The use of organisms to perform practical tasks for

humans- to analyze and manipulate the genomes of organisms

Plasmids• A small circular DNA molecule separate from the much

larger bacterial chromosome.

Plasmids – BIG DEAL• What can they be used for?

Restriction Enzymes• These are tools used to “cut” DNA in specific locations

AAAATTCCGAGACGAATTCAATACGAATTCGGGTTAAACCCCCGAATTCGGGCCTCA

• How many times do you see GAATTC?

• Draw a line between the G&A (in these sections)

• So how many sections of DNA do you have now?

The Good With the Bad

The manipulation of DNA allows scientists to do some interesting things.

**Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms.

Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey.

1. **Transgenic animals are often used in research.

• What might be the benefit to medical research of a mouse whose immune system is genetically altered to mimic some aspect of the human immune system?

2. **Transgenic plants and animals may have increased value as food sources.

• What might happen to native species if transgenic animals or plants were released into the wild?

Nucleic Acid Probe• A complimentary strand of DNA that has been radioactively labeled

Let’s say we want to find the sequence TAGGCT

What is it How is it done When?

Plants

Animals

Animal Cloning

To improve the characteristics of the plants

Use of plasmids from the soil to introduce new genes

•To delay ripening•Improved nutritional content•Resistance to spoilage or disease

Same as plants- better quality “wool”Or to mature in a shorter time

•Extract an egg cell•Sperm fertilizes the egg•Desired gene is injected into the fertilized egg

•To make vaccines•Growth hormones

Entire genomes can be cloned

“Dolly”

The nucleus from a single cell replaces the nucleus of an unfertilized egg from another animal- the egg develops into an animal that has the same genome as the nuclear donor

Cloning can offer the potential to mass produce an animal

Polymerase Chain Reaction (PCR)

•A method for amplifying a DNA base sequence.

•The newly synthesized DNA strands can serve as templates for making more DNA—amplifying the desired sequence.

How?

When?

Can detect viral genes infected with the virus that causes AIDS

PCR

**Genetic Markers- particular stretches of DNA that are variable among individuals

Ex.) DNA fragments that include certain disease alleles have distinct genetic markers

**DNA fingerprinting- a particular banding pattern produced by your restriction fragments

- Unless you have an identical twin, it is unlikely to have the exact same fingerprint

Gel Electrophoresis

• A method of separating large molecules (such as DNA fragments or proteins).

How?

• An electric current is passed through a medium containing the mixture

• Each kind of molecule travels through the medium at a different rate, depending on its electrical charge and size.

• Separation is based on these differences.

DNA plus restriction enzyme

Mixture of DNA fragments

Power source

Longer fragments

Shorter fragments

Gel Electrophoresis

Gel

Stem cells

•-Cells with the potential to “turn into” an undifferentiated cells

•-Have the potential into various types of cells

DNA Sequencing•Any lab technique used to find out the sequence of nucleotide bases in a DNA molecule or fragment.

Fluorescent dye Single strand of DNA

Strand broken after A

Strand broken after C

Strand broken after G

Strand broken after T

Power source

Gel

DNA Sequencing

Go to Section:

Gene Therapy

•The process of introducing new genes into the DNA of a person's cells to correct a genetic disease or flaw

Section 13-3

Making Recombinant DNA

Human Cell

Gene for human growth hormone

Recombinant DNA

Gene for human growth hormone

Sticky ends

DNA recombination

DNA insertion

Bacterial Cell

Plasmid

Bacterial chromosome

Bacterial cell containing gene for human growth hormone

Go to Section:

CloningFlowchart

A body cell is taken from a donor animal.

An egg cell is taken from a donor animal.

The fused cell begins dividing, becoming an embryo.

The nucleus is removed from the egg.

The body cell and egg are fused by electric shock.

The embryo is implanted into the uterus of a foster mother.

The embryo develops into a cloned animal.

A donor cell is taken from a sheep’s udder.

Donor Nucleus These two

cells are fused using an electric shock.

Fused Cell

The fused cell begins dividing normally.

Embryo

The embryo is placed in the uterus of a foster mother.

Foster Mother

The embryo develops normally into a lamb—Dolly

Cloned Lamb

Egg Cell

An egg cell is taken from an adult female sheep.

The nucleus of the egg cell is removed.

Cloning of the First Mammal

Go to Section: