mit open science talk

building the research web

john wilbanks13 november 2007

open science and open publishingmit csail

science commons:

explicit contractual rights, granted in advance, to use and re-use knowledge (papers, tools, data)

readable by non-lawyers and machines

proto-infrastructure for knowledge sharing

technical platform: semantic web

most of what is known is thrown away(cognitive problem)

most of what is known is poorly fitted for use and reuse by machines and so+ware

(design problem)

most of what is known is poorly licensed for redesign and reuse by machines and so+ware

(legal problem)

very few research materials are actually available (social problem)

based on what’s been published in journals and databases, what signal transduction genes might be

active in pyramidal neurons?

what you get

DRD1, 1812 adenylate cyclase activationADRB2, 154 adenylate cyclase activationADRB2, 154 arrestin mediated desensitization of G-protein coupled receptor protein signaling pathwayDRD1IP, 50632 dopamine receptor signaling pathwayDRD1, 1812 dopamine receptor, adenylate cyclase activating pathwayDRD2, 1813 dopamine receptor, adenylate cyclase inhibiting pathwayGRM7, 2917 G-protein coupled receptor protein signaling pathwayGNG3, 2785 G-protein coupled receptor protein signaling pathwayGNG12, 55970 G-protein coupled receptor protein signaling pathwayDRD2, 1813 G-protein coupled receptor protein signaling pathwayADRB2, 154 G-protein coupled receptor protein signaling pathwayCALM3, 808 G-protein coupled receptor protein signaling pathwayHTR2A, 3356 G-protein coupled receptor protein signaling pathwayDRD1, 1812 G-protein signaling, coupled to cyclic nucleotide second messengerSSTR5, 6755 G-protein signaling, coupled to cyclic nucleotide second messengerMTNR1A, 4543 G-protein signaling, coupled to cyclic nucleotide second messengerCNR2, 1269 G-protein signaling, coupled to cyclic nucleotide second messengerHTR6, 3362 G-protein signaling, coupled to cyclic nucleotide second messengerGRIK2, 2898 glutamate signaling pathwayGRIN1, 2902 glutamate signaling pathwayGRIN2A, 2903 glutamate signaling pathwayGRIN2B, 2904 glutamate signaling pathwayADAM10, 102 integrin-mediated signaling pathwayGRM7, 2917 negative regulation of adenylate cyclase activityLRP1, 4035 negative regulation of Wnt receptor signaling pathwayADAM10, 102 Notch receptor processingASCL1, 429 Notch signaling pathwayHTR2A, 3356 serotonin receptor signaling pathwayADRB2, 154 transmembrane receptor protein tyrosine kinase activation (dimerization)PTPRG, 5793 transmembrane receptor protein tyrosine kinase signaling pathwayEPHA4, 2043 transmembrane receptor protein tyrosine kinase signaling pathwayNRTN, 4902 transmembrane receptor protein tyrosine kinase signaling pathwayCTNND1, 1500 Wnt receptor signaling pathway`

what you want

and if you want the tools associated with those genes?

cell lines?plasmids?reagents?

methods and protocols?unpublished data sets?

Open Access Content

Open SourceKnowledge Management

Open AccessResearch Tools

the research web

old collaboration:

reading the canon on paperquerying single-access databases

human as mediatorartisanal tool manufacturingtightly controlled distribution

new collaboration:

reading the canon with machinesintegrating databasescomputer as mediator

industrial tool manufacturingstandardized distribution

Open Access Content

the research web

legal framework for research: the paper metaphor

(ownership and access)

“Therefore, learned man, without wishing to be inopportune, I beg you most emphatically to communicate your discovery to the learned world”

Letter to Copernicus, 1 November 1536Archbishop of Capua Nikolaus Cardinal von Schönberg

copyrights allow ownership of papers by the nature of the medium, not the nature of the work

the nature of the work is profoundly integrative: one set of facts per “paper” are connected to elements of

knowledge throughout science

http://orpheus-1.ucsd.edu/acq/license/cdlelsevier2004.pdf

“By open access to the literature, we mean its free availability on the public internet, permitting users to read, download, copy, distribute, print, search, or link

to the full texts of these articles, crawl them for indexing, pass them as data to so+ware, or use them for any other lawful purpose, without financial, legal

or technical barriers other than those inseparable from gaining access to the internet itself.”

image from the public library of sciencelicensed to the public under CC-BY 3.0

“The only constraint on reproduction and distribution, and the only role for copyright in this domain, should be to give authors control over the integrity of their work and the right to be properly

acknowledged and cited” - the Budapest Open Access Initiative

image from the public library of sciencelicensed to the public under CC-BY 3.0

<License rdf:about="http://creativecommons.org/licenses/by/3.0/"> <permits rdf:resource="http://creativecommons.org/ns#Reproduction" /> <permits rdf:resource="http://creativecommons.org/ns#Distribution" /> <permits rdf:resource="http://creativecommons.org/ns#DerivativeWorks" /> <requires rdf:resource="http://creativecommons.org/ns#Notice" /> <requires rdf:resource="http://creativecommons.org/ns#Attribution" /> </License>

creates another dimension for search:

“find me stuff I know I have the right to use”

cc:license

FLOSS:License

GNU/LINUX

cc:license

a commons for data: create zones of certainty

“freedom to integrate”

no quid pro quo

Open AccessResearch Tools

the research web

legal framework for research: the artisanal metaphor

(pre-industrial culture of tool-making)

Alzheimer’sDisease

Huntington’sDisease

MultipleSclerosis

Autism

research silos: same genes, same cells, same brain

Alzheimer’sDisease

Huntington’sDisease

MultipleSclerosis

Autism

bilateral contracts and deals

Alzheimer’sDisease

Huntington’sDisease

MultipleSclerosis

Autism

“one to many” offers / networks

Provider Lab

Depository

Recipient Lab

MTA

deposittracking

fulfillment

searching / ordering

industrial tool manufacture and distribution

cc:license

apply these methods to physical materials as well:available via standard, one-click contracts

discoverable by digital identifiersfulfilled by third parties to the transactionacknowledged by citation-inspired systems

usage modes:

A) public offer (one-to-many)

B) private negotiation (eliminate inherent disadvantages in expertise)

thanks to the metadata, efficient to discover resources:while reading papers

while browsing databases

Open SourceKnowledge Management

the research web

technical framework for research: the “one database per child” metaphor

(it depends on what the meaning of “gene” is)

27,266 papers

4,563 papers

41,985 papers

10,365 papers

128,437 papers

“knowledge = product”is causing systemic failures to exploit opportunities

afforded by the network

27,266 papers

4,563 papers

41,985 papers

10,365 papers

128,437 papers

“knowledge = network” better reflects the reality of knowledge

“find me genes involved in

signal transduction

that are related to pyramidal

neurons”

gp145trkB does not require p75LNGFR to form a functional receptor for BDNF in hippocampal pyramidal neurons

gp145trkB does not require p75LNGFR to form a functional receptor for BDNF in hippocampal pyramidal neurons

is this a creative expression or a forced move?

NeuronDBBAMS

Literature

Homologene

SWAN

Entrez Gene

Gene Ontology

Mammalian Phenotype

PDSPki

BrainPharm

AlzGene

Antibodies

PubChem

MESH

Reactome

Allen Brain Atlas

slide derived from W3C HCLS

Drug

NeuronPathological

Agent

Receptor

Channel

inhibitsinhibits

Agent

NeuronalProperty

PathologicalChange

involvesinvolves inhibits

Compartment

has

is_located_in

is_located_in

slide courtesy of kei chung, yale

NeuronDB

BAMS

Literature

Homologene

SWAN

Entrez Gene

Gene Ontology

Mammalian Phenotype

PDSPki

BrainPharm

AlzGene

Antibodies

PubChem

MESH

Reactome

Allen Brain Atlas

slide courtesy of W3C HCLS

prefix go: <http://purl.org/obo/owl/GO#>prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#>

prefix owl: <http://www.w3.org/2002/07/owl#>prefix mesh: <http://purl.org/commons/record/mesh/>

prefix sc: <http://purl.org/science/owl/sciencecommons/>prefix ro: <http://www.obofoundry.org/ro/ro.owl#>

select ?genename ?processnamewhere

{ graph <http://purl.org/commons/hcls/pubmesh> { ?paper ?p mesh:D017966 .

?article sc:identified_by_pmid ?paper. ?gene sc:describes_gene_or_gene_product_mentioned_by ?article.

} graph <http://purl.org/commons/hcls/goa>

{ ?protein rdfs:subClassOf ?res. ?res owl:onProperty ro:has_function.

?res owl:someValuesFrom ?res2. ?res2 owl:onProperty ro:realized_as.

?res2 owl:someValuesFrom ?process. graph <http://purl.org/commons/hcls/20070416/classrelations>

{{?process <http://purl.org/obo/owl/obo#part_of> go:GO_0007166} union

{?process rdfs:subClassOf go:GO_0007166 }} ?protein rdfs:subClassOf ?parent.

?parent owl:equivalentClass ?res3. ?res3 owl:hasValue ?gene.

} graph <http://purl.org/commons/hcls/gene>

{ ?gene rdfs:label ?genename } graph <http://purl.org/commons/hcls/20070416>

{ ?process rdfs:label ?processname}}

Mesh: Pyramidal Neurons

Pubmed: Journal Articles

Entrez Gene: Genes

GO: Signal Transduction

running code

Many of the genes are indeed related to Alzheimer’s Disease through gamma

secretase (presenilin) activity

DRD1, 1812 adenylate cyclase activationADRB2, 154 adenylate cyclase activationADRB2, 154 arrestin mediated desensitization of G-protein coupled receptor protein signaling pathwayDRD1IP, 50632 dopamine receptor signaling pathwayDRD1, 1812 dopamine receptor, adenylate cyclase activating pathwayDRD2, 1813 dopamine receptor, adenylate cyclase inhibiting pathwayGRM7, 2917 G-protein coupled receptor protein signaling pathwayGNG3, 2785 G-protein coupled receptor protein signaling pathwayGNG12, 55970 G-protein coupled receptor protein signaling pathwayDRD2, 1813 G-protein coupled receptor protein signaling pathwayADRB2, 154 G-protein coupled receptor protein signaling pathwayCALM3, 808 G-protein coupled receptor protein signaling pathwayHTR2A, 3356 G-protein coupled receptor protein signaling pathwayDRD1, 1812 G-protein signaling, coupled to cyclic nucleotide second messengerSSTR5, 6755 G-protein signaling, coupled to cyclic nucleotide second messengerMTNR1A, 4543 G-protein signaling, coupled to cyclic nucleotide second messengerCNR2, 1269 G-protein signaling, coupled to cyclic nucleotide second messengerHTR6, 3362 G-protein signaling, coupled to cyclic nucleotide second messengerGRIK2, 2898 glutamate signaling pathwayGRIN1, 2902 glutamate signaling pathwayGRIN2A, 2903 glutamate signaling pathwayGRIN2B, 2904 glutamate signaling pathwayADAM10, 102 integrin-mediated signaling pathwayGRM7, 2917 negative regulation of adenylate cyclase activityLRP1, 4035 negative regulation of Wnt receptor signaling pathwayADAM10, 102 Notch receptor processingASCL1, 429 Notch signaling pathwayHTR2A, 3356 serotonin receptor signaling pathwayADRB2, 154 transmembrane receptor protein tyrosine kinase activation (dimerization)PTPRG, 5793 transmembrane receptor protein tyrosine kinase signaling pathwayEPHA4, 2043 transmembrane receptor protein tyrosine kinase signaling pathwayNRTN, 4902 transmembrane receptor protein tyrosine kinase signaling pathwayCTNND1, 1500 Wnt receptor signaling pathway`

http://hcls1.csail.mit.edu:8890/sparql/?query=prefix%20go%3A%20%3Chttp%3A%2F%2Fpurl.org%2Fobo%2Fowl%2FGO%23%3E%0Aprefix%20rdfs%3A%20%3Chttp%3A%2F%2Fwww.w3.org%2F2000%2F01%2Frdf-schema%23%3E%0Aprefix%20owl%3A%20%3Chttp%3A%2F%2Fwww.w3.org%2F2002%2F07%2Fowl%23%3E%0Aprefix%20mesh%3A%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Frecord%2Fmesh%2F%3E%0Aprefix%20sc%3A%20%3Chttp%3A%2F%2Fpurl.org%2Fscience%2Fowl%2Fsciencecommons%2F%3E%0Aprefix%20ro%3A%20%3Chttp%3A%2F%2Fwww.obofoundry.org%2Fro%2Fro.owl%23%3E%0A%0Aselect%20%3Fgenename%20%3Fprocessname%0Awhere%0A%7B%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2Fpubmesh%3E%0A%20%20%20%20%20%7B%20%3Fpaper%20%3Fp%20mesh%3AD017966%20.%0A%20%20%20%20%20%20%20%3Farticle%20sc%3Aidentified_by_pmid%20%3Fpaper.%0A%20%20%20%20%20%20%20%3Fgene%20sc%3Adescribes_gene_or_gene_product_mentioned_by%20%3Farticle.%0A%20%20%20%20%20%7D%0A%20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2Fgoa%3E%0A%20%20%20%20%20%7B%20%3Fprotein%20rdfs%3AsubClassOf%20%3Fres.%0A%20%20%20%20%20%20%20%3Fres%20owl%3AonProperty%20ro%3Ahas_function.%0A%20%20%20%20%20%20%20%3Fres%20owl%3AsomeValuesFrom%20%3Fres2.%0A%20%20%20%20%20%20%20%3Fres2%20owl%3AonProperty%20ro%3Arealized_as.%0A%20%20%20%20%20%20%20%3Fres2%20owl%3AsomeValuesFrom%20%3Fprocess.%0A%20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2F20070416%2Fclassrelations%3E%0A%20%20%20%20%20%7B%7B%3Fprocess%20%3Chttp%3A%2F%2Fpurl.org%2Fobo%2Fowl%2Fobo%23part_of%3E%20go%3AGO_0007166%7D%0A%20%20%20%20%20%20%20union%0A%20%20%20%20%20%20%7B%3Fprocess%20rdfs%3AsubClassOf%20go%3AGO_0007166%20%7D%7D%0A%20%20%20%20%20%20%20%3Fprotein%20rdfs%3AsubClassOf%20%3Fparent.%0A%20%20%20%20%20%20%20%3Fparent%20owl%3AequivalentClass%20%3Fres3.%0A%20%20%20%20%20%20%20%3Fres3%20owl%3AhasValue%20%3Fgene.%0A%20%20%20%20%20%20%7D%0A%20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2Fgene%3E%0A%20%20%20%20%20%7B%20%3Fgene%20rdfs%3Alabel%20%3Fgenename%20%7D%0A%20%20%20graph%20%3Chttp%3A%2F%2Fpurl.org%2Fcommons%2Fhcls%2F20070416%3E%0A%20%20%20%20%20%7B%20%3Fprocess%20rdfs%3Alabel%20%3Fprocessname%7D%0A%7D&format=&maxrows=50

prefix go: <http://purl.org/obo/owl/GO#>prefix rdfs: <http://www.w3.org/2000/01/rdf-schema#>

prefix owl: <http://www.w3.org/2002/07/owl#>prefix mesh: <http://purl.org/commons/record/mesh/>

prefix sc: <http://purl.org/science/owl/sciencecommons/>prefix ro: <http://www.obofoundry.org/ro/ro.owl#>

select ?genename ?processnamewhere

{ graph <http://purl.org/commons/hcls/pubmesh> { ?paper ?p mesh:D009369 . ?article sc:identified_by_pmid ?paper.

?gene sc:describes_gene_or_gene_product_mentioned_by ?article. }

graph <http://purl.org/commons/hcls/goa> { ?protein rdfs:subClassOf ?res.

?res owl:onProperty ro:has_function. ?res owl:someValuesFrom ?res2.

?res2 owl:onProperty ro:realized_as. ?res2 owl:someValuesFrom ?process.

graph <http://purl.org/commons/hcls/20070416/classrelations> {{?process <http://purl.org/obo/owl/obo#part_of> go:GO_0007166}

union {?process rdfs:subClassOf go:GO_0006610 }}

?protein rdfs:subClassOf ?parent. ?parent owl:equivalentClass ?res3.

?res3 owl:hasValue ?gene. }

graph <http://purl.org/commons/hcls/gene> { ?gene rdfs:label ?genename }

graph <http://purl.org/commons/hcls/20070416> { ?process rdfs:label ?processname}

}

the “view source” effect

building on a commons means “snap together” integration of the tools, data, and literature

fragile

existing infrastructure must stay openfreedom to access the canonfreedom to build the tools

new infrastructure must persistagreements on names and meanings

open names and meanings

Open Access Content

Open SourceKnowledge Management

Open AccessResearch Tools

the research web

“design for re-use”

“follow the rule of least power”

“you! in the lab! start innovating!”

use the commons as the backbone of the research web:

1)evaluate what you believe against what is online2) low-friction access to what is needed for further work

use the commons as a method for integrating emerging and disruptive technologies into the research web

atgaccatgattacgccaagcgcgcaattaaccctcactaaagggaacaaaagctggagctccaccgcggtggcggcagcactagagctagtggatcccccgggctgtagaaattcgatatcaagcttatcgataccgtcgacctcgagggggggcccggtacccaattcgccctatagtgagtcgtattacgcgcgctcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaataataa

codon devices

if we can’t deal with the data we create in a classic drug discovery context, how will we deal with the

data that comes from user-generated biology?

retail: $79.95 + shippingages ten and up

thank you

wilbanks@creativecommons.orghttp://sciencecommons.org

Investors and support: MacArthur FoundationKauffman Foundation

MIT CSAILHighQ FoundationOmidyar Network

Teranode Corporationanonymous charitable foundations

in-kind supporters

MTA:iBridge Network

AddgeneStrainInfo.net

Cure Huntington’s Disease InitiativeEmory University

City of Hope Hospital

Open Access:SPARC/Ass’n of Research Libraries

Carnegie-Mellon UniversityMIT

Public Library of ScienceBioMed Central

Nature PrecedingsSpringer Author Choice

Global Biodiversity Information FacilityCODATA

Neurocommons:W3C HCLS

Millennium Pharmaceuticals (so+ware and curated content)

Virtuoso So+wareHewlett-Packard

acknowledgments