non-mutated regulators of cancer growth in basal-like breast cancer and transformed colon
Post on 11-Sep-2021
2 Views
Preview:
TRANSCRIPT
i
Non-mutated Regulators of Cancer Growth in Basal-like Breast Cancer and Transformed
Colon Cells
by
Anwesha Ghosh
Submitted in Partial Fulfillment of the
Requirements for the Degree
Doctor of Philosophy
Supervised by
Dr. Helene R. McMurray, PhD
Department of Biology
Arts, Sciences and Engineering
School of Arts and Sciences
University of Rochester
Rochester, New York
2015
ii
Dedication
This thesis is dedicated to my late grandmother, Mrs. Bharati Sen, who taught me to go out there
and search for the truth.
iii
Biographical Sketch
The author was born in Kolkata, India, on February 16, 1988. She attended Heritage
Institute of Technology, under the West Bengal University of Technology (India), and graduated
with the Bachelor of Technology degree in Biotechnology in 2010. She came to the University of
Rochester, Rochester NY (USA) in the Fall of 2010 and began graduate studies in the Department
of Biology. She received her Master of Science degree in Biology from University of Rochester
in 2012. She has worked as teaching assistant at the Department of Biology from 2010 to 2015.
She pursued her research on the genetics and signaling biology of cancer under the guidance of
Dr. Helene R. McMurray.
iv
Acknowledgements
I owe the deepest gratitude to my advisor, Dr. Helene McMurray, who has been a true mentor
for me in the process of learning how to pursue science. She has been a constant source of
guidance, encouragement and support during the developmental years of my PhD. Alongside
science, she has been a source of inspiration on how to effectively manage time and be a better
communicator.
I am deeply indebted to my committee members: Dr. David Goldfarb, Dr. Matthew Hilton, Dr.
Douglas Portman and Dr. Andrei Seluanov. They have provided constant support and insightful
suggestions that have been invaluable for the progress of my PhD.
I would like to thank Dr. Hartmut “Hucky” Land for his numerous suggestions and invaluable
discussions that I had. I would also like to thank Dr. Craig Jordan for providing crucial support for
the RNA sequencing component of my project. I owe my thanks to Soumyaroop Bhattacharya for
helping me with the analysis of the RNA sequencing results.
A special thanks to Cynthia Landry, Jill van Atta and Daina Bullwinkel for making the grad
school process smoother for me. I also want to thank the past and present members of the lab,
especially Dorothy Heyer, for her constant technical support, Emily Walters, Dr. Pierre Candelaria
and Luca Iorga for their friendship. My special thanks to folks from the neighbouring labs,
especially Aslihan, Brad, Jordan, Mary, Nirmalya, Shweta and Vijaya, for brainstorming sessions,
technical support and personal motivation. I also remember my friends in Rochester and around
the world, who are too numerous to mention and have supported me in their own special ways.
Lastly, I would like to express my eternal gratitude to my parents and my aunt for showering
me with constant love and support and believing in me.
v
Abstract
Cooperation Response Genes (CRGs) are non-mutant regulators of the malignant phenotype
in cancer cells. Distinct sets of CRGs contribute to transformation in different types of cancer, with
accumulating evidence for a set of CRGs regulated by cooperation of mutant p53 and mutant Ras
that are important in multiple epithelial cancers, including transformed colon cells and basal-like
breast cancer (BLBC). Among the CRGs is Notch3, a transmembrane receptor of the Notch family
that regulates cell proliferation and fate specification in multi-cellular organisms. Here, we
demonstrate a cancer-selective role of Notch3 in restricting cell growth of BLBC.
Through genome scale transcriptomic analysis, we discover that there is a cancer-specific
response to activation of Notch3, part of which is required for the cell growth inhibitory role of
Notch3 in BLBC. We specifically identify a novel interaction between Notch and Sfrp2, a known
Wnt pathway antagonist, and show that the genetic interaction is essential for Notch3 to control
BLBC cell growth, concomitant with Sfrp2 dependent changes in expression of cell cycle
regulatory genes.
We also observe that a similar architecture underlies Notch3-mediated growth inhibition in
growth inhibition in the transformed colon cells. Our work elucidates how Notch3 restricts cancer
cell proliferation in transformed colon cells through a genetic interaction between Notch3 and
Sfrp2 that is essential for the cancer-selective growth inhibitory action of Notch3 in transformed
colon cells.
Lastly, we describe a statistical method based on linear regression modeling that refines the
method for identifying CRGs. While 84 of the genes originally identified as CRGs are also
identified by the linear modeling method, twelve new genes are identified as CRGs in the
vi
transformed colon cells. We test the importance of one of the new CRGs, Clca1 and find that
suppressing Clca1 expression causes a significant reduction in tumor formation. Hence the newly
proposed linear modeling method is useful for identifying CRGs critical for tumor formation.
vii
Contributors and Funding Sources
All experiments described in this thesis were performed by the author except for the following:
Chapter II
Figure 2.4: The high throughput RNA sequencing and CuffDiff Analysis was performed by the
UR Functional Genomics Center.
Chapter III
Figure 3.1: Compound perturbations of Sfrp2 knock-down and NIC3 expression in mp53/Ras
cells was performed by Dorothy Heyer and cell count assay was performed by Helene
McMurray.
Chapter IV
Figure 4.3: CRGs were identified by linear modeling and the statistical method was analyzed by
Jesse Llop and Peter Salzman.
Figure 4.4: Comparison of linear modeling with the original synergy score was performed by
Jesse Llop and Peter Salzman.
Funding for the research was provided by the Wilmot Cancer Center and the Breast Cancer
Research Initiative Fund through grants awarded to Dr. Helene R. McMurray.
viii
Table of Contents
Chapter I. General Introduction 1
1.1 Oncogene Cooperation in Cellular Transformation 2
1.2 Approaches to Achieving Cancer Selectivity 8
1.3 Basal-like Breast Cancer 16
1.4 Colorectal Cancer 18
1.5 The Role of Notch Signaling and Wnt Signaling in Cancer 20
1.6 Rationale of the Current Study 24
1.7 Figures 26
Chapter II. Notch3 cancer-selectively controls proliferation via a network of genes
specifically in basal-like breast cancer
28
2.1 Abstract 29
2.2 Introduction 30
2.3 Results 32
2.4 Discussion 39
2.5 Figures 42
Chapter III. Conserved molecular interactions implicated in cancer selective
control of cell growth by Notch3 in mp53/Ras-transformed murine colon cells and
BLBC
56
3.1 Abstract 57
3.2 Introduction 58
ix
3.3 Results 60
3.4 Discussion 63
3.5 Figures 66
Chapter IV. A novel statistical model for identification of synergistically regulated
genes
72
4.1 Abstract 73
4.2 Introduction 74
4.3 Results 77
4.4 Discussion 80
4.5 Figures 82
Chapter V. Discussions 89
5.1 Summary of Findings 90
5.2 Significance of Findings 92
5.3 Future Directions 97
5.4 Conclusions 100
Chapter VI. Materials and Methods 101
6.1 Materials 102
6.1.1 Parental Cell Lines 102
6.1.2 Plasmids 104
6.1.3 shRNA Target Sequences 106
6.1.4 Real-Time PCR Primers 107
6.2 Methods 109
Chapter VII. Appendix 115
x
Bibliography 127
xi
List of Tables
Table 1 Genes responding to Notch3 in Cancer Cells and Their Response in Non-
Cancer Cells According to DESeq Analysis
113
Table 2 Comparison of DESeq, EdgeR and Cuffdiff in fold change and p-value 118
Table 3 Mutation spectrum of BLBC cell lines used in the study 123
xii
List of Figures
Figure 1 Notch3 activation inhibits cell growth in transformed colon cells 26
Figure 2.1 Notch3 restricts proliferation in a cancer-selective manner 42
Figure 2.2 Expression of Notch3 in perturbed BLBC and non-cancerous breast cells 44
Figure 2.3 Induction of Hey/Hes family of genes in response to NIC3 expression in
Cancer Cells and Non-Cancer Cells
46
Figure 2.4 Cancer-specific regulation of gene expression by Notch3 48
Figure 2.5 Comparison of gene expression levels in cancer cells versus non-cancer cells 50
Figure 2.6 Notch3 requires Sfrp2 for cancer-specifically restricting proliferation 52
Figure 2.7 Cancer-specific Notch3 sensitive genes have a hierarchy of interactions 53
Figure 2.8 Notch3 knock-down lowers Sfrp2 expression in BLBC cells 55
Figure 3.1 Notch3 restricts cell growth via induction of Sfrp2 in colon transformed cells 67
Figure 3.2 Notch3 inhibits canonical Wnt pathway gene expression by induction of
Sfrp2
68
Figure 3.3 Sfrp2 induction is insufficient to phenocopy Notch3 activation 70
Figure 4.1 ‘Cooperation Response Genes’, downstream effectors of interaction between
oncogenic mutations
83
Figure 4.2 Examples of synergistic and non-synergistic expression patterns 84
Figure 4.3 Linear modeling synergy coefficient classifies tumor inhibitory genes 85
Figure 4.4 Comparison of linear modeling to the original classifier, synergy score 86
Figure 4.5 Novel CRGs found by linear modeling 87
xiii
Figure 4.6 Knock-down of the newly identified CRG, Clca1, inhibits tumor growth 88
1
Chapter I
General Introduction
2
1.1 Oncogene Cooperation in Cellular Transformation
Cancer cells arise from normal cells as the result of a multistep process involving the
accumulation of multiple oncogenic lesions (Vogelstein and Kinzler, 1993). Such oncogenic
lesions include activating mutations in pro-oncogenic genes and inactivating mutations in tumor
suppressive genes. Examples of pro-oncogenic genes are Ras and Myc. The Ras genes encode for
a family of GTP-binding proteins that act as switches for signaling pathways that regulate cellular
processes like proliferation, differentiation, survival and apoptosis (Giehl, 2005). Oncogenic
mutation of Ras makes the protein independent of GAP binding that typically activates the protein,
so that Ras protein reaches a perpetually “on’ state, causing continuous stimulation of the
downstream signaling (Adjei et al., 2001; Prior et al., 2012). Similarly, the transcription factor,
Myc, lies at the crossroads of multiple growth promoting pathways including Wnt signaling, and
activating mutation in the Myc gene causes the protein to be stabilized and avoid degradation,
causing aberrant signaling (Dang, 2012). Tumor suppressor genes such as p53 typically
accumulate inactivating mutations. P53 is a stress response gene that drives DNA repair, cell cycle
arrest and apoptosis of potentially malignant cells (Ryan et al., 2001). Inactivating mutations in
p53 prevent the protein from binding to DNA and driving these responses (Sigal and Rotter, 2000).
Such mutated oncogenes and tumor suppressors cooperate to transform the cell, leading to
uncontrolled clonal expansion (Pedraza-Farina, 2006).
The evidence that cellular transformation requires cooperation between oncogenic lesions
comes from multiple observations. First of all, cancer is most commonly observed later in life and
the probability of getting cancer increases exponentially with age in both humans and mice
(Armitage and Doll, 1954; Peto et al., 1975; Vogelstein and Kinzler, 1993). Statistical analysis of
epidemiological data from multiple types of cancer suggests that transformation of human cells
3
requires the occurrence of at least 4-6 rate limiting steps (Armitage, 1954). These predictions are
consistent with the various distinct histopathological stages of development of cancers in humans
(Kinzler and Vogelstein, 1996). These rate limiting steps represent accumulation of mutations in
oncogenes and tumor suppressors (Weinberg, 1989; Bishop, 1987). Histological and molecular
analysis of tissues obtained from different stages of transformation show an association between
accumulation of mutations and progression of the malignant disease, with certain mutations
typically associated with a particular stage of the disease (Fearon and Vogelstein, 1990; Kinzler
and Vogelstein, 1996; Vogelstein and Kinzler, 1993; Ingvarsson, 1999; Abate-Shen and Shen,
2000; Bardeesy and DePinho, 2002). For example, in colorectal cancer, mutations in the tumor
suppressor gene APC or proto-oncogene Ras are early events found in premalignant tissues, while
inactivating mutations in the gatekeeper gene p53 are typically found in later stages of malignant
tissues (Fearon and Vogelstein, 1990). More importantly, when premalignant tissues and fully
malignant tissues found within the same tumor are analyzed for mutations, the fully malignant
cells contain the same set of mutations as the premalignant cells, along with a set of novel
mutations additionally acquired (Vogelstein and Kinzler, 1993; Jones et al., 2008).
Moreover, in vitro and in vivo experiments in which combinations of oncogenic mutations
are introduced into different cell types demonstrate that specific combinations of mutations are
sufficient to drive cells into a malignant state. For example, introducing oncogenic Ras causes rat
embryonic fibroblast cells to initially proliferate and then growth arrest in vitro without the ability
to form tumors in immunocompromised mice, whereas activated Myc cooperates with Ras to
transform rat embryonic fibroblast cells, bypassing the growth arrest phenotype (Land et. al, 1983).
Polyoma virus middle-T and Ras transform baby rat kidney cells (Ruley, 1983). Similarly,
combinations of APC and Ras (D’Abaco et al., 1996) and p53 and Ras (Hinds 1989) was sufficient
4
to transform murine colon epithelial cells. Similar observations have been made in rodent models
introducing combinations of oncogenic mutations in various tissues in vivo. For example,
introducing Myc and Ras under breast specific promotors synergistically and dramatically
increases tumor formation in the mouse mammary gland (Sinn et al., 1987), while transgenic
introduction of BRCA1 mutation in the mammary glands of p53 null mice caused basal-like breast
tumor formation (McCarthy et al., 2007). The combination of Myc and Ras produces tumors in a
range of tissues, when introduced mid-gestation in a mouse embryo (Compere et al., 1989).
Similarly, p53 null mice with a heterozygous null Rb mutation show greater tumor formation
versus the presence of either mutation (Williams et al., 1994).
Experiments show that human cells are more complicated and require combinations of
more than two mutations to cause cellular transformation. For example, the combination of SV40
large-T and H-ras is insufficient to transform human embryonic kidney cells and fibroblast cells.
These cells also require constitutive hTERT expression to become tumorigenic (Hahn et al., 1999).
The same combination of oncogenes are sufficient to transform human mammary epithelial cells
as well (Elenbaas et al., 2001). Similarly, human fibroblast cells deficient in p16INK4a are
transformed with the combination of hTERT and either Ras or Myc (Drayton et al., 2003).
It is interesting to note that not all combinations of oncogenes are capable of transforming
cells. This suggests that there may be multiple circuits controlling growth and deregulation of more
than one growth circuits is necessary to trigger uncontrolled growth (Vogelstein and Kinzler,
1993). Mutations in multiple genes may be critical for overcoming cellular defenses to the
introduced oncogene, producing conditions adverse for cellular growth (Hahn and Weinberg,
2002). For example, introduction of exogenous oncogenic Ras often triggers cellular senescence
or apoptosis in both mouse and human cells (Serrano et al., 1997). This premature growth arrest is
5
bypassed by either disrupting p53 alone in mouse cells or disrupting both p53 and Rb pathways in
human cells (Serrano et al., 1997). Disruption of the p53 and Rb pathways prevents the onset of
senescence, allowing the transformed cell to divide indefinitely. Hence, the additional mutations
need to neutralize the antineoplastic responses mounted by the previously introduced oncogene
(Weinberg, 1997).
The malignant cell, transformed by the combinations of oncogenic mutations, is able to
survive indefinitely, proliferate rapidly and uncontrollably independent of growth signals, evade
differentiation, invade to surrounding tissue and migrate to distant locations within the body,
sustain angiogenesis and alter metabolic requirements, along with other novel characteristics
(Hanahan and Weinberg, 2000, 2011). These altered characteristics of the transformed cell are
referred to as the hallmarks of cancer (Hanahan and Weinberg, 2000, 2011). Some of these
hallmarks stem from the deregulation in functions of the oncogenic lesions on being mutated. For
example, neoplastic growth of cells is triggered by activating mutations in the Ras signaling
pathways (Downward, 2003). Activating mutations in the phosphatidylinositol 3- kinase – Akt
pathway allow survival of the cancer cell in multiple cell types (Vivanco and Sawyers, 2002).
Similarly, inactivating mutations in p53 prevents triggering of cell cycle arrest, apoptosis and
senescence phenotypes controlled by the gene (Lowe et al., 1993; Schmitt et al., 2002; Livingstone
et al., 1992).
Hallmarks of the malignant cell are also triggered by the synergistic effect of the oncogenic
combination. The oncogenic combination decides the context dependent role of one of the
oncogenes. Bcl-2 overexpression licenses the pro-proliferative role of Myc in transformed cells,
as mentioned earlier (Vogelstein and Kinzler, 1993). Oncogenic Raf activates MAPK signaling,
triggering proliferation, as well as p53-dependent induction of p21 triggering cell-cycle arrest
6
(Lloyd et al., 1997). Dominant negative p53 prevents cell cycle arrest by blocking induction of
p21, allowing hyper-proliferation to take place in primary rat Schwann cells (Lloyd et al., 1997).
A similar mechanism of for the pro-proliferative role of Raf via p53 deactivation is also seen in
murine keratinocytes (Roper et al., 2001). Oncogenic Ras, in combination with dominant negative
p53, can synergistically regulate cellular motility and increase invasiveness of transformed murine
colon epithelial cells (Xia and Land, 2007). Simultaneous expression of mutant p53 and Ras also
allows the pro-invasive arm of RhoA activity to take place (Xia and Land, 2007). Oncogenic Ras,
by itself, promotes the activity of RhoA, a GTPase essential for cellular migration and invasion by
its membrane localization, while simultaneously suppressing its activity by activating p53 induced
RhoA inhibitor p190RhoGAP (Arthur and Burridge, 2001; Xia and Land, 2007). Expressing
dominant negative p53 with oncogenic Ras downregulates the inhibitory circuit of RhoA
modulation, allowing RhoA activation and driving malignant cell motility and invasiveness (Xia
and Land, 2007). Thus, cooperation between oncogenic lesions drives synergistic changes
occurring further downstream, and further efforts were invested in identifying additional key
synergistic mediators of the transformation process.
Critical mediators of the cancer behavior were identified downstream of cooperating
oncogenes. On introducing dominant negative p53 and oncogenic Ras in murine colon epithelial
cells, 95 annotated genes were found synergistically dysregulated in expression within the
transformed cells, as compared to non-transformed cells (McMurray et al., 2008). These genes,
known as Cooperation Response Genes (CRGs), were enriched in essential regulators of the
transformed state. When their expressions were individually reset back to levels in non-
transformed colon cells, the tumors formed on by many of these perturbations were significantly
smaller than non-perturbed transformed cells. In contrast, much fewer genes that respond to mutant
7
p53 and activated Ras in a non-synergistic fashion had tumor-inhibitory effects (McMurray et al.,
2008, McMurray et al., unpublished data).
CRGs are involved in regulating multiple functions including cellular signaling, autophagy
and metabolism. (McMurray et al., 2008; Kinsey et al., 2014; Smith et al., 2012) For example,
Plac8, a gene synergistically upregulated in expression in response to p53 and Ras, is a critical
regulator of autophagy in cancer cells (McMurray et al., 2008; Kinsey et al., 2014). Cancer cells
depend on Plac8 to enhance and sustain autophagic flux, allowing the maintenance of metabolic
homeostasis within cancer cells (Kinsey et al., 2014). Similarly, Abca1, a gene synergistically
downregulated in expression, is found to mediate cholesterol transfer across the plasma membrane
(McMurray et al., 2008; Smith and Land, 2012). Cancer cells preferentially lower the expression
of Abca1 to maintain elevated levels of cholesterol within the mitochondria, preventing release of
apoptosis-promoting molecules, allowing for survival (Smith and Land, 2012).
Similarly, CRGs were also identified in other types of cancer, including acute myeloid
leukemia, basal cell carcinoma and medulloblastoma, and were found to be essential mediators of
the transformation in such contexts too (Ashton et al., 2012; Eberl et al., 2012; Gotschel et al.,
2013). Importantly, a subset of the original CRGs identified in colorectal cancer downstream of
mutant p53 and activated H-Ras (mp53/Ras) have been found to play critical roles in other
epithelial cancers like pancreatic cancer, androgen-independent prostate cancer and basal-like
breast cancer (BLBC) (Kinsey et al., 2014; Walters et al., unpublished; McMurray et al.,
unpublished).
8
1.2 Approaches to Achieving Cancer Selectivity
An ideal strategy to target cancer would be to identify vulnerabilities present in cancer cells
that do not affect normal cells. Though cancer is actually a collection of many distinct diseases
that differ in tissue of origin, characteristic mutations (The Cancer Genome Atlas et al., 2013; The
Cancer Genome Atlas, 2012), gene expression patterns (Perou et al., 2000) and, only recently
appreciated, cell of origin within a tissue (Molyneux et al., 2010), there appear to be key features
present across cancer types and sub-types, driven by core signaling architectures that appear to be
dysregulated via mutations in different genes across cancers, as discussed earlier. Studies have
found that the transformed cell is dependent on many of these features in a cancer-specific manner,
providing a window of opportunity to identify vulnerabilities present.
One observation made in cancer cells is that often, the transformed cell is dependent on
one or more of its oncogenic proteins or pathways for its survival and continued functioning
(Sharma and Settleman, 2007). Coined by Bernard Weinstein in 2000, this phenomenon is known
as oncogene addiction (Weinstein, 2000; Weinstein 2002; Weinstein and Joe, 2006). This
dependency of the cancer cell has been observed in cell lines, mouse tumor models as well as
human clinical studies using drugs targeting such oncogenic mutations. Myc is an oncogene whose
expression is widely deregulated in multiple types of cancer (Vita and Henriksson, 2006). The first
ever demonstration of oncogene addiction was the inhibition of Myc via antisense RNA in human
tumor-derived promyelocytic leukemia cell lines. Inhibition of Myc caused these cells to stop
proliferating and differentiate (Yokoyama and Imamoto, 1987; Loke et al., 1988). Acute inhibition
of Myc in mouse models of Myc-activated lymphoma, leukemia and skin cancer causes induction
of apoptosis, senescence and regression of angiogenesis, respectively, indicating that the outcome
9
of disruption of oncogene addiction is context dependent (Felsher and Bishop, 1999; Arvanitis and
Felsher, 2006; Pelengaris et al., 1999; Wu et al., 2007; Beer et al., 2004; Boxer et al., 2004).
Similarly, H-Ras, K-Ras and BCR-ABL also demonstrate a similar phenomenon. Inducible
mouse models show that inactivation of H-Ras in melanoma, K-Ras in colorectal cancer and BCR-
ABL in leukemia causes tumor cell apoptosis and abrogates the ability to form tumors in vivo
(Chin et al., 1999; Fisher et al., 2001; Huettner et al., 2000; Shirasawa et al., 1993). Similar
observations have been made for deinduction of these genes in cultured human cell lines too
(Mukhopadhyay et al., 1991; Tokunaga et al., 2000; Kohl et al., 1994; Liu et al., 1998; Golas et
al., 2003).
Alongside classical oncogenes and tumor suppressors, other types of genes have also been
found to drive transformation. Oncogenic microRNAs (also called oncomirs) are also found to be
drivers of the transformation process (Esquela-Kerscher and Slack, 2006). For example, the miR-
17-92 cluster is commonly found to be amplified and overexpressed in B-cell lymphomas and lung
cancers (Ota et al., 2004; He et al., 2005; Hayashita et al., 2005). Constitutive activation of this
polycistronic miRNA cluster cooperates with Myc to accelerate B-cell lymphoma development
(He et al., 2005). It is interesting to find that cancer cells created by oncomir activation are addicted
to the oncomiRs, with inhibition of lung cancer cell growth following inhibition of any of the
miRNAs in the miR-17-92 cluster (Matsubara et al., 2007).
Drugs targeting oncogenes have been utilized in clinical settings with a few clear successes.
Gleevac, an ABL-specific tyrosine kinase inhibitor, has been successfully used in select patients
of chronic myelogenous leukemia whose cancer cells contain BCR-ABL mutations (Kim, 2003).
Antibodies and small molecule inhibitors targeting ErbB2/HER2, a common oncogene amplified
in approximately 30% of breast cancers, cause growth inhibition of cell cultured breast cancer cells
10
as well as xenografts in nude mice, while treatment of patients with HER2+ disease via targeted
antibodies Transtuzumab/Herceptin and Pertuzumab shows clinical success with patients with
high efficacy (Berger et al., 1988; Hudziak et al., 1989; Xia et al., 2002; Rabindran et al., 2004;
Wong et al., 2006; Hudis, 2007; Vogel et al., 2002). Similarly, kinase inhibitors targeting a kinase
domain mutated form of EGFR found in a sub-population of patients with non-small cell lung
cancer show significant clinical responses (Lynch et al., 2004; Pao et al., 2004; Sharma et al.,
2007). Also, vemurafenib, a BRAF kinase inhibitor has been successful in improving the survival
of melanoma and thyroid cancer patients harboring the BRAF V600E mutation (Chapman et al.,
2011; Kim et al., 2013). However it is harder to target non-kinase oncogenes like Ras and Myc
that do not bind to substrates via rapid catalytic processes that can be potentially inhibited (Luo et
al., 2009; Gysin et al., 2011).
In conjunction with activating mutations in oncogenes, cancer cells often possess loss of
function mutations in tumor suppressor genes. Hence, cancer cells show similar addiction to the
inactivation of the tumor suppressor genes, reacting to the reintroduction of wild-type copies of
the tumor suppressors – a phenomenon called tumor suppressor hypersensitivity (Weinstein,
2002). This has been best demonstrated in studies on p53, a tumor suppressor gene that is
inactivated in majority of all human cancers (Soussi, 2007; The Cancer Genome Atlas Database).
Cancer cells undergo apoptosis or senescence on the reintroduction of wild type p53 (Adachi et
al., 1996; Gomez-Manzano et al., 1996; Vater et al., 1996; Martins et al., 2006). However,
translating the concept of tumor suppressor hypersensitivity into clinical applications is harder
because it is difficult to restore or mimic the function of an inactivated or absent gene through
small molecule interventions (Luo et al., 2009).
11
The knowledge that tumors are addicted to mutated oncogenes and tumor suppressor
spurred efforts to identify more of these types of changes and do so across various types of cancer.
Recent large-scale projects focused on genomic sequencing of multiple types of cancers have
found that outside common mutations in well studied oncogenes and tumor suppressors such as
p53, Ras, PI3 kinase, PTEN, Rb and p16INK4a, many other mutations are found in cancer cells but
for any individual gene, the frequency of a mutation occurring is much lower than for those
classical oncogenes and tumor suppressors (Cancer Genome Atlas Research Network, 2008; Ding
et al., 2008; Parsons et al., 2009; Sjoblom et al., 2006; Wood et al., 2007). Because of the
heterogeneity of mutations even in cancers of the same tissue, it becomes difficult to distinguish
driver mutations from changes that do not contribute to the malignant phenootype (Luo et al.,
2009). Further analysis is needed to understand whether and which of these low-frequency
mutations contributes to malignancy. Until such functional analysis is performed, we cannot
estimate whether targeting these non-classical mutations will achieve anti-cancer targeting and so
cannot predict whether that will be cancer-specific.
An alternative strategy to identify cancer selective targets is to identify vulnerabilities
present within the cancer cell outside its dependency on mutated lesions. Beyond mutations, cancer
cells are dependent on a wide variety of additional mediators of the transformation process that
may be differentially regulated between cancer cells and normal cells (Solimini et al., 2007). These
genes and pathways may also help the malignant cell cope with additional stresses it faces due to
its transformed state (Luo et al., 2009). This phenomenon is known as non-oncogene addiction
and provides an opportunity to identify additional cancer-selective targets (Solimini et al., 2007;
Luo et al., 2009).
12
One way to accomplish this might be to target non-mutated genes downstream of
oncogenic lesions in the pathway. For example, tumors with inactivating PTEN mutations are often
dependent on PI3K signaling, since PTEN is an inhibitor of PI3K (Cully et al.,2006). Hence, small
molecule PI3K inhibitors would be potentially toxic to the tumor cells addicted to PI3K signaling
(Cully et al., 2006). Similarly, inactivating mutations in Rb, or the cyclin-dependent kinase
inhibitors p16, p21 or p27 (CDKi) exert effects on cell cycle via cyclin-dependent kinase activity
which directly control cell-cycle entry (Aprelikova et al., 1995; Kaye, 2002). Tumors harboring
mutations in these CDKi genes may be particularly sensitive to cyclin-dependent kinase inhibitor
molecules (Luo et al., 2007).
A second way to leverage non-oncogene addiction to specifically target cancer cells is to
identify cellular stresses faced by cancer cells that are not faced by non-cancer cells. Cancer cells
could be targeted by either shutting down pathways required by the cancer cell to cope with such
stresses or by increasing the stress load of the cancer cell to overload the stress-response capability
(Luo et al., 2007). For example, cancer cells often rebalance the levels of expression of various
genes, changing the stoichiometry of protein subunits of different complexes, causing proteolytic
stress on chaperone pathways that regulate the homeostasis of the proteome (Luo et al., 2007).
Heat shock pathways help in promoting protein folding and are often activated in tumors without
being mutated (Whitesell and Lindquist, 2005). HSF1 belongs to this pathway and is induced by
cellular stresses like hypoxia frequently faced by cancer cells, driving the expression of heat shock
proteins that help promote protein refolding, prevent protein aggregation and target misfolded
proteins towards degradation (Dai et al., 2007). Knocking down HSF1 using shRNAs reduces
cancer cell viability, without affecting non-cancer cells such as primary mammary epithelial cells
and human lung fibroblasts (Dai et al., 2007). HSF1 has not been found to be mutated in tumors,
13
and HSF1 overexpression is not sufficient to transform immortalized mouse embryonic fibroblasts
in combination with mutant Ras, whereas inhibiting HSF1 prevents transformation with mutant
p53 and activated Ras or PDGF-B, causing increased cell death. Thus, HSF1induction provides atl
east one mechanism by which cancer cells may depend on a non-mutated protein, in this case to
tolerate proteolytic stress (Dai et al., 2007).
Similarly, cancer cells metabolism is dysregulated, allowing cancer cells to survive in
abnormal stromal environments. Most cancer cells increase glucose uptake and upregulate the
glycolysis pathway to metabolize this glucose (Kim and Dang, 2006). What drives cancer cells
into this highly glycolytic state is not well understood, but this adaptation is believed to be useful
for the cancer cell to divert metabolites towards biosynthesis, reduce ROS production via
mitochondrial oxidative phosphorylation and tolerate varying oxygen levels available in the tumor
microenvironment (DeBerardinis et al., 2008; Kroemer and Pouyssegur, 2008; Vander Heiden et
al., 2009). Cancer cells cannot tolerate inhibition of the glycolytic and metabolite biosynthetic
pathways because of sustained pro-proliferative signals coming from oncogenes (Vander Heiden
et al., 2001; Vander Heiden et al., 2009). Inhibiting either genes involved in glycolysis, including
ATP citrate lyase or lactate dehydrogenase A or biosynthetic genes, such as acetyl CoA
carboxylase or fatty acid synthase causes tumor growth arrest (DeBerardinis et al., 2008; Kroemer
and Pouyssegur, 2008).
Because non-mutated genes critical to the cancer phenotype are a potential source for anti-
cancer targets, efforts have been directed at identifying such genes via RNAi-based screens (Luo
et al., 2009). In these approaches, a pool of shRNA or siRNA molecules are introduced into cancer
cells and shRNAs depleted from this pool under a selective pressure such as cell competition or
growth in limiting conditions are tested further for functions. Distinct RNAi screens compare
14
cancer cells and non-cancer cells (Schlabach et al., 2008), two different kinds of cancer cells (Ngo
et al., 2006) or follow certain phenotypes like proliferation and survival change (Silva et al., 2008).
Other approaches depend on synthetic lethality, the phenomenon due to which a cancer cell is
unable to survive due to change in function of two or more genes simultaneously but not the
individual genes themselves (Ulrich et al., 2011). In the case of RNAi based screens for cancer
regulators, hits are defined as genes that are required only due to the presence of a particular
oncogenic mutation (Luo et al., 2009; Scholl et al., 2009; Barbie et al., 2009; Boettcher et al.,
2014). However RNAi screens can only be used to identify genes whose loss is toxic to the cancer
cell, missing targets that would inhibit cancer cell growth upon activation or increased expression.
CRGs represent non-mutated mediators of transformation that are often found to be
required by malignant cells. Synergistically disregulated downstream of cooperating oncogenes,
CRGs provide an opportunity to identify additional non-oncogenes essential for the transformed
state. Originally identified in a murine model of colon cell transformation based on cooperation
between mutant p53 and activated H-Ras, CRGs have been found to mediate crucial functions of
the cancer cell, as explained above. Plac8, an upregulated CRG, has been demonstrated to be
required by cancer cells to mediate autophagy (Kinsey et al., 2008). Plac8 helps the cancer-cell
cope with proteolytic stress that is unique to the cancerous state and hence Plac8 silencing inhibits
tumor growth in a cancer-selective manner, demonstrating no obvious phenotype in normal tissues.
A subset of CRGs have been found to play essential roles in multiple epithelial cancers including
human colorectal cancer and basal-like breast cancer (McMurray et al., 2008; Walters et al.,
unpublished). Studies in basal-like breast cancer demonstrate that perturbing CRGs have cancer-
specific effects, with perturbed non-cancerous cells showing little or no obvious change in
15
phenotype (Walters et al., unpublished). Hence, there is piling evidence that many CRGs play a
cancer-selective role in regulation of the malignant phenotype.
16
1.3 Basal-like Breast Cancer
Breast cancer is a heterogeneous disease with each type of tumor characterized by distinct
characteristic features and clinical outcomes (Reis-Filho et al., 2005; Simpson et al., 2005; Vargo-
Gogola et al., 2007). Subtypes of breast cancer vary as a result of distinct genetic, epigenetic and
transcriptomic variations (Reis-Filho and Lakhani, 2008; Geyer et al., 2009; Correa-Geyer and
Reis-Filho, 2009; Weigelt et al., 2008; Weigelt and Reis-Filho, 2009). Although the characteristics
of the disease are often directly associated with the patterns of genetic lesions found within the
tumor (Weigelt and Reis-Filho, 2009), it is often found that tumors of the same histological subtype
show contrasting clinical outcomes (Badve et al., 2011).
With the advent of high throughput gene expression measurement technologies, efforts
have been made to classify breast tumors based on molecular features rather than or in addition to
histological features. Microarray analysis of human breast tumors led to division of breast cancer
into at least five distinct subtypes: luminal A, luminal B, normal-like, HER2 positive and basal-
like breast cancers (BLBCs) (Perou et al., 2000; Solie et al., 2001; Sorlie et al., 2003; Hu et al.,
2006; Rakha et al., 2008; Parker et al., 2009; Badve et al., 2011).
Basal-like breast cancer is one of the most aggressive subtypes of breast cancer that
accounts for up to 15 - 25% of all breast cancers and is more likely to affect pre-menopausal
women (Livasy et al., 2006; Haffty et al., 2006; Fulford et al., 2006). The aggressiveness of the
tumors leads to frequent tumor recurrences within the first and third years, with the majority of
patients succumbing to BLBC within the first five years following therapy (Dent et al., 2007;
Tischkowitz et al., 2007). Patients with basal-like breast cancer are found to survive less after the
first occurrence of metastasis compared to patients with non-basal-like tumors (Fulford et al.,
2007). Many BLBCs are triple negative breast cancers characterized by the lack of estrogen
17
receptor and progesterone receptor and lack of HER2 protein overexpression and HER2 gene
amplification (Tomao et al., 2014). The lack of hormone receptor expression makes BLBC
insensitive to modern breast cancer therapies such tamoxifen, which targets estrogen receptor and
herceptin, which targets HER2 protein (Badve et al., 2011).
Established human BLBC cell lines provide an excellent model system to study the disease
in vitro and in vivo (Chavez et al., 2010). Hence, For my studies, I utilized six BLBC lines
representing the two subtypes of basal-like breast cancer, namely Basal A and Basal B. (Table 1)
(Walters et al., unpublished). These BLBC cell lines were compared to two immortalized but non-
tumorigenic mammary epithelial cell lines, MCF10A and MCF12A. (Table 1) (Walters et al.,
unpublished). These cell lines were spontaneously immortalized cells derived from benign breast
tissue of patients of fibrocystic disease (Paine et al., 1992; Soule et al., 1990). These cells are
phenotypically similar to mammary progenitor cells, with the capacity to expnd and, when given
appropriate signals, to differentiate into luminal and basal epithelial cells in vitro to form hollow
acinar structures that recapitulate mammary duct formation (Debnath et al., 2003; Holliday and
Speirs, 2011). Experiments show that conditional deletion of BRCA1 and p53 in mouse mammary
progenitor cells form basal-like breast tumors, suggesting that progenitor cells are the cells of
origin of basal-like breast cancer (Liu et al., 2007; Molyneux et al., 2010; Van Keymeulen et al.,
2011).
18
1.4 Colorectal Cancer
Colorectal cancer is the a leading cause of cancer-related death in the United States, third
only to lung and prostate cancers in men and lung and breast cancers in women (Siegel et al.,
2011). More than 90% of the tumors arise from epithelial cells in the colorectal mucosa
(Hamilton et al., 2010). Though early studies concentrated on familial colorectal cancers to find
common drivers of the disease, only a small proportion (around 5-10%) of the tumors are due to
inherited diseases while the rest appear sporadically (Smith et al., 2002). Alongside common
mutations like APC, p53, K-Ras and Smad4, colorectal tumors also include mutations in Arid1A,
Sox9 and Fam123b (The Cancer Genome Atlas, 2012; Smith et al., 2002), making it particularly
hard to target cancer cells through a specific oncogene addiction. Hence there is need for studies
of common downstream mediators of transformation that are essential to the tumor.
Normal adult colorectal epithelial cells are hard to culture and hence very few in vitro
colorectal cancer transformation models comparing transformed cells to normal cells exist
(D’Abaco et al., 1996; McMurray et al., 2008). We leverage one of the few available models for
normal colon cell function, using murine colorectal epithelial cells derived from a transgenic
mouse (called the Immortomouse) with conditional expression of a temperature-sensitive SV40
large T gene (Jat et al., 1991). Young Adult Mouse Colon (YAMC) cells derived from the
Immortomouse can be cultured indefinitely under permissive conditions, (grown at 33°C and in
the presence of IFNγ), where the SV40 T can promote growth and inhibit senescence by binding
to p53 (Colby and Shenk, 1982). After switching cell cultures to a non-permissive temperature,
37°C – 39°C, the conformation of SV40 T is disrupted, while withdrawal of IFNγ halts further
transcription of the T, leading to loss of the immortal phenotype and cellular senescence over a
two week time period (Whitehead and Robinson, 2008). The mutant p53 and activated Ras
19
transformed YAMC cells have been utilized to identify critical mediators of the malignant
phenotype called CRGs, as discussed earlier (McMurray et al.,2008).
20
1.5 The role of Notch signaling and Wnt signaling in cancer
The Notch signaling pathway is a highly conserved pathway in the animal kingdom, with
Notch signaling architecture apparent in organisms ranging from C. elegans to humans (Artavanis-
Tsakonas et al., 1999; Schweisguth, 2000). Notch signaling is activated by the binding of trans-
membrane ligands Delta, Serrate or Jagged to the Notch receptor, which constrains Notch
activation to cells bordering Delta/Jag-expressing cells. Upon ligand binding, the Notch receptor
undergoes two steps of proteolytic cleavage by ADAM-family metalloproteases and γ-secretase,
causing the release of the Notch intracellular domain (NICD). The NICD travels to the nucleus,
where it cooperates with RBP-Jκ (also known as CSL), a DNA-binding protein and the coactivator
Mastermind (Mam) to promote canonical transcription of target genes (Bray, 2006). The NICD
may also promiscuously interact with other binding partners to activate non-canonical Notch
signaling by driving transcription through other pathway machinery (Kim et al., 2012; Watanabe
et al., 2013). The Notch pathway is known to control cell-fate determination, differentiation, cell
survival, proliferation and angiogenesis in various cell types (Artavanis-Tsakonas et al., 1999;
Miele and Osborne, 1999; Phng and Gerhardt, 2009).
Notch signaling was first implicated in cancer in T lymphoblastic leukemia (T-ALL) when
a chromosomal translocation places the 3’ region of NOTCH1 into the TCRβ locus causing Notch1
activation by expression of the NICD (Ellisen et al., 1991). Though the particular translocation
appeared to be rare, occuring in less than 1% of T-ALL cases, a majority of all T-ALL cases have
been found to harbor mutations that activate NOTCH1 (Weng et al., 2004). Notch signaling was
similarly implicated in solid tumors including breast cancer, medulloblastoma, colorectal cancer,
non-small cell lung carcinoma and melanoma (Ranganathan et al., 2011; Reedijk et al., 2005).
21
Activation of the Notch pathway also has been reported to have tumor suppressive
functions. Notch1 loss of function causes the formation of spontaneous basal cell carcinomas in
older mice and sensitizes these animals to chemically induced skin carcinogenesis (Nicolas et al.,
2003). Evidence of tumor suppressive activity of the Notch pathway is also found in breast cancer,
prostate cancer, lung cancer, hepatocarcinoma, glioblastoma and squamous cell carcinoma
(Harrison et al., 2010; O’Neill et al., 2007; Parr et al., 2004; Shou et al., 2001; Whelan et al., 2009;
Wang et al., 2009; Qi et al., 2003; Sun et al., 2003; Duan et al., 2006; Panelos et al., 2008; Proweller
et al., 2006; Sriuranpong et al., 2001). Reports in basal-like breast cancer suggest a complicated
role as well (Dong et al., 2010; Xu et al., 2012; Lee et al., 2008), with Notch3 being reported as
tumor suppressive (Cui et al., 2013) as well as pro-oncogenic (Yamaguchi et al., 2008). This
suggests that the role of Notch signaling in cancer must be context specific and may be determined
by its interaction with other signaling pathways (Radtke and Clevers, 2005).
Another pathway important for cellular proliferation and lineage development is the Wnt
pathway. The canonical Wnt signaling pathway acts through the effector molecule β-catenin
(Tolwinski and Wieschaus, 2004). In the absence of Wnt signaling, β-catenin is sequestered by the
Axin2/GSK/APC complex and degraded via proteolytic cleavage. Wnt signaling is mediated by
Wnt ligands which bind to the Frizzled (FZD) receptors (Yang-Snyder et al., 1996). Dishevelled
(DSH) becomes activated, which mediates the release of β-catenin from the Axin2/GSK/APC
complex. β-catenin becomes stabilized and is able to move to the nucleus and activate transcription
of target genes (Behrens et al., 1996).
Along with proliferation, β-catenin also has a well-defined role in cell-cell adhesion
(Ozawa et al., 1989). There are other branches of Wnt signaling independent of B-catenin,
22
classified under non-canonical Wnt signaling, that are known to mediate diverse processes like
cell polarity, cell migration and cell-cell adhesion (Montcouquiol et al., 2006).
The Wnt signaling pathway was first implicated in cancer when inactivating mutations of
APC were found to cause tumor formation in a majority of sporadic colorectal cancers and familial
adenomatous polyposis (FAP), a hereditary predisposition to the formation of benign adenomas in
the colon–rectum (Fodde et al., 2001). A fraction of sporadic colorectal cancers also have gain-of-
function mutations of CTNNB1, the B-catenin gene (Polakis 2007). Similar gain-of-function
mutations of CTNNB1 were found in ~20% cases of different cancers (colon cancer, melanoma,
hepatocellular carcinoma, medulloblastoma, hepatoblastoma, gastrointestinal tumors, Wilms
tumors and others) (Polakis 2000). Hence, increased Wnt signaling is implicated as a driver of
cancer. In breast cancer, even though few mutations in the Wnt pathway genes have been found in
patient samples (Candidus et al., 1996; Schlosshauer et al., 2000; Jonsson et al., 2000), nuclear or
cytoplasmic staining of B-catenin is an independent marker that correlates with poor prognosis in
breast cancer (Lin et al., 2000).
Interaction between Notch and Wnt signaling was first reported in the context of the
development and patterning of the wing of Drosophila. (Couso and Martinez Arias, 1994; Hing et
al. 1994) During wing development, Wingless, the Wnt1 orthologue in Drosophila, and Notch are
found to synergistically drive the expression of vestigial (vg) (Zecca and Struhl, 2007). Synergistic
interaction between Notch and Wnt pathways to control cell fate has also been reported in
vertebrate cells, such as during the development of skin precursors (Estrach et al., 2006), the
patterning of the rhombomeres (Cheng et al., 2004) and during somitogenesis (Aulehla and
Hermann, 2004). In Drosophila, Wnt signaling is known to drive Notch signaling via positive
feedback control of expression of Notch ligands (de Celis and Bray, 1997) while Notch signaling
23
is known to antagonize Wnt signaling directly (Brennan et al., 1999) via mechanisms like Notch
suppressing the activity of Armadillo, the B-catenin orthologue in Drosophila in a RBP-Jk-
independent manner (Hayward et al., 2006). In vertebrates, Wnt and Notch signaling are often
associated with precursor differentiation into alternative fates in various cell types like intestinal
development and haematopoiesis, often in an antagonistic fashion with Wnt signaling low and
Notch signaling high (Duncan et al., 2005; Han et al., 2002).
Notch and Wnt pathways are known to interact in cancer as well. The two pathways are
known to synergistically control tumorigenesis in breast and colorectal cancer (Ayyanan et al.,
2006; Fre et al., 2009). In cancers like colorectal cancer Wnt signaling drives Notch signaling by
controlling the expression of Notch ligands like Jag1 (Rodilla et al., 2009; Pannequin et al., 2009).
Notch signaling is also found to antagonize Wnt signaling when Notch acts as a tumor suppressor.
The Notch1-/- mouse epidermal cells, which form basal-cell carcinoma like tumors, show a de-
repression of β-catenin signaling (Nicolas et al., 2003). Similarly Notch1 inhibits β-catenin
signaling through the recruitment of epigenetic modifier SETDB1 in the APCmin mouse colorectal
cancer model (Kim et al., 2012). Thus, the Notch-Wnt interaction is very context specific.
24
1.6 Rationale of the current study
Identification of CRGs downstream of cooperating oncogenes defines novel mediators of
the transformation process, non-oncogenes to which the cancer cell is addicted (McMurray et al.,
2008; Ashton et al., 2012; Eberl et al., 2012; Gotschel et al., 2013). Drugs reversing the CRG
expression signature in colorectal cancer and acute myeloid leukemia have successfully been able
to reduce in vivo tumor formation (Sampson et al., 2013; Ashton et al., 2012). In leukemia, drugs
reversing CRG expression had cancer selective effects, with no discernible toxic effects on normal
cells (Ashton et al., 2012). Drugs found to reverse the CRG signature in transformed colon cells
also had cancer-selective effects at the level of CRG gene expression, but were not tested for
biological selectivity (Sampson et al., 2013). Among CRGs induced in a cancer-selective manner
was Notch3, a Notch pathway receptor molecule (Sampson et al., 2013). Transformed colorectal
cancer cells were found to have lower expression of Notch3 as compared to non-transformed colon
epithelial cells (McMurray et al., 2008), and drug effects on transformed cells were found to
depend on the induction of Notch3 for their effect on tumor formation, because on knocking down
Notch3 (Sampson et al., 2013).
Notch3 is activated, like other Notch receptor molecules, via proteolytic cleavage and
release of the intracellular domain that translocates into the nucleus and drives transcription of
target genes (Artavanis-Tsakonas et al., 1999). Hence, Notch3 was activated by expressing the
constitutively active Notch3 intracellular domain in murine colorectal cancer cells expressing
mutant p53 and constitutively active Ras. When Notch3 was activated, the cancer cells stopped
growing, as compared to non-perturbed colorectal cancer cells. (Fig 1: Unpublished Data)
However, since the non-transformed murine colon epithelial cells senesce on growing in vitro, the
25
colorectal cancer model does not provide a good system to study the cancer-selective effects of
Notch3.
Recent work from our laboratory has defined a role for CRGs in control of malignancy in
BLBC, and in particular has begun to use available non-cancerous mammary cells to examine
cancer selective effects of CRG modulation (Walters et al., unpublished). Thus, the model system
provides an opportunity to study the molecular basis of cancer-selective effects of CRGs, using
Notch3 as an example.
My studies define a novel genetic interaction between Notch3 and Sfrp2, another CRG
known to act as Wnt pathway antagonist. Moreover, we find similar interactions and consequences
of these interactions in both BLBC and transformed colon cells. It also reports a novel statistical
method to refine CRG identification using gene expression data, with Clca1 as a tumor-inhibitory
CRG discovered by the novel statistical method.
26
1.1 Figures
A
B
0
200000
400000
600000
800000
1000000
1200000
0 hrs 24 hrs 48 hrs 72 hrs 96 hrs
Ce
ll C
ou
nts
pBp3 pBp3 NIC3
.00
1.00
2.00
3.00
4.00
5.00
6.00
7.00
8.00
9.00
Vector NIC3
Re
lati
ve
Ex
pre
ssio
n
mp53/Ras
* * *
*
Vector NIC3
27
Figure 1: Notch3 activation inhibits cell growth in transformed colon cells.
A. Line graph shows effect of expression of Notch3 intracellular domain (NIC3) in mp53/Ras
cells on cell growth, with the continuous line representing unperturbed cells and the dashed
line representing NIC3 expressing cells. Error bars were SDs of 3 independent
experiments. *: P<0.01; Student’s T Test.
B. Histogram measures the expression of Notch3 in NIC3 expressing mp53/Ras cells. Black
bar represents unperturbed cells and dashed bar represents NIC3 expressing cells.
*:P<0.01; Student’s T Test.
28
Chapter II
Notch3 cancer-selectively controls proliferation via a network of genes specifically in basal-
like breast cancer
29
2.1 Abstract
Cooperation Response Genes (CRGs) are non-mutant regulators of the malignant phenotype of
cancer cells. Distinct sets of CRGs contribute to transformation in different types of cancer, with
accumulating evidence for a set of CRGs regulated by cooperation of mutant p53 and mutant Ras
that are important in multiple epithelial cancers, including basal-like breast cancer (BLBC).
Among the CRGs is Notch3, a transmembrane receptor of the Notch family that is found to cancer-
selectively regulate cell growth in a cancer selective manner. Here, we demonstrate how Notch3
plays a cancer-selective role in restricting proliferation of basal-like breast cancer cells.
Through genome-scale transcriptomic analysis, we demonstrate that Notch3 interacts with other
signaling pathways like the Wnt pathway in a distinct way in basal-like breast cancer versus non-
cancerous breast cells. Moreover, this cancer-specific interaction between Notch and Wnt
signaling selectively controls proliferation of cancerous cells. These studies provide a new insight
into the circuitry underlying the transformed state of basal-like breast cancer cells, advancing our
understanding of how basal-like breast cancer-specific vulnerabilities can arise.
30
2.2 Introduction
Key changes in gene expression are found to occur in response to cooperating combinations of
oncogenic mutations. Such synergistically dysregulated genes, or “cooperation response genes”
(CRGs) have been found to essential for the transformed state, mediating key features of the cancer
cell phenotype like uncontrolled proliferation, indefinite survival and altered metabolism
(McMurray et al., 2008; Ashton et al., 2012; Eberl et al.,2012; Kinsey et al., 2014). CRGs have
been identified and found to play critical roles in multiple cancers including colorectal cancer,
acute myeloid leukemia and basal-like breast cancer (McMurray et al., 2008; Ashton et al., 2012;
Eberl et al., 2012). Importantly, a subset of the original CRGs identified in colorectal cancer
downstream of mutant p53 and activated H-Ras (mp53/Ras) have been found to play critical roles
in other epithelial cancers like pancreatic cancer, androgen-independent prostate cancer and basal-
like breast cancer (BLBC) (Kinsey et al., 2014; Walters et al., unpublished; McMurray et al.,
unpublished). Pharmacological compounds antagonizing the CRG gene expression signature have
tumor inhibitory activity, including HDAC inhibitor (HDACi) treatment of mp53/Ras transformed
colon cells and ErbB2 inhibitor, Tyrophostin AG825, treatment of BCR-ABL/NUP98-HOXA9
transformed leukemia cells (Sampson et al., 2013; Ashton et al., 2012). Interestingly, the HDACi
antagonize the CRG gene signature in colorectal cancer cells while impacting CRG expression
within non-transformed colon cells in a non-specific pattern with overall changes of smaller
magnitude, showing cancer-selective effects (Sampson et al., 2013).
Among the cancer-specific CRG responses underlying HDACi activity is the Notch3 gene, a
Notch pathway receptor gene. Notch receptors are transmembrane proteins that control
fundamental biological processes like stem cell maintenance and proliferation, differentiation and
cell fate determination (Mizutani et al., 2001). One of the four Notch receptors in mammals,
31
Notch3 is activated via a ligand-receptor interaction that ultimately leads to proteolytic cleavage
that releases the intracellular domain into the cytoplasm (Bray, 2006). The dissociated intracellular
domain then translocates to the nucleus and associates with its heterodimeric partner protein
RBPJκ to form a transcriptional activator complex (Bray, 2006; Ohashi et al., 2010). The complex
drives transcription of multiple genes, canonically including the Hes/Hey family of transcriptional
factors (Bray, 2006).
Here, we demonstrate the cancer-selective role of Notch3 in controlling proliferation of BLBC
cells. Using Notch3 as an example of a CRG playing a transcriptional role, we start investigating
the molecular basis of such cancer-selective effects. Utilizing whole genome-scale analysis of the
transcriptional effects of Notch3 activation, we identify downstream targets of Notch3, at least one
of which is necessary for its role in proliferation. Moreover, we observe a hierarchy within the
interactions of the cancer-specific Notch3 sensitive genes. These studies give us an insight on the
underlying circuitry of basal-like breast cancer cells as compared to non-transformed breast cells
cells, demonstrating the importance of genetic interactions among CRGs, helping us advance the
understanding of how basal-like breast cancer-specific vulnerabilities may arise.
32
2.3 Results
2.3.1 Notch3 restricts proliferation in a cancer-selective manner
Previous work showed that Notch3 expression is lower in colorectal cancer cells than non-
transformed colon cells and its activation inhibits cancer cell growth in transformed colon cells
(McMurray et al., 2008; Figure 1). However, normal colon cells rapidly senesce in vitro, making
it difficult to examine biological effects of genetic perturbation in this model system. Interestingly,
recent studies in our laboratory have shown that a subset of the CRGs identified downstream of
cooperation between mutant p53 and activated H-Ras in colon cells play essential roles in other
epithelial cancers, including pancreatic cancer, androgen-independent prostate cancer and BLBC.
(Kinsey et al., 2014; Walters et al., unpublished; McMurray et al., unpublished). Moreover,
utilizing BLBC and non-transformed mammary epithelial cell lines, our lab has been able to
demonstrate that CRGs have cancer-selective effects in BLBC. (Walters et al., unpublished) Thus,
we leveraged this model system to allow comparison of phenotypic effects of Notch3 perturbation
in addition to molecular comparisons that were ultimately done in both breast and colon cells
(Shown here and Chapter III).
To determine the role of Notch3 in BLBC, we compared the baseline expression of Notch3 at
the level of mRNA across a panel of human BLBC cell lines and in two non-transformed human
mammary epithelial cell lines (Neve et al., 2006; Lehmann et al., 2011), finding that Notch3
expression is significantly lower in the BLBC cells as compared to the non-cancer cells (Figure
2.1A).
Since BLBC cells appear to have lower Notch3 expression as compared to non-cancer cells,
we next tested whether this difference contributed to phenotypic differences between the BLBC
33
and non-transformed breast cells. Because Notch3 is activated via cleavage and release of the
intracellular domain, the Notch3 intracellular domain acts as a constitutively active form of
Notch3. Hence, we expressed the Notch3 intracellular domain (NIC3) via retroviral infection in a
number of BLBC cell lines and measured cell accumulation over 72 hours. We observed that in
each of six basal-like breast cancer cell lines, introduction of the NIC3 inhibited growth of the
cancer cells (Figure 2.1B). This suggested that Notch3 activation restricts the growth of basal-like
breast cancer cells. We also performed the corresponding loss-of-function experiments, assessing
cell accumulation after knocking down Notch3 mRNA in two of the BLBC cell lines, MDA-MB-
231 and HCC1954. Reduction in Notch3 levels allowed BLBC cells to accumulate faster than
control cells (Figure 2.1C). Hence gain of function and loss of function experiments support the
idea that Notch3 activity restricts the growth of BLBC cells.
Because other CRGs appear to have cancer specific effects in BLBC cells (Walters et al.,
unpublished), we hypothesized that Notch3 would inhibit cell growth in a cancer selective fashion.
We tested this by introducing activated Notch3 into non-cancerous breast cells and measuring
accumulation of these cells, observing no significant change in growth of the NIC3 expressing
cells as compared to vector control cells (Figure 1D). To control for the possibility that the lack
of response to NIC3 in non-cancerous mammary cells was due to lack of NIC3 expression, we
examined Notch3 expression in both BLBC cells and non-transformed cells expressing NIC3,
finding similar levels of Notch3 in all perturbed cell populations (Figure 2.2). Morover, we
examined the response of the canonical Hey and Hes family of genes to introduction of NIC. In
both BLBC and non-cancerous cells, we found evidence for Hes/Hey induction, suggesting that
NIC3 activation was high enough to engender expected molecular responses (Figure 2.3) Hence
we concluded that Notch3 selectively restricts growth of BLBC cells.
34
2.3.2 Notch3 controls the expression of numerous genes in a cancer specific manner
Since Notch3 is a transcription factor, we hypothesized that the different phenotypic responses
of BLBC cells and non-cancer cells would be reflected by a differential transcriptional response
in each cell type. RNA was isolated from multiple, independently-generated samples of each cell
line with or without NIC3 expression used for high-throughput RNA sequencing. The raw reads
were mapped using SHRiMP 2.2.3 and gene counts were obtained using HTSeq. Gene counts were
normalized using DESeq and EdgeR, grouping all BLBC lines together and grouping all non-
cancerous cell populations together to identify responses that were highly consistent across these
populations. .
Among the basal-like breast cancer cells, 173 genes were identified whose expression was
disregulated more than two-fold up or down in NIC3 expressing cells as compared to unperturbed
cells. (Table 1) The p-values associated with each of these changes is also listed. Further, we
compared the results of three different algorithms for identifying differentially expressed gene
expression, and each of these gave a similarly rank-ordered gene list, with distinct p-values
associated with each of the changes (Table 2).
To assess cancer-specific and non-specific gene expression responses to NIC3, we compared
fold change in expression of genes responsive to NIC3 in BLBC cells with the change in expression
observed upon NIC3 introduction in non-cancer cells (Table 1). Of 173 genes responsive to NIC3
in BLBC cells, only 35 genes responded similarly in non-cancer cells (Figure 2.4A and B). Among
these genes, we found canonical Notch target genes, including Hey1, Hes1 and Hey2. As
35
independently verified by qPCR, NIC3 activation induced the Hes/Hey family gene expression as
compared to vector control in both cancer cells and non-cancer cells. (Figure 2.4C; Figure 2.3)
Interestingly, out of the 173 NIC3 sensitive genes found in BLBC cells, 112 genes did not
appear to change in non-cancer cells expressing NIC3 and 26 genes move in the opposite direction
in NIC3 expressing non-cancer cells, for example, increasing in BLBC cells while decreasing in
non-cancer cells (Figure 2.4A and B, Table 1). Thus, these genes showed a cancer-specific change
in expression in response to NIC3 expression, mirroring the observed cancer-specific biological
responses.
Gene ontology analysis of genes that respond to NIC3 in a cancer-specific manner revealed
that many of these genes are implicated in prominent signaling pathways with putative roles in
cancer, including the Wnt pathway, the TGFβ pathway and the NFκb pathway. (Figure 2.4D, Table
2) For example, Wnt antagonist Sfrp2 (SFRP2) is induced upon NIC3 expression but only in
BLBC cells, while Cyclin D1 (CCND1) and N-Myc (MYCN) are repressed in response to NIC3
expression in BLBC cells but not non-cancerous cells, as independently verified by qPCR
measurement (Figure 2.4E, Figure 2.5).
2.3.3 Notch3 depends on Sfrp2 for restricting proliferation of basal-like breast cancer cells
Among the genes induced in response to NIC3 is another cooperation response gene, Sfrp2,
which is found to be expressed at lower levels in transformed colon cells as compared to normal
colon cells (McMurray et al.,2008), and in basal-like breast cancer cells as compared to non-
transformed mammary epithelial cells. (Figure 2.6A). Moreover, it is apparently highly sensitive
to Notch3 levels, as knock-down of Notch3 expression reduces Sfrp2 expression. (Figure 2.8)
36
Sfrp2 belongs to the family of secreted frizzled proteins that modulate Wnt signaling by
directly binding to and sequestering Wnt ligands and thus preventing them from binding to cell
surface Frizzled receptors and activating downstream signaling (Alfaro et al., 2008). Activation of
Wnt signaling is known to promote cell growth of all cancer cells, including basal-like breast
cancer. (Polakis, 2000; Yang et al., 2011) Because Notch3 restricts cell growth of BLBC cells and
produces a corresponding increase in expression of the Wnt antagonist Sfrp2, we hypothesized
that Notch3 would depend on the induction of Sfrp2 to inhibit BLBC growth.
To test the hypothesis, we activated Notch3 by expressing NIC3 in BLBC cells with or without
shRNA-mediated knockdown of Sfrp2. We, then, examined the accumulation of each cell
population. As observed earlier, expressing NIC3 in BLBC cells inhibited cell growth. However,
loss of Sfrp2 induction significantly rescued cell growth upon introduction of NIC3 (Figure 2.6B).
To control for the possibility that Sfrp2 knocked-down cells did not respond to NIC3 expression
due to lack of sufficient NIC3 expression, we examined Notch3 expression in all the perturbed
BLBC cells, finding similar levels of Notch3 in both unperturbed and Sfrp2 knocked down cells
expressing NIC3 (Figure 2.6C). These results show that growth inhibition of BLBC cells following
activation of Notch3 requires induction of Sfrp2.
2.3.4 Induction of a subset of Notch3-responsive genes requires induction of Sfrp2
Canonical Wnt signaling is reported to drive cell growth through increased expression of
cell cycle regulators, including the Myc family of transcription factors and Cyclin D1 (Herbst et
al., 2014; Loh et al., 2014). Since Sfrp2 is reported to be a canonical Wnt antagonist and we find
that Sfrp2 expression is increased in BLBC cells expressing NIC3, we hypothesized that NIC3
37
would have effects on downstream targets of Wnt signaling such as CCND1 and MYCN. From
the RNA-sequencing analysis of NIC3 expressing BLBC and normal cells, we find that CCND1
and MYCN are selectively suppressed in response to introduction of NIC3 into BLBC cells (Figure
2.7A).
Given that CCND1 and MYCN decrease under conditions where Notch3 activity and Sfrp2
expression increase, we hypothesized a causal relationship between these events, predicting that
CCND1 and MYCN suppression in BLBC cells would depend on Sfrp2 induction. To test this, we
examined gene expression patterns via RT-qPCR from NIC3-expressing cells with or without
knock-down of Sfrp2. We observed that NIC3 expression corresponded with reduced expression
of CCND1 and MYCN expression in basal-like breast cancer cells, consistent with RNA-
sequencing results. However, while knock-down of Sfrp2 alone had little effect on CCND1 and
MYCN expression, introduction of NIC3 into cells with Sfrp2 knock-down produced significantly
less suppression of CCND1 and MYCN expression that seen with NIC3 alone (Figure 2.7B).
Hence, the reduction in CCND1 and MYCN expression in response to NIC3 depends on the
induction of Sfrp2.
This leads to the question of Sfrp2 induction is required for all the changes in gene expression
seen upon NIC3 introduction into BLBC cells. For example, expression of the TGFβ target gene,
Snai2, appears to be sensitive to NIC3 in a cancer-specific manner (Figure 2.7). To test whether
increased expression of Snai2 in response to NIC3 expression depends on Sfrp2 induction, we
measured the levels of Snai2 mRNA expression in BLBC cells with or without NIC3 and Sfrp2
knock-down, finding that Snai2 expression increased in NIC3-expressing cells, and reduction in
Sfrp2 expression had no effect on Snai2 expression, with similar expression levels in both cell
38
populations (Figure 2.7C). Hence, Sfrp2 is not required by Notch3 to induce Snai2 expression in
basal-like breast cancer cells.
Taken together, the results demonstrate the existence of a cancer-specific response to Notch3
activation at the level of gene expression that corresponds to cancer-selective growth inhibition.
Moreover, my work reveals a novel set of relationships between Notch3, Sfrp2 and downstream
targets of the Wnt pathway that is implicated in this phenotype.
39
2.4 Discussion
CRGs are enriched in essential mediators of the transformation process, representing non-
mutated genetic dependencies present within the cancer cell. Perturbing CRGs impacts the
functioning of cancer cells without affecting non-cancer cells, as shown in basal-like breast cancer
(Walters et al., unpublished). We are just starting to mechanistically understand how cancer cell
function is enabled based on altered expression of CRGs. In this study, we focus on Notch3 as an
example of a cancer cell growth regulatory CRG and start exploring the genetic interactions
through which Notch3 regulates cell growth in a cancer-selective manner.
We observe that activating Notch3 produces a differential transcriptional response between
cancer cells and non-cancer cells. Notch3 depends on at least one of the genes modulated in a
cancer-specific manner, SFRP2, in order to regulate growth of BLBC cells. Thus, dependence on
reduced Notch3 expression represents a non-oncogene addiction, a novel vulnerability in BLBC
cells with a unique mechanism underlying this vulnerability (Luo et al., 2009). The cancer cell
requires reduced Notch3 expression in order to maintain activation of at least the Wnt pathway
and possibly other cancer-specific regulatory programs, without which the cancer cell would
ultimately stop growing. This is reminiscent of synthetic lethality, where Notch3 activation is
lethal for the cancer cell due to simultaneous inhibition of the Wnt pathway. Further studies are
needed to assess whether these interactions represent a very unique feature of the cancer cells or
if the relationship between Notch3, Sfrp2, Cyclin D1 and N-Myc represents the top of an iceberg
of cancer-specific transcriptional programs that represent synthetic dependencies on critical non-
oncogenes.
Our current study reports that Notch3 inhibits proliferation of basal-like breast cancer cells in
a cancer-selective manner. This corresponds with previous work reporting Notch3 as a tumor
40
suppressor in BLBC (Cui et al., 2013), though there is some evidence that Notch3 may act as an
oncogene depending on contextual cues (Yamaguchi et al., 2008). Part of this context could be
determined by the mutation load of the tumors themselves. The basal-like breast cancer cell lines
that we chose to study had p53 and Ras pathway mutations. The role of Notch could also be
governed by the dose of Notch signaling of the transformed cell with respect to its dose in the
originating non-transformed cell. Our current work finds that the role of Notch3 in cell growth
regulation is defined by its interaction with genes of other signaling pathways. In cancer cells,
Notch3 is able to modulate Wnt pathway genes, inhibiting cell growth while in non-cancer cells,
we observe this genetic interaction is absent. This corresponds with previous studies that also show
how Notch signaling as a tumor suppressive pathway act by inhibit canonical Wnt signaling in
cancer (Nicolas et al., 2009; Kim et al., 2012).
While gene regulatory network reconstruction has revealed the beginnings of an interactive
network among CRGs, including suggesting the existence of an interaction between Notch3 and
Sfrp2 in transformed murine colon cells (Almudevar et al., 2011), the data shown here provides
evidence for a functional role of this genetic interaction in BLBC cells, suggesting three key points:
that this interaction plays a role in controlling cancer cell biology; and that this interaction is
conserved between colon transformation and BLBC, as well as across mouse and human cells.
Based on these data, we would predict similar functional consequences for modulation of Notch3
and Sfrp2 in transformed murine colon cells (Chapter III). This suggests that at least some of the
CRGs genetically interact to mediate the transformation process, controlling functions essential
for the cancer cell.
In conclusion, the current findings reported here start to address how CRGs control the
survival and growth of transformed cells in a cancer-selective manner. Using Notch3 as a
41
representative example, we find that cancer cells and non-cancer cells differ in transcriptional
response to Notch3 activation, part of which contributes to the cancer-specific cell growth response
to NIC3 expression. We identify a critical genetic interaction between two CRGs, i.e., the
induction of Sfrp2 by Notch3 activation, which is necessary for Notch3 to control cell growth in
cancer cells. This study starts to shed light on how cancer-selective dependencies are built based
on CRGs.
42
2.5 Figures
A
B
C
0
0.5
1
1.5
Re
lati
ve
En
do
ge
no
us
No
tch
3 E
xp
ress
ion
0
50000
100000
150000
200000
0 hrs 24 hrs 48 hrs 72 hrs
Ce
ll C
ou
nts
HCC1954
Vector NIC3
0
100000
200000
300000
0 hrs 24 hrs 48 hrs 72 hrs
Ce
ll C
ou
nts
MDA-MB-231
Vector NIC3
0
50000
100000
150000
0 hrs 24 hrs 48 hrs 72 hrs
Ce
ll C
ou
nts
HCC1569
Vector NIC3
0
100000
200000
300000
0 hrs 24 hrs 48 hrs 72 hrs
Ce
ll C
ou
nts
MDA-MB-468
Vector NIC3
0
50000
100000
150000
0 hrs 24 hrs 48 hrs 72 hrs
Ce
ll C
ou
nts
HCC70
Vector NIC3
0
100000
200000
300000
0 hrs 24 hrs 48 hrs 72 hrs
Ce
ll C
ou
nts
Hs578T
Vector NIC3
0
500000
1000000
0 hrs 24 hrs 48 hrs 72 hrs
Ce
ll C
ou
nts
HCC1954
pSR Puro Scrambled sh001 pSR Puro hNotch3 sh1026
pSR Puro hNotch3 sh1459 pSR Puro hNotch3 sh833
0
500000
1000000
1500000
0 hrs 24 hrs 48 hrs 72 hrs
Ce
ll C
ou
nts
MDA-MB-231
pSR Puro Scrambled sh001 pSR Puro hNotch3 sh1026
pSR Puro hNotch3 sh1459 pSR Puro hNotch3 sh833
* * ** * * *
** * * ** * * ** * *
* * * * * * ** * *
** **
*
**
*
*
43
D
Figure 2.1: Notch3 restricts proliferation in a cancer-selective manner
A. Histogram shows endogenous expression levels of Notch3, as measured by qPCR in non-
cancerous mammary cells, MCF10A and MCF12A, and basal-like breast cancer (BLBC) cell
lines, MDA-MB-231, HCC1954, HCC1569, MDA-MB-468, HCC70 and Hs578T. *: P<0.01, **:
P<0.05; Student’s T Test.
B. Line graphs show effect of expression of the Notch3 intracellular domain (NIC3) in BLBC lines
MDA-MB-231, HCC1954, MDA-MB-468, HCC70, Hs578T and HCC1569, with continuous line
showing vector control and dashed line showing NIC3 expressing cells. *: P<0.01, **: P<0.05;
Student’s T Test.
C. Line graphs show effect of knock-down of Notch3 in BLBC cell lines MDA-MB-231 and
HCC1954, with continuous line showing vector control and dashed lines showing NIC3 knocked
down cells. *: P<0.01, **: P<0.05; Student’s T Test.
D. Line graphs show effect of expression of the Notch3 intracellular domain (NIC3) in non-cancerous
MCF10A and MCF12A, with continuous line showing vector control and dashed line showing
NIC3 expressing cells. NS: Not significant p-value
0
50000
100000
150000
200000
0 hrs 24 hrs 48 hrs 72 hrs
Ce
ll C
ou
nts
MCF10a
Vector NIC3
0
50000
100000
150000
200000
0 hrs 24 hrs 48 hrs 72 hrs
Ce
ll C
ou
nts
MCF12a
Vector NIC3
44
A
0
1
2
3
4
5
6
7
8
9
Vector NIC3
Re
lati
ve
Ex
pre
ssio
n o
f N
otc
h3
HCC1954
0
1
2
3
4
5
6
7
8
Vector NIC3
Re
lati
ve
Ex
pre
ssio
n o
f N
otc
h3
MDA-MB-231
0
1
2
3
4
5
6
7
8
Vector NIC3
Re
lati
ve
Ex
pre
ssio
n o
f N
otc
h3
HCC1569
0
1
2
3
4
5
6
7
8
Vector NIC3
Re
lati
ve
Ex
pre
ssio
n o
f N
otc
h3
MDA-MB-468
0
1
2
3
4
5
6
7
8
Vector NIC3
Re
lati
ve
Ex
pre
ssio
n o
f N
otc
h3
HCC70
0
1
2
3
4
5
6
7
8
9
Vector NIC3
Re
lati
ve
Ex
pre
ssio
n o
f N
otc
h3
Hs578T
* * *
* * *
45
B
Figure 2.2: Expression of Notch3 in perturbed BLBC and non-cancerous breast cells
A. Histograms show expression of Notch3 in all six NIC3 expressing BLBC cell. *: P<0.01;
Student’s T Test. B. Histograms show expression of Notch3 in NIC3 expressing non-transformed breast cells. *:
P<0.01; Student’s T Test.
0
1
2
3
4
5
6
7
8
Vector NIC3
Re
lati
ve
Ex
pre
ssio
n o
f N
otc
h3
MCF10a
0
1
2
3
4
5
6
7
8
Vector NIC3
Re
lati
ve
Ex
pre
ssio
n o
f N
otc
h3
MCF12a
* *
46
0
1
2
3
4
MCF10a MCF12a HCC1954 MDA-MB-231
Re
lati
ve
ex
pre
ssio
n o
f
He
s1
Hes1 levels
pBp3 pBp3 NIC3
0
2
4
6
MCF10a MCF12a HCC1954 MDA-MB-231
Re
lati
ve
ex
pre
ssio
n o
f
He
s5
Hes5 levels
pBp3 pBp3 NIC3
0
5
10
MCF10a MCF12a HCC1954 MDA-MB-231
Re
lati
ve
ex
pre
ssio
n o
f
He
y1
Hey1 levels
pBp3 pBp3 NIC3
*
*
*
*
*
* *
*
*
*
* *
47
Figure 2.3: Induction of Hey/Hes family of genes in response to NIC3 expression in Cancer Cells
and Non-Cancer Cells
Bar graphs show expression of Hes1, Hes5, Hey1 and Hey2 in BLBC and non-transformed mammary
epithelial cells in response to NIC3 expression. *: P<0.01; Student’s T Test.
0
10
20
MCF10a MCF12a HCC1954 MDA-MB-231
Re
lati
ve
Ex
pre
ssio
n o
f
He
y2
Hey2 levels
pBp3 pBp3 NIC3
* *
*
*
48
A B
C
D
E
R² = 0.0095
R² = 0.6415
R² = 0.6179
-6
-4
-2
0
2
4
6
8
10
-4 -2 0 2 4 6 8 10
log
2fo
ld c
ha
ng
e (
NIC
3 e
xp
ress
ion
in
un
tra
nsf
orm
ed
ce
lls)
log2fold change (NIC3 expression in cancer cells)
Uncorrelate
d genes, 112
Positively
correlated
genes, 35
Negatively
correlated
genes, 26
0
5
10
15
20
Vector NIC3
Re
lati
ve
Ex
pre
ssio
n o
f H
ey
2
MDA-MB-231
0
5
10
15
Vector NIC3
Re
lati
ve
Ex
pre
ssio
n o
f H
ey
2
HCC1954
0
5
10
15
Vector NIC3
Re
lati
ve
Ex
pre
ssio
n o
f H
ey
2
MCF10a
0
5
10
15
pBp3 NIC3
Re
lati
ve
Ex
pre
ssio
n o
f H
ey
2
MCF12A
0
2
4
6
8
pBp3 NIC3
Re
lati
ve
Ex
pre
ssio
n o
f S
frp
2
MDA-MB-231
0
2
4
6
8
pBp3 NIC3
Re
lati
ve
Ex
pre
ssio
n o
f S
frp
2
HCC1954
0
2
4
6
pBp3 NIC3
Re
lati
ve
Ex
pre
ssio
n o
f S
frp
2
MCF10A
0
2
4
6
pBp3 NIC3
Re
lati
ve
Ex
pre
ssio
n o
f S
frp
2
MCF12A
* * * *
* *
49
Figure 2.4: Cancer-specific regulation of gene expression by Notch3
A. The scatterplot shows the log2fold change in expression in BLBC cells of genes that were
significantly disregulated (Fold Change > 2 or Fold Change < 0.5) in BLBC cells expressing
NIC3 compared to vector control and their corresponding log2fold change in expression in non-
cancerous cells.
B. The pie-chart represents the number of genes that are positively, negatively and uncorrelated in
BLBC and non-cancerous cells in response to NIC3 expression.
C. Histograms show change in expression of Notch target gene Hey2 in response to expression of
NIC3 as compared to vector control in BLBC cells MDA-MB-231 and HCC1954 and non-
cancerous MCF10A and MCF12A. *: P<0.01; Student’s T Test. D. The graphic shows all the signaling pathways whose genes are found to be cancer-specifically
disregulated in response to NIC3, as found by Ingenuity Pathway Analysis (IPA) along with the
predicted modulation of the signaling pathway in response to NIC3.
E. Histograms show change in expression of Wnt pathway antagonist Sfrp2 in response to
expression of NIC3 as compared to vector control in BLBC cells MDA-MB-231 and HCC1954
and non-cancerous MCF10A and MCF12A. *: P<0.01; Student’s T Test.
50
A
B
0
0.5
1
1.5
pBp3 pBp3
NIC3
Re
lati
ve
Ex
pre
ssio
n o
f
Ccn
d1
MDA-MB-231
0
0.5
1
1.5
pBp3 pBp3
NIC3
Re
lati
ve
Ex
pre
ssio
n o
f
Ccn
d1
HCC1954
0
0.5
1
1.5
pBp3 pBp3
NIC3
Re
lati
ve
Ex
pre
ssio
n o
f
Ccn
d1
MCF10A
0
0.5
1
1.5
pBp3 pBp3
NIC3
Re
lati
ve
Ex
pre
ssio
n o
f
Ccn
d1
MCF12A
0
0.2
0.4
0.6
0.8
1
1.2
pBp3 pBp3
NIC3
Re
lati
ve
Ex
pre
ssio
n o
f
MY
CN
MDA-MB-231
0
0.2
0.4
0.6
0.8
1
1.2
pBp3 pBp3
NIC3
Re
lati
ve
Ex
pre
ssio
n o
f
MY
CN
HCC1954
0.9
0.95
1
1.05
1.1
1.15
1.2
pBp3 pBp3
NIC3
Re
lati
ve
Ex
pre
ssio
n o
f
MY
CN
MCF10A
0
0.5
1
1.5
pBp3 pBp3
NIC3
Re
lati
ve
Ex
pre
ssio
n o
f
MY
CN
MCF12A
* *
* *
51
C
Figure 2.5: Comparison of gene expression levels in cancer cells versus non-cancer cells
Histograms show the change in expression of cancer-selective NIC3 responsive genes Ccnd1, MYCN and
Snai2 in BLBC cells MDA-MB-231 and HCC1954 and non-transformed mammary epithelial cells
MCF10A and MCF12A. *: P<0.01; Student’s T Test.
0
1
2
3
4
5
6
7
pBp3 pBp3
NIC3
Re
lati
ve
Ex
pre
ssio
n o
f
Sn
ai2
MDA-MB-231
0
1
2
3
4
5
6
7
pBp3 pBp3
NIC3
Re
lati
ve
Ex
pre
ssio
n o
f
Sn
ai2
HCC1954
0
1
2
3
4
5
6
7
pBp3 pBp3
NIC3
Re
lati
ve
Ex
pre
ssio
n o
f
Sn
ai2
MCF10A
0
1
2
3
4
5
6
7
pBp3 pBp3
NIC3
Re
lati
ve
Ex
pre
ssio
n o
f
Sn
ai2
MCF12A
*
*
52
A
B
Figure 2.6: Notch3 requires Sfrp2 for cancer-specifically restricting proliferation
A. Histogram shows endogenous expression levels of Sfrp2, as measured by qPCR in non-cancerous
mammary cells, MCF10A and MCF12A, and basal-like breast cancer (BLBC) cell lines, MDA-
MB-231 and HCC1954. *: P<0.01; Student’s T Test. B. Histogram shows effect of knocking down Sfrp2 and expressing NIC3 on cell proliferation of
BLBC cells MDA-MB-231 and HCC1954. Proliferation is measured by number of cells on the
plate-well 72 hours post seeding 50,000 cells within the well. *: P<0.01; ANOVA Test.
0
0.5
1
1.5
2
MCF10a MCF12a HCC1954 MDA-MB-231
Re
lati
ve
En
do
ge
no
us
Sfr
p2
E
xp
res
sio
n
0
50000
100000
150000
200000
250000
300000
350000
400000
450000
Ce
ll C
ou
nt
at
72
hrs
MDA-MB-231
0
20000
40000
60000
80000
100000
120000
140000
160000
180000C
ell
Co
un
t a
t 7
2 h
rs
HCC1954
* *
*
*
53
A
B C
0
0.2
0.4
0.6
0.8
1
1.2
1.4
Re
lati
ve
Ex
pre
ssio
n o
f C
cnd
1
0
0.5
1
1.5
Re
lati
ve
Ex
pre
ssio
n o
f C
cnd
1
0
0.2
0.4
0.6
0.8
1
1.2
1.4
Re
lati
ve
Ex
pre
ssio
n o
f M
YC
N
0
0.5
1
1.5
2
Re
lati
ve
Ex
pre
ssio
n o
f M
YC
N
0
0.5
1
1.5
2
2.5
3
3.5
4
Re
lati
ve
Ex
pre
ssio
n o
f T
GF
BR
1 HCC1954
0
0.5
1
1.5
2
2.5
3
3.5
4
Re
lati
ve
Ex
pre
ssio
n o
f T
GF
BR
1 MDA-MB-231
0
1
2
3
4
5
6
Re
lati
ve
Ex
pre
ssio
n o
f S
na
i2
MDA-MB-231
0
1
2
3
4
5
6
Re
lati
ve
Ex
pre
ssio
n o
f S
na
i2
HCC1954
* *
*
*
54
Figure 2.7: Cancer-specific Notch3 sensitive genes have a hierarchy of interactions
A. Histograms show expression change of Wnt target genes Ccnd1 and MYCN in response to
knocking down Sfrp2 and expressing Notch3 in BLBC cell lines MDA-MB-231 and HCC1954.
*: P<0.01; ANOVA Test.
B. Histograms show expression change of TGFb pathway gene Snai2 in response to knocking down
Sfrp2 and expressing Notch3 in BLBC cell lines MDA-Mb-231 and HCC1954.
C. Figure shows hierarchy of gene interactions between Notch3 and its cancer sensitive genes.
55
Figure 2.8:Notch3 knock-down lowers Sfrp2 expression in BLBC cells
Histograms show change in expression of Sfrp2 in response to Notch3 knockdown in BLBC cell
lines MDA-MB-231 and HCC1954. **:P<0.05; Student’s T Test.
0
0.2
0.4
0.6
0.8
1
1.2
Vector Notch3 1026 KD Notch3 1459 KD Notch3 833 KD
Re
lati
ve E
xpre
ssio
n o
f S
frp
2
MDA-MB-231
0
0.2
0.4
0.6
0.8
1
1.2
Vector Notch3 1026 KD Notch3 1459 KD Notch3 833 KD
Re
lati
ve E
xpre
ssio
n o
f S
frp
2
HCC1954
**
**
56
Chapter III
Conserved molecular interactions implicated in cancer selective control of cell growth by
Notch3 in mp53/Ras-transformed murine colon cells and BLBC
57
3.1 Abstract
CRGs are essential mediators of transformation in multiple cancers. Originally identified
in colorectal cancer downstream of mutant p53 and Ras, a subset of the CRGs were also found to
control cancer cell behavior in other epithelial cancers, including basal-like breast cancer, playing
a cancer-selective role. Previous studies investigating the molecular basis of the cancer-selective
role of CRGs like Notch3 in cancer cell growth found a unique cancer-specific genetic interaction
between Notch3 and Sfrp2, another CRG, in BLBC cells. Notch3 induces Sfrp2 to restrict cell
growth in BLBC cells, inhibiting Wnt pathway genes in the process. Our current studies find that
a similar genetic interaction exists between Notch3 and Sfrp2 in the murine mp53/Ras transformed
colon cells. Furthermore, this induction of Sfrp2 is necessary for the cell growth restricting role of
Notch3 but not sufficient to phenocopy the effect in both BLBC and transformed colon cells. Taken
together, these data suggest that common genetic interactions underlie the anti-proliferative effects
of Notch3 in both BLBC and transformed murine colon cells.
58
3.2 Introduction
The current body of cancer literature demonstrates cancer as a complex and heterogenous
collection of diseases (Greaves and Maley, 2012; The Cancer Genome Atlas Research Network et
al., 2013), subdividing and categorizing tumors on the basis of tissue of origin, genetic mutations
and histological markers (Perou et al., 2000; Nguyen et al., 2008; Shen et al., 2010; Lex et al.,
2012). However common themes emerge among the seemingly disparate cancers studied,
including common phenotypic features of the cancer cell, known as the hallmarks of cancer
(Hanahan and Weinberg, 2000; 2011), as well as a dependence on altered genetic circuits in the
form of oncogene cooperation (McMurray et al., 2008; Ashton et al., 2012; Eberl et al., 2012).
Hence, we predict that there may be other common underlying molecular features that appear in
seemingly different cancers. Moreover, accumulating evidence points to the dysregulation of
CRGs as a conserved, common feature in a number of cancer types, in particular between BLBC
and colon (Walters et al., unpublished; Chapter II). Thus, we hypothesize that the genetic
interactions observed downstream of Notch3 in BLBC would also feature in Notch3-mediated
growth arrest of transformed colon cells.
While studying how cancer-specific vulnerabilities may arise in BLBC, we identified a
novel interaction between CRGs of the Notch and Wnt pathway wherein Notch3 induces Wnt
pathway antagonist Sfrp2 to restrict BLBC cell growth in a cancer-selective manner, inhibiting
Wnt pathway genes Ccnd1 and MYCN as a consequence (Chapter II). Because we had evidence
that Notch3 also restricts growth of mp53/Ras transformed murine colon cells (mp53/Ras cells,
hereafter), we wanted to investigate whether the underlying molecular control points were
conserved in this model.
59
In mp53/Ras cells, our results will demonstrate a similar dependence of Notch3 on Sfrp2
for the growth restrictive effects of Notch3 activation. The downstream consequences of Notch3
introduction includes inhibition of canonical Wnt pathway target genes CCND1 and MYC, in a
manner depedent on Sfrp2induction. However, while induction of Sfrp2 is necessary for the anti-
growth effect of Notch3, exogenous expression of Sfrp2 is not sufficient on its own to cause growth
arrest in either BLBC or mp53/Ras cells. These studies begin to establish the existence of
commonalities not only among gene expression patterns but also among molecular interactions in
transformed murine colon cells and BLBC cells downstream of cooperating oncogenic mutations.
60
3.3 Results
3.3.1 Notch3 induces Sfrp2 to restrict proliferation in colorectal cancer
Both Notch3 and Sfrp2 were identified as a cooperation response gene synergistically
down-regulated in response to cooperation between the dominant negative mutant form of p53
(p53175H, abbreviated here as mp53) and oncogenic Ras (RasV12, abbreviated as Ras) within the
murine colorectal cancer model (mp53/Ras cells), in murine colon cells (McMurray et al., 2008).
Consistent with results in BLBC cells, activating Notch3 by expressing NIC3 in mp53/Ras cells
causes growth arrest in vitro and significantly inhibits tumor formation in vivo (Figure 2.1A; Figure
3.1). Experiments testing for dependence of Notch3 on Sfrp2 induction in BLBC revealed a critical
role for Sfrp2 in the context of increased Notch3 activity (Chapter II). Hence, we wanted to test
whether the genetic interaction between Notch3 and Sfrp2 existed in mp53/Ras cells, and if so
whether this interaction was critical in control of mp53/Ras cell growth as in BLBC cells. To begin
comparing mp53/Ras and BLBC circuitry, we tested whether Sfrp2 expression was increased upon
Notch3 activation by expression of the NIC3 in mp53/Ras cells (Figure 3.2A). Comparison of
NIC3-expressing cells with vector control populations shows significant increase in Sfrp2
expression in response to NIC3.
Since Notch3 inhibits growth of mp53/Ras cells, we wanted to further test whether this
effect of Notch3 depends on the induction of Sfrp2. Thus, we introduced NIC3 into mp53/Ras
cells with or without shRNA to knock down Sfrp2 expression and cell growth in vitro (Figure
3.2B). We observed that while cells with NIC3 expression alone show reduced growth, this was
rescued by reduced expression of Sfrp2 with no significant difference in cell accumulation between
vector control cells and cells with NIC3 introduced on a background of Sfrp2 knock-down.
Reduced expression of Sfrp2 alone had no significant effect on cell growth, suggesting that, as in
61
BLBC cells, restriction of mp53/Ras cell growth by Notch3 activation is dependent on Sfrp2
induction.
3.3.2 Inhibition of Wnt pathway genes in response to Notch3 activation depends on Sfrp2
induction
Our previous work in BLBC cells revealed that along with Sfrp2 induction, Notch3
activation inhibits the expression of Wnt pathway target genes CCND1 and MYCN. Because
NIC3-driven growth arrest appears to depend on Sfrp2 in mp53/Ras cells, we tested whether
additional features of the response to NIC3 expression were similarly dependent on Sfrp2 in
mp53/Ras cells and BLBC cells. First, we simply examined the expression of CCND1 and MYCN
in response to NIC3 introduction into mp53/Ras cells (Figure 3.2A). We observed that while NIC3
expression caused a significant decrease in expression of Ccnd1 in mp53/Ras cells, it did not cause
a strong decrease in expression of MYCN. We also tested the change in expression of MYC, a
gene that is closely related to MYCN, and observed that NIC3 expression strongly and
significantly decreased the expression of MYC in mp53/Ras cells. Hence, in mp53/Ras cells MYC
replaces MYCN in its ability to respond to NIC3 expression.
Further, because in BLBC, we observed that inhibition of Wnt pathway target genes
CCND1 and MYCN in response to NIC3 expression depended upon the induction of Sfrp2, we
asked whether a similar relationship exists between Notch3, Sfrp2, Ccnd1 and Myc in mp53/Ras
cells. To test this, we measured the expression of CCND1 and MYC in NIC3 expressing cells with
or without knock-down of Sfrp2 (Figure 3.2B), finding that while NIC3 expression resulted in
decreased levels of CCND1 and MYC, NIC3 expressing cells in which Sfrp2 was suppressed
62
showed little change in levels of CCND1 and MYC expression, with expression of these genes in
NIC3/Sfrp2 KD cells similar to levels seen in vector control cells. These results show that Sfrp2
induction is necessary for suppression of CCND1 and MYC expression in response to Notch3
activation in mp53/Ras cell, consistent with results from BLBC cells.
3.3.3 Sfrp2 induction is not sufficient to inhibit cancer cell growth
Since Sfrp2 induction is necessary for Notch3 mediated growth arrest in both BLBC cells
and mp53/Ras-transformed colon cells, we wanted to test whether Sfrp2 induction alone is
sufficient to cause growth arrest in cancer cells. To test this, we overexpressed Sfrp2 in the
mp53/Ras colorectal cancer cells as well as two basal-like breast cancer cell lines MDA-MB-231
and HCC1954 and monitored cell growth over time (Figure 3.3A, 3.3B). We observed that in both
the colorectal cancer and basal-like breast cancer cells, there is no significant change in cell growth
in response to Sfrp2 expression. To control for the possibility that the lack of response might relate
to insufficient expression of Sfrp2, we measured the levels of Sfrp2 expression in the perturbed
BLBC and mp53/Ras cells and found that Sfrp2 expression is increased at levels similar to its
induction in response to NIC3 expression (Figure 3.3C). Hence, it appears that while Sfrp2
induction is necessary for the cancer cell response to NIC3, expression of Sfrp2 by itself is not
sufficient to drive growth arrest in cancer cells.
63
3.4 Discussion
Previous studies have demonstrated that CRGs identified downstream of mp53 and Ras in
murine transformed colon cells play a critical role in regulation of other epithelial cancers like
pancreatic cancer and BLBC (Kinsey et al., 2014; Walters et al., unpublished; Chapter II). Our
current studies find that alongside the role of individual CRGs being conserved across multiple
cancer types, we demonstrate that the role of interactions between CRGs are also conserved across
cancer types and between murine and human cells. Notch3 serves as an example of a CRG that
plays similar roles in colorectal cancer and basal-like breast cancer as a critical regulator of cancer
cell growth. Comparing the responses of BLBC cells and their non-transformed counterparts to
perturbation of Notch3 expression revealed a novel mechanism underlying Notch3-mediated arrest
that appears to have shared features in mp53/Ras transformed colon cells.
Our current work finds that similar to BLBC cells, transformed colon cell growth is
regulated by Notch3 through a mechanism involving induction of Sfrp2 that inhibits the expression
of cell cycle-regulator Wnt pathway targets. It is interesting to note that low Notch3 expression in
cancer cells allows high MYCN levels in BLBC, while in transformed colon cells, MYC appears
to a Wnt target. Both c-Myc, encoded by the MYC gene, and n-Myc, encoded by the MYCN gene,
belong to the same family of proteins that controls cellular proliferation, differentiation and
apoptosis (Facchini and Penn, 1998), sharing gene and protein structural features (Henriksson and
Luscher, 1996). In fact, n-myc has been shown to be able to molecularly replace c-myc in
controlling proliferation and differentiation (Malynn et al., 2000). Hence, we consider that altered
action of canonical Wnt signaling on either of these genes observed in response to NIC3 expression
would have similar impact on BLBC and mp53/Ras cells.
64
The induction of Wnt antagonist Sfrp2, along with the inhibition of Wnt pathway genes in
response to NIC3 expression in BLBC and colorectal cancer cells support the hypothesis that
Notch signaling plays a tumor suppressive role by repressing Wnt signaling. This data agrees with
previous observations in colorectal cancer and basal-cell carcinoma of the skin where Notch
behaves in a tumor suppressive role by inhibiting Wnt signaling (Nicolas et al., 2003; Kim et al.,
2012). Notch1 deletion in skin cells leads to transformation, and the basal-cell carcinoma cells
formed are found to possess high levels of nuclear localization of β-catenin, a sign of increased
canonical Wnt signaling (Nicolas et al, 2003). In the APCmin colorectal cancer model, where β-
catenin activity is independent of the APC machinery, Notch1 acts a tumor suppressor by
recruiting the epigenetic modifier SETB1 to repress β-catenin driven transcription (Kim et al.,
2012). Hence, uncontrolled activation of canonical Wnt signaling may be a required mechanism
driving cancer cell proliferation, and down-regulation of Notch family members via oncogene
cooperation may represent a mechanism for cancer cells to allow higher Wnt signaling in the
absence of Wnt pathway mutations.
Thus, in conclusion, we observe that Notch3 restricts cancer cell growth by a similar
mechanism in both BLBC and colorectal cancer cells, showing that not only roles but also
interactions among CRGs are conserved across cancer types. We characterize a genetic interaction
between Notch3 and Sfrp2 that controls cell growth and observe inhibition of Wnt pathway genes
that is dependent on the genetic interaction. We also observe that even though Notch3 activation
depends on Sfrp2 induction to restrict cell growth, induction of Sfrp2 induction by itself is not
sufficient to control cell growth. Together, these results suggest that cancer cells depend on
elevated Wnt signaling to drive cancer cell growth and down-regulation of Notch pathway genes
65
downstream on oncogene transformation is a mechanism by which cancer cells maintain such
elevated levels of Wnt signaling.
66
3.5 Figures
A
B
0
2
4
6
8
10
12
pBp3 pBp3 NIC3
Re
lati
ve E
xpre
ssio
n o
f S
frp
2
0
500000
1000000
1500000
2000000
2500000
Vector Sfrp2-KD
Ce
ll C
ou
nts
Control NIC3
*
*
67
Figure 3.1: Notch3 restricts cell growth via induction of Sfrp2 in colon transformed cells
A. Histogram shows the effect of Notch3 intracellular domain (NIC3) on the expression
levels of Sfrp2 in mp53/Ras cells, as measured by qPCR. *:P<0.01
B. Histogram shows effect of knocking down Sfrp2 and expressing NIC3 on cell
proliferation of mp53/Ras cells. Proliferation is measured by number of cells on the plate-
well 48 hours post seeding 50,000 cells within the well. *:P<0.01
68
A
0
0.2
0.4
0.6
0.8
1
1.2
pBp3 NIC3
Re
lati
ve e
xpre
ssio
n o
f
CC
ND
1
0
0.2
0.4
0.6
0.8
1
1.2
pBp3 NIC3
Re
lati
ve E
xpre
ssio
n o
f
MY
CN
0
0.2
0.4
0.6
0.8
1
1.2
pBp3 NIC3
Re
lati
ve E
xpre
ssio
n o
f
MY
C
*
*
*
69
B
Figure 3.2: Notch3 inhibits canonical Wnt pathway gene expression by induction of Sfrp2
A. Histograms show the change in expressions of Ccnd1, MYC and MYCN in response
to NIC3 expression in mp53/Ras cells. *: P<0.01; ANOVA Test.
B. Histograms show expression change of Wnt target genes Ccnd1 and MYC in
response to knocking down Sfrp2 and expressing Notch3 in mp53/Ras cells. *:
P<0.01; ANOVA Test
0
0.2
0.4
0.6
0.8
1
1.2
Vector Sfrp2 KD NIC3 Sfrp2 KD NIC3
Re
lati
ve E
xpre
ssio
n o
f C
CN
D1
0
0.2
0.4
0.6
0.8
1
1.2
Vector Sfrp2 KD NIC3 Sfrp2 KD NIC3
Re
lati
ve E
xpre
ssio
n o
f M
YC
*
*
70
A
.00
2.00
4.00
6.00
8.00
10.00
Vector Sfrp2
Re
lati
ve E
xpre
ssio
n o
f
Sfr
p2
mp53/Ras
0
1
2
3
4
5
6
Vector Sfrp2
Re
lati
ve E
xpre
ssio
n o
f
Sfr
p2
MDA-MB-231
0
1
2
3
4
5
Vector Sfrp2
Re
lati
ve E
xpre
ssio
n o
f
Sfr
p2
HCC1954
*
*
*
71
B
Figure 3.3: Sfrp2 induction is insufficient to phenocopy Notch3 activation
A. Histograms show Sfrp2 expression upon over-expression in mp53/Ras cells and
BLBC cells MDA-MB-231 and HCC1954. *:P<0.01; Student’s T Test.
B. Line graphs show effect of Sfrp2 overexpression in mp53/Ras cells and BLBC cells
MDA-MB-231 and HCC1954 with continuous line showing vector control cells and
dashed line showing Sfrp2 expressing cells.
0
500000
1000000
1500000
0 hrs 24 hrs 48 hrs 72 hrs 96 hrs
Ce
ll C
ou
nts
mp53/Ras
pBp3 pBp3 Sfrp2
0
100000
200000
300000
400000
0 hrs 48 hrs 96 hrs
Ce
ll C
ou
nts
MDA-MB-231
pBp3 pBp3 Sfrp2
0
50000
100000
150000
0 hrs 48 hrs 96 hrs
Ce
ll C
ou
nts
HCC1954
pBp3 pBp3 Sfrp2
72
Chapter IV
A novel statistical model for identification of synergistically regulated genes
73
4.1 Abstract
Identifying molecular differences between normal and cancer cells is an important first step
in identifying specific vulnerabilities present in cancer cells. Identified as key gene expression
changes occurring downstream of cooperating oncogenes, CRGs have been found to be essential
mediators of the transformation process, regulating cancerous phenotypes in multiple cancers. Via
transcriptional profiling of a model of malignant transformation in which the contribution of each
oncogenic mutation to the gene expression profile can be assessed, CRGs were initially identified
by an ad hoc ‘synergy score’. Here we propose a simple, rigorous statistic to quantify such synergy.
Our statistic provides a number of attractive features, most important of which is a better
accounting for variability in gene expression data used to search for CRGs. We apply our synergy
statistic to expression profiles of colon cells expressing a dominant negative mutant form of the
tumor suppressor p53 or a constitutively active form of the proto-oncogene Ha-Ras, or the two
together. The new method discovers new genes that may play a role in the malignant phenotype,
with at least one such novel gene identified as promoting tumor formation, such that reducing
expression of this gene by genetic perturbation significantly reduced tumor formation by
mp53/Ras-transformed colon cells. This new method for identification of CRGs will aid in future
searches for tumor regulatory molecules in models of malignant cell transformation.
74
4.2 Introduction
Arising from a normal cell, cancer cells accumulate various key molecular changes
including change in gene expression in order to develop aberrant tumorigenic characteristics
(Zhang et al., 1997; Golub et al., 1999; Ross et al., 2000). The cancer cell becomes dependent on
some of these aberrant gene expression changes, a phenomenon known as non-oncogene addiction
(Solimini et al., 2007; Luo et al., 2009). Interestingly, resetting the expression of such non-mutated
genes critical for the cancer cell is often found to affect cancer cells adversely but produces no
effect on normal cells (Conde et al., 2001; Dewhirst et al.,2008; Dai et al., 2007; Solimini et al.,
2007; Luo et al., 2009). Identification of critical non-mutated genes and pathways could provide
multiplicity of cancer-specific targets.
Malignant transformation of a cell occurs by cooperation between mutated oncogenes and
tumor suppressors (Land et al., 1983; Parada et al., 1984). One way to discover non-mutated genes
with a critical role in the cancer cell is by identifying changes in gene expression that occur
synergistically in response to cooperating oncogenic mutations. Quantifying cooperative
regulation has already proven a promising systems biological method for finding non-oncogenes
(McMurray et al., 2008; Ashton et al., 2012; Eberl et al., 2012). McMurray et. al. described a novel
use of transcriptomics to find gene expression changes essential to the cancer phenotype in a
murine model of colon transformation by identifying genes with synergistically regulated
expression in response to the presence of cooperating oncogenes (Figure 4.1) (McMurray et al.,
2008). By comparing the transcriptome of mp53/Ras transformed murine colon cells with
expression patterns of murine colon cells containing each mutated gene individually, they were
able to quantify the synergistic effects the two oncogenes had on polysomal RNA expression.
Functional testing of synergistically and non-synergistically regulated genes revealed a gene set
75
rich in critical regulators of tumor formation, dubbed as the Cooperation Response Genes (CRGs).
More recent experiments demonstrate that the role of CRGs is conserved in a number of human
cancers and that modulation of CRGs frequently has strong and specific anticancer effects
(McMurray et al., 2008; Kinsey et al., 2014; Walters et al., unpublished; McMurray et al.,
unpublished). CRGs have also been identified and characterized in other types of cancer, including
blast crisis chronic myelogenous leukemia and basal cell carcinoma (Ashton et al. 2012; Eberl et
al., 2012).
Synergy in this context is a non-additive change in gene expression, occurring because of
interaction between the oncogenic mutations that drive transformation; these synergistic effects
exceed the expected additive effects based on the effects of the individual mutations (Perez-Perez
et al., 2009). To date, identification of CRGs has depended on a synergy score that compared the
mean expression of a given gene in cells harboring multiple mutations with the sum of the mean
expressions of that gene in cells with each oncogenic mutation alone. If the change in expression
of that particular gene in response to cooperating mutations is more than the sum of change in
expression of the gene due to the presence of each mutation individually, the gene is classified as
synergistically dysregulated (McMurray et al., 2008). This approach was also used to identify
genes cooperatively dysregulated downstream of a combination of two pharmacological agents
that produced synergistic anticancer effects upon treatment of renal cell carcinoma cells (Han et
al., 2012). However computation of a synergy score based on mean expression values does not
take into account the variation in gene expression of a gene across multiple replicates, causing the
mean to be biased by outliers in the data. (Figure 4.2)
As a proposed solution to better account for variability in gene expression during
identification of cooperative responses, we define synergy as a deviation from additive effect. In
76
particular, gene expression values are modeled as a two-way ANOVA that considers the effect of
each mutation and their combination. Using a proper statistical procedure allows us to model the
noise in the system and properly account for variability by using well understood p-values. We
will show that this novel method has strong detection ability while keeping the false discoveries
to a minimum by looking at the receiver operating characteristic (ROC) curve and discuss selecting
a cut-off point.
Applying the proposed method to data from mp53/Ras-mediated transformation of murine
colon cells, we find that we identify almost the entire original set of CRGs ( 83 out of 95 identified
in McMurray et al., 2008). Using this new statistical procedure, we also identified twelve new
CRGs, and tested the biological role of one of these CRGs, Clca1, by genetic perturbation and
finding reduced tumor formation capacity of mp53/Ras-transformed cells upon knock-down of
this gene. Thus, we report a modified procedure for identification of CRGs in genome scale gene
expression data that robustly identifies genes critical to the malignant phenotype, including a novel
regulator of tumor transformation, Clca1.
77
4.3 Results
In order to identify genes synergistically disregulated downstream of cooperating
oncogenic mutations, we compared gene expression profiles of young adult murine colon (YAMC)
cells expressing either a dominant negative mutant of p53, p53175H (hereafter, mp53), or an
activated form of Ha-Ras, H-Ras12V (hereafter, Ras), both mutant proteins (mp53/Ras) or and
normal parental cells, as described in McMurray et al. (2008). We restricted our investigation to
538 genes differentially expressed between mp53/Ras and YAMC cells, 226 of which are up-
regulated and 312 of which are down-regulated.
We first performed a linear regression analysis on the differentially expressed genes of the
form:
expression ~ bp * p53 + br * Ras + bpr * (p53 ^ Ras)
We ranked the dysregulated genes according to their score. (Figure 4) The first 95 genes ordered
by linear regression were considered CRGs to allow for direct comparison of the outputs of the
linear model with the original synergy score and were further considered for their importance.
In order to assess whether the linear modeling approach identifies a set of genes enriched
for regulators of the malignant phenotype, we considered the 34 genes that have been evaluated
for their effects on tumor growth, as described by McMurray et al. (2008). As with the synergy
score method, it was necessary to separate genes up-regulated in mp53/Ras cells as compared to
YAMC cells from those down-regulated in mp53/Ras cells as compared to YAMC cells, prior to
analyzing the distribution of tumor inhibitory genes over the ranking of synergistic response to
cooperating oncogenes. Among the up-regulated genes, we observe that the ranking procedure
tends to order genes that regulate tumor formation, as shown by red lines, ahead of non-tumor
regulatory genes, as shown by black lines, showing enrichment of genes critical to the cancer
phenotype (Figure 4.3A). For down-regulated genes, however, application of the linear model has
78
a milder effect on the separation of tumor inhibitory genes as compared non-tumor inhibitory
genes, while still producing some separation of this characteristic (Figure 4.3B).
We also drew Receiver Operating Characteristic (ROC) curves, representing the relative
rates of false positives to true positives for our ranking of up-regulated genes and down-regulated
genes, considering genes whose perturbation is tumor inhibitory as true positives and genes whose
perturbation is not tumor regulatory as false positives. Application of the linear model performed
favourably for both up- and down-regulated genes, with up-regulated genes showing the most
consistently high true positive rates with low false positive rates (Figure 4.3C). The ROC curve
indicates that we can keep the false negative rate below 10% for the up-regulated genes and below
20% for the down-regulated genes while obtaining high sensitivity of 70-80%. We also learn from
the ROC curve that selection of a particular p-value cut-off point would not change the false
positive and negative detection rates. This analysis shows that the proposed linear modeling
approach can effectively identify synergistically regulated genes, segregating genes with tumor-
inhibitory potential with a low false positive rate.
Next, we compared the performance of the linear model against the original synergy score.
By plotting the genes according to their score from the linear model as a function of the reported
synergy score (McMurray et al., 2008), we observe that the tumor inhibitory genes, represented by
red circles, are ranked earlier as CRGs by the linear modeling method than by the original synergy
score (Figure 4.4A). Similarly, ROC curves representing the true positive rate versus false positive
rate of linear modeling versus synergy score, we found that the linear model performs better than
the synergy score, considering tumor-inhibitory genes as true positives and non-inhibitory genes
as false positives. Co-plotting ROC curves for both classifiers shows a slight advantage for linear
modeling over the synergy score, in terms of segregating tumor inhibitory genes (Figure 4.4B).
79
On analyzing the actual list of CRGs identified by synergy statistic, we found that 84 of
the genes identified were part of the original set of CRGs, as ranked by synergy score. The linear
model identified twelve new genes that appear to be synergistically regulated in mp53/Ras-
transformed colon cells. Five of these genes were up-regulated in expression, while seven of them
are down-regulated in expression (Figure 4.5A). These genes are known to regulate varied
biological functions (Figure 4.5B).
We start testing the importance of these new CRGs with Clca1, the CRG with the highest
expression. Clca1 expression was reset in mp53/Ras cells with the aim of achieving YAMC cell
levels of expression (Figure 4.6A) , and tumor formation capacity of perturbed cells was compared
to unperturbed control cells. Interestingly, tumors formed by cells with reduced expression of
Clca1 were significantly smaller as compared to vector control cells (Figure 4.6B), showing that
high levels of Clca1 are required for the maintenance of malignant cancer cells.
80
4.4 Discussion
CRGs have been shown to be play a key role in malignancy of various kinds of cancers,
including colorectal cancer, acute myeloid leukemia, pancreatic cancer and breast cancer
(McMurray et al., 2008; Ashton et al., 2012; Kinsey et al., 2014; Walters et al., unpublished).
Identification of synergistically regulated genes provides an effective method for discovery of
critical regulators of cancer cell function. Here, we refine the procedure for identifying CRGs by
accounting for variability in gene expression data as measured by transcriptomic methods. The
approach of applying a linear model and identifying genes whose expression does not fit this model
is a more elegant and rigorous statistical method to find synergistically regulated genes.
Our statistical measure of synergy compares favorably to the original synergy score
described by McMurray et. al. In direct comparison to the synergy score, the linear modeling
approach proposed here ranks differentially expressed genes in a similar order (Figure 4.3A). In
contrast to synergy score, however, our statistic penalizes many genes quite heavily, based on
variation in their expression values across biological replicates in the dataset. In comparing each
of these methods for identifying to known effects of perturbation of genes in this set, we see the
ROC curves (Figure 4.3B) favor our linear synergy model over the original synergy score, both
for up and down regulated genes (Figure 4.3C), providing a quantitative measure of the improved
selection of tumor inhibitory genes by the linear model.
The linear model prioritizes genes biologically relevant to the cancer phenotype, arguing
that the more consistent and strong the cooperative effects of the oncogenic drivers on gene
expression, the more likely a gene is to play a role in the cancer phenotype.. Among genes
differentially expressed between normal and transformed cell lines, our model very strongly favors
genes found through testing via tumor formation assays to be relevant to the cancer phenotype.
81
Application of the linear model to mp53/Ras cooperation-driven transformation of colon
cells data identifies new CRGs including the gene Clca1. Clca1 belongs to the family of Ca2+-
activated chloride channel proteins that help that cell sense its environment, based on osmotic ion
concentration. (Gruber et al., 1998) The role of chloride channel activation is not well understood
in the context of cancer. The activation of other voltage-dependent chloride channels is required
for invasiveness of malignant gliomas and the volume-sensitive chloride channel activation is
found to be required for transformation of cervical epithelium (Chou et al., 1995; Soroceanu et al.,
1999). Interestingly, we find that the expression of Clca1 is synergistically up-regulated in
mp53/Ras cells, and suppression of Clca1 significantly reduces tumor formation in vivo,
demonstrating a novel role for this protein in cancer.
Consequently, the proposed linear modeling approach to identify synergistic responses to
cooperating oncogenic mutations stands validated, both in absolute terms, and relative to the
previous measure of synergy, in its ability to identify genes dysregulated by altered expression
rather than mutation that are essential for transformation. These methods remain valuable tools for
quantifying non-additive regulation.
82
4.5 Figures
Figure 4.1: ‘Cooperation Response Genes’, downstream effectors of interaction between
oncogenic mutations. Scheme illustrating that CRGs are essential mediators of cell
transformation downstream of cooperating oncogenic mutations that control multiple cellular
process required for malignant transformation.
83
Figure 4.2: Examples of synergistic and non-synergistic expression patterns. Expression
levels are shown for each cell line on two genes, one that shows synergistic expression (A), and
one that shows merely additive expression (B). Green lines mark where bpr = 0 in transformed
expression.
84
Figure 4.3: Linear modeling synergy coefficient classifies tumor inhibitory genes. For up-
regulated (A), and down-regulated (B) genes, our classifier ranks tumor inhibitory genes (in red)
favorably. Receiver Operating Characteristic (C) shows the relative rates of False Positive to True
Positive acceptance for our rankings of up-regulated and down-regulated genes, where tumor
inhibitory genes are considered true positives, and non-inhibitory genes false positives. Here we
see favorable performance on both up- and down-regulated genes, with better performance on the
up-regulated.
85
Figure 4.4: Comparison of linear modeling to the original classifier, synergy score. (A) Scatter
plot indicates rank order of significance of interaction in gene expression (p-value, t-test), as
identified by the general linear model (y-axis), compared to the rank order of synergy, as identified
by synergy score (x-axis). Dots are color coded to indicate the effect of perturbation of each gene
on tumor formation capacity of mp53/Ras cells (red, significant reduction in tumor volume; black,
no significant change in tumor volume; gray, not perturbed). Gray lines denote cut-offs in each
ranking. (B) Receiver operating characteristic (ROC) curves show the rate of identification of true
positive genes as compared to false positives for the synergy score (red line) and the general linear
model (blue line). Random chance is indicated by the green diagonal line. The area under each
curve (AOC) is a measure of improvement over random chance. AOC values for linear model and
synergy score are shown below the graph.
86
Figure 4.5: Novel CRGs found by linear modeling. Linear modeling selects 95 CRGs, of which
12 are new. These CRGs span a number of biological processes within the cell (A). The novel
CRGs are shown below (B) on a plot of differential expression between YAMC and mp53/Ras
cells, color coded according to their function.
87
A
B
0
0.2
0.4
0.6
0.8
1
1.2
pLKO.1 Clca1 #1 Clca1 #2
Re
lati
ve
Ex
pre
ssio
n o
f C
lca
1
* *
**
88
Figure 4.6: Knock-down of the newly identified CRG, Clca1, inhibits tumor growth. (A) Bar
graphs show expression of Clca1 in mp53/Ras cells expressing shRNAs targeting Clca1. *: p <
0.01; Student’s T Test. (B) Box plots show tumor volume at 4 weeks post injection, from
mp53/Ras cells stably expressing either of two shRNA constructs targeting the newly identified
CRG, Clca1. ** indicates significantly smaller tumors, as compared to vector control (p < 0.05,
unadjusted, Wilcoxon signed-rank test).
89
Chapter V
Discussions
90
5.1 Summary of findings
CRGs represent critical mediators of cancerous transformation present downstream of
cooperating oncogenes. Remarkably, CRGs appear to represent a point of convergence across
distinct types of cancer, playing a similar role in malignancy of human colon, basal-like breast,
pancreatic and prostate cancers (McMurray et al., 2008; Kinsey et al., 2014; Walters et al.,
unpublished; McMurray et al., unpublished). Work done in the basal-like breast cancer model has
shown that resetting CRG expression has cancer-selective effects, inhibiting BLBC growth with
little effect on non-transformed cells (Walters et al., unpublished). My work begins to explore how
such cancer-selective effects of CRGs can arise, with a focus on Notch3 as an example because of
the critical role of this gene in malignant cell growth (Chapter II, Figure 1), the key role of Notch3
in cancer-selective effects of pharmacological targeting of CRGs (Chapter I) and hints at the
potential underlying mechanism by which Notch3 might impinge on cancer cell function
(Almudevar et al., 2011).
Notch3 is a cell surface receptor and transcription factor whose expression is down-
regulated in BLBC cells as compared to non-transformed mammary epithelial cells. In Chapter II
of this thesis, I demonstrate that activation of Notch3 causes a cancer-selective growth inhibition
in BLBC cells, while similar perturbation in non-transformed mammary epithelial cells has no
effect on growth. I discover that there is a cancer-specific transcriptional response to activation of
Notch3, part of which is required for cell growth restriction in response to Notch3 in BLBC.
Specifically, I identify a novel interaction between Notch and Sfrp2, a known Wnt pathway
antagonist, and show that this genetic interaction is essential for Notch3 to control BLBC cell
growth, concomitant with Sfrp2-dependent changes in expression of cell cycle regulatory genes.
Taken together, this work demonstrates a novel genetic interaction present in BLBC but not non-
91
cancerous cells involving Notch and Wnt pathway genes that is essential for the cancer-selective
role of Notch3 in restricting BLBC growth.
Since reduced Notch3 expression is also essential for cell growth in transformed murine
colon cells, in Chapter III of the thesis, I test whether similar architecture underlies Notch3-
mediated growth inhibition in mp53/Ras-expressing colon cells. I discovered that just as in BLBC
cells, Notch3 activation drives an induction of Sfrp2 and consequently reduces cell growth while
inhibiting Wnt pathway target genes in transformed colon cells. I further demonstrate that Sfrp2
induction by itself is not sufficient to inhibit cancer cell growth in either BLBC cells or transformed
colon cells. Collectively, Chapter II and Chapter III elucidate how Notch3 restricts cancer cell
proliferation and characterize a genetic interaction between Notch3 and Sfrp2 that is essential for
this cancer-selective growth inhibitory action of Notch3.
Chapter IV describes a statistical model that refines the method for identifying CRGs. The
statistical method, based on a linear regression model, rank orders genes differentially expressed
in cancer based on the degree non-additivity in their response to the presence of cooperating
oncogenic lesions, while accounting for variance across replicates of gene expression data. We
find that this linear model performs better than the original synergy score in eliminating false
positives, defined as genes with a low probability of inhibiting tumor formation. While 83 of the
genes originally identified as CRGs by the synergy score metric are also identified by the new
linear model, twelve new genes are identified as CRGs. We test the importance of one of the new
CRGs, Clca1 and find that suppressing Clca1 expression in mp53/Ras cells causes a significant
reduction in tumor formation. Hence, the proposed linear modeling approach is a useful method
for identifying CRGs that are critical for tumor formation.
92
5.2 Significance of Findings
Arising from normal cells as a result of malignant transformation, tumor cells differ vastly
from their cell of origin at the level of genetic and epigenetic changes to DNA (Feinberg and
Tycko, 2004; Pleasance et al., 2010), at the level of functional output or phenotype (Hanahan and
Weinberg, 2000; 2011) as well as at the level of gene expression (Zhang et al., 1997; Baylin et al.,
2001). Researchers first started to target cancer cells through exploitation of phenotypic
differences between cancer and normal cells, such as ability to grow rapidly, using agents that
target DNA replication or cell division (Esposito et al., 2013; Hurley, 2002). More recently, the
focus has shifted to targeting oncogenic mutations for cancer-selective inhibition of cancer growth
(Weinstein 2002; Weinstein and Joe, 2006; Weinstein et al., 2008). My work and that of others
demonstrate that cancer selective targeting can also be achieved through targeting changes in gene
expression that are essential for the cancer cell to regulate cancer cell behavior (Luo et al., 2009;
Solimini et al., 2007; Conde et al., 2001; Dewhirst et al.,2008; Dai et al., 2007).
While mutations in oncogenes and tumor suppressors drive the transformation process and
cancer cells are often found to be addicted to these mutated genes, it is not simple to target many
genes known to harbor frequent oncogenic mutations. For example, activated oncogenes that lack
kinase activity, such as MYC and other transcription factors, have proven to be difficult to target
pharmacologically (Prochownik, 2004; Luo et al., 2009). Moreover, by virtue of the fact that they
are lost in cancer, tumor suppressor genes have never successfully been reactivated in a clinically
useful fashion (Knudsen and Knudsen, 2008; Hong et al., 2014). Hence, it is essential to identify
other kinds of changes that mediate the transformation process and are essential for the functioning
of cancer cells. CRGs are enriched in such non-mutated regulators of malignant cell transformation
to which the cancer cell is addicted. Understanding how cancer cells are addicted to CRGs reveals
93
important mechanisms that underlie cancer-specific action of these genes and provides an
opportunity to identify additional cancer-specific dependencies that can potentially be targeted.
Though CRGs were first identified in the murine colon cells transformed by mutant p53
and activated H-Ras, a subset of CRGs are found to be essential in multiple epithelial cancers
including BLBC. The BLBC model system provides an opportunity to compare the behavior of
transformed cells and non-transformed cells in response to CRG perturbations and previous studies
from our lab had shown that CRGs can play a cancer-specific role in BLBC (Walters et al.,
unpublished). My thesis work begins to tease apart how CRGs can control malignant cell growth
in a cancer-specific manner, focusing on Notch3. The most important observation that can be made
when considering the whole body of my work is the discovery that Notch3 cancer-selectively
inhibits cell growth by eliciting differential transcriptional responses in cancer cells versus non-
cancer cells.
Notch3 belongs to the family of Notch receptor proteins and is found to restrict cancer cell
growth in the BLBC and colorectal cancer model. While characterizing the cancer-specific
response to Notch3 activation in BLBC cells versus non-cancerous breast cells, I observed a
differential transcriptional response between cancer cells and non-cancer cells. This correlates to
previous in silico observations in colorectal cancer where modeling of gene regulatory networks
in cancer cells versus non-cancer cells found that that transcriptional responses of many signaling
pathways changed in cancer cells, with transcription factors like Gli2 and Asxl1 losing most of its
old interactions with other genes and gaining new interactions on transformation (Cordero et al.,
2014). Similarly, another study found that multiple myeloma cells are dependent on IRF4, a
transcription factor, due to differential transcriptional response between cancer cells and normal
B-cells (Shaffer et al., 2008). The differential transcriptional response to Notch3 activation that I
94
observe in cancer cells versus non-cancer cells could be a consequence of the dosage of activated
Notch3 in cancer cells and non-cancer cells. Hence, my work contributes to the body of work
addressing how certain signaling pathways play differential roles in cancer cells via regulation of
transcriptional targeting.
From this study, we identify a previously unidentified interaction between Notch3 and
Sfrp2, occurring in BLBC but not non-cancerous cells, which is essential for Notch3 mediated
inhibition of cancer cell growth. Interestingly, Sfrp2, a CRG , down-regulated in transformed
mp53/Ras expressing colon cells and is similarly dysregulated in BLBC. Sfrp2 is known to
antagonize Wnt signaling in various contexts, suggesting that reduced Sfrp2 expression would
promote Wnt signaling and cell growth, which is consistent with my results showing that Sfrp2
induction upon Notch3 activation is a key part of BLBC growth inhibition (Kawano and Kypta,
2003; Esteve et al., 2011). Consistently, we also observe the inhibition of downstream targets of
the Wnt pathway upon Notch3 activation, and these changes are dependent on Sfrp2 induction.
The relationship we observe between Notch and Wnt signaling in BLBC cells is consistent with
other models of cancer in which Notch signaling plays a tumor suppressive role. For example,
Notch1 deletion in skin cells leads to transformation, and the resulting basal-cell carcinoma cells
have increased canonical Wnt signaling as measured increased nuclear localization of β-catenin
(Nicolas et al, 2003). In the APCmin intestinal cancer model, where β-catenin is hyperactivated
through loss of the APC machinery, Notch1 acts a tumor suppressor by recruiting the epigenetic
modifier SETB1 to the promoters of Wnt target genes, which represses β-catenin driven
transcription (Kim et al., 2012). Hence, inhibition of canonical Wnt signaling may be a required
mechanism by which Notch signaling exerts tumor suppressive action.
95
While the genetic interaction between Notch3 and Sfrp2 was first characterized in BLBC,
it is interesting to note that the genetic relationship is also found in the murine colon transformation
model, as reported in Chapter III. This piece of evidence suggests that while CRGs are often
similarly dysregulated in different kinds of cancers, the genetic circuitry underlying the
dysregulation of CRGs is also quite similar at least for these relationships in BLBC and
transformed colon cells. While this could be a consequence of similar mutational background of
p53 and Ras/Raf pathway mutations in the colon transformation and BLBC models, driven by the
identity of the mutations themselves, part of this could also be a result of rewiring of genetic
circuitry as part of the transformation process due to the effects of cooperation between the
oncogenic lesions.
Because of the many lines of accumulating evidence that CRGs and interactions between
them contribute significantly to the malignant phenotype, Chapter IV attempts to refine the
technique of CRG identification by applying linear regression modeling. The technique calculates
a measure of synergistic changes in gene expression while taking variance in gene expression into
account. It then rank orders genes according to their synergy measure in order to identify CRGs,
those with the least additive control of their expression. Comparison with another method of CRG
identification, the synergy score, shows that the new mathematical model performs better in
identifying tumor inhibitory CRGs. While most of the CRGs identified by the mathematical model
have been previously described by the original paper, the model also identified twelve new CRGs.
Our current work goes on to demonstrate that at least one of these novel CRGs is critical to the
transformed phenotype of mp53/Ras cells.
Clca1, this newly identified tumor regulatory CRG, belongs to the family of Ca2+-activated
chloride channel proteins that help that cell interact with its environment (Gruber et al., 1998). Our data are
96
consistent with previous observations that ion channels often contribute towards tumor formation,
regulating proliferation, differentiation and apoptosis (Lehen’kyi et al., 2011). Chloride channel proteins
like chloride channel 3 (CLC3) have been found to inhibit apoptosis by affecting osmotic pressure of the
cell through ion flow, and are reported to be upregulated in prostate cancer (Shen et al., 2002; Lemonnier
et al., 2004). This correlates with our observation that Clca1 is upregulated in colorectal cancer cells as
compared to non-transformed cells and that knocking down Clca1 expression reduces tumor formation
capacity in vivo. Thus Clca1 represents a proof of concept that CRGs identified by the linear modelling
procedure contain tumor inhibitory genes.
97
5.3 Future Directions
The work presented in this thesis starts to address how CRGs can play a cancer-selective
role in BLBC. Notch3 is considered an example of a CRG that controls cell growth in a cancer
specific manner. My work identifying differential transcriptional responses to Notch3 activation
in cancer cells versus non-cancer cells finds numerous genes belonging to various signal
transduction pathways. We focused on Wnt pathway genes because this pathway has been heavily
implicated in driving proliferation of cancer cells, and the observed direction of change in gene
expression of the Wnt pathways genes was consistent with the hypothesis that Notch3 activation
inhibited this signaling. We have, however, not directly demonstrated that Notch3 activation
inhibits the key signaling steps along the Wnt pathway. Canonical Wnt signaling is driven by
nuclear localization of β-catenin. Hence future studies should investigate whether Notch3
activation ultimately leads to reduced nuclear localization of β-catenin and whether activation of
Notch3 is dependent on the inhibition of canonical signaling and nuclear localization of β-catenin.
Our current study indicates that cancer cell growth mediated by Notch3 is dependent on
the induction of Sfrp2. We also observe that downstream of Sfrp2 induction, there is reduced
expression of canonical Wnt target genes MYCN/MYC and Ccnd1. Future studies should also
investigate whether Notch3 mediated growth arrest is dependent on reduction in these genes.
Because there are reports that Myc modulates Ccnd1 expression in multiple cellular contexts
(Philipp et al., 1999; Perez-Roger et al., 1999), I would also test whether there is a hierarchy in
interaction between MYCN/MYC and Ccnd1.
The transcriptomic analysis also identified multiple genes belonging to other signaling
pathways that responded in a cancer-selective manner to Notch3 activation. Hence, future studies
98
sould also investigate the interaction of Notch3 with other signaling pathways to drive growth
inhibition. Candidate pathways include the p53 and PTEN pathway that are known to drive cell
growth arrest, apoptosis and senescence in cancer cells (Stambolic et al, 2001; Mayo et al., 2003;
Chen et al., 2005).
While high throughput mRNA sequencing identifies changes in the transcriptional
response to Notch3 activation, we cannot differentiate direct Notch3 targets from indirect changes
in transcriptional regulation. Hence, we will perform chromatin immunoprecipitation, possibly
coupled to high-throughput sequence analysis to determine whether NIC3 directly binds to the
promoter of Sfrp2 and other genes changed in response to Notch3 activation. This will help identify
direct cancer-specific targets of Notch3.
We also could also test whether NIC3 expression restricts transcription via canonical Notch
signaling. Canonical Notch signaling occurs by the nuclear localization of Notch intracellular
domain which then recruits RBPJκ and drives the transcription of Notch target genes. We observe
induction of canonical Notch target genes in response to NIC3 expression in both cancer cells and
non-cancer cells, as reported in Chapter II. Hence, the cancer-specific response of Notch3 may not
stem from canonical Notch signaling. Non-canonical Notch signaling occurs independent of
RBPJκ, when the Notch intracellular domain promiscuously binds to transcriptional machinery of
other pathways to drive transcription of alternative targets (Anderson et al, 2012; Ayaz and
Osborne, 2014). We observe that in the BLBC cells, there is greater expression of genes such as
Axin2 and Runx2 that are capable of promiscuously binding NIC3 and driving non-canonical
Notch signaling. (Data not shown; Kim et al., 2012; Watanabe et al., 2013) Hence, we hypothesize
that in cancer cells, where there is higher expression of these partner molecules, Notch3 activation
99
causes greater availability of NIC3 to promiscuously bind with them, driving non-canonical Notch
signaling.
To test whether the cancer-specific role of Notch3 activation occurs through canonical
signaling, we would knock down RBPJκ and assess whether NIC3 expression still drives cancer
cell growth arrest in vitro. We would also individually knock down each of the promiscuous
partner molecules required for non-canonical Notch signaling and test whether NIC3 expression
is dependent on the partner molecules for cancer-selective growth arrest. These experiments could
provide a molecular mechanism by which Notch3 controls cell growth in a cancer-selective
manner.
Finally, the novel statistical method of identifying CRGs provides a useful technique to
improve CRG identification. We would like to utilize this method in other cancer models where
CRGs have been identified and compare the ability of this method to identify CRGs with
previously applied methods. Moreover, the newly discovered CRGs in the colon transformation
model provide additional molecules of interest for further studies, as only one out of twelve of
these CRGs has been tested for its importance in tumor formation. The rest of the CRGs could be
perturbed in the mp53/Ras-expressing colon cells and tested for their requirement in tumor
formation. It will also be interested to see if Clca1 and the other CRGs are essential for BLBC cell
regulation and whether they have a cancer-selective role. Importantly further identification of
interactions among CRGs to control cancer cell behavior will start addressing questions of how
CRGs selectively control cancer cell behavior downstream of oncogenic transformation.
100
5.4 Conclusions
Previous work from the lab had demonstrated the importance of CRGs in transformed
colon and BLBC. Importantly CRGs play a cancer-specific role in BLBC. The current work
described in the thesis starts to address how this cancer-selective role of CRGs may be
programmed at the molecular level, using Notch3 as an example. We identify a unique genetic
interaction between Notch3 and Wnt pathway genes that is essential for the cancer cell growth
regulatory role of Notch3, alongside additional differential transcriptional response to Notch3
activation in cancer cells. We go on to establish that a similar genetic interaction exists in
transformed colon cells, also regulating cancer cell growth. Finally, we introduce a more rigorous
method to identify CRGs, which identifies twelve new CRGs. We find that atleast one of these
new CRGs, Clca1, is essential for tumor formation.
101
Chapter VI
Materials and Methods
102
6.1 Materials
6.1.1 Parental Cell Lines
Name Description Source
YAMC Murine colonic cells derived
from young adult “immorto”
mice (Whitehead et al., 1993)
Burgess, LICR, Melbourne
Phoenix-Eco Ecotropic retroviral
packaging cell line
G. Nolan
Phoenix-GP Amphitropic retroviral
packaging cell line
G. Nolan
HCC1954 Human breast ductal
carcinoma cell line
ATCC
MDA-MB-231 Human breast
adenocarcinoma cell line
ATCC
HCC1569 Human breast metaplastic
carcinoma cell line
ATCC
MDA-MB-468 Human breast
adenocarcinoma cell line
ATCC
HCC70 Human breast primary ductal
carcinoma cell line
ATCC
Hs578T Human breast carcinoma cell
line
ATCC
103
MCF10a Human immortalized
mammary epithelial cell line
ATCC
MCF12a Human immortalized
mammary epithelial cell line
ATCC
104
6.1.2 Plasmids
Name Description Source
pBabePuro3 Moloney murine leukemia
virus retroviral vector.
Contains puromycin
resistance gene driven by the
SV40 early promoter.
H. Land
pBabePuro3-NIC3 A murine Notch3 intracellular
domain cDNA cloned into the
EcoRI site of pBabePuro3
H.R. McMurray
pBabePuro3-Sfrp2 A murine Sfrp2 cDNA cloned
into the EcoRI site of
pBabePuro3
H.R. McMurray
pSuperRetroPuro A retroviral version of the
pSuper vector designed to
generate shRNA in
mammalian cells, with
expression driven by the HI
RNA promoter. Contains
puromycin resistance gene
driven by a PGL promoter.
H. Land
pSRPuro-hNotch3sh833 A human Notch3 shRNA
targeting sequence inserted
into BglII and HindIII of
pSuperRetroPuro
A. Ghosh
pSRPuro-hNotch3sh1026 A human Notch3 shRNA
targeting sequence inserted
into BglII and HindIII of
pSuperRetroPuro
A. Ghosh
pSRPuro-hNotch3sh1459 A human Notch3 shRNA
targeting sequence inserted
into BglII and HindIII of
pSuperRetroPuro
A. Ghosh
pSuperRetroHygro A retroviral version of the
pSuper vector designed to
generate shRNA in
mammalian cells, with
expression driven by the HI
RNA promoter. Contains
hygromycin resistance gene
driven by a PGK promoter.
OligoEngine
pSRHygro-hSfrp2sh1406 A human Sfrp2 shRNA
targeting sequence inserted
HR McMurray
105
into BglII and HindIII of
pSuperRetroHygro
pSRHygro-hSfrp2sh1578 A human Sfrp2 shRNA
targeting sequence inserted
into BglII and HindIII of
pSuperRetroHygro
HR McMurray
pSRHygro-hSfrp2sh1652 A human Sfrp2 shRNA
targeting sequence inserted
into BglII and HindIII of
pSuperRetroHygro
HR McMurray
pSRHygro-Sfrp2sh1274 A murine Sfrp2 shRNA
targeting sequence inserted
into BglII and HindIII of
pSuperRetroHygro
HR McMurray
pSRHygro-Sfrp2sh1476 A murine Sfrp2 shRNA
targeting sequence inserted
into BglII and HindIII of
pSuperRetroHygro
HR McMurray
pLKO A lentiviral vector. Contains
puromycin resistance gene.
Open Biosystems
pLKOshClca1 #1 A murine Clca1 shRNA
targeting sequence inserted
into pLKO
Open Biosystems
pLKOshClca1 #2 A murine Clca1 shRNA
targeting sequence inserted
into pLKO
Open Biosystems
106
6.1.3 shRNA Target Sequences
hScr001 – GGTTCACGG
hNotch3sh833 – CCAAAAAGA
hNotch3sh1026 – CTCGCAATA
hNotch3sh1459 – TCATCGATA
hSfrp2sh1406 – TAGCTCACT
hSfrp2sh1578 – CATGCAAAT
hSfrp2sh1652 – GTCTTACAA
Sfrp2sh1274 – TCTCTTGAA
Sfrp2sh1476 – TGGTCAGTC
Clca1 #1 – GCATGGATAAACGGTACAGTA
Clca1 #2 - GCTGAGTTTATAGGTGATTAT
107
6.1.4 Real-Time PCR Primers
Murine RhoA Forward – AGCTTGTGGTAAGACATGCTTG
Murine RhoA Reverse – GTGTCCCATAAAGCCAACTCTAC
Human/Murine NIC3 Forward – ATGCCGATGTCAATGCAGTGGATG
Human/Murine NIC3 Reverse – TCTCTTCCTTGCTGTCCTGCATGT
Human/Murine Hey2 Forward – TCTGCCAAGTTAGAAAAGGCTG
Human/Murine Hey2 Reverse – CAAGAGCATGGGCATCAAAGTA
Murine CyclinD1 Forward – AGATGTGGACATCTGAGGG
Murine CyclinD1 Reverse – AGGGGTGATGCAGATTCTATC
Human CyclinD1 Forward – GCTGCGAAGTGGAAACCATC
Human CyclinD1 Reverse – CCTCCTTCTGCACACATTTGAA
Human MYC Forward – GGCTCCTGGCAAAAGGTCA
Human MYC Reverse – CTGCGTAGTTGTGCTGATGT
Murine MYC Forward – CCCTATTTCATCTGCGACGAG
Murine MYC Reverse – GAGAAGGACGTAGCGACCG
Human MYCN Forward – ACCCGGACGAAGATGACTTCT
Human MYCN Reverse – CAGCTCGTTCTCAAGCAGCAT
Murine MYCN Forward – AGGATACCTTGAGCGACTCAGAT
108
Murine MYCN Reverse – GGCTCAGGCTCTTCGCTTTTG
Human Snai2 Forward – CGAACTGGACACACATACAGTG
Human Snai2 Reverse – CTGAGGATCTCTGGTTGTGGT
Murine Clca1 Forward – TACGAGGGTGTGGTCATTGCCATT
Murine Clca1 Reverse – TGGCTGGCTTCAAACAGGTAGGTA
109
6.2 Methods
6.2.1 Cell Culture
Young adult mouse colon (YAMC) cells (Whitehead 1993), and YAMC cells expressing both
p53175H and HRasV12 (mp53/Ras) cells were maintained as previously described (McMurray
2008; Xia 2007). Briefly, cells were cultured at 33оC and with 5% CO2 in water jacket humidified
incubators. Growth media was RPMI (Gibco) containing 10% (v/v) fetal bovine serum (FBS), 1x
insulin-selenium-transferrin-A (ITS-A) (Gibco), 2.5 μg/mL gentamicin (Gibco), and 25 U/ml
interferon-У (IF) (RandD Systems). Cells were conditionally immortalized when grown at 33оC
and in the presence of IF, due to IF driven expression of a thermosensitive SV40 Large T-antigen,
allowing for expansion of non-mp53/Ras cells in culture. All mp53/Ras cell derivatives were
cultured at 39оC in RPMI media supplemented with 10% (v/v) FBS, 1x ITS-A, and 2.5 μg/mL
gentamicin. YAMC cells and all derivatives were grown on 1 μg/cm2 collagen I coated dishes
(BD Biosciences). DLD-1 and HT-29 human colon cancer cells, as well as amphitropic and
ecotropic phoenix viral producer cells were maintained at 37оC and with 5% CO2 in water jacket
humidified incubators. Growth media was DMEM (Gibco) supplemented with 10% (v/v) FBS, 2
μg/mL gentamicin, and 100 μg/ml kanamycin.
Basal-like breast cancer cell lines were maintained as previously described (Neve et al., 2006;
Walters et al., unpublished). The cells were maintained at 37оC and with 5% CO2 in water jacket
humidified incubators. Growth media was DMEM (Gibco) or RPMI (Gibco) supplemented with
10% (v/v) FBS, 2 μg/mL gentamicin, and 100 μg/ml kanamycin.
Non-transformed mammary epithelial cell lines, MCF10A and MCF12A were maintained as
previously described (Debnath et al., 2003; Neve et al., 2006; Walters et al., unpublished). The
110
cell lines were maintained at 37оC and with 5% CO2 in water jacket humidified incubators. Growth
media was DMEM:F12 (Gibco) supplemented with 5% (v/v) heat activated horse serum, 0.01
mg/ml insulin, 100 ng/ml cholera toxin, 500 ng/ml hydrocortisone, 1X Penicillin/Streptomycin
and 20 ng/ml EGF.
6.2.2 Genetic perturbation of gene expression:
Genetically perturbed cells were derived by retroviral infection with virus containing appropriate
cDNA or shRNA expression constructs. Retrovirus for infection of mp53/Ras cells was produced
by transient transfection of ecotropic phoenix cells. Six hours prior to transfection, ecotropic
phoenix cells were seeded at 2.5x106 cells per 10cm dish in 10 mL of DMEM media. Cells were
then transiently transfected overnight, in standard growth media, with 20 μg of calcium phosphate
precipitated DNA (in 550 μl H2O, 50 μl of 2M CaCl2, and 600 μl 2X HBS (250 mM NaCl, 50
mM HEPES pH 7.1, 1.5 mM Na2HPO4)). DNA was precipitated by adding 2X HBS to
DNA/CaCl2/H2O mixture drop-wise while vortexing and then incubating at room temperature for
20 minutes. Following overnight transfection, media was removed from phoenix cells and replaced
with 4 mL standard growth media. Human infectious retrovirus for infection of BLBC and non-
transformed mammary epithelial cells was produced with amphitropic phoenix cells using the
same procedure described above for ecotropic phoenix cells, except amphitropic phoenix cells
were additionally co-transfected with 3 μg of VSV-G expression vector.
Lentiviral infections were also used to silence the expression of genes. pLKO-shRNA vectors were
identified among the collection at Open Biosystems, and sets of these molecules were tested to
identify appropriate knock-down constructs. For production of lentivirus, pLKO lentiviral
111
constructs were co-transfected with the VSV-G gene and a packaging plasmid containing the gag,
pol, and rev genes into 293TN cells (gift of Dr. C. Proschel).
Infections were performed 48 hours after phoenix producer cell transfections. 24 hours prior to
infection, mp53/Ras cells, BLBC, or non-transformed cells were seeded at 2.5x105 cells
respectively per 10 cm dish. Infections were carried out by filtering virus containing media through
0.45 μm syringe filter (Pall) and adding to target cell dishes, along with polybrene at a final
concentration of 8 μg/ml. Target cell growth media was removed prior to adding virus. Following
90 minutes of infection, virus was removed and fresh virus containing media/polybrene was added.
Three rounds of such infections were carried out at 39оC for mp53/Ras cells and 37оC for BLBC
and non-transformed mammary epithelial cells, after which, 10 mL of fresh media was added. 48
hours post-infection, polyclonal cell populations stably expressing indicated cDNAs and/or
shRNAs were generated by selection in standard growth media containing either 5 μg/mL
puromycin or 250 μg/mL hygromycin. All stable knockdown cell lines were generated were
generated using a pSuper.Retro vector system, while the pBabe vector system was utilized for
stable gene expression.
6.2.3 Quantitation of gene expression:
For collection of RNA, cells were grown without antibiotic for 48 hours, followed by serum
withdrawal for 24 hours prior to harvesting for RNA isolation. Total RNA was extracted from cells
following the standard RNeasy Mini Kit protocol for animal cells, with on-column DNase
digestion (Qiagen). cDNA was generated for qPCR analysis by mixing 5μg RNA with 10 mM
DTT, 400 μM dNTP mixture, 1x SuperScript II reverse transcriptase buffer, and 0.3 ng random
hexamer primer, then denaturing RNA at 90°C for 5 minutes, placing RNA mixture on ice and
112
adding 1μl SuperScript II reverse transcriptase and 1 μl RNaseOUT RNase inhibitor for a total
reaction volume of 50μl (all components from Invitrogen). RT reactions were carried out at 42°C
for 2 hr, followed by heat inactivation of RT enzyme by incubation at 70 degrees Celsius for 10
minutes.
SYBR Green-based quantitative PCR was run using cDNA produced as described above for
TLDA, with 1x Bio-Rad iQ SYBR Green master mix, 0.2 µM forward and reverse primer mix,
with gene-specific qPCR primers for each gene tested. Primers were identified using the Primer
Bank database (Wang and Seed, 2003), available at
http://pga.mgh.harvard.edu/primerbank/index.html or designed using the IDT PrimerQuest tool
(https://www.idtdna.com/Scitools/Applications/Primerquest/). Differential gene expression was
calculated by the ∆∆Ct method. Reactions were run on the iCycler (Bio-Rad), as follows: 5 min at
95°C, 45 cycles of 95°C for 30 seconds, 58 to 61°C for 30 seconds, 68 to 72°C for 45 seconds to
amplify products, followed by 40 cycles of 94°C with 1°C step-down for 30 seconds to produce
melt curves.
6.2.4 Cell count assay:
Cells were cultured in 6-well dishes (50,000 cells in 2 ml) in a 37°C incubator with 5% CO2 level
overnight to allow them adhere. Cells were dissociated from the wells with 300 ul trypsin, followed
by 700 ul media to stop trypsinization. Cells were counted using a Bio-Rad® TC-10 Automated
Cell Counter.
6.2.5 High-throughput RNA sequencing:
113
Independently isolated RNA from triplicate samples of each condition and cell line was sequenced
at the University of Rochester Genomics Research Center using Illumina HiSeq 2500 at a depth
of 20-25 million mapped reads. The raw reads were mapped using SHRiMP 2.2.3 and gene counts
were obtained using HTSeq. Gene counts were normalized using DESeq, EdgeR and CuffDiff
separately.
6.2.6 Calculation of Synergy Statistic based on Linear Modeling:
Messenger RNA expression profiles of YAMC, mp53, Ras, and mp53/Ras cells were determined
using the following the procedure: Five μg of RNA was reverse transcribed to cRNA and labeled
using a mAMP kit (Ambion). cRNA was then fragmented and hybridization cocktails were made
using the Affymetrix standard protocol for eukaryotic target hybridization. Targets were then
hybridized to Affymetrix Mouse 430 2.0 arrays at 45оC for 16 hours. Following hybridization,
arrays were washed and stained using Affymetrix Fluidics protocol EukGE-WS2v4_450 and then
scanned with the Affymetrix GeneChip Scanner 3000. A total of 10 biological replicates were
measured for each cell line.
For all differentially expressed probes, mean expression for normal and transformed cell lines were
compared. For probes with a lower mean expression in transformed cells, expression values were
adjusted according to the formula:
adjusted expression = 1/(raw expression)
For each mircoarray probe, a linear regression was fitted on the reads for transformed expression
levels and each of the contributing oncogenes:
expression ~ bp * p53 + br * Ras + bpr * (p53 ^ Ras)
Where,
p53 = indicator for presence of the dominant negative p53 mutation
Ras = indicator for presence of the constitutively active H-Ras mutation
bp = fit coefficient for the effect on expression of p53 alone
114
br = fit coefficient for the effect on expression of H-Ras alone
bpr = fit coefficient for the additional contribution of p53 and H-Ras interaction
From this fit model, error was calculated on each observation. This error was assumed to
follow a normal distribution. Consequently, a standard linear modeling was performed, using
coefficient t-test for the significance of the interaction term bpr against the one sided null
hypothesis
H0: bpr ≤ 0
We considered this t-statistic a monotonically increasing function of oncogene
cooperativity, and the corresponding p-value a map to the (0,1) interval. The p-value from this
coefficient hypothesis test then becomes our synergy statistic.
115
Chapter VII: Appendix
116
7.1 Table 1: Genes responding to Notch3 in Cancer Cells and Their Response in Non-
Cancer Cells According to DESeq Analysis
id CancerfoldChange
CancerP-
value NormalfoldChange
NormalP-
value
VIPR2 0.181059 0.020945 1.13269 0.870608
FRMPD2 0.199413 0.012687 0.733149 0.752917
LOC400950 0.226792 0.018325 0.930443 0.896356
LOC100652892 0.2331 0.040792 0.882086 0.819909
FAM90A10 0.233524 0.025718 0.986848 0.98648
CCND1 0.250989 0.035446 0.564673 0.28591
NGFR 0.252927 0.043323 1.200605 0.603531
HSPB7 0.254037 0.043473 0.616417 0.648804
SPATA18 0.272443 0.012947 1.014893 0.950298
SNORA51 0.273406 0.002447 0.905369 0.879628
KCP 0.289992 0.001832 1.068375 0.801264
CT62 0.318729 0.033671 0.955613 0.97594
MMP13 0.323566 0.036503 0.934813 0.928375
LOC100507139 0.330973 0.024549 0.653874 0.439386
MYCN 0.346622 0.045302 0.859702 0.753133
GPR25 0.34933 0.040511 1.256486 0.840876
IZUMO4 0.35192 0.034487 1.370343 0.585666
GNG3 0.358355 0.020719 1.473071 0.68404
QRFPR 0.382918 0.017721 0.59884 0.31748
FBXO40 0.392431 0.015153 1.030058 0.907708
SEMA3C 0.405798 0.002284 0.649512 0.42559
AGPAT9 0.425498 0.003559 1.036986 0.963033
SLC34A3 0.432256 0.042526 0.761623 0.74848
FBXL22 0.435627 0.041257 0.588322 0.355456
TPTE2 0.447451 0.018959 0.606224 0.533752
MAST4-AS1 0.452005 0.037719 1.220293 0.242255
EXTL1 0.469482 0.018222 1.127839 0.816285
PRICKLE1 0.498796 0.017251 0.940037 0.910662
NR3C2 0.499128 0.00216 0.589958 0.394853
TACC2 2.006583 0.037153 1.096789 0.532536
ARHGEF16 2.007449 0.041513 0.783004 0.562646
MYO7B 2.010683 0.04689 0.605439 0.43816
TAGLN2 2.033992 0.004786 1.225839 0.20165
CCDC19 2.041832 0.013703 1.364533 0.63627
CD82 2.063358 0.002778 1.178228 0.677849
SLC1A4 2.064237 0.006151 0.929302 0.890315
PLK2 2.078904 0.031193 1.130537 0.788954
117
TGFBR1 2.08662 0.020479 1.093027 0.344713
JAG1 2.08857 0.00673 0.714686 0.284393
ADORA2B 2.111559 0.046236 1.881838 0.337902
CCDC80 2.120803 0.014837 0.842231 0.899674
TNFSF14 2.149847 0.022527 0.778323 0.751311
LINC00346 2.167245 0.047904 0.81249 0.874619
TNFRSF21 2.24355 0.000866 0.983107 0.974724
ADAM19 2.285263 0.007515 0.7957 0.641443
NUAK2 2.294652 0.016794 1.431036 0.305976
ITGB3 2.312739 0.023963 0.849229 0.768718
SOCS2 2.324458 0.018501 1.307858 0.532056
PTPRE 2.333835 0.0303 0.662824 0.241933
TLL2 2.354181 0.016929 0.571556 0.344381
MCC 2.38291 0.032273 0.753963 0.606752
LOC100506082 2.394511 0.039816 0.57859 0.305301
LOC100652988 2.416968 0.037606 1.624979 0.654934
XRCC4 2.430463 0.008323 0.629282 0.383888
COL4A1 2.44082 0.041729 0.549423 0.413547
BMI1 2.449299 0.024829 1.208495 0.658234
ENC1 2.46053 0.048827 1.02336 0.957824
ROR1 2.469121 0.041966 1.872295 0.118058
EDNRA 2.569591 0.036326 1.513977 0.627323
AFAP1L2 2.586009 0.042078 0.681614 0.476291
FAM182B 2.608463 0.027324 1.023379 0.981508
DGKB 2.648701 0.006683 0.653547 0.377733
TSPAN9 2.759017 0.008647 1.189519 0.410356
SPHK1 2.770955 0.012242 0.708411 0.467362
MAST4-AS1 2.779462 0.033147 1.329628 0.67145
KIF26B 2.781266 0.027247 0.609257 0.32928
THBS1 2.869102 0.047464 0.508104 0.410654
RNF152 2.872086 0.013749 0.88749 0.873027
C2orf27A 2.935612 0.039594 0.631183 0.568529
PRR5L 2.962134 0.032985 1.04041 0.959357
COL15A1 3.034662 0.022512 1.029766 0.960751
PAPPA 3.05249 0.029396 1.52894 0.313847
4-Sep 3.059746 0.003175 0.66591 0.567911
ARHGAP30 3.105959 0.031574 0.564793 0.513834
C6orf136 3.10796 0.044052 0.958013 0.948755
HRCT1 3.125673 0.003485 1.453991 0.671419
GPR15 3.161011 0.028782 1.337744 0.694487
AXIN2 3.183552 0.009525 0.650626 0.447706
HES4 3.228435 0.039419 0.98331 0.984392
SERPINB9 3.240564 0.010292 1.193882 0.365155
118
FOXS1 3.442116 0.043286 1.141228 0.877309
CYP24A1 3.461646 0.003148 1.049765 0.968734
LRRIQ4 3.475687 0.035556 0.541496 0.305868
LOC158696 3.503303 0.0019 0.921261 0.659892
GPR124 3.641576 0.030101 0.850693 0.349979
MX2 3.946378 0.045163 0.661504 0.644213
KAL1 3.996504 0.025365 0.624288 0.371523
PDZD2 4.148129 0.029239 1.575667 0.463028
TMEM171 4.476454 0.041782 1.173907 0.823844
SFRP2 4.747359 0.038065 1.654721 0.658944
SNAI2 4.949469 0.027388 0.718718 0.368297
CD69 4.977345 0.026388 0.786514 0.833209
OPRD1 5.077258 0.033546 1.373977 0.781545
C8orf33 5.164977 0.039824 0.66908 0.747036
UBQLN3 5.628165 0.035535 1.106589 0.946492
IL4I1 5.796641 0.033739 0.991095 0.979233
CALU 5.952869 0.017257 0.955613 0.97594
SLC46A3 6.073329 0.006481 1.44988 0.404944
TBX15 6.665798 0.03867 1.215533 0.779687
LINC00173 6.955827 0.031781 1.337976 0.407251
NGF 7.178988 0.03489 0.660393 0.778436
CREB3L1 8.138478 0.009482 0.962996 0.917853
NID1 9.305301 0.001981 0.635379 0.549625
PTHLH 9.636783 0.023366 0.847221 0.807828
AWAT1 9.66648 0.037107 0.980745 0.988758
CCDC13 9.832618 0.000773 1.283706 0.554471
HTRA3 10.86674 0.009873 0.607808 0.647078
COL5A3 11.567 0.034422 1.010659 0.988336
LOC100506735 17.59229 0.032244 0.650124 0.695282
SYN1 22.33446 0.031777 1.693727 0.651976
FLT1 197.6398 0.027192 1.743946 0.734572
MGAT4C 525.6169 0.047157 0.717307 0.517369
PTGER3 0.340467 0.00993 86.87689 0.424583
DLX3 0.361598 0.003141 7.860805 0.418376
KCNH3 0.430576 0.01403 21.24104 0.423282
GPR39 0.485223 0.021788 7.051346 0.467763
FLJ37035 2.104785 0.047571 0.449741 0.160831
SHCBP1L 2.242087 0.026138 0.218569 0.386312
LRRC4C 2.298844 0.0272 0.477806 0.671028
QRICH2 2.346979 0.034581 0.26267 0.07461
LOC100652903 2.355681 0.041737 0.422862 0.242806
C9orf142 2.395188 0.024616 0.21924 0.163814
F2RL1 3.240514 0.0071 0.32852 0.068623
119
CTGF 3.244717 0.037739 0.452556 0.124806
COL5A1 3.289488 0.037856 0.303933 0.098371
LOC643650 3.65744 0.009434 0.444321 0.433947
LOC158376 3.726465 0.041318 0.260698 0.275398
LOC100652762 3.993391 0.00916 0.4757 0.174432
HSPB8 3.995186 0.008216 0.22865 0.284602
GRIK2 4.009478 0.003048 0.236255 0.133097
PLEKHG4B 4.667554 0.006045 0.415723 0.136526
LOC100131774 4.91251 0.02132 0.370824 0.430101
HEY2 5.131421 0.024639 0.338503 0.365721
LOC100505880 6.537345 0.011436 0.278271 0.151142
SCG5 8.865437 0.019637 0.403751 0.391336
LOC100506624 11.18629 0.025304 0.233664 0.090064
CCDC102B 11.33875 0.046095 0.46971 0.33739
SPARC 19.27651 0.048834 0.393488 0.425696
SFTA1P 2.59051 0.010804 3.420923 0.382087
SOCS1 2.597587 0.034235 2.286812 0.523663
BMP8B 2.617958 0.038561 2.604961 0.49109
ATP6V0D1 2.632429 0.01311 20.83269 0.300802
EMR4P 2.638945 0.03413 2.238816 0.402092
ADAMTS15 2.679544 0.041958 8.076344 0.097758
USP2 2.699535 0.047411 9.78049 0.385494
SERPINB7 3.042256 0.002339 6.632575 0.217401
F2RL2 3.056687 0.045927 52.74914 0.40867
SLC26A5 3.428623 0.006534 3.480997 0.361126
WNT11 3.715786 0.001891 2.195041 0.633743
ENHO 4.140027 0.005139 2.071687 0.530577
TRPC4 4.448749 0.005094 8.09085 0.47377
MGC39372 4.58926 0.012858 2.328995 0.639829
NRARP 4.626738 0.040032 3.932816 0.054061
ODZ2 4.76769 0.028435 4.266974 0.423236
NOTCH3 4.965876 0.016795 3.952471 0.325034
GAB3 5.038856 0.046177 7.647145 0.401594
PDGFRB 5.944996 0.041453 20.63889 0.399685
HEY1 6.343054 0.031968 134.0128 0.379403
THSD7B 9.137828 0.013053 195.2937 0.413048
HEY2 12.00724 0.024313 2.449738 0.313044
SORBS2 24.35517 0.005617 4.065925 0.489518
XKR4 0.153378 0.002051 0.338503 0.365721
POLN 0.188267 0.006839 0.304215 0.313952
PRB3 0.264647 0.029012 0.372589 0.35767
ITPK1-AS1 0.277181 0.008087 0.385774 0.350981
LOC100505872 0.313696 0.017169 0.332918 0.115203
120
TBR1 0.321369 0.023459 0.162054 0.405677
TTTY4C 0.355019 0.027339 0.334981 0.179182
TTTY4 0.355019 0.027339 0.431408 0.19867
RDM1 0.415826 0.010707 0.326208 0.067661
RSPH6A 0.432475 0.045709 0.469569 0.354763
STAC2 0.457781 0.021926 0.44089 0.424434
LOC386597 0.478014 0.047042 0.463937 0.367963
121
7.2 Table 2: Comparison of DESeq, EdgeR and Cuffdiff in fold change and p-value
id
DESeq
CancerfoldChange
DESeq
Cancer
P-value
Cuffdiff
Cancer
inverse
logfold
change
CuffDiff
Cancer
p-value
EdgeR
Cancer
Fold-
Change
EdgeR
Cancer
p-value
VIPR2 0.181059 0.020945 2.68285 0.467862 0.181059 0.520945
FRMPD2 0.199413 0.012687 1.57287 0.723681 0.199413 0.512687
LOC400950 0.226792 0.018325 2.3207 0.534645 0.226792 0.518325
LOC100652892 0.2331 0.040792 0.508363 0.946141 0.2331 0.540792
FAM90A10 0.233524 0.025718 1.96936 0.549015 0.233524 0.525718
CCND1 0.250989 0.035446 0.384226 0.709024 0.250989 0.535446
NGFR 0.252927 0.043323 1.78071 0.497493 0.252927 0.543323
HSPB7 0.254037 0.043473 1.91649 0.387807 0.254037 0.543473
SPATA18 0.272443 0.012947 1.80775 0.45278 0.272443 0.512947
SNORA51 0.273406 0.002447 1.82072 0.968396 0.273406 0.502447
KCP 0.289992 0.001832 2.06191 0.344901 0.289992 0.501832
CT62 0.318729 0.033671 1.66275 0.228298 0.318729 0.533671
MMP13 0.323566 0.036503 1.77192 0.346829 0.323566 0.536503
LOC100507139 0.330973 0.024549 1.62325 0.736752 0.330973 0.524549
MYCN 0.346622 0.045302 -0.1899 0.918685 0.346622 0.545302
GPR25 0.34933 0.040511 1.68741 0.488406 0.34933 0.540511
IZUMO4 0.35192 0.034487 0.886538 0.576469 0.35192 0.534487
GNG3 0.358355 0.020719 1.66554 0.949174 0.358355 0.520719
QRFPR 0.382918 0.017721 1.39538 0.406904 0.382918 0.517721
FBXO40 0.392431 0.015153 1.30545 0.483768 0.392431 0.515153
SEMA3C 0.405798 0.002284 1.33071 0.128665 0.405798 0.502284
AGPAT9 0.425498 0.003559 1.21819 0.174206 0.425498 0.503559
SLC34A3 0.432256 0.042526 1.66792 0.458492 0.432256 0.542526
FBXL22 0.435627 0.041257 1.1532 0.931082 0.435627 0.541257
TPTE2 0.447451 0.018959 0.375733 0.796083 0.447451 0.518959
MAST4-AS1 0.452005 0.037719 1.11278 0.871237 0.452005 0.537719
EXTL1 0.469482 0.018222 1.08661 0.554165 0.469482 0.518222
PRICKLE1 0.498796 0.017251 0.987458 0.429636 0.498796 0.517251
NR3C2 0.499128 0.00216 0.95261 0.312295 0.499128 0.50216
TACC2 2.006583 0.037153 -1.08988 0.210176 2.006583 0.537153
ARHGEF16 2.007449 0.041513 0.864967 0.584164 2.007449 0.541513
MYO7B 2.010683 0.04689 -0.9282 0.307354 2.010683 0.54689
TAGLN2 2.033992 0.004786 -1.05793 0.132001 2.033992 0.504786
CCDC19 2.041832 0.013703 -0.91378 0.298454 2.041832 0.513703
CD82 2.063358 0.002778 -1.04378 0.175576 2.063358 0.502778
SLC1A4 2.064237 0.006151 -1.06484 0.246534 2.064237 0.506151
122
PLK2 2.078904 0.031193 -1.10767 0.138049 2.078904 0.531193
TGFBR1 2.08662 0.020479 -1.12501 0.194068 2.08662 0.520479
JAG1 2.08857 0.00673 -1.06925 0.137225 2.08857 0.50673
ADORA2B 2.111559 0.046236 -1.04687 0.228838 2.111559 0.546236
CCDC80 2.120803 0.014837 -1.14069 0.158074 2.120803 0.514837
TNFSF14 2.149847 0.022527 -1.08568 0.628789 2.149847 0.522527
LINC00346 2.167245 0.047904 -1.15727 0.203689 2.167245 0.547904
TNFRSF21 2.24355 0.000866 -1.20442 0.087718 2.24355 0.500866
ADAM19 2.285263 0.007515 -1.25002 0.090505 2.285263 0.507515
NUAK2 2.294652 0.016794 -1.23216 0.124619 2.294652 0.516794
ITGB3 2.312739 0.023963 -1.31402 0.146637 2.312739 0.523963
SOCS2 2.324458 0.018501 -1.22919 0.17214 2.324458 0.518501
PTPRE 2.333835 0.0303 -1.21378 0.190021 2.333835 0.5303
TLL2 2.354181 0.016929 -1.3267 0.14065 2.354181 0.516929
MCC 2.38291 0.032273 -1.35824 0.766271 2.38291 0.532273
LOC100506082 2.394511 0.039816 -1.33405 0.416695 2.394511 0.539816
LOC100652988 2.416968 0.037606 -1.31952 0.155396 2.416968 0.537606
XRCC4 2.430463 0.008323 -1.38003 0.132957 2.430463 0.508323
COL4A1 2.44082 0.041729 -1.27204 0.131291 2.44082 0.541729
BMI1 2.449299 0.024829 0.07065 0.958965 2.449299 0.524829
ENC1 2.46053 0.048827 -1.31785 0.085438 2.46053 0.548827
ROR1 2.469121 0.041966 -1.32925 0.247747 2.469121 0.541966
EDNRA 2.569591 0.036326 -1.39109 0.221853 2.569591 0.536326
AFAP1L2 2.586009 0.042078 -1.42989 0.195776 2.586009 0.542078
FAM182B 2.608463 0.027324 -0.74367 0.895487 2.608463 0.527324
DGKB 2.648701 0.006683 -1.45265 0.278488 2.648701 0.506683
TSPAN9 2.759017 0.008647 -1.48877 0.15113 2.759017 0.508647
SPHK1 2.770955 0.012242 -1.44134 0.117978 2.770955 0.512242
MAST4-AS1 2.779462 0.033147 1.11278 0.871237 2.779462 0.533147
KIF26B 2.781266 0.027247 -1.24574 0.426515 2.781266 0.527247
THBS1 2.869102 0.047464 -1.57721 0.036644 2.869102 0.547464
RNF152 2.872086 0.013749 -1.61122 0.073136 2.872086 0.513749
C2orf27A 2.935612 0.039594 -0.86242 0.800856 2.935612 0.539594
PRR5L 2.962134 0.032985 -1.6163 0.177384 2.962134 0.532985
COL15A1 3.034662 0.022512 -1.68286 0.090573 3.034662 0.522512
PAPPA 3.05249 0.029396 -1.65682 0.074583 3.05249 0.529396
4-Sep 3.059746 0.003175 -1.54924 0.430743 3.059746 0.503175
ARHGAP30 3.105959 0.031574 0.130636 0.884952 3.105959 0.531574
C6orf136 3.10796 0.044052 0.113783 0.953163 3.10796 0.544052
HRCT1 3.125673 0.003485 -1.66215 0.148174 3.125673 0.503485
GPR15 3.161011 0.028782 -1.68826 0.116777 3.161011 0.528782
AXIN2 3.183552 0.009525 -1.64971 0.063722 3.183552 0.509525
HES4 3.228435 0.039419 -1.75121 0.171476 3.228435 0.539419
123
SERPINB9 3.240564 0.010292 -1.73641 0.034733 3.240564 0.510292
FOXS1 3.442116 0.043286 -1.82495 0.069395 3.442116 0.543286
CYP24A1 3.461646 0.003148 -1.83871 0.040194 3.461646 0.503148
LRRIQ4 3.475687 0.035556 -1.84382 0.452154 3.475687 0.535556
LOC158696 3.503303 0.0019 -1.82196 0.317467 3.503303 0.5019
GPR124 3.641576 0.030101 -1.95704 0.268897 3.641576 0.530101
MX2 3.946378 0.045163 -2.04339 0.038868 3.946378 0.545163
KAL1 3.996504 0.025365 -2.04288 0.027067 3.996504 0.525365
PDZD2 4.148129 0.029239 -2.13729 0.026039 4.148129 0.529239
TMEM171 4.476454 0.041782 0 1 4.476454 0.541782
SFRP2 4.747359 0.038065
-
1.79769e+308 0.243881 4.747359 0.538065
SNAI2 4.949469 0.027388 -2.34292 0.006733 4.949469 0.527388
CD69 4.977345 0.026388 -1.76864 0.690893 4.977345 0.526388
OPRD1 5.077258 0.033546 -2.00815 0.437159 5.077258 0.533546
C8orf33 5.164977 0.039824 -0.05665 0.937812 5.164977 0.539824
UBQLN3 5.628165 0.035535 -2.39033 0.445365 5.628165 0.535535
IL4I1 5.796641 0.033739 -2.34632 0.996979 5.796641 0.533739
CALU 5.952869 0.017257 -0.15159 0.854332 5.952869 0.517257
SLC46A3 6.073329 0.006481 -2.66281 0.001088 6.073329 0.506481
TBX15 6.665798 0.03867 -1.95868 0.289545 6.665798 0.53867
LINC00173 6.955827 0.031781 -2.72518 0.224542 6.955827 0.531781
NGF 7.178988 0.03489 -2.82063 0.006448 7.178988 0.53489
CREB3L1 8.138478 0.009482 -3.02508 0.000269 8.138478 0.509482
NID1 9.305301 0.001981 -3.36048 0.27814 9.305301 0.501981
PTHLH 9.636783 0.023366 -3.30844 0.031186 9.636783 0.523366
AWAT1 9.66648 0.037107 -1.27163 0.619787 9.66648 0.537107
CCDC13 9.832618 0.000773 -2.5315 0.203819 9.832618 0.500773
HTRA3 10.86674 0.009873 -3.36502 0.000757 10.86674 0.509873
COL5A3 11.567 0.034422 -4.24019 0.007865 11.567 0.534422
LOC100506735 17.59229 0.032244 -4.1342 0.000143 17.59229 0.532244
SYN1 22.33446 0.031777 -4.48728 0.812689 22.33446 0.531777
FLT1 197.6398 0.027192 -7.08885 1.42E-05 197.6398 0.527192
MGAT4C 525.6169 0.047157 -9.24041 3.76E-07 525.6169 0.547157
PTGER3 0.340467 0.00993 1.16031 0.96647 0.340467 0.50993
DLX3 0.361598 0.003141 1.45404 0.158348 0.361598 0.503141
KCNH3 0.430576 0.01403 1.22551 0.448683 0.430576 0.51403
GPR39 0.485223 0.021788 1.08458 0.274365 0.485223 0.521788
FLJ37035 2.104785 0.047571 3.3E-05 0.999991 2.104785 0.547571
SHCBP1L 2.242087 0.026138 -1.2262 0.560459 2.242087 0.526138
LRRC4C 2.298844 0.0272 -1.23368 0.44624 2.298844 0.5272
QRICH2 2.346979 0.034581 -1.26064 0.166434 2.346979 0.534581
LOC100652903 2.355681 0.041737 -1.15814 0.281121 2.355681 0.541737
124
C9orf142 2.395188 0.024616 0.055548 0.944709 2.395188 0.524616
F2RL1 3.240514 0.0071 -1.75051 0.014896 3.240514 0.5071
CTGF 3.244717 0.037739 -1.69313 0.050852 3.244717 0.537739
COL5A1 3.289488 0.037856 -1.75004 0.083909 3.289488 0.537856
LOC643650 3.65744 0.009434 -1.8998 0.708339 3.65744 0.509434
LOC158376 3.726465 0.041318 -1.94526 0.244615 3.726465 0.541318
LOC100652762 3.993391 0.00916 -2.05379 0.013868 3.993391 0.50916
HSPB8 3.995186 0.008216 -2.12191 0.020242 3.995186 0.508216
GRIK2 4.009478 0.003048 -1.81698 0.573814 4.009478 0.503048
PLEKHG4B 4.667554 0.006045 -2.43163 0.031411 4.667554 0.506045
LOC100131774 4.91251 0.02132 -1.86556 0.714374 4.91251 0.52132
HEY2 5.131421 0.024639 -2.60305 0.05273 5.131421 0.524639
LOC100505880 6.537345 0.011436 -2.81903 0.995148 6.537345 0.511436
SCG5 8.865437 0.019637 0 1 8.865437 0.519637
LOC100506624 11.18629 0.025304 -3.65394 0.82903 11.18629 0.525304
CCDC102B 11.33875 0.046095 -3.63251 0.015731 11.33875 0.546095
SPARC 19.27651 0.048834 -4.74729 0.003356 19.27651 0.548834
SFTA1P 2.59051 0.010804 -1.44596 0.073659 2.59051 0.510804
SOCS1 2.597587 0.034235 -1.3762 0.158014 2.597587 0.534235
BMP8B 2.617958 0.038561 0.3004 0.893717 2.617958 0.538561
ATP6V0D1 2.632429 0.01311 -0.06605 0.927219 2.632429 0.51311
EMR4P 2.638945 0.03413 -1.48914 0.365885 2.638945 0.53413
ADAMTS15 2.679544 0.041958 -1.45415 0.09657 2.679544 0.541958
USP2 2.699535 0.047411 -1.37721 0.265968 2.699535 0.547411
SERPINB7 3.042256 0.002339 -1.62348 0.094214 3.042256 0.502339
F2RL2 3.056687 0.045927 -1.64368 0.179699 3.056687 0.545927
SLC26A5 3.428623 0.006534 -1.67329 0.941983 3.428623 0.506534
WNT11 3.715786 0.001891 -1.8206 0.255378 3.715786 0.501891
ENHO 4.140027 0.005139 -1.43111 0.488657 4.140027 0.505139
TRPC4 4.448749 0.005094 -2.14491 0.237102 4.448749 0.505094
MGC39372 4.58926 0.012858 -2.34156 0.087135 4.58926 0.512858
NRARP 4.626738 0.040032 -2.17073 0.012725 4.626738 0.540032
ODZ2 4.76769 0.028435 -2.31751 0.018968 4.76769 0.528435
NOTCH3 4.965876 0.016795 -2.34615 0.023644 4.965876 0.516795
GAB3 5.038856 0.046177 -2.47164 0.112357 5.038856 0.546177
PDGFRB 5.944996 0.041453 -2.65841 0.0066 5.944996 0.541453
HEY1 6.343054 0.031968 -2.58177 0.009817 6.343054 0.531968
THSD7B 9.137828 0.013053 -3.94591 0.229895 9.137828 0.513053
HEY2 12.00724 0.024313 -2.60305 0.05273 12.00724 0.524313
SORBS2 24.35517 0.005617 -4.66787 0.001915 24.35517 0.505617
XKR4 0.153378 0.002051 2.63961 0.97112 0.153378 0.502051
POLN 0.188267 0.006839 1.57351 0.949203 0.188267 0.506839
PRB3 0.264647 0.029012 0.715667 0.742098 0.264647 0.529012
125
ITPK1-AS1 0.277181 0.008087 1.8124 0.967806 0.277181 0.508087
LOC100505872 0.313696 0.017169 1.6589 0.575555 0.313696 0.517169
TBR1 0.321369 0.023459 1.60361 0.474657 0.321369 0.523459
TTTY4C 0.355019 0.027339 1.51513 0.533881 0.355019 0.527339
TTTY4 0.355019 0.027339 1.51513 0.533881 0.355019 0.527339
RDM1 0.415826 0.010707 1.11086 0.504447 0.415826 0.510707
RSPH6A 0.432475 0.045709 1.01796 0.459405 0.432475 0.545709
STAC2 0.457781 0.021926 1.12101 0.440987 0.457781 0.521926
LOC386597 0.478014 0.047042 0.975997 0.770469 0.478014 0.547042
126
Table 3: Mutation Spectrum of BLBC cell lines used in the study
Cell line Gene
Cluster
ER
mutation
PR
mutation
HER2
overexpr
ession
TP53
protein
levels
Age of
patient
(years)
Ethnicity
MDA-MB-
231
BaB - - ++
(Mutated)
51 W
HCC1954 BaA - - + +/- 61 El
HCC1569 BaA - - + -
(Mutated)
70 B
MDA-MB-
468
BaA - - + 51 B
HCC70 BaA - - ++
(Mutated)
49 B
Hs578T BaB - - +
(Mutated)
74 W
MCF10A BaB - - +/-
(Wild-
type)
36 W
MCF12A BaB - - + 60 W
Modified from Neve et al., 2006
127
Bibliography
Abate-Shen, C., and M. M. Shen. "Molecular Genetics of Prostate Cancer." Genes &
Development 14.19 (2000): 2410-434. Web.
Adjei, A. A. "Blocking Oncogenic Ras Signaling for Cancer Therapy." JNCI Journal of the
National Cancer Institute 93.14 (2001): 1062-074. Web.
Aguilera, O., M. F. Fraga, E. Ballestar, M. F. Paz, M. Herranz, J. Espada, J. M. García, A.
Muñoz, M. Esteller, and J. M. González-Sancho. "Epigenetic Inactivation of the
Wnt Antagonist DICKKOPF-1 (DKK-1) Gene in Human Colorectal Cancer."
Oncogene 25.29 (2006): 4116-121. Web.
Alfaro, M. P., M. Pagni, A. Vincent, J. Atkinson, M. F. Hill, J. Cates, J. M. Davidson, J.
Rottman, E. Lee, and P. P. Young. "The Wnt Modulator SFRP2 Enhances
Mesenchymal Stem Cell Engraftment, Granulation Tissue Formation and
Myocardial Repair." Proceedings of the National Academy of Sciences 105.47
(2008): 18366-8371. Web.
Almudevar, Anthony, Matthew N. Mccall, Helene Mcmurray, and Hartmut Land. "Fitting
Boolean Networks from Steady State Perturbation Data." Statistical Applications
in Genetics and Molecular Biology 10.1 (2011): n. pag. Web.
Andersen, Peter, Hideki Uosaki, Lincoln T. Shenje, and Chulan Kwon. "Non-canonical
Notch Signaling: Emerging Role and Mechanism." Trends in Cell Biology 22.5
(2012): 257-65. Web.
Armitage, P., and R. Doll. "The Age Distribution of Cancer and a Multi-stage Theory of
Carcinogenesis." British Journal of Cancer 8.1 (1954): 1-12. Web.
128
Artavanis-Tsakonas, S., M. D. Rand, and R. J. Lake. "Notch Signaling: Cell Fate Control and
Signal Integration in Development." Science 284.5415 (1999): 770-76. Web.
Ashton, John M., Marlene Balys, Sarah J. Neering, Duane C. Hassane, Glenn Cowley,
David E. Root, Peter G. Miller, Benjamin L. Ebert, Helene R. McMurray,
Hartmut Land, and Craig T. Jordan. "Gene Sets Identified with Oncogene
Cooperativity Analysis Regulate In Vivo Growth and Survival of Leukemia Stem
Cells." Cell Stem Cell 11.3 (2012): 359-72. Web.
Ayaz, Furkan, and Barbara A. Ozborne. "Non-Canonical Notch Signaling in Cancer and
Immunity." Frontiers in Oncology 4.345 (2014): n. pag. Web.
Bardeesy, Nabeel, and Ronald A. Depinho. "Pancreatic Cancer Biology and Genetics."
Nature Reviews Cancer 2.12 (2002): 897-909. Web.
Baylin, Stephen B., Manel Esteller, Michael R. Rountree, Kurtis E. Bachman, Kornel
Schuebel, and James G. Herman. "Aberrant Patterns of DNA Methylation,
Chromatin Formation and Gene Expression in Cancer." Human Molecular
Genetics 10.7 (2001): 687-92. Web.
Bishop, J. Michael. “The molecular genetics of cancer.” Science. 235(4786) (1987): 305-311.
Chang, Kyle, Chad J. Creighton, Caleb Davis, Lawrence Donehower, Jennifer Drummond,
David Wheeler, Adrian Ally, Miruna Balasundaram, Inanc Birol, Yaron S N
Butterfield, Andy Chu, Eric Chuah, Hye-Jung E. Chun, Noreen Dhalla, Ranabir
Guin, Martin Hirst, Carrie Hirst, Robert A. Holt, Steven J M Jones, Darlene Lee,
Haiyan I. Li, Marco A. Marra, Michael Mayo, Richard A. Moore, Andrew J.
Mungall, A. Gordon Robertson, Jacqueline E. Schein, Payal Sipahimalani, Angela
Tam, Nina Thiessen, Richard J. Varhol, Rameen Beroukhim, Ami S. Bhatt,
129
Angela N. Brooks, Andrew D. Cherniack, Samuel S. Freeman, Stacey B. Gabriel,
Elena Helman, Joonil Jung, Matthew Meyerson, Akinyemi I. Ojesina, Chandra
Sekhar Pedamallu, Gordon Saksena, Steven E. Schumacher, Barbara Tabak,
Travis Zack, Eric S. Lander, Christopher A. Bristow, Angela Hadjipanayis, Psalm
Haseley, Raju Kucherlapati, Semin Lee, Eunjung Lee, Lovelace J. Luquette,
Harshad S. Mahadeshwar, Angeliki Pantazi, Michael Parfenov, Peter J. Park,
Alexei Protopopov, Xiaojia Ren, Netty Santoso, Jonathan Seidman, Sahil Seth,
Xingzhi Song, Jiabin Tang, Ruibin Xi, Andrew W. Xu, Lixing Yang, Dong Zeng,
J. Todd Auman, Saianand Balu, Elizabeth Buda, Cheng Fan, Katherine A.
Hoadley, Corbin D. Jones, Shaowu Meng, Piotr A. Mieczkowski, Joel S. Parker,
Charles M. Perou, Jeffrey Roach, Yan Shi, Grace O. Silva, Donghui Tan,
Umadevi Veluvolu, Scot Waring, Matthew D. Wilkerson, Junyuan Wu, Wei
Zhao, Tom Bodenheimer, D. Neil Hayes, Alan P. Hoyle, Stuart R. Jeffreys, Lisle
E. Mose, Janae V. Simons, Mathew G. Soloway, Stephen B. Baylin, Benjamin P.
Berman, Moiz S. Bootwalla, Ludmila Danilova, James G. Herman, Toshinori
Hinoue, Peter W. Laird, Suhn K. Rhie, Hui Shen, Timothy Triche, Daniel J.
Weisenberger, Scott L. Carter, Kristian Cibulskis, Lynda Chin, Jianhua Zhang,
Gad Getz, Carrie Sougnez, Min Wang, Gordon Saksena, Scott L. Carter, Kristian
Cibulskis, Lynda Chin, Jianhua Zhang, Gad Getz, Huyen Dinh, Harsha Vardhan
Doddapaneni, Richard Gibbs, Preethi Gunaratne, Yi Han, Divya Kalra, Christie
Kovar, Lora Lewis, Margaret Morgan, Donna Morton, Donna Muzny, Jeffrey
Reid, Liu Xi, Juok Cho, Daniel Dicara, Scott Frazer, Nils Gehlenborg, David I.
Heiman, Jaegil Kim, Michael S. Lawrence, Pei Lin, Yingchun Liu, Michael S.
130
Noble, Petar Stojanov, Doug Voet, Hailei Zhang, Lihua Zou, Chip Stewart, Brady
Bernard, Ryan Bressler, Andrea Eakin, Lisa Iype, Theo Knijnenburg, Roger
Kramer, Richard Kreisberg, Kalle Leinonen, Jake Lin, Yuexin Liu, Michael
Miller, Sheila M. Reynolds, Hector Rovira, Ilya Shmulevich, Vesteinn Thorsson,
Da Yang, Wei Zhang, Samirkumar Amin, Chang-Jiun Wu, Chia-Chin Wu, Rehan
Akbani, Kenneth Aldape, Keith A. Baggerly, Bradley Broom, Tod D. Casasent,
James Cleland, Chad Creighton, Deepti Dodda, Mary Edgerton, Leng Han,
Shelley M. Herbrich, Zhenlin Ju, Hoon Kim, Seth Lerner, Jun Li, Han Liang,
Wenbin Liu, Philip L. Lorenzi, Yiling Lu, James Melott, Gordon B. Mills, Lam
Nguyen, Xiaoping Su, Roeland Verhaak, Wenyi Wang, John N. Weinstein,
Andrew Wong, Yang Yang, Jun Yao, Rong Yao, Kosuke Yoshihara, Yuan Yuan,
Alfred K. Yung, Nianxiang Zhang, Siyuan Zheng, Michael Ryan, David W. Kane,
B. Arman Aksoy, Giovanni Ciriello, Gideon Dresdner, Jianjiong Gao, Benjamin
Gross, Anders Jacobsen, Andre Kahles, Marc Ladanyi, William Lee, Kjong-Van
Lehmann, Martin L. Miller, Ricardo Ramirez, Gunnar Rätsch, Boris Reva, Chris
Sander, Nikolaus Schultz, Yasin Senbabaoglu, Ronglai Shen, Rileen Sinha, S.
Onur Sumer, Yichao Sun, Barry S. Taylor, Nils Weinhold, Suzanne Fei, Paul
Spellman, Christopher Benz, Daniel Carlin, Melisssa Cline, Brian Craft, Kyle
Ellrott, Mary Goldman, David Haussler, Singer Ma, Sam Ng, Evan Paull, Amie
Radenbaugh, Sofie Salama, Artem Sokolov, Joshua M. Stuart, Teresa Swatloski,
Vladislav Uzunangelov, Peter Waltman, Christina Yau, Jing Zhu, Stanley R.
Hamilton, Gad Getz, Carrie Sougnez, Scott Abbott, Rachel Abbott, Nathan D.
Dees, Kim Delehaunty, Li Ding, David J. Dooling, Jim M. Eldred, Catrina C.
131
Fronick, Robert Fulton, Lucinda L. Fulton, Joelle Kalicki-Veizer, Krishna-Latha
Kanchi, Cyriac Kandoth, Daniel C. Koboldt, David E. Larson, Timothy J. Ley,
Ling Lin, Charles Lu, Vincent J. Magrini, Elaine R. Mardis, Michael D. Mclellan,
Joshua F. Mcmichael, Christopher A. Miller, Michelle O'laughlin, Craig Pohl,
Heather Schmidt, Scott M. Smith, Jason Walker, John W. Wallis, Michael C.
Wendl, Richard K. Wilson, Todd Wylie, Qunyuan Zhang, Robert Burton, Mark
A. Jensen, Ari Kahn, Todd Pihl, David Pot, Yunhu Wan, Douglas A. Levine,
Aaron D. Black, Jay Bowen, Jessica Frick, Julie M. Gastier-Foster, Hollie A.
Harper, Carmen Helsel, Kristen M. Leraas, Tara M. Lichtenberg, Cynthia
Mcallister, Nilsa C. Ramirez, Samantha Sharpe, Lisa Wise, Erik Zmuda, Stephen
J. Chanock, Tanja Davidsen, John A. Demchok, Greg Eley, Ina Felau, Brad A.
Ozenberger, Margi Sheth, Heidi Sofia, Louis Staudt, Roy Tarnuzzer, Zhining
Wang, Liming Yang, Jiashan Zhang, Larsson Omberg, Adam Margolin, Benjamin
J. Raphael, Fabio Vandin, Hsin-Ta Wu, Mark D M Leiserson, Stephen C. Benz,
Charles J. Vaske, Houtan Noushmehr, Theo Knijnenburg, Denise Wolf, Laura
Van't Veer, Eric A. Collisson, Dimitris Anastassiou, Tai-Hsien Ou Yang, Nuria
Lopez-Bigas, Abel Gonzalez-Perez, David Tamborero, Zheng Xia, Wei Li, Dong-
Yeon Cho, Teresa Przytycka, Mark Hamilton, Sean Mcguire, Sven Nelander,
Patrik Johansson, Rebecka Jörnsten, Teresia Kling, Jose Sanchez, John N.
Weinstein, Eric A. Collisson, Gordon B. Mills, Kenna R Mills Shaw, Brad A.
Ozenberger, Kyle Ellrott, Ilya Shmulevich, Chris Sander, and Joshua M. Stuart.
"The Cancer Genome Atlas Pan-Cancer Analysis Project." Nature Genetics 45.10
(2013): 1113-120. Web.
132
Compere, S. J. "The Ras and Myc Oncogenes Cooperate in Tumor Induction in Many
Tissues When Introduced into Midgestation Mouse Embryos by Retroviral
Vectors." Proceedings of the National Academy of Sciences 86.7 (1989): 2224-
228. Web.
Conde, Carmen, Manual Mark, Javier Oliver, Aline Huber, Gilbert De Murcia, and Josiane
Ménissier‐de Murcia. "Loss of Poly(ADP-ribose) Polymerase-1 Causes Increased
Tumour Latency in P53-deficient Mice." The EMBO Journal 20.13 (2001): 3535-
543. Web.
Cordero, David, Xavier Solé, Marta Crous-Bou, Rebeca Sanz-Pamplona, Laia Paré-Brunet,
Elizabet Guinó, Sebastiano Biondo, and Víctor Moreno. "Large Differences in
Global Transcriptional Regulatory Programs of Normal and Tumor Colon Cells."
BMC Cancer 14.708 (2014): n. pag. Web.
Couso, J., and A. Arias Martinez. "Notch Is Required for Wingless Signaling in the
Epidermis of Drosophila." Cell 79.2 (1994): 259-72. Web.
D'Abaco, G. M., R. H. Whitehead, and A. W. Burgess. "Synergy between Apc Min and an
Activated Ras Mutation Is Sufficient to Induce Colon Carcinomas." Molecular
Cell Biology 16.3 (1996): 884-91. Web.
Dai, Chengkai, Luke Whitesell, Arlin B. Rogers, and Susan Lindquist. "Heat Shock Factor 1
Is a Powerful Multifaceted Modifier of Carcinogenesis." Cell 130.6 (2007): 1005-
018. Web.
Dang, Chi V. "MYC on the Path to Cancer." Cell 149.1 (2012): 22-35. Web.
133
Dewhirst, Mark W., Yiting Cao, and Benjamin Moeller. "Cycling Hypoxia and Free Radicals
Regulate Angiogenesis and Radiotherapy Response." Nature Reviews Cancer 8.8
(2008): 654. Web.
Drayton, Sarah, Janice Rowe, Rebecca Jones, Radost Vatcheva, Darren Cuthbert-Heavens,
John Marshall, Mike Fried, and Gordon Peters. "Tumor Suppressor P16INK4a
Determines Sensitivity of Human Cells to Transformation by Cooperating
Cellular Oncogenes." Cancer Cell 4.4 (2003): 301-10. Web.
Elenbaas, B. "Human Breast Cancer Cells Generated by Oncogenic Transformation of
Primary Mammary Epithelial Cells." Genes & Development 15.1 (2001): 50-65.
Web.
Elenbaas, B. "Human Breast Cancer Cells Generated by Oncogenic Transformation of
Primary Mammary Epithelial Cells." Genes & Development 15.1 (2001): 50-65.
Web.
Esposito, Luca, Paola Indovina, Flora Magnotti, Daniele Conti, and Antonio Giordano.
"Anticancer Therapeutic Strategies Based on CDK Inhibitors." Current
Pharmaceutical Design 19.30 (2013): 5327-332. Web.
Esteve, P., A. Sandonìs, C. Ibañez, A. Shimono, I. Guerrero, and P. Bovolenta. "Secreted
Frizzled-related Proteins Are Required for Wnt/β-catenin Signalling Activation in
the Vertebrate Optic Cup." Development 138.19 (2011): 4179-184. Web.
Facchini, Linda M., and Linda Z. Penn. "The Molecular Role of Myc in Growth and
Transformation: Recent Discoveries Lead to New Insights." The FASEB Journal
12.9 (1998): 633-51. Web.
134
Fearon, Eric R., and Bert Vogelstein. "A Genetic Model for Colorectal Tumorigenesis." Cell
61.5 (1990): 759-67. Web.
Feinberg, Andrew P., and Benjamin Tycko. "The History of Cancer Epigenetics." Nature
Reviews Cancer 4.2 (2004): 143-53. Web.
Felsher, Dean W., and Bishop, J. Michael. “Reversible tumorigenesis by MYC in
hematopoietic lineages.” Mol Cell. 4(2) (1999): 199-207. Web.
Fodde, Riccardo, Ron Smits, and Hans Clevers. "Apc, Signal Transduction And Genetic
Instability In Colorectal Cancer." Nature Reviews Cancer 1.1 (2001): 55-67. Web.
Giehl, Klaudia. "Oncogenic Ras in Tumour Progression and Metastasis." Biological
Chemistry 386.3 (2005): 193-205. Web.
Greaves, Mel, and Carlo C. Maley. "Clonal Evolution in Cancer." Nature 481.7381 (2012):
306-13. Web.
Götschel, Frank, Daniela Berg, Wolfgang Gruber, Christian Bender, Markus Eberl, Myriam
Friedel, Johanna Sonntag, Elena Rüngeler, Hendrik Hache, Christoph Wierling,
Wilfried Nietfeld, Hans Lehrach, Annemarie Frischauf, Reinhard Schwartz-
Albiez, Fritz Aberger, and Ulrike Korf. "Synergism between Hedgehog-GLI and
EGFR Signaling in Hedgehog-Responsive Human Medulloblastoma Cells
Induces Downregulation of Canonical Hedgehog-Target Genes and Stabilized
Expression of GLI1." Ed. Vladimir N. Uversky. PLoS ONE 8.6 (2013): E65403.
Web.
Gysin, S., M. Salt, A. Young, and F. Mccormick. "Therapeutic Strategies for Targeting Ras
Proteins." Genes & Cancer 2.3 (2011): 359-72. Web.
135
Hahn, W. C., C. M. Counter, and R. A. Weinberg. "Creation of Human Tumour Cells with
Defined Genetic Elements." Nature 400.6743 (1999): 464-68. Web.
Hahn, William C., and Robert A. Weinberg. "Modelling the Molecular Circuitry of Cancer."
Nature Reviews Cancer 2.5 (2002): 331-41. Web.
Han, Tiandong, Donghao Shang, Xiuhong Xu, and Ye Tian. "Gene Expression Profiling of
the Synergy of 5-aza-2′-deoxycytidine and Paclitaxel against Renal Cell
Carcinoma." World Journal of Surgical Oncology 10.1 (2012): 183. Web.
Hanahan, Douglas, and Robert A. Weinberg. "The Hallmarks of Cancer." Cell 100.1 (2000):
57-70. Web.
Hanahan, Douglas, and Robert A. Weinberg. "Hallmarks of Cancer: The Next Generation."
Cell 144.5 (2011): 646-74. Web.
Harrison, H., G. Farnie, S. J. Howell, R. E. Rock, S. Stylianou, K. R. Brennan, N. J. Bundred,
and R. B. Clarke. "Regulation of Breast Cancer Stem Cell Activity by Signaling
through the Notch4 Receptor." Cancer Research 70.2 (2010): 709-18. Web.
Henriksson, M., and B. Luscher. "Proteins of the Myc Network: Essential Regulators of Cell
Growth and Differentiation." Advanced Cancer Research 68.109 (1996): 82.
Web.
Herbst, Andreas, Vindi Jurinovic, Stefan Krebs, Susanne E. Thieme, Helmut Blum, Burkhard
Göke, and Frank T. Kolligs. "Comprehensive Analysis of β-catenin Target Genes
in Colorectal Carcinoma Cell Lines with Deregulated Wnt/β-catenin Signaling."
BMC Genomics 15.74 (n.d.): n. pag. Web.
136
Hinds, P., C. Finlay, and A. J. Levine. "Mutation Is Required to Activate the P53 Gene for
Cooperation with the Ras Oncogene and Transformation." Journal of Virology
63.2 (1989): 739-46. Web.
Hong, Bo, A. Heuvel, Varun Prabhu, Shengliang Zhang, and Wafik El-Deiry. "Targeting
Tumor Suppressor P53 for Cancer Therapy: Strategies, Challenges and
Opportunities." Current Drug Targets 15.1 (2014): 80-89. Web.
Hurley, Laurence H. "DNA and Its Associated Processes as Targets for Cancer Therapy."
Nature Reviews Cancer 2.3 (2002): 188-200. Web.
Ingvarsson, Sigurdur. "Molecular Genetics of Breast Cancer Progression." Seminars in
Cancer Biology 9.4 (1999): 277-88. Web.
Jones, S., W.-D. Chen, G. Parmigiani, F. Diehl, N. Beerenwinkel, T. Antal, A. Traulsen, M.
A. Nowak, C. Siegel, V. E. Velculescu, K. W. Kinzler, B. Vogelstein, J. Willis,
and S. D. Markowitz. "Comparative Lesion Sequencing Provides Insights into
Tumor Evolution." Proceedings of the National Academy of Sciences 105.11
(2008): 4283-288. Web.
Kawano, Y., and R. Kypta. "Secreted Antagonists of the Wnt Signalling Pathway." Journal
of Cell Science 116.13 (2003): 2627-634. Web.
Kim, Hyun-A, Bon-Kyoung Koo, Ji-Hoon Cho, Yoon-Young Kim, Jinwoo Seong, Hee Jin
Chang, Young Min Oh, Daniel E. Stange, Jae-Gahb Park, Daehee Hwang, and
Young-Yun Kong. "Notch1 Counteracts WNT/β-catenin Signaling through
Chromatin Modification in Colorectal Cancer." Journal of Clinical Investigation
122.9 (2012): 3248-259. Web.
137
Kim, Julian A. "Targeted Therapies for the Treatment of Cancer." The American Journal of
Surgery 186.3 (2003): 264-68. Web.
Kinzler, Kenneth W., and Bert Vogelstein. "Lessons from Hereditary Colorectal Cancer."
Cell 87.2 (1996): 159-70. Web.
Knudsen, Erik S., and Karen E. Knudsen. "Tailoring to RB: Tumour Suppressor Status and
Therapeutic Response." Nature Reviews Cancer 8.9 (2008): 714-24. Web.
Land, Hartmut, Luis F. Parada, and Robert A. Weinberg. "Tumorigenic Conversion of
Primary Embryo Fibroblasts Requires at Least Two Cooperating Oncogenes."
Nature 304.5927 (1983): 596-602. Web.
Lehmann, Brian D., Joshua A. Bauer, Xi Chen, Melinda E. Sanders, A. Bapsi Chakravarthy,
Yu Shyr, and Jennifer A. Pietenpol. "Identification of Human Triple-negative
Breast Cancer Subtypes and Preclinical Models for Selection of Targeted
Therapies." Journal of Clinical Investigation 121.7 (2011): 2750-767. Web.
Lex, A., M. Streit, H.-J. Schulz, C. Partl, D. Schmalstieg, P.j. Park, and N. Gehlenborg.
"StratomeX: Visual Analysis of Large-Scale Heterogeneous Genomics Data for
Cancer Subtype Characterization." Computer Graphics Forum 31.3pt3 (2012):
1175-184. Web.
Liu, Yajun, Dongchu Sun, and Chong Z. He. "A Hierarchical Conditional Autoregressive
Model for Colorectal Cancer Survival Data." Wiley Interdisciplinary Reviews:
Computational Statistics 6.1 (2014): 37-44. Web.
Livingstone, Laura R., White, Alicia, Sprouse, Jason, Livanos, Elizabeth, Jacks, Tyler, Tlsty,
Thea D. “Altered cell cycle arrest and gene amplification potential accompany
loss of wild-type p53.” Cell 70(6) (1992): 923-935. Web.
138
Lloyd A.C., Obermuller, F., Staddon, S., Barth, C.F., McMahon, M. and Land, H.
“Cooperating oncogenes converge to regulate cyclin/cdk complexes.” Genes
Dev., 11 (1997): 663–677.
Loh, Yan Ni, Ellen L. Hedditch, Laura A. Baker, Eve Jary, Robyn L. Ward, and Caroline E.
Ford. "The Wnt Signalling Pathway Is Upregulated in an in Vitro Model of
Acquired Tamoxifen Resistant Breast Cancer." BMC Cancer 13.1 (2013): 174.
Web.
Loke SL, Stein C, Zhang X, Avigan M, Cohen J, Neckers LM. Delivery of c-myc antisense
phosphorothioate oligodeoxynucleotides to hematopoietic cells in culture by
liposome fusion: specific reduction in c-myc protein expression correlates with
inhibition of cell growth and DNA synthesis. Curr Top Microbiol Immunol.
141(1988): 282-289.
Lowe, Scott W, Ruley, H. Earl, Jacks, Tyler and Housman, David E. “p-53 dependent
apoptosis modulates the cytotoxicity of anticancer agents.” Cell 74(6) (1993):
957-967. Web.
Luo, Ji, Nicole L. Solimini, and Stephen J. Elledge. "Principles of Cancer Therapy:
Oncogene and Non-oncogene Addiction." Cell 138.4 (2009): 807. Web.
Malynn, Barbara A., Ignacio M. De Alboran, Rónán C. O'Hagan, Roderick Bronson, Laurie
Davidson, Ronald A. DePinho, and Frederick W. Alt. "N-myc Can Functionally
Replace C-myc in Murine Development, Cellular Growth, and Differentiation."
Genes and Development 14.11 (2000): 1390-399. Web.
139
Mccarthy, A., K. Savage, A. Gabriel, C. Naceur, Js Reis-Filho, and A. Ashworth. "A Mouse
Model of Basal-like Breast Carcinoma with Metaplastic Elements." The Journal
of Pathology 211.4 (2007): 389-98. Web.
McMurray, Helene R., Erik R. Sampson, George Compitello, Conan Kinsey, Laurel
Newman, Bradley Smith, Shaw-Ree Chen, Lev Klebanov, Peter Salzman, Andrei
Yakovlev, and Hartmut Land. "Synergistic Response to Oncogenic Mutations
Defines Gene Class Critical to Cancer Phenotype." Nature 453.7198 (2008):
1112-116. Web.
Miele, Lucio, and Barbara Osborne. "Arbiter of Differentiation and Death: Notch Signaling
Meets Apoptosis." Journal of Cellular Physiology 181.3 (1999): 393-409. Web.
Mizutani, T. "Conservation of the Biochemical Mechanisms of Signal Transduction among
Mammalian Notch Family Members." Proceedings of the National Academy of
Sciences 98.16 (2001): 9026-031. Web.
Molyneux, Gemma, Felipe C. Geyer, Fiona-Ann Magnay, Afshan Mccarthy, Howard
Kendrick, Rachael Natrajan, Alan Mackay, Anita Grigoriadis, Andrew Tutt, Alan
Ashworth, Jorge S. Reis-Filho, and Matthew J. Smalley. "BRCA1 Basal-like
Breast Cancers Originate from Luminal Epithelial Progenitors and Not from Basal
Stem Cells." Cell Stem Cell 7.3 (2010): 403-17. Web.
Montcouquiol, Mireille, E. Bryan Crenshaw, and Matthew W. Kelley. "Noncanonical Wnt
Signaling And Neural Polarity." Annual Review of Neuroscience 29.1 (2006):
363-86. Web.
Muzny, Donna M., Matthew N. Bainbridge, Kyle Chang, Huyen H. Dinh, Jennifer A.
Drummond, Gerald Fowler, Christie L. Kovar, Lora R. Lewis, Margaret B.
140
Morgan, Irene F. Newsham, Jeffrey G. Reid, Jireh Santibanez, Eve Shinbrot, Lisa
R. Trevino, Yuan-Qing Wu, Min Wang, Preethi Gunaratne, Lawrence A.
Donehower, Chad J. Creighton, David A. Wheeler, Richard A. Gibbs, Michael S.
Lawrence, Douglas Voet, Rui Jing, Kristian Cibulskis, Andrey Sivachenko, Petar
Stojanov, Aaron Mckenna, Eric S. Lander, Stacey Gabriel, Gad Getz, Li Ding,
Robert S. Fulton, Daniel C. Koboldt, Todd Wylie, Jason Walker, David J.
Dooling, Lucinda Fulton, Kim D. Delehaunty, Catrina C. Fronick, Ryan Demeter,
Elaine R. Mardis, Richard K. Wilson, Andy Chu, Hye-Jung E. Chun, Andrew J.
Mungall, Erin Pleasance, A. Gordon Robertson, Dominik Stoll, Miruna
Balasundaram, Inanc Birol, Yaron S. N. Butterfield, Eric Chuah, Robin J. N.
Coope, Noreen Dhalla, Ranabir Guin, Carrie Hirst, Martin Hirst, Robert A. Holt,
Darlene Lee, Haiyan I. Li, Michael Mayo, Richard A. Moore, Jacqueline E.
Schein, Jared R. Slobodan, Angela Tam, Nina Thiessen, Richard Varhol, Thomas
Zeng, Yongjun Zhao, Steven J. M. Jones, Marco A. Marra, Adam J. Bass, Alex H.
Ramos, Gordon Saksena, Andrew D. Cherniack, Stephen E. Schumacher, Barbara
Tabak, Scott L. Carter, Nam H. Pho, Huy Nguyen, Robert C. Onofrio, Andrew
Crenshaw, Kristin Ardlie, Rameen Beroukhim, Wendy Winckler, Gad Getz,
Matthew Meyerson, Alexei Protopopov, Juinhua Zhang, Angela Hadjipanayis,
Eunjung Lee, Ruibin Xi, Lixing Yang, Xiaojia Ren, Hailei Zhang, Narayanan
Sathiamoorthy, Sachet Shukla, Peng-Chieh Chen, Psalm Haseley, Yonghong
Xiao, Semin Lee, Jonathan Seidman, Lynda Chin, Peter J. Park, Raju
Kucherlapati, J. Todd Auman, Katherine A. Hoadley, Ying Du, Matthew D.
Wilkerson, Yan Shi, Christina Liquori, Shaowu Meng, Ling Li, Yidi J. Turman,
141
Michael D. Topal, Donghui Tan, Scot Waring, Elizabeth Buda, Jesse Walsh,
Corbin D. Jones, Piotr A. Mieczkowski, Darshan Singh, Junyuan Wu, Anisha
Gulabani, Peter Dolina, Tom Bodenheimer, Alan P. Hoyle, Janae V. Simons,
Matthew Soloway, Lisle E. Mose, Stuart R. Jefferys, Saianand Balu, Brian D.
O’Connor, Jan F. Prins, Derek Y. Chiang, D. Neil Hayes, Charles M. Perou,
Toshinori Hinoue, Daniel J. Weisenberger, Dennis T. Maglinte, Fei Pan,
Benjamin P. Berman, David J. Van Den Berg, Hui Shen, Timothy Triche Jr,
Stephen B. Baylin, Peter W. Laird, Gad Getz, Michael Noble, Doug Voet, Gordon
Saksena, Nils Gehlenborg, Daniel Dicara, Juinhua Zhang, Hailei Zhang, Chang-
Jiun Wu, Spring Yingchun Liu, Sachet Shukla, Michael S. Lawrence, Lihua
Zhou, Andrey Sivachenko, Pei Lin, Petar Stojanov, Rui Jing, Richard W. Park,
Marc-Danie Nazaire, Jim Robinson, Helga Thorvaldsdottir, Jill Mesirov, Peter J.
Park, Lynda Chin, Vesteinn Thorsson, Sheila M. Reynolds, Brady Bernard,
Richard Kreisberg, Jake Lin, Lisa Iype, Ryan Bressler, Timo Erkkilä, Madhumati
Gundapuneni, Yuexin Liu, Adam Norberg, Tom Robinson, Da Yang, Wei Zhang,
Ilya Shmulevich, Jorma J. De Ronde, Nikolaus Schultz, Ethan Cerami, Giovanni
Ciriello, Arthur P. Goldberg, Benjamin Gross, Anders Jacobsen, Jianjiong Gao,
Bogumil Kaczkowski, Rileen Sinha, B. Arman Aksoy, Yevgeniy Antipin, Boris
Reva, Ronglai Shen, Barry S. Taylor, Timothy A. Chan, Marc Ladanyi, Chris
Sander, Rehan Akbani, Nianxiang Zhang, Bradley M. Broom, Tod Casasent,
Anna Unruh, Chris Wakefield, Stanley R. Hamilton, R. Craig Cason, Keith A.
Baggerly, John N. Weinstein, David Haussler, Christopher C. Benz, Joshua M.
Stuart, Stephen C. Benz, J. Zachary Sanborn, Charles J. Vaske, Jingchun Zhu,
142
Christopher Szeto, Gary K. Scott, Christina Yau, Sam Ng, Ted Goldstein, Kyle
Ellrott, Eric Collisson, Aaron E. Cozen, Daniel Zerbino, Christopher Wilks, Brian
Craft, Paul Spellman, Robert Penny, Troy Shelton, Martha Hatfield, Scott Morris,
Peggy Yena, Candace Shelton, Mark Sherman, Joseph Paulauskis, Julie M.
Gastier-Foster, Jay Bowen, Nilsa C. Ramirez, Aaron Black, Robert Pyatt, Lisa
Wise, Peter White, Monica Bertagnolli, Jen Brown, Timothy A. Chan, Gerald C.
Chu, Christine Czerwinski, Fred Denstman, Rajiv Dhir, Arnulf Dörner, Charles S.
Fuchs, Jose G. Guillem, Mary Iacocca, Hartmut Juhl, Andrew Kaufman, Bernard
Kohl Iii, Xuan Van Le, Maria C. Mariano, Elizabeth N. Medina, Michael Meyers,
Garrett M. Nash, Phillip B. Paty, Nicholas Petrelli, Brenda Rabeno, William G.
Richards, David Solit, Pat Swanson, Larissa Temple, Joel E. Tepper, Richard
Thorp, Efsevia Vakiani, Martin R. Weiser, Joseph E. Willis, Gary Witkin,
Zhaoshi Zeng, Michael J. Zinner, Carsten Zornig, Mark A. Jensen, Robert Sfeir,
Ari B. Kahn, Anna L. Chu, Prachi Kothiyal, Zhining Wang, Eric E. Snyder, Joan
Pontius, Todd D. Pihl, Brenda Ayala, Mark Backus, Jessica Walton, Jon
Whitmore, Julien Baboud, Dominique L. Berton, Matthew C. Nicholls, Deepak
Srinivasan, Rohini Raman, Stanley Girshik, Peter A. Kigonya, Shelley Alonso,
Rashmi N. Sanbhadti, Sean P. Barletta, John M. Greene, David A. Pot, Kenna R.
Mills Shaw, Laura A. L. Dillon, Ken Buetow, Tanja Davidsen, John A. Demchok,
Greg Eley, Martin Ferguson, Peter Fielding, Carl Schaefer, Margi Sheth, Liming
Yang, Mark S. Guyer, Bradley A. Ozenberger, Jacqueline D. Palchik, Jane
Peterson, Heidi J. Sofia, and Elizabeth Thomson. "Comprehensive Molecular
143
Characterization of Human Colon and Rectal Cancer." Nature 487.7407 (2012):
330-37. Web.
Neve, Richard M., Koei Chin, Jane Fridlyand, Jennifer Yeh, Frederick L. Baehner, Tea Fevr,
Laura Clark, Nora Bayani, Jean-Philippe Coppe, Frances Tong, Terry Speed, Paul
T. Spellman, Sandy Devries, Anna Lapuk, Nick J. Wang, Wen-Lin Kuo, Jackie L.
Stilwell, Daniel Pinkel, Donna G. Albertson, Frederic M. Waldman, Frank
Mccormick, Robert B. Dickson, Michael D. Johnson, Marc Lippman, Stephen
Ethier, Adi Gazdar, and Joe W. Gray. "A Collection of Breast Cancer Cell Lines
for the Study of Functionally Distinct Cancer Subtypes." Cancer Cell 10.6 (2006):
515-27. Web.
Nguyen, P. L., A. G. Taghian, M. S. Katz, A. Niemierko, R. F. Abi Raad, W. L. Boon, J. R.
Bellon, J. S. Wong, B. L. Smith, and J. R. Harris. "Breast Cancer Subtype
Approximated by Estrogen Receptor, Progesterone Receptor, and HER-2 Is
Associated With Local and Distant Recurrence After Breast-Conserving
Therapy." Journal of Clinical Oncology 26.14 (2008): 2373-378. Web.
Nicolas, Michael, Anita Wolfer, Kenneth Raj, J. Alain Kummer, Pleasantine Mill, Mascha
Van Noort, Chi-Chung Hui, Hans Clevers, G. Paolo Dotto, and Freddy Radtke.
"Notch1 Functions as a Tumor Suppressor in Mouse Skin." Nature Genetics 33.3
(2003): 416-21. Web.
Ohashi, Shinya, Mitsuteru Natsuizaka, Yumi Yashiro–Ohtani, Ross A. Kalman, Momo
Nakagawa, Lizi Wu, Andres J. Klein–Szanto, Meenhard Herlyn, J. Alan Diehl,
Jonathan P. Katz, Warren S. Pear, John T. Seykora, and Hiroshi Nakagawa.
"NOTCH1 and NOTCH3 Coordinate Esophageal Squamous Differentiation
144
Through a CSL-Dependent Transcriptional Network." Gastroenterology 139.6
(2010): 2113-123. Web.
Panelos, John, Francesca Tarantini, Milena Paglierani, Claudia Di Serio, Vincenza Maio,
Silvia Pellerito, Nicola Pimpinelli, Marco Santucci, and Daniela Massi.
"Photoexposition Discriminates Notch 1 Expression in Human Cutaneous
Squamous Cell Carcinoma." Modern Pathology 21.3 (2008): 316-25. Web.
Perou, Charles M., Therese Sørlie, Michael B. Eisen, Matt Van De Rijn, Stefanie S. Jeffrey,
Christian A. Rees, Jonathan R. Pollack, Douglas T. Ross, Hilde Johnsen, Lars A.
Akslen, Patrick O. Brown, and David Botstein. "Molecular Portraits of Human
Breast Tumours." Nature 406 (2000): 747-52. Print.
Peto, R., F. J. Roe, P. N. Lee, L. Levy, and J. Clack. "Cancer and Ageing in Mice and Men."
Br J Cancer. 32(4) (1975): 411-426. Web.
Phng, L.-K., and Holger Gerhardt. "Angiogenesis: A Team Effort Coordinated by Notch."
Developmental Cell 16.2 (2009): 196-208. Web.
Pleasance, Erin D., R. Keira Cheetham, Philip J. Stephens, David J. Mcbride, Sean J.
Humphray, Chris D. Greenman, Ignacio Varela, Meng-Lay Lin, Gonzalo R.
Ordóñez, Graham R. Bignell, Kai Ye, Julie Alipaz, Markus J. Bauer, David
Beare, Adam Butler, Richard J. Carter, Lina Chen, Anthony J. Cox, Sarah Edkins,
Paula I. Kokko-Gonzales, Niall A. Gormley, Russell J. Grocock, Christian D.
Haudenschild, Matthew M. Hims, Terena James, Mingming Jia, Zoya Kingsbury,
Catherine Leroy, John Marshall, Andrew Menzies, Laura J. Mudie, Zemin Ning,
Tom Royce, Ole B. Schulz-Trieglaff, Anastassia Spiridou, Lucy A. Stebbings,
Lukasz Szajkowski, Jon Teague, David Williamson, Lynda Chin, Mark T. Ross,
145
Peter J. Campbell, David R. Bentley, P. Andrew Futreal, and Michael R. Stratton.
"A Comprehensive Catalogue of Somatic Mutations from a Human Cancer
Genome." Nature 463.7278 (2009): 191-96. Web.
Polakis, Paul. "The Many Ways of Wnt in Cancer." Current Opinion in Genetics &
Development 17.1 (2007): 45-51. Web.
Polakis, Paul. "Wnt Signaling and Cancer." Genes and Development 14.15 (2000): 1837-851.
Web.
Pedraza-Farina. “Mechanisms of Oncogenic Cooperation in Cancer Initiation and
Metastasis.” Yale J Biol Med. 79(3-4) (2006): 95-103. Web.
Pérez-Pérez, José Manuel, Héctor Candela, and José Luis Micol. "Understanding Synergy in
Genetic Interactions." Trends in Genetics 25.8 (2009): 368-76. Web.
Prior, I. A., P. D. Lewis, and C. Mattos. "A Comprehensive Survey of Ras Mutations in
Cancer." Cancer Research 72.10 (2012): 2457-467. Web.
Prochownik, Edward V. "C-Myc as a Therapeutic Target in Cancer." Expert Review of
Anticancer Therapy 4.2 (2004): 289-302. Web.
Proweller, A. "Impaired Notch Signaling Promotes De Novo Squamous Cell Carcinoma
Formation." Cancer Research 66.15 (2006): 7438-444. Web.
Radtke, F. "Self-Renewal and Cancer of the Gut: Two Sides of a Coin." Science 307.5717
(2005): 1904-909. Web.
Ranganathan, P., K. L. Weaver, and A. J. Capobianco. "Notch Signaling in Solid Tumors: A
Little Bit of Everything but Not All the Time." Nature Reviews Cancer 11 (2011):
338-51. Web.
146
Reedijk, M. "High-level Coexpression of JAG1 and NOTCH1 Is Observed in Human Breast
Cancer and Is Associated with Poor Overall Survival." Cancer Research 65.18
(2005): 8530-537. Web.
Roper E, Weinberg W, Watt FM, Land H. "p19ARF-independent induction of p53 and cell
cycle arrest by Raf in murine keratinocytes." EMBO reports. 2(2) (2001):145-50.
Ruley, H. Earl. "Adenovirus Early Region 1A Enables Viral and Cellular Transforming
Genes to Transform Primary Cells in Culture." Nature 304.5927 (1983): 602-06.
Web.
Ryan, Kevin M., Andrew C. Phillips, and Karen H. Vousden. "Regulation and Function of
the P53 Tumor Suppressor Protein." Current Opinion in Cell Biology 13.3 (2001):
332-37. Web.
Sampson, E. R., H. R. McMurray, D. C. Hassane, L. Newman, P. Salzman, C. T. Jordan, and
H. Land. "Gene Signature Critical to Cancer Phenotype as a Paradigm for
Anticancer Drug Discovery." Oncogene 32.33 (2012): 3809-818. Web.
Schlosshauer, P. W. "APC Truncation and Increased Beta-catenin Levels in a Human Breast
Cancer Cell Line." Carcinogenesis 21.7 (2000): 1453-456. Web.
Schmitt, Clemens A., Fridman, Jordan S., Yang, Meng, Baranov, Eugene, Hoffman, Robert
M., Lowe, Scott W. “Dissection p53 tumor suppressor functions in vivo. Cancer
Cell 1(3) (2002): 289-298. Web.
Schweisguth, François. "Regulation of Notch Signaling Activity." Current Biology 14.3
(2004): R129-138. Web.
147
Serrano, Manuel, Athena W. Lin, Mila E. Mccurrach, David Beach, and Scott W. Lowe.
"Oncogenic Ras Provokes Premature Cell Senescence Associated with
Accumulation of P53 and P16INK4a." Cell 88.5 (1997): 593-602. Web.
Shaffer, Arthur L., N. C. Tolga Emre, Laurence Lamy, Vu N. Ngo, George Wright,
Wenming Xiao, John Powell, Sandeep Dave, Xin Yu, Hong Zhao, Yuxin Zeng,
Bangzheng Chen, Joshua Epstein, and Louis M. Staudt. "IRF4 Addiction in
Multiple Myeloma." Nature 454.7201 (2008): 226-31. Web.
Sharma, Sreenath V. and Settleman, Jeffrey. “Oncogene addiction: setting the stage for
molecularly targeted cancer therapy.” Genes Dev. 21(2) (2007): 3214-3231. Web.
Shen, R., A. B. Olshen, and M. Ladanyi. "Integrative Clustering of Multiple Genomic Data
Types Using a Joint Latent Variable Model with Application to Breast and Lung
Cancer Subtype Analysis." Bioinformatics 26.2 (2010): 292-93. Web.
Sigal, A., and V. Rotter. "Oncogenic Mutations of the P53 Tumor Suppressor: The Demons
of the Guardian of the Genome." Cancer Research 60.24 (2000): 6788-793. Web.
Sinn, Eric, William Muller, Paul Pattengale, Isidore Tepler, Racheal Wallace, and Philip
Leder. "Coexpression of MMTV/v-Ha-ras and MMTV/c-myc Genes in
Transgenic Mice: Synergistic Action of Oncogenes in Vivo." Cell 49.4 (1987):
465-75. Web.
Smith, Bradley, and Hartmut Land. "Anticancer Activity of the Cholesterol Exporter ABCA1
Gene." Cell Reports 2.3 (2012): 580-90. Web.
Smith, G. "Mutations in APC, Kirsten-ras, and P53---alternative Genetic Pathways to
Colorectal Cancer." Proceedings of the National Academy of Sciences 99.14
(2002): 9433-438. Web.
148
Solimini, Nicole L., Ji Luo, and Stephen J. Elledge. "Non-Oncogene Addiction and the Stress
Phenotype of Cancer Cells." Cell 130.6 (2007): 986-88. Web.
Vita, Marina and Henriksson, Marie. “The Myc oncoprotein as a therapeutic target for human
cancer.” Semin Cancer Biol. 16(4) (2006): 318-330. Web.
Vivanco, I, and Sawyers, CL. “The phosphatidylinositol 3-Kinase AKT pathway in human
cancer. “ Nat Rev Cancer. 2(7) (2002): 489-501. Web.
Vogelstein, Bert, and Kenneth W. Kinzler. "The Multistep Nature of Cancer." Trends in
Genetics 9.4 (1993): 138-41. Web.
Walters, Emily, Heyer, Dorothy, Candelaria, Pierre V, Wang, Simeng and McMurray,
Helene R. “CRGs regulate BLBC growth in a cancer-selective manner.”
Unpublished.
Weinberg, Robert A. "Oncogenes, Antioncogenes, and the Molecular Basis of Multistep
Carcinogenesis." Cancer Research 55 (1989): 3713-721. Web.
Weinstein, I. B., A. Joe, and D. Felsher. "Oncogene Addiction." Cancer Research 68.9
(2008): 3077-080. Web.
Weinstein, I. B. "CANCER: Enhanced: Addiction to Oncogenes--the Achilles Heal of
Cancer." Science 297.5578 (2002): 63-64. Web.
Weinstein, I. Bernard, and Andrew K. Joe. "Mechanisms of Disease: Oncogene Addiction—
a Rationale for Molecular Targeting in Cancer Therapy." Nature Clinical Practice
Oncology 3.8 (2006): 448-57. Web.
Weng, A. P., A. A. Ferrando, and J. C. Aster. "Activating Mutations of NOTCH1 in Human
T Cell Acute Lymphoblastic Leukemia." Science 306.5694 (2004): 269-71. Web.
149
Whelan, Jarrett T., Anne Kellogg, Brian M. Shewchuk, Karlene Hewan-Lowe, and Fred E.
Bertrand. "Notch-1 Signaling Is Lost in Prostate Adenocarcinoma and Promotes
PTEN Gene Expression." Journal of Cellular Biochemistry 107.5 (2009): 992-
1001. Web.
Williams, Bart O., Lee Remington, Daniel M. Albert, Shizuo Mukai, Roderick T. Bronson,
and Tyler Jacks. "Cooperative Tumorigenic Effects of Germline Mutations in Rb
and P53." Nature Genetics 7.4 (1994): 480-84. Web.
Xia, Mingxuan, and Hartmut Land. "Tumor Suppressor P53 Restricts Ras Stimulation of
RhoA and Cancer Cell Motility." Nature Structural & Molecular Biology 14.3
(2007): 215-23. Web.
Yang, L., X. Wu, Y. Wang, K. Zhang, J. Wu, Y-C Yuan, X. Deng, L. Chen, C. C H Kim, S.
Lau, G. Somlo, and Y. Yen. "FZD7 Has a Critical Role in Cell Proliferation in
Triple Negative Breast Cancer." Oncogene 30.43 (2011): 4437-446. Web.
Yokoyama, K, and Imamoto, F. “Transcriptional control of the endogenous MYC
protooncogene by antisense RNA.” Proc Natl Acad Sci USA. 84(21) (1987):
7363-7367.
Zhang, Lin, Wei Zhou, Victor E. Velculescu, Scott E. Kern, Ralph H. Hruban, Stanley R.
Hamilton, Bert Vogelstein, and Kenneth W. Kinzler. "Gene Expression Profiles in
Normal and Cancer Cells." Science 276.5316 (1997): 1268-272. Web.
top related