of industrial application of spring-8 easy-to-understand
Post on 23-Oct-2021
5 Views
Preview:
TRANSCRIPT
The photograph shows the SPring-8 storage ring used to generate synchrotron radiation. Synchrotron radiation is an electromagnetic wave generated when a high-energy electron beam is bent in a magnetic fifield, and SPring-8 provides X-rays that are 100 million times brighter than conventional X-rays. Similarly to microscopes, the brighter the light, the higher the resolution.
CCCCCCCOOOOONNNNNTTTTTTEEEEEENNNNNNNTTTTTSSSSS
Research method using synchrotron radiation;synchrotron radiation is irradiated to a target substance to measure its absorption, transmission, diffraction, scattering, and the emission of fluorescent X-rays and photoelectrons.
ReaReaReaReaReaRealizlizlizlizlizatatatiatiatiatitiioooon on o on of Ef Ef Ef EEnvinnvinvinvironrononronmememmmeeentantattantallyllylyllylly–Fr–Fr–Fr–Fr–Fr–Frrienienieieiieni ddlydly HiHiigh-gh-gh-PerPerPerPerrerrforforforforforforfo manmamanmance ce ThrThree-e--e -WaWaWaWayWaWayWaWa CaCataltalt ysyst h-PP eeen ——— 2CClarClarClararClarrrrificaificificificaificaficationtiontiontiontiont of of of of of two twtwo t oo wo majomajomajomajoajomm r mr mer mer m chanchanchanismsismsmssmsmss of of of of ofofof of cataccatacatacatacccat lystlystysty s fos for aur auutotomotomoomoomootivetivetivetivetivetiveiveive exhexhexhexhexhexhexexhaustauaustust purpurificaificationtio
ReaReaReaReReaRealizlizlizlizl atatititiatit on on on on n of of ofof of f IntIntIIntIntn ellelllellel igeigeigeigegeent nt nt nt ntnt nt t CatCatCatCaCC alyalyalya st st forforfor AAuAuAutomtomtomtomtomtomtommotiotototiototo ve-vevve-v EmiEmississis onsonsonss CoCoCoCoCoCoCoC ntrntrntnt ol ol —————— 4ClarClarClarClarClaCla ificaificificaficaficaficaationtiontiontiontiooonon of ofof of off selfselfselfselfe f-reg-reg--regreggenerenerenerenereneratinatinatinatinatinating meg g meg meechanchchanismism to mto mto mo maintaintintaintaintaintainainainainainin catcatacatacatacatac alytiyyt c acactivitivityty
DevDevDDeDevDevDevDDevveloeloeloeloeloooolopmepmpmemepmpmepmeent nt nt nt nt of of of of of fo highighighighighihihhigh ph ph ph ph erferferformormormmancancanncncncance,e,e,e,e,e,, fufuefuefufu l-el el fficiffifficiffi entente t tittiiresesesres —————————— 666AnalAnalAnaAnaAnalAnalAna ysiysisysisysysisysisysiss of of of of threthrethrehreree-die-die-die-die-ddid mmenmensmensmensmensionaionaionoo l stl sttructrucructructcture ureure ure re r in tin tin tin tin tin tin tn tireiireireirer matemmatematem rialriaal at at the the nanonaano tototo micrmicrmicrmicrmicrmicromometometomomomomo er ser scalecalea
DevDevDDevDevDeDevD veloeloeloelooe pmepmepmepmepmemem nt nt nnt ntnnt of ofof fo HaiHaiiHH r-CC-Cr-Cr CCarearearearereareareare PrPrPrPrPrPrPrProododuoduoduoduo cctststs ThThhat at MakkM kake He He HHe He HHaiairairaira SShShinynyy ———— 8QuanQuanQuQuanQuanu tifictifictifictificficatioatioatioatioation ofn ofn ofn o of haihaihh r shr shshine inennnneene at tat tat tat tat tat tt tt the che che che che che che che celluelluelluellue lar lar rlla leveevell
DevDevDevDevDevDeveloeloeloeloeelol pmepmepmeppmepm ntnt tnttt t of oofof of oo HaiHaiHaiHaiHaaiair-Cr-Cr-Cr-Cr-Cr-Cr arearearearre PrPrP oduoductsctss frfrfrom om omom RicRicRicRicRicce We We Weee Wateterr r ———— 10VisuVisuVisuVisuisualizalizalizalizizli inginginggngg the heththtthehheh penepenepenepeneppenepe trattrattrattrattratta ion ionionion ion ioion of aof aof aof aof a proprotecttectiveive compc mpoundoundounddound intintintintntn o tho tho tho the haee ir ur singng spspectroscopy
DevDevDevvDeDeDevDevDe eloeloeloeloeloeloelooe pmepmepmepmepmempm nt ntnt nt ntt oof of of ofof AntAAAntAntA i-ci-ci ariariesese CheCheChewinwinwinwinng Gg Gg Gg Gg GGGumumum —————— 121CrysyCryCrysCCrysrCrysC talltalltallalllograograograograograographicphicphicphicphich visvisvisvisv ualiualiuu zatizatiz on oon of thf the pre pe p ocesocesocesesss ofs ofs ofs os ofos resresresresresesrestoratoratoratorat tiontio aftfter eearlyarly-s-stage caries
DevDevDevDevevD veloeloeloeloeloele opmepmepmepmep nt nt n of of oof LonLong-Lg-Lg-L-Lastastastastastingingingingingingnng ArArArArArAA tifitifitifitiificiaciacial Jl Joinoi tsts ———— 14A neA neA neA neA neA n w diw diw diw directrecrectrectioniono in din desigesigesigsigningningngningn matmatmatmatmattmateriaeriaeriaeriaeriaerials tls tls tls tls tls o pro pro po pro eveneevent oxt oxidata ion on and and degradation of artificial joints
DevDDevD veloeloell pmepmemepmememement nt nt nt ntnnn ofof ofof o MatMatMatM erierial ala DesesDesignigni MeMethot d for Autoclaved Lightweight Aerated Concrete ——— 18AnalAnalysisysisysisysis of of of of formformformformformo atioatioiiation men men chanchanism sm of cf cof rystrystallial ne cne omponent tobermorite
EstEstEstEstablablablablishishshi ingingingg MeMeMM thothothothohoods ds ds dds ds ds to to toto to toto o DeDesDeDesDesD ignign MaM terterialials fs for o Polymer-Modified Cement Waterproofing Coating ——— 16PursPursPursPurPur uituitu of hof hhydraydyd tiontiononnonn andandandandand harharharharharhardenidenidendenn ng png pg rocerocessess
ResResRResRespoponponnp diddindinng tgg to to tthe he hee ResResRestritritrictictiono of Hazardous Substances in Electronic Products ——— 20EstaEstaEstatablisblisbliblishmenhmenhment oft of highigh h-seh-se-sensitnsnsititivitivitvi y noy n ndestructive inspection method for hexavalent chromium
DevDevDevDeveloeloeloe pmepmepment nt of of of of HiHigHigHi h-Eh-Efficiffic ency Recycling Technology for Tungsten ——— 22ChemChemCheme icalicalica stastastaate atete ate te nalynalynalyalysissississis of tof tf ungsungn ten during ion exchange in collection system
DevDevDeeDeveloeloeloopmepmepmem nt nt nt nt of ofof of LonLoLong-Lg ife Next-Generation Li-Ion Batteries ——— 24ClarClarClarificaificaificaificacaationtiontion of of of the theththe causcaucc es os f performance deterioration of Li-ion batteries
ImpImpImpImpprovrovrovrorr emeemeemement of Capacity of Nickel-Metal Hydride Battery y ——— 26ClarClarClarClarClarificaificaificaficationtiontion of of the th optimal composition of the electrode
ConConConC trittributbutioion to Development of Next-Generation CMOS Products ——— 28DeveDevelopmlopment ent of tof echnology for evaluating ultrathin-film laminated structures
Develoopmep nnt of of Photonic Integrated Devices with High Luminescent Efficiencyi I t t d D i ith Hi h L i t Effi iDevelopment of Photonic Integrated Devices with High Luminescent Efficiency ——— 3232
EstEstablablishishmenment ot f Method for Analyzing Next-Generation Metal-Oxide-Semiconductor Field-Effect Transistors ——— 30NondNondN estrestructiuctive ave analynal sis is of internal states of semiconductor laminated structures
——— 3434
——— 363636366636
——— 4444040440444444444044404440440404000400000000004400000404000040404004444440
——— 44444444444444444444444444444444444444444
X-ray Fluorescence analysis
Photoelectron spectroscopy
Irradiation of synchrotron radiation
X-ray absorption fine structure (XAFS)
Infrared absorptionspectroscopy
X-ray diffraction/scattering
Imaging
Industrial applications account for more than 20% of the total number of research proposals carried out at SPring-8. The world’s highest measurement and analysis technologies with high-performance synchrotron radiation have become essential for material evaluation for manufacturing in companies. This booklet is a collection of research proposals with industrial applications conducted at SPring-8, the achievements of which are presented to be easily understood by people outside the field of expertise. This booklet was prepared for general readers to easily comprehend the contents when they see the title and the “achievements” in the blue box. Such clear and simple explanations have been strongly requested by the managers of companies using or considering the use of SPring-8 as well as by the politicians and policymakers who determine the social significance of SPring-8. I hope that this booklet will help such people and the general public to understand the contribution of SPring-8 to industry. I sincerely appreciate the cooperation of the many parties involved, including those from companies involved in the preparation of this booklet.
Yoshiharu Doi, President Japan Synchrotron Radiation Research Institute (JASRI)
Easy-to-Understand Examples of Industrial Application of SPring-8
top related