physiological and molecular characterization of
Post on 10-Apr-2022
8 Views
Preview:
TRANSCRIPT
Physiological and molecular
characterization of organophosphate
pesticide (profenofos and chlorpyrifos)
degrading bacterial strains
Hina Jabeen
Submitted in partial fulfillment of
requirement for the degree
Doctor of Philosophy
2015
Department of Biotechnology (NIBGE)
Pakistan Institute of Engineering and Applied Sciences
Nilore-45650 Islamabad, Pakistan
National Institute for Biotechnology and Genetic Engineering
P. O. BOX 577, JHANG ROAD, FAISALABAD.
(Affiliated with PIEAS, Islamabad)
Declaration of Originality
I hereby declare that the work accomplished in this thesis is the result of my own research
carried out in Environmental Biotechnology Division (EBD), NIBGE. This thesis has not
been published previously nor does it contain any material from the published resources that
can be considered as the violation of international copyright law.
Furthermore, I also declare that I am aware of the terms “copyright” and “plagiarism”, and if
any copyright violation was found out in this work, I will be held responsible of the
consequences of any such violation.
Signature: _______________
Name of the Student: Hina Jabeen
Registration No. 10-7-1-015-2008
Date: ______________
Place: NIBGE, Faisalabad
National Institute for Biotechnology and Genetic Engineering
P. O. BOX 577, JHANG ROAD, FAISALABAD.
(Affiliated with PIEAS, Islamabad)
Research Completion Certificate
Certified that the research work contained in this thesis entitled “Physiological and
molecular characterization of organophosphate pesticide (profenofos and
chlorpyrifos) degrading bacterial strains” has been carried out and completed by
“Hina Jabeen” under my supervision during her PhD studies in the subject of
Biotechnology.
____________________ _________________
Date Dr Samina Iqbal
Research Supervisor
Submitted Through
________________
Dr Shahid Mansoor
Director NIBGE
Certificate of Approval
This is to certify that the work contained in this thesis entitled “Physiological and
molecular characterization of organophosphate pesticide (profenofos and
chlorpyrifos) degrading bacterial strains”, carried out by “Hina Jabeen” in our
opinion is fully adequate, in scope and quality, for the degree of Doctor of Philosophy in
Biotechnology from Pakistan Institute of Engineering and Applied Sciences (PIEAS).
Approved by:
Internal Examiner/Supervisor:
Signature: _________________
Name: Dr. Samina Iqbal
External Examiner
Signature: _________________
Name: Dr Irshad Hussain
External Examiner:
Signature: _________________
Name: Dr Tahira Iqbal
Verified by:
Signature: _________________
Name: Dr. Shahid Mansoor
Head, Department of NIBGE (Biotechnology)
Stamp: _____________________
Dedicated to My beloved Parents, Bhaya,
And My grandfather
A spiritual companion who guided me
at all the steps of this task
Allah Bless his Soul!
Acknowledgements
Foremost, I am thankful to ALLAH ALMIGHTY, the only Creator, for blessing me with the
opportunity to seek knowledge and granting me success and determination through all the
phases of life. My deepest feelings of gratefulness are for HOLY PROPHET (PEACE BE
UPON HIM), the most loved one of Allah Almighty and a role model for humanity in all the
aspects forever. I would like to extend my gratitude to Higher Education Commission (HEC),
Pakistan for providing me the financial support for PhD studies and making my dreams come
true. My special gratitude for Dr Shahid Mansoor, Director NIBGE, for providing an excellent
environment for research and academics. Next I would like to pay my heartiest gratitude to
someone I revere as much, my supervisor, Dr Samina Iqbal, as she molded me as an
independent researcher through her continuous advices, systematic guidance, encouragement
and support. No words can suffice her role in my accomplishment.
I am greatly obliged to Dr Rebecca Parales, my foreign supervisor and Juan Parales,
foreign instructor for their cordial advices, endeavors and support during the tenure of IRSIP
fellowship (International Research Support Initiative Program, HEC) at University of
California, Davis, CA, USA. I am profoundly indebted to Head Environmental Biotechnology
Division, (SEBD) NIBGE Dr Qaiser Mehmood Khan for his kind attitude, guidance and
cooperation. I wish to express my sincere gratitude to Samina Anwar for her support, advices
and encouragement at all the points during my research which helped me to sum up my
determination and courage at many hopeless moments in research life. I am really grateful to
Dr Mohammad Afzal for his sincere advices and guidance during this research. I offer my
generous thanks to Dr. Sajjad Mirza for providing HPLC facility in his laboratory and for his
help in plant growth promoting analysis of bacteria, to Dr. Asma Imran for her cooperation
and support in the accomplishment of Confocal Laser Scanning Microsopic analysis to
complete a part of this research. I would like to say heartfelt thanks to Dr Mohammad
Ibrahim Rajoka for his valuable guidance in kinetic analysis of pesticides degradation.
My cordial gratitude to my friends Tanveer Majeed, Mariaum Zain, Muissa Fatima,
Saira Ali, and Maryam Zafar for their constant help and company, my lab fellows Sadiqa
Firdous, Fiaz Ahmad and Muhammad Asif Nadeem for their contributions which goes
beyond any measurable value and all my colleagues at NIBGE.
For any successful task, the support, faith and blessings of near and dear ones is a
must. I am totally indebted to my great grandparents, my beloved father and mother, my
brothers, sisters and bhabi, for their true love, patience, understanding and endurance during
the whole tenure of this journey. Their prayers traced me everywhere which were the source of
hope and success in this task. I cannot express my feelings for the everlasting love of my
mother and her prayers and I can never possibly repay. I can never forget to mention the name
of my beloved cousin & an affectionate companion, Saman Hina, for her great support,
encouragement and well wishes at all the points of this task.
Hina Jabeen
i
Table of Contents
Acknowledgement
Table of Contents................................................................................................................i
List of Figures..................................................................................................................vii
List of Tables....................................................................................................................xii
List of Abbreviations......................................................................................................xiii
Abstract............................................................................................................................xv
Chapter 1
Introduction and Review of Literature
1.1 Environmental xenobiotics ................................................................................... 1
1.2 Pesticides .............................................................................................................. 1
1.3 Pesticides: A necessary evil ................................................................................. 3
1.4 Organophosphate pesticides ................................................................................. 5
1.4.1 Mode of action and toxicity of organophosphate pesticides ......................... 8
1.4.2 Environmental impact and hazards of OP pesticides .................................. 11
1.5 Pesticide situation in Pakistan ............................................................................ 13
1.6 Bioremediation/Biodegradation ......................................................................... 15
1.7 Bioremediation/Biodegradation of pesticides .................................................... 15
1.8 Microbial degradation of organophosphate pesticides ....................................... 18
1.9 Factors affecting biodegradation of pesticides ................................................... 24
1.10 Organophosphate degrading enzymes ................................................................ 27
1.11 Bioremediation of organophosphate contaminated soil ..................................... 27
1.12 Plant microbe interaction for the remediation of pesticides/pollutants .............. 28
1.13 Objectives of the study ....................................................................................... 30
Chapter 2
Materials and Methods
2.1 Chemicals ........................................................................................................... 31
2.2 Bacterial strains used in the study ...................................................................... 31
2.3 Soil collection ..................................................................................................... 32
ii
2.4 Growth media ..................................................................................................... 32
2.4.1 Maintenance and preservation of the bacterial strains ................................ 32
2.5 Equipment used in the study .............................................................................. 33
2.6 Enrichment of profenofos and chlorpyrifos degrading bacterial strains ............ 33
2.7 Isolation of pesticide degrading bacterial strains ............................................... 33
2.8 Molecular characterization of bacterial isolates ................................................. 34
2.8.1 DNA Isolation ............................................................................................. 34
2.8.2 Preparation of Heat shock competent cells (C-cells) .................................. 35
2.8.3 Amplification of 16S rRNA gene from bacterial isolates ........................... 35
2.8.4 Agarose gel electrophoresis ........................................................................ 36
2.8.5 Ligation and cloning of the 16S rRNA gene .............................................. 36
2.8.6 Sequencing of 16S rRNA gene and bacterial identification ....................... 36
2.9 Morphological and biochemical characteristics of the bacterial isolates ........... 37
2.9.1 Morphological characterization .................................................................. 37
2.9.2 Physiology and Biochemical characterization ............................................ 37
2.9.2.1 Gram staining .......................................................................................... 37
2.9.2.2 Antibiotic resistance of isolates............................................................... 38
2.10 Inoculum preparation ......................................................................................... 38
2.11 Experimental set up for pesticide degradation studies ....................................... 39
2.11.1 Determination of the detection wavelength of the pesticides ..................... 39
2.11.2 Extraction of pesticide residues from liquid cultures ................................. 39
2.11.3 HPLC conditions for pesticide residual analyses........................................ 40
2.12 Soil microcosm studies (Pot Experiments) ........................................................ 40
2.12.1 Soil collection for microcosm experiments ................................................ 40
2.12.2 Determination of Maximum Water Holding Capacity (MWHC) of the
soil ............................................................................................................... 40
2.12.3 Preparation of pesticide-contaminated soil ................................................. 41
2.12.4 Extraction and analysis of pesticide residues from soil .............................. 41
2.12.5 Optimization of soil moisture on pesticide degradation ............................. 41
2.12.6 Optimization of inoculum density for pesticide degradation in soil ........... 42
2.13 Identification of pesticide metabolites ............................................................... 42
iii
2.14 Study of potential genes encoding hydrolases/oxygenases in pesticide degrading
bacterial strains ...................................................................................................... 43
2.14.1 Amplification of the OP degrading genes ................................................... 43
2.14.2 Agarose gel electrophoresis, cloning and sequencing of the amplified
gene ............................................................................................................. 43
Chapter 3
Isolation, characterization and degradation potential of profenofos
degrading bacterial strains
3.1 Introduction ...................................................................................................... 46
3.2 Materials and Methods .................................................................................... 49
3.2.1 Development of profenofos degrading bacterial consortium ...................... 49
3.2.2 Molecular identification of PFF degrading bacterial strains comprising the
consortium PBAC ....................................................................................... 50
3.2.3 Morphology and biochemical analysis of PFF degrading bacterial isolates50
3.2.4 Biodegradation of PFF by pure cultures and bacterial consortium PBAC . 50
3.2.5 Extraction and HPLC analysis of PFF residues .......................................... 50
3.2.6 Optimization of culture conditions for PFF degradation using Response
surface Methodology (RSM) ...................................................................... 51
3.2.7 PFF degradation by PBAC at different initial concentrations .................... 52
3.2.8 Soil microcosm studies for PFF degradation .............................................. 52
3.2.9 Identification of PFF metabolites................................................................ 52
3.2.10 Study of potential genes encoding OP hydrolases/oxygenases .................. 52
3.2.11 Biodegradation of other pesticides .............................................................. 53
3.2.12 Data analysis ............................................................................................... 53
3.3 Results ............................................................................................................... 54
3.3.1 Molecular identification of PFF degrading bacterial isolates ..................... 54
3.3.2 Morphological and biochemical characterization of PFF degrading bacterial
isolates......................................................................................................... 60
3.3.3 Antibiotic resistance assay .......................................................................... 63
3.3.4 Biodegradation of PFF in aqueous medium by pure cultures and PBAC .. 64
3.3.5 Biodegradation of PFF with different initial concentrations by PBAC ...... 67
3.3.6 Optimization of culture conditions for PFF degradation using RSM ......... 69
3.3.7 Response surface plots for PFF degradation ............................................... 75
3.3.8 Soil microcosm studies of PFF degradation ............................................... 80
iv
3.3.8.1 Optimization of soil moisture contents for PFF degradation .................. 80
3.3.8.2 Optimization of inoculum density for PFF degradation in sterilized soil 80
3.3.9 Identification of profenofos metabolites ..................................................... 84
3.3.10 Detection of OP degrading genes in PFF degrading bacterial strains (PF1-
PF4) ............................................................................................................. 96
3.3.11 Biodegradation of other pesticides by the bacterial consortium PBAC ..... 97
3.4 Discussion .......................................................................................................... 99
Chapter 4
Isolation, characterization and degradation potential of chlorpyrifos
degrading bacterial strains
4.1 Introduction
4.2 Materials and methods
4.2.1 Enrichment and isolation of CP degrading bacterial strains ..................... 108
4.2.2 Identification and characterization of selected strain HN3 ....................... 108
4.2.3 Experimental set up for CP degradation studies ....................................... 108
4.2.4 Extraction and analysis of CP residues ..................................................... 109
4.2.5 Turbidometric study to monitor the growth of the bacterial strain, HN3 . 109
4.2.6 Optimization of temperature and pH for biodegradation of CP by HN3 .. 109
4.2.7 CP degradation in minimal and complex media ....................................... 109
4.2.8 Kinetics of CP degradation by HN3 at different initial concentrations
of CP ......................................................................................................... 110
4.2.9 Biodegradation of TCP (primary metabolite of CP) ................................. 110
4.2.9.1 Biodegradation of TCP in minimal and complex media ....................... 110
4.2.9.2 Extraction and analysis of TCP residues ............................................... 110
4.2.9.3 Detection of chloride ions produced during CP and TCP degradation . 111
4.2.10 Soil microcosm studies of CP ................................................................... 111
4.2.11 Identification of CP metabolites ............................................................... 112
4.2.12 Study of potential genes encoding OP hydrolases/oxygenases ................ 112
4.2.13 Data Analysis ............................................................................................ 112
4.3 Results ............................................................................................................. 112
4.3.1 Isolation and selection of CP degrading bacterial strain ........................... 112
4.3.2 Molecular, morphological and biochemical identification of strain HN3 114
v
4.3.3 Antibiotic resistance assay ........................................................................ 114
4.3.4 Biodegradation of CP by Mesorhizobium sp. HN3 .................................. 118
4.3.4.1 Optimum temperature for the CP degradation by Mesorhizobium sp.
HN3 ....................................................................................................... 118
4.3.4.2 Optimization of pH for CP degradation by Mesorhizobium sp. HN3 ... 118
4.3.4.3 Biodegradation of CP at different initial concentrations ....................... 118
4.3.4.4 Kinetics of CP degradation and TCP accumulation and degradation
thereafter ................................................................................................. 123
4.3.4.5 Co-metabolic degradation of CP by Mesorhizobium sp. HN3 .............. 128
4.3.5 Biodegradation of TCP by Mesorhizobium sp. HN3 ................................ 130
4.3.5.1 Biodegradation of TCP at different initial concentrations .................... 130
4.3.5.2 Release of chloride ions in culture media containing CP and TCP ...... 130
4.3.6 Soil microcosm studies of CP ................................................................... 135
4.3.6.1 Optimization of soil moisture level for CP degradation in unsterilized
soil ......................................................................................................... 135
4.3.6.2 Biodegradation of CP in sterilized and unsterilized soil ....................... 135
4.3.6.3 Optimization of inoculum density for CP degradation in sterilized soil 136
4.3.7 Identification of Chlorpyrifos metabolites ................................................ 140
4.3.8 Detection of OP degrading genes in Mesorhizobium sp. HN3 ................. 155
4.4 Discussion ........................................................................................................ 157
Chapter 5
Bio-stimulation: Microbe Assisted Phytoremediation
5.1 Introduction .................................................................................................... 162
5.2 Materials and Methods .................................................................................. 163
5.2.1 Soil fortification with CP .......................................................................... 163
5.2.2 Bacterial strains used in the study ............................................................. 164
5.2.3 Plasmid used for transformation ............................................................... 164
5.2.4 Preparation of electrocompetent cells of Mesorhizobium sp. HN3 .......... 164
5.2.5 Electroporation of yfp gene into Mesorhizobium sp. HN3 ....................... 165
5.2.6 Experimental design.................................................................................. 165
5.2.7 Extraction and analysis of chlorpyrifos residues in the soil and plant ...... 166
vi
5.2.8 Detection and enumeration of the bacteria in the soil............................... 166
5.2.9 Root and shoot colonization by Mesorhizobium sp. HN3yfp ................... 167
5.2.10 Measurement of growth parameters.......................................................... 167
5.2.11 Phosphate solubilization ........................................................................... 167
5.2.12 Indoleacetic acid production ..................................................................... 168
5.2.13 Data analysis ............................................................................................. 168
5.3 Results ............................................................................................................. 169
5.3.1 Biodegradation of CP in the planted and un-planted soil ......................... 169
5.3.2 Chlorpyrifos uptake by plant .................................................................... 172
5.3.3 Colonization of Mesorhizobium sp. HN3 in soil ...................................... 173
5.3.4 Colonization of Mesorhizobium sp. HN3 in the roots and shoots ryegrass
173
5.3.5 Plant biomass......................................................................................... 178
5.3.6 Plant growth promoting properties of Mesorhizobium strain HN3 .......... 181
5.3.6.1 Indoleacetic acid production .............................................................. 181
5.3.6.2 Phosphate solubilization .................................................................... 181
5.4 Discussion ........................................................................................................ 182
Chapter 6
General Discussion.........................................................................................................186
Chapter 7
References ......................................................................................................................191
Appendices
Publications
vii
LIST OF FIGURES
Figure 1.1 General chemical structure of organophosphate pesticides 6
Figure 1.2 Normal Mode of action of acetycholinesterase in the absence of OP
compounds 10
Figure 1.3 Mechanism of action of OP compounds or inhibition of
acetylcholinesterase enzyme 10
Figure 1.4 Pesticides movement in the environment after their application 11
Figure 1.5 Trend of insecticide use in Pakistan 14
Figure 1.6 Hydrolysis of organophosphate by a bacterial phosphotriesterase enzyme 18
Figure 1.7 Plant microbe interaction for the remediation of pesticide contaminated
soil 29
Figure 3.1 Chemical structure of profenofos 46
Figure 3.2 Restriction Fragment Length Polymorphism of IGS gene from PFA-PFH 55
Figure 3.3 Neighbor joining tree showing the phyllogenetic relationship of strain PF1 56
Figure 3.4 Neighbor joining tree showing the phyllogenetic relationship of strain PF2 57
Figure 3.5 Neighbor joining tree showing the phyllogenetic relationship of strain PF3 58
Figure 3.6 Neighbor joining tree showing the phyllogenetic relationship of strain PF4 59
Figure 3.7 Morphology of profenofos degrading pure bacterial isolates grown on LB-
agar medium 62
Figure 3.8 Degradation of profenofos and its metabolite BCP by pure bacterial
isolates and the consortium PBAC 65
Figure 3.9 Degradation of profenofos by the PBAC at different initial concentrations of
profenofos in MSM 68
Figure 3.10 The parity plot of PFF degradation (%) 72
Figure 3.11 Coutour and Response surface plots for profenofos degradation (%) as a
result of interaction of pH and temperature at constant inoculum size 76
Figure 3.12 Contour and response surface plots for profenofos degradation (%) as a
result of interaction of pH and inoculum size at constant temperature 77
Figure 3.13 Contour and response surface plots for profenofos degradation (%) as a
result of interaction of temperature and inoculum size at constant pH 78
viii
Figure 3.14 Optimization Ramp for profenofos degradation 79
Figure 3.15 Degradation (% ) of profenofos by the bacterial consortium PBAC in the
sterilized soil at different moisture levels 82
Figure 3.16 Degradation (% ) of profenofos by the bacterial consortium PBAC in the
sterilized soil at different inoculum sizes 83
Figure 3.17 Total ion chromatogram (TIC) of the extract of the spent culture medium
containing profenofos at zero time 86
Figure 3.18 Mass spectrum of of profenofos 87
Figure 3.19 Total ion chromatogram (TIC) of the extract of the spent culture medium
containing profenofos harvested after 24 h 88
Figure 3.20 Total ion chromatogram (TIC) of the extract of the spent culture medium
containing profenofos harvested after 72 h. 89
Figure 3.21 Total ion chromatogram (TIC) of the extract of the spent culture medium
containing CP harvested after 96 h 90
Figure 3.22 Mass spectrum of 4-bromo-2-chlorophenol (BCP), the hydrolysis
products of profenofos 91
Figure 3.23 Mass spectrum of O- ethyl-S-propyl-O-hydrogen phosphorothioate
(EPHP), the hydrolysis products of profenofos 92
Figure 3.24 Mass spectrum ethylene glycol, a proposed ring cleavage product of
BCP 93
Figure 3.25 Mass spectrum of 4-bromo-2-chlorophenyl ethyl propyl phosphate
(BCPEPP) 94
Figure 3.26 Proposed biodegradation pathway of Profenofos by the bacterial
consortium 95
Figure 3.27 Amplification of opdA gene encoding an OP hydrolase (OPAA) in PFF
degrading bacterial strains (PF1-PF2) 96
Figure 3.28 Degradation of PFF and other pesticides by bacterial consortium 98
Figure 4.1 Chemical structure of chlorpyrifos 103
Figure 4.2 Degradation (%) of chlorpyrifos by 8 selected bacterial strains 113
Figure 4.3 Mesorhizobium sp. HN3 grown on LB-agar plate after 48 h of incubation 115
Figure 4.4 Scanning Electron Microscopy image of Mesorhizobium sp. HN3 115
ix
Figure 4.5 UPGMA tree showing the phyllogenetic relationship of strain HN3
116
Figure 4.6 Degradation (%) of chlorpyrifos by Mesorhizobium sp. HN3 as a sole
source of carbon and energy at different incubation temperatures 120
Figure 4.7 Degradation (%) of chlorpyrifos by Mesorhizobium sp. HN3 as a sole
source of carbon and energy at different initial pH 121
Figure 4.8 Biodegradation (%) of chlorpyrifos by Mesorhizobium sp. HN3 at different
initial concentrations as a sole source of carbon and energy 122
Figure 4.9 Kinetics of CP degradation at 37C by Mesorhizobium sp. HN3 at different
initial concentrations 124
Figure 4.10 First order kinetics of chlorpyrifos degradation in MSM at different initial
concentrations 126
Figure 4.11 Co-metabolic degradation of chlorpyrifos by Mesorhizobium sp. HN3 128
Figure 4.12 Biodegradation of chlorpyrifos by Mesorhizobium sp. HN3 in nitrogen
free medium 129
Figure 4.13 Biodegradation (%) of TCP by Mesorhizobium sp. HN3 as a sole source
of carbon and energy at different initial concentrations 131
Figure 4.14 Co-metabolic degradation of TCP by Mesorhizobium sp. HN3 132
Figure 4.15 Analysis of chloride ions produced as a result of chlorpyrifos
degradation in a chloride free medium 133
Figure 4.16 Analysis of chloride ions produced as a result of TCP degradation in a
chloride free medium 134
Figure 4.17 Biodegradation (%) of chlorpyrifos by Mesorhizobium sp. HN3 in the
unsterilized soil at different soil moistures 137
Figure 4.18 Biodegradation (%) of chlorpyrifos by Mesorhizobium sp. HN3 in the
unsterilized and sterilized soil 138
Figure 4.19 Biodegradation (%) of chlorpyrifos by Mesorhizobium sp. HN3 in the
sterilized soil at different inoculums densities 139
Figure 4.20 Total ion chromatogram (TIC) of the extract of the spent culture medium
containing CP at zero time 142
Figure 4.21 Mass spectrum of chlorpyrifos (CP) 143
x
Figure 4.22 Total ion chromatogram (TIC) of the extract of the spent culture medium
containing CP harvested at 48 h (2 days)
144
Figure 4.23 Mass spectrum of 3,5,6-trichloro-2-pyridinol 145
Figure 4.24 Mass spectrum of Diethylthiophosphate (DETP) 146
Figure 4.25 Mass spectrum of 3,5,6 trichloro-2-methoxypyridine (TMP) 147
Figure 4.26 Total ion chromatogram (TIC) of the extract of the spent culture medium
containing CP harvested after 72 h (3 days). 148
Figure 4.27 Mass spectrum of 3,5-dichloropyridine 149
Figure 4.28 Mass spectrum of 3-chloro-2-pyridinol 150
Figure 4.29 Mass spectrum of 3,5-trichloro-2-methoxypyridine 151
Figure 4.30 Total ion chromatogram (TIC) of the extract of the spent culture medium
containing CP harvested after 120 h (5 days) of incubation. 152
Figure 4.31 Mass spectrum of chromatogram of maleamic acid 153
Figure 4.32 Predicted biodegradation pathway of chlorpyrifos 154
Figure 4.33 Amplification of opdA gene encoding an OP hydrolase (OPAA) in CP
degrading Mesorhizobium sp. HN3 156
Figure 4.34 Amplification pcaH gene encoding an protocatechuate dioxygenase in CP
degrading Mesorhizobium sp. HN3 156
Figure 5.1 Degradation of CP and accumulation & subsequent disappearance of TCP
by ryegrass (Lolium multiflorum) and Mesorhizobium sp. 170
Figure 5.2 CLSM images (10X) of time course colonization process of Lolium
multiflorum (ryegrass) roots by Mesorhizobium sp. HN3yfp after 15 days of
inoculation
174
Figure 5.3 CLSM images (10X) of time course colonization process of Lolium
multiflorum (ryegrass) roots by Mesorhizobium sp. HN3yfp after 30 days of
inoculation
175
Figure 5.4 CLSM images (10X) of time course colonization process of Lolium
multiflorum (ryegrass) roots by Mesorhizobium sp. HN3yfp after 45 days of
inoculation
176
Figure 5.5 A comparison of shoot lengths and root lengths among different ryegrass
plant treatments 179
xi
Figure 5.6 Qualitative test of IAA production by Mesorhizobium sp. HN3 using Ferric
chloride
181
Figure 5.7 Qualitative test of phosphate solubilization by Mesorhizobium sp. HN3 on
Pikoviskaya medium 181
xii
List of Tables
Table 1.1 Some commonly used organophosphate pesticides and their metabolites 7
Table 1.2 Microorganisms isolated for the biodegradation of organophosphorus pesticides 21
Table 2.1 Bacterial strains used in the study 32
Table 2.2 Antibiotics used in the study 38
Table 2.3 Sequences of the previously reported primers used in this study 44
Table 2.4 Primer sequences designed by aligning the already reported
organophosphate degrading genes 45
Table 3.1 Experimental ranges and levels of independent variables 51
Table 3.2 Percent (%) similarity of profenofos degrading bacterial strains with reported
16SrRNA gene sequences in the GenBank 54
Table 3.3 Biochemical characteristics of profenofos degrading bacteria 61
Table 3.4 Response of profenofos degrading bacterial strains to different antibiotics 63
Table 3.5 Degradation kinetics of profenofos by pure and mixed cultures 66
Table 3.6 The 23 factorial and central composite design for experiment 71
Table 3.7 The CCD matrix showing actual values (%) along with the experimental values
of PFF degradation 73
Table 3.8 Analysis of Variance (ANOVA) for the response (% degradation of PFF) 74
Table 3.9 Different metabolites of profenofos and their detail 85
Table 4.1 Previously reported chlorpyrifos and TCP degrading bacterial strains 106
Tabl Table 4.2 Biochemical and morphological characteristics of Mesorhizobium sp. HN3 117
Table 4.3 Kinetic parameters for chlorpyrifos degradation and product (TCP) formation 125
Table Table 4.4 First order kinetics parameters for chlorpyrifos degradation by Mesorhizobium
sp. HN3 in liquid medium (MSM) 127
Table 5.1 First order kinetics parameters of chlorpyrifos degradation in planted and un-
planted soils 171
Table 5.2 CP uptake and accumulation in roots and shoots of ryegrass 172
Table 5.3 Colonization of Mesorhizobium sp. HN3yfp in planted (ryegrass) and un-planted
soil 177
Table 5.4 Effect of chlorpyrifos on plant growth parameters 180
xiii
LIST OF ABBREVIATIONS
2,4-D 2,4-Dichlorophenoxyacetic acid
AcH Acetylcholine
AChE Acetylcholinesterase enzyme
ASS Antibiotic sensitivity sulphonamide agar
CFU Colony Forming Units
CLSM Confocal Laser Scanning Microscope
CP Chlorpyrifos
DDT Dichloro-diphenyl-trichloro-ethane
DETP diethyl thiophosphoric acid
ECDs Endocrine disruptors
EPA Environmental Protection Agency
EPHP O- ethyl-S-propyl-O-hydrogen phosphorothioate
GC-MS Gas Chromatography Mass Spectrometer
HPLC High Performance Liquid Chromatography
IAA Indoleacetic acid
mpd Methyl parathion degrading
MPH Methyl parathion hydrolase
MS Mass Spectrum
MSM Minimal salt medium
NFM Nitrogen Free Medium
OC Organochlorine
OP Organophosphorus
xiv
OPAA Organophosphorus acid anhydrolase
opd Organophosphate degrading
opdA Organophosphorus acid anhydrolase gene
OPH Organophosphorus hydrolase
pcaH Protocatechuate hydrolyzing (gene)
PFF Profenfos
PGPR Plant growth promoting Rhizobia
POPs Persistent organic pollutants
P-solubilization Phosphate solubilization
SEM Scanning Electron Microscopy
TCP 3,5,6 trichloro-2-pyridinol
TMP 3,5,6 trichloro-2-methoxypyridine
WHO World Health Organization
xv
ABSTRACT
Organophosphate pesticides (OPs) are the synthetic chemicals that have broad
applications in agriculture for controlling different kinds of pests such as insects and
weeds etc. They poison the insects and mammals by paralyzing their central nervous
system which is linked to many acute and long term health disorders. Two of the most
widely used and broad-spectrum OP pesticides are the chlorpyrifos (CP) and profenofos
(PFF) which are used for protecting various crops against serious insect pests. However,
continuous and indiscriminate use of these pesticides is of great concern due to their
serious impacts and hazards on the environment and humans. Remediation of these toxic
pesticides and related contaminants using microorganisms having the right metabolic
pathways seems to be the most effective technology. Objectives of this study were to
isolate and characterize bacterial strains capable of complete degradation of CP, PFF and
their toxic metabolites, optimize culture conditions that govern degradation of these
compounds by the isolated bacteria and investigate the pathways of degradation.
A chlorpyrifos degrading bacterial strain, Mesorhizobium sp. HN3 was isolated and
characterized. Time course shake flask experiments and kinetic analysis revealed high
efficiency of Mesorhizobium sp. HN3 for CP degradation up to 300 mg/L at range of at a
broad range of culture conditions. Importantly, HN3 also degraded 3,5,6 trichloro-2-
pyridinol (TCP), a more toxic and persistent metabolite of CP. Further, enhanced CP
degradation in soil was achieved by the combined use of Mesorhizobium sp. HN3 and
ryegrass (Lolium multiflorum). Moreover, a yfp-tagged variant of Mesorhizobium sp.
HN3 (HN3yfp) was used to study the colonization of this strain in the rhizosphere and
endosphere of ryegrass. The strain HN3yfp proficiently colonized the rhizosphere & roots
of ryegrass, removed CP and TCP residues uptaken by the plant thus enhanced plant
growth.
For PFF degradation, a bacterial consortium PBAC, consisting of Achromobacter
xylosoxidans, Pseudomonas aeruginosa, Bacillus sp. and Citrobacter koseri, was
isolated. PBAC was capable of degrading PFF and its toxic hydrolysis product 4-bromo-
2-chlorophenol (BCP). The efficacy of PFF degradation was modeled by central
composite design (CCD) based on response surface methodology (RSM). The
simultaneous effects of three test interacting factors on the PFF degradation (%) were
xvi
monitored and conditions were optimized for maximum degradation of PFF. Gas
Chromatography Mass Spectrometry (GC-MS) analysis of CP and PFF provided plenty
of information regarding their metabolites and hence biodegradation pathways of the two
pesticides were predicted successfully. The detection of dehalogenation and ring cleavage
metabolites of the pesticides indicated the complete degradation of the toxic pesticides.
The overall study indicates that CP degrading Mesorhizobium sp. HN3 and PFF
degrading bacterial consortium PBAC are the promising candidates for the remediation
of OP contaminated sites. Further, the study provides insight into the fate and
biodegradation pathways of the two pesticides.
Validity of the study is that fate of TCP or BCP have seldom been addressed. Rather,
previous reports emphasis on the parent compound degradation. But the degradation of
the metabolites is more important due to the fact that OP pesticides degrade to their
metabolites soon after they reach soil. Metabolites are usually more toxic and persistent
than the parent compounds. Moreover, to best of our knowledge this is the first study
involving the elaborately designed optimization experiments for profenofos degradation
by a diverse bacterial consortium. Also, degradation of BCP by the microbial
communities has not already been reported.
Chapter 1 Introduction and Review of Literature
1
Chapter 1
Introduction and Review of Literature
1.1 Environmental xenobiotics
The term xenobiotic originated from the Greek word xeno which means “foreign”
and biotic means “pertaining to life” hence xenobiotics are generally referred to as
compounds that are foreign to living bodies. Xenobiotics are the synthetic chemicals that
were developed in the last century with the major purpose of benefit to mankind. Such
synthetic compounds have been employed as explosives, pesticides, dyes, solvents and
refrigerants in industrial, urban and agricultural applications. However, an ever mounting
production of synthetic chemicals is attributed largely to fast growing global
industrialization and new innovations in synthetic chemistry. Generally the term
xenobiotic is used with the context of pollutants or contaminants that are harmful for the
life. This is because the discharge and accumulation of these noxious compounds into the
environment have become enormous (Duong et al., 1997). Millions of kilograms of toxic
chemicals are discharged worldwide in water, air and soils as reported by Third World
Network (TWN) reports. These toxic chemicals cause environmental problems thus
disturbing the original balance in nature. Although, they enter the environment at very
low residual concentrations but their consequences are aggravated due to bio-
accumulation and bio-concentration leading to the overall disturbed quality of the
environment. Although, scientists all over the world are trying to develop strategies to
reduce the indiscriminate use of these pollutants so as to overcome the problems
associated with them, however, their words are not well given attention and many
substances are still in use without considering their unfavorable impact (Shukla et al.,
2010).
1.2 Pesticides
Among all xenobiotics, pesticides are the most widely used all over the world.
Pests are defined differently depending on different habitats and the roles they play in
different locations. For example, in rural areas, pests include all the species of insects,
weeds, bird, mites, slugs, rodents, snails and arthropods that cause damage to the crops.
Chapter 1 Introduction and Review of Literature
2
For urban inhabitants, pests include all kinds of mosquitoes, flies, insects, bacteria and
viruses that can be vectors for diseases, cause disturbance & unhygienic conditions in the
environment and endanger health and comfort. The term pesticide, in particular describes
a group of chemical substances that modify natural processes of living organisms deemed
to be pests, whether these are insects, mold or fungi, weeds or deleterious plants.
Environmental Protection Agency (EPA) which is the primary regulator of the pesticide
use, defines pesticide more elaborately as: “any substance or mixture of substances
intended for preventing, destroying, repelling or mitigating any pest.”
Pesticides are classified on the basis of their physical properties, chemical
structure, target organism and mode of action. Based on the target organism, pesticides
are named as insecticides (used to kill the insect pests of crops and also mosquitoes, flies
and the insect vectors for human diseases), herbicides (intended to mitigate the unwanted
plants), fungicides (to kill fungi), avicides (to kill bird pests) and acaricides (to get rid of
tick and mites). Classification of pesticides based on chemical structure is usually more
preferred by the scientists because mode of action, toxicity and characteristics of
pesticides depend on the chemical structure. Major chemical families of pesticides
include organochlorines (OCs), organophosphates (OPs), carbamates and pyrethroids.
Organochlorines are the organic compounds with several chlorine atoms. Owing to
the presence of chlorine atoms, they are highly persistent and non biodegradable hence
stay in the environment for long period of time. Their mode of action includes the
disruption of sodium or potassium balance of nerve fibers thus continuously transmitting
the nerve impulses. Commonly known OC pesticides are DDT, eldrin and endosulfan..
Organophosphate pesticides are the organic phosphorus containing substances
which control the target pests by irreversibly inhibiting the acetyl cholinesterase (AChE)
enzyme (Clark, 2006). Currently, organophosphates are the most widely used insecticides
as they effectively control the serious insect pests and are less persistent compared to
organochlorines. Commonly used OP pesticides include chlorpyrifos, diazinon,
profenofos, parathion and triazophos.
Carbamates are the derivatives of carbamic acid and they also act as cholinesterase
inhibitors but they cause reversible and less severe inhibition compared to that caused by
OPs. Some of the carbamates include carbaryl, carbofuran and aldicarb. Pyrethroids are
Chapter 1 Introduction and Review of Literature
3
analogs of the naturally occurring insecticides found in the pyrethrum extracted from the
chrysanthemum flowers. Being highly effective against insect pests at low concentrations,
they are also getting popularity for crop protection.
1.3 Pesticides: A necessary evil
Pesticides are very old existing since around 1000 BC when ancient Chinese
started using sulphur for the control of fungi and bacteria. After that, arsenic and honey
were used as a mixture to kill insect pests. Arsenic compounds were used as herbicides as
well as insecticide in late 1800’s. By the late 1900s, a compound called Paris green
(copper acetoarsenite) became a tool for farmers in USA to get rid of the agricultural
pests (Lah, 2011). These primitive forms of pesticides paved the way for developing
advanced and effective formulations of pesticides in the hope of providing more benefits
to mankind.
Use of advanced synthetic chemicals which include, herbicides, insecticides and
fertilizers (collectively called agrochemicals) started in late 1930s and early 1940s to
enhance crop quality and yield. It was the time when world population was increasing
tremendously more than the availability of resources. The population reached 6.0 billion
in the year 2000, and is projected to increase to approximately 8.0 billion by the year
2025. Hence there developed an immense need of improving the quality and quantity of
the food to support everyday growing population. Pesticide popularity soared after the
insecticidal properties of many organochlorine compounds including aldrin, DDT
(dichloro-diphenyl-trichloro-ethane), endrin and dieldrin were discovered. Being
inexpensive and effective; these products were widely used with DDT being the most
popular owing to its strong and broad-spectrum activity. These chemicals controlled a
great variety of sucking and chewing insects as well as aphids, spiders, mites, and other
pests that attack important crops like sugarcane, cotton, tobacco, peanuts, many fruits and
vegetables. Moreover, these chemicals helped in controlling many life threatening
diseases such as yellow fever, malaria and typhus by killing the insect vectors responsible
for the spread of these diseases. In this way many insect control programs were able to
save millions of lives. Hence, the use of pesticides both in the field of public health and
Chapter 1 Introduction and Review of Literature
4
crop protection increased and they emerged as a necessary tool for economical pest
management in modern agriculture.
Unluckily, most of the synthetic pesticides, predominantly the chlorinated
compounds are highly persistent in the environment causing toxicity to all life forms
including humans. The adverse impact of these toxic chemicals can extend from the point
of production or application to a large-scale and even to global level. Chemical pesticides
can harm agricultural workers who do not follow the safety guidelines such as proper
protective dressing. Usually, human exposure to pesticides occurs through ingestion
(accidentally or intentionally eating the contaminated food) or inhalation (though air
contaminated with pesticide residues as a result of spray on crops).
Public concerns regarding pesticide use appeared after Rachel Carson’s book,
“Silent Spring” was published in 1962, which addressed the toxicity and hazards
associated with DDT and other related pesticides. The book helped in developing
awareness in the people about the persistence of pesticides in the environment and
subsequent contamination of food chain. It described about the decline of bird population
due to thinning of egg shells and other toxic effects in birds. Further, it has been reported
extensively that organochlorine pesticides accumulate in the fatty tissues of animals and
cause chronic health effects, such as cancer, genetic, teratogenic and neurological effects
(Chaudhry and Chapalamadugu, 1991; Dua et al., 2002; Vaccari et al., 2006).
Organochlorines were also classified in persistent organic pollutants (POPs) that are
environmentally persistent, highly toxic and tend to bioaccumulate (Yu et al., 2006).
According to Stockholm Convention on POPs, nine out of the twelve POPs belong to
organochlorines. They are also designated as endocrine disruptors (ECDs) (Tsai, 2010).
World Health Organization (WHO) has classified pesticides toxicity effects in classes
ranging from class Ia to class III. Class Ia includes highly toxic pesticides and class III
includes slightly toxic pesticides (Copplestone, 1988). Most of the class Ia pesticides are
still in use in the developing countries (Bull, 1982).
Since DDT and other OC pesticides were banned by 1970s owing to their
persistence, toxicity and health effects, organophosphate and carbamate pesticides gained
popularity. Organophosphate pesticides had already been synthesized as potential warfare
agents by the Germans for use in World War II but they were kept secret. However, they
Chapter 1 Introduction and Review of Literature
5
were re-purposed as insecticides after the organochlorine pesticides. Organophosphates
and carbamate pesticides became widespread in agriculture as they are effective against a
broad range of insects pests. Also being less persistent and less toxic, OPs were
considered environmentally safe compared to OCs. Moreover, being more biodegradable,
they were perceived as an absolute alternative to the persistent organochlorine pesticides
(Hansen et al., 1983; Coats et al., 1989).
“Silent Spring” also redirected the research towards more environment friendly
and natural types of pesticides. In this regard pyrethroids were introduced as they were
synthesized from pyrethrins that are the natural poisons for the insects. Synthetic
pyrethroids also target the nervous system of pests. Recent literature further indicates that
pesticide exposure is widespread and presents potential risks to humans, especially to
susceptible populations such as pregnant women and children (Whyatt et al., 2004 and
Eskenazi et al., 2004). Potential adverse effects of pesticide exposure to children’s health,
including reproductive outcomes, childhood cancers, neurobehavioral toxicity, and
endocrine disruption have been well studied (Garry, 2004).
1.4 Organophosphate pesticides
Organophosphorus compounds are ubiquitous and constitute a large group of
chemical agents (Kamanyire and Karalliedde, 2004). Synthetic organophosphorus (OP)
compounds are being used throughout the world as additives of pesticides, petroleum and
plasticizers and cover more than 38% of world pesticides used (Singh, 2008). Regarding
the chemical structure, they are the esters of phosphoric acids and generally consist of a
central phosphorus atom attached with a double bond to either oxygen (P=O) or sulfur
(P=S), two organic side chains (R1 and R2), and an additional side chain that behaves as
the leaving group (X) and belongs to a variety of substituted aromatic, heterocyclic or
aliphatic groups such as cyanide, thiocyanate, halide, phosphate, phenoxy, thiophenoxy,
or carboxylate group (Figure 1.1). Leaving group imparts variations in the properties of
different OP compounds. Insecticidal properties of the OP compounds depend largely on
the R1 and R2. Organophosphates with methyl or ethyl as R1=R2 are very effective
insecticides compared to those containing propyl or isopropyl groups (Fukuto, 1990).
Usually the “R” group is bonded to the phosphorus atom in different ways. Generally, an
Chapter 1 Introduction and Review of Literature
6
oxygen or sulfur atom is present between the R group and phosphorus atom and the
structures are known as phosphate or phosphothioate respectively (Karpouzas and Singh,
2006). Some OPs contain R1 bonded to phosphorus atom through a direct bond and R2 is
bonded to phosphorus atom by a sulfur atom (thion phosphonates) or an oxygen atom
(phosphonates).
Names and chemical structures of some of the commonly used OP pesticides and their
respective hydrolytic metabolites are given in Table 1.1.
Figure 1.1 General chemical structure of organophosphate pesticides
P
O
R2(O,S)
R1(O,S)(S)
(O,S)
X
Chapter 1 Introduction and Review of Literature
7
Table 1.1: Some commonly used organophosphate pesticides and their
metabolites
Compound Chemical structure Metabolite Chemical structure
Chlorpyrifos [O, O diethyl- O (3, 5, 6
trichloro-2-pyridyl
phosphorothioate)]
3,5,6-trichloro-2-
pyridinol
Profenofos O-4-bromo-2-chlorophenyl O-
ethyl S-propyl phosphorothioate
4-bromo-2-
chlorophenol
Br
Cl
HO
Methyl parathion O,O-dimethyl-O-p-nitrophenyl
phosphorothioate
4-nitrophenol
Diazinon O,O-Diethyl O-[4-methyl-6-
(propan-2-yl)pyrimidin-2-yl]
2-isopropyl-4-
methyl-6-
hydroxypyrimidine N
N
CH
CH3
CH3
HO
Triazophos 0, O-diethyl o-(1-phenyl-1H-1,
2, 4-triazol-3-yl)
phosphorothioate
N
N
N
O
P
OS
O
1-phenyl-1,2,4-
triazole-3-ol N
N
N
OH
Cl
N
Cl
O
Cl
P
S
O
O Cl
NCl
OH
Cl
Br
Cl
OP
O O
S
NOP
O
O
OS
O-
N
N
CH
CH3
CH3
OP
S
O
O
O
H
NO2
Chapter 1 Introduction and Review of Literature
8
1.4.1 Mode of action and toxicity of organophosphate pesticides
Organophosphate insecticides are known to inhibit the acetyl cholinesterase
(AChE) which is a potent enzyme responsible for the normal nervous coordination in
insects, humans and other organisms (Yair et al., 2008). AChE is present in peripheral,
central and autonomic nervous system and regulates the level of acetylcholine which is
an important neurotransmitter and transmits the nerve impulses within the brain and
different parts of body. Normally, after impulse transmission, acetylcholine binds to the
active site of AChE due to its chemical structure complementarity to the active site of the
enzyme (Figure 1.2). AChE then hydrolyzes the acetylcholine to acetyl CoA and choline
to avoid accumulation of the neurotransmitter and overstimulation of muscles (Fukuto,
1990; Karpouzas and Singh, 2006).
OPs mimic the structure of acetylcholine hence easily bind to AChE thereby
inhibiting the normal activity of the AChE. Binding of OPs to active site of the enzyme
alters its structure and function and acetylcholine cannot bind to the enzyme due to
competitive inhibition (Figure 1.3). AChE inhibition leads to the accumulation of the
acetylcholine in the brain, at synapses, ganglia in the autonomic nervous system, skeletal
neuromuscular junctions, adrenal medulla and some in the sympathetic nervous system
(Chandrasekara and Pathiratne, 2005). Ultimate effects of the AChE inhibition include
headache, convulsion, disturbed breathing, paralysis and death of pests. (Ragnarsdottir,
2000).
Besides the target pests, OPs are known to adversely affect or kill other organisms
including ecologically important insects like beetles, bees, and wasps as well as aquatic
organisms e.g. protozoans, fish and tadpoles and higher animals including humans.
(Colosio et al., 2009; Jokanovic and Prostran, 2009). Routes of entry of
organophosphates to human body generally involve oral (intentional or unintentional
ingestion), respiratory (through inhalation) or dermal (through skin contact) exposure.
Dermal and respiratory exposure can also occur accidently and both are the efficient
entry routes for the pesticides (Khan et al., 2010). The inception and severity of OP
poisoning is usually determined by the exposure route, dose and physicochemical
properties of the pesticide e.g. lipid or tissue solubility and rate of
metabolism/degradation (Fukuto, 1990). Moreover, OP exposure is related to broad-
Chapter 1 Introduction and Review of Literature
9
spectrum effects including a variety of nerve disorders and interruption of many vital
functions in higher animal and humans (Eaton et al., 2008; Ghisari and Bonefeld-
Jorgensen, 2005; Middlemore-Risher et al., 2010; Ventura et al., 2012).
OP poisoning results in a number of health effects which have been ascribed to be
the consequence of AChE inhibition. However, it was suggested that inactivation of
AChE by itself cannot account for all the adverse health effects, hence there may be some
other mechanisms responsible for OP toxicity within the organism’s body which
contribute to the overall effect (Zaki, 1982). It is now clear that, although inhibition of
AChE is a key mechanism of OPs, however, the disruption of other enzymes, individual
susceptibility and the direct exposure of tissues to OPs are also important factors to be
considered. They are very toxic to vertebrates and many reports indicate that they are
more toxic than organochlorines (Khanna et al., 1995).
Chapter 1 Introduction and Review of Literature
10
Acetylcholine
Acetylcholine
Figure 1.3 Mechanism of action of OP compounds or inhibition of acetylcholinesterase enzyme
Figure 1.2 Normal mode of action of acetylcholinesterase in the absence of OP
Chapter 1 Introduction and Review of Literature
11
1.4.2 Environmental impact and hazards of OP pesticides
Environment is polluted by the excessive and continuous use of pesticides. Once
these chemicals are applied on crops, they are distributed in the environment by winds,
water, by being washed off crops with rain water into soil and water reservoirs. The
contaminated soil and water reach the river systems which finally end up in the sea
(Figure 1.4). Sometimes pesticides break down to more toxic and persistent metabolites
which pollute the air, water, soil and ultimately all the ecosystems as well as their natural
biota. A huge number of environmental problems such as pollution of air, water and
terrestrial ecosystems, hazardous effects on different organisms, and disturbances in
biogeochemical cycles can be attributed to the excessive applications and large scale
synthesis of toxic chemicals.
Figure 1.4 Pesticide movement in environment after their applications
Chapter 1 Introduction and Review of Literature
12
Approximately, 10% of the applied pesticides succeed in reaching the target site
or pests while the rest is just dispersed into soil, air and water. Consequently, they are
routinely found in non-target areas of the environment and vital non target species. The
residues and metabolites of pesticides tend to accumulate in soil at very unacceptable
levels (Shalaby and Abdou, 2010; Ortiz-Hernández, 2011). Eventual impact of the soil
contamination of pesticides is the decline of soil biodiversity. The small organisms are
essential to ecosystems because they are important in maintaining the structure and
function of natural ecosystems (Pal et al., 2005). Chlorpyrifos and glyphosate are
reported to affect earthworm and predatory arthropods respectively (Reinecke and
Reinecke, 2007; Muangphra et al., 2012).
Soil erosion and water runoff are the major ways of pesticide contamination of
aquatic ecosystems. Soluble pesticides can easily leach into lakes, streams and rivers.
Organophosphate pesticides have been shown to strongly affect the aquatic species of
vertebrates and invertebrates thus destroying natural biota (Beketov and Leiss, 2008;
DeLorenzo et al., 2001). Dichlorvos, a very toxic OP pesticide, has been reported to
cause toxicity in fish through impaired metabolism and death (Mir et al., 2012; Das,
2013). Mammals and birds are hurt by drinking the pesticide contaminated water or
eating fish and aquatic animals with toxic residues accumulated in their bodies. Such kind
of animals appears as good “indicator species”. Lethal impacts on non target life from
direct exposure include very severe kind of malfunctioning of body functions leading to
death. Indirect poisoning leads to long-term effects such as reduced growth, short
survival, and disturbed reproductive rate.
Food commodities become contaminated by direct applications of the OP
pesticides on crops. Bio-augmentation of these pollutants through food chains and food
web leads to the toxic impact on the non target organisms (Grzelak et al., 2012). OPs are
degraded as soon as they reach soil, however, degradation metabolites are often more
persistent which continue to accumulate in the environment and ultimately enter food
chain, animal and human tissues. Therefore, OPs proved to be much more toxic and
hazardous than were originally considered. For example, malathion has been reported to
affect the aquatic food web (Relyea and Hoverman, 2008).
Chapter 1 Introduction and Review of Literature
13
1.5 Pesticide situation in Pakistan
Pesticide use in Pakistan started decades ago in the form of chemicals to control
the pests. The consumption of pesticides increased in the country from 250 Metric Tons
(MT) in 1950 to 670 MT in 1980s when their sales and distributions were transferred to
private sector (Tariq et al., 2007). According to FAO, (2002) 2.5 million tons/year
pesticides are being used worldwide including Pakistan. Pakistan is one of the developing
countries who are using pesticides at high rate in the hope of sustaining the ever
increasing population of the country. One of the reasons of high pesticide consumption is
that pesticide companies motivated the farmers to use higher dose of pesticides than the
recommended dose. Moreover, higher rate of illiteracy and lack of knowledge in the crop
growers also contributed to haphazard use of pesticides in Pakistan. Insecticides are the
most widely used (almost 85%) of all the pesticides in Pakistan. The consumption of
insecticides was highest in the year 2003-2005 followed by a decline. However, the rate
of their consumption again jumped in the year 2008 onward with a fluctuating rate of
consumption (Economic survey of Pakistan, 2012-2013) (Figure 1.5).
In Pakistan, cotton crop is under the extensive insecticide applications. The reason
behind the extreme dependence of cotton on the insecticides is that cotton was attacked
severely by the insect pests in 1995 to 1998 that reduced the overall yield and quality of
the cotton leading to severe economic loss to the country. Hence pesticides were applied
to cotton with the hope to recover the loss (Tariq, 2005; Mazari, 2005). Farmers were
attracted towards the apparent benefit and outcomes of insecticides and continued
excitedly to apply them in excessive amounts on cotton and other crops. But in this way,
these chemicals became a disaster for the country leading towards the contamination of
drinking water, food, fruits, milk, vegetables, fish and meat (Baig et al., 2009). Many
reports are present regarding the pesticide residues in water and food in Pakistan (Masud
and Farhat, 1985; Cheema and Shah, 1987; Parveen et al., 1996). According to a report
(1984) from National Institute for Health, (NIH) Islamabad, Pakistan, insecticide residues
were found in poultry, dairy products and vegetable oils. The insecticides found were
DDT, Methyl parathion, malathion and dieldrin. Commonly found insecticide residues in
water and food stuff (cotton seed oil) include organophosphates e.g. chlorpyrifos,
monocrotophos and methamidophos. (Parveen et al., 1996). Pakistani soils are also
Chapter 1 Introduction and Review of Literature
14
reported to contain pesticides residues. Soil and groundwater contamination reports are
available from different parts of the country (Bano et al., 1991).
Figure 1.5 Trend of insecticide use in Pakistan
Chapter 1 Introduction and Review of Literature
15
1.6 Bioremediation/Biodegradation
A number of conventional methods had been in use to eliminate or reduce the
ever increasing contamination of the planet. These methods include landfill,
incineration, and cap & contain methods and complete destruction of the pollutants by
the use of UV oxidation and chemicals decomposition (Parasad et al., 2012). However,
major drawback associated with the conventional methods is the release of toxic
intermediates into the environment (Debarati et al., 2005). Additionally, these methods
are expensive, laborious and environment unfriendly especially in extensive agricultural
areas (Jain et al., 2005).
Keeping in view the drawbacks of conventional methods, some eco-friendly
option needs to be adapted that renders the destruction and elimination of pollutants
without producing harmful substances in the environment. This aim was achieved by
exploiting the naturally existing biological properties of microorganisms and the process
is called bioremediation. ‘‘Bioremediation is a process that utilizes the metabolic
potential of living organisms such as plants, bacteria or fungi to clean up contaminated
environments, to detoxify, degrade or remove environmental pollutants”.
Bioremediation uses biological or metabolic processes of the microorganisms.
The importance of the microorganisms in bioremediation process lies in their diversity;
ubiquity and metabolic flexibility which make them use diverse ecological conditions.
Many microorganisms may grow in diverse media because of their excellent capacity of
adaptation and mutation. Furthermore, microorganisms have been found to possess
tremendous potential to acquire capacities of xenobiotic degradation when exposed to
these xenobiotics for long periods. Microorganisms can survive in almost any kind of
the environmental conditions if an appropriate source of energy and carbon is available.
1.7 Bioremediation/Biodegradation of pesticides
The extensive and widespread use of synthetic pesticides has led to a significant
effort to develop modern technologies for the elimination or reduction of these
contaminants from the environment. “Bioremediation” is a promising approach which
exploits the ability of microbial organisms (bacteria or fungi) to degrade or eliminate
toxic chemicals from the environment. This is the most effective, economical and
Chapter 1 Introduction and Review of Literature
16
environment-friendly strategy to date which is based on environmental biotechnology
field. Environmental biotechnology is an old field that introduced the composting and the
wastewater treatment systems. But the advanced and recent accomplishments of this
research area include the bioremediation for the safe cleanup of contaminated
environment.
Attention has been focused on the isolation of bacteria with the capability of
degrading two types of compounds due to their widespread environmental problems; the
petroleum hydrocarbons; and chlorinated compounds including the pesticides. Literature
indicates that there are mainly three objectives of microbial isolations for pesticide
degradation; first is to get insights into the mechanisms of the inherent microbial
metabolism; second, to determine the mechanisms of gene/enzyme evolution and third is
to apply these microbes for the detoxification of the contaminated sites (Singh and
Walker, 2006).
A complete knowledge regarding ecological, physiological, biochemical and
molecular aspects of microorganisms has a significant role in analyzing their potential for
bioremediation (Mishra et al., 2001). Moreover, an understanding of evolutionary history
of microbes is also important in getting insights into their degradation capabilities.
Microorganisms play major roles in determining the environmental fate of chemical
pesticides because they are used as source of nitrogen, carbon or other nutrients as well as
energy. Pesticides are the recalcitrant compounds and may be resistant to complete
biodegradation in some cases because microorganisms are not adapted to utilize these
chemicals. However, frequent and repeated applications of a certain pesticide without the
crop rotation often results in the development of pesticide degrading capabilities in the
indigenous soil microorganisms, a phenomenon known as “enhanced biodegradation”
(Walker and Suett, 1986; Zhang and Bennett, 2005). Wider implications of enhanced
biodegradation were observed in crop fields in 1980s. Many reports are available that
demonstrate the use of native microorganisms in contaminated soil and sediment for the
degradation of pesticides (Walker and Suett, 1986). First report of enhanced
biodegradation of pesticides by microorganisms came in 1971 (Sethunathan, 1971).
Following the discovery of environmental persistence, a number of bacterial strains have
been isolated that are capable of degrading DDT (Nadeau et al., 1994; Bidlan and
Chapter 1 Introduction and Review of Literature
17
Manonmani, 2002; Blasco et al., 2008; Fang et al., 2010). In the similar way, discovery
of toxic effect of other pesticides resulted in the unearthing of their degrading organisms.
By now, many microorganisms possessing pesticide utilization capabilities have been
isolated. These isolates include fungi and bacteria that can utilize the pesticides as a
source of essential nutrients e.g. carbon, phosphorus or nitrogen (Singh and Walker,
2006). Certain rhizospheric organisms were also reported to take part in degradation of
pesticide contaminants. Degradation studies in a rhizosphere system suggest that rather
than a single microorganism, a diverse microbial community is involved in the enhanced
degradation of chemical pollutants. Rhizospheric microorganisms found at
bioremediation sites mostly include Ectomycorrhizal fungi, Bacillus sp., Pseudomonas
sp. and Trichoderma sp. (Singh et al., 2002). However, after fifty years of research on the
microbial degradation, detailed knowledge about degradation pathways is available for
only a limited number of pesticides (Gomez, et al., 2007). A detailed knowledge about
the micro-organism and its environment is required that gives an insight into the
physiology, ecology, biochemistry and molecular aspects of that organism before
employing it for the remediation of a contaminated site (Iranzo et al., 2001).
The biochemical or enzymatic basis, an important aspect of microbial degradation
of pesticides, has been given considerable attention. The microbial metabolism of
pesticides is catalyzed by various extracellular or intracellular microbial enzymes
attacking a pesticide. These enzymes may be peroxidases, oxygenases or hydrolytic
enzymes. The attacked pesticide serves as a carbon, nitrogen, phosphorus, energy source
or as final electron acceptor. Sometime, a physiologically useful primary substrate (easy
to degrade) for example glucose induces the production of enzymes which can then
modify the molecular structure of another compound making it predisposed to microbial
enzymes (Luo et al., 2008). This process is called co-metabolic degradation and it takes
place in conditions when attack by the microbial enzymes is not strong enough to degrade
the pesticide. Microbial degradation therefore, presents a promising approach for the
removal of pesticide contaminants from the environment. Bacterial biochemical systems
transform the pesticides and modify their structure and toxicological properties leading to
complete conversion of the toxic chemical into inoffensive inorganic end products
(Racke et al., 1990; Singh, 2009).
Chapter 1 Introduction and Review of Literature
18
Complete biodegradation eventually results in the mineralization of xenobiotic
compounds to CO2 and water. Many of the reactions involved in co-metabolism of
pesticides including oxidation-reduction, de-halogenation, ring-cleavage and hydrolysis,
occur simultaneously (Hazen, 1997). This transformation can lead to complete
detoxification, breakdown of products, which may be further attacked by other microbial
groups.
1.8 Microbial degradation of organophosphate pesticides
OP compounds contain the ester bond in the form of phospho (P=O) or
phophothio esters (P=S). The ester structure makes these compounds susceptible to
hydrolysis which is considered to be the major step in detoxification or degradation of the
OP pesticides as it removes the toxicity inducing leaving group (Figure 1.6). Further,
complete mineralization following the hydrolysis occurs through important reactions
such as alkylation, dealkylation, oxidation, reduction or ring cleavage (Singh et al.,
1999).
Figure 1.6 Hydrolysis of organophosphate pesticide by a bacterial phosphotriesterase
enzyme
Oxidation is usually uncommon in OPs (Lal, 1982). As described in the previous
section, enhanced biodegradation seems to be very significant in detoxifying the
repeatedly used pesticides without the introduction of degrading microbial communities
from other soils. This has been reported in many OP pesticides including isofenofos,
ethofos and feminofos. However, sometimes, soil micro-biota shows same degradation
tendencies towards different pesticides belonging to the same chemical family. This kind
P
O
R2(O,S)
R1(O,S)(S)
(O,S)
X
P
O
R2(O,S)
R1(O,S)(S)
OH
H(O,S)X
+
Bacterial
phosphotriesterase
Organophosphate pesticide
Chapter 1 Introduction and Review of Literature
19
of trend is known as “cross adaptation” which is common in carbamates and other groups
of pesticides. Such pesticides are usually structural analogs of each other in terms of their
chemistry. However, within organophosphate pesticide group only limited trend of cross
adaptation has been observed (Racke and Coats, 1988) and more recently this trend has
been reported between chlorpyrifos and fenamifos (Singh et al., 2005). Further, cross
adaptation between organophosphates and pentachlorophenols is evident from a recent
study carried out by Fuentes et al., (2013) who reported that a single culture of
Streptomyces was capable of degrading chlorpyrifos and pentachlorophenol. This might
be due to the fact that characteristic microbial enzymes recognize the chemicals with
similar structure and bonds hence catalyze the degradation. The positive impact of the
cross adaptation of enhanced biodegradation is that microorganisms isolated for one
pesticide can be used for degrading or remediating the other pesticide for which no
microbial isolates are known. This aspect of cross adaptation has been extensively used
for organophosphate pesticides because mostly, two or more pesticides are applied
concurrently for crop protection which often leads to a mixed contamination of pesticide
residues in the soil environment. In such situations cross adaptation works very well and
helps in remediation of mixed pesticide residues.
A large number of bacterial species have been isolated till recent years which can
degrade these compounds in aqueous medium as well as in soils (Table 1.2). Degradation
of the OPs as a sole carbon source as well as co-metabolically is evident. Parathion (O,O-
diethyl-O-p-nitrophenyl phosphorothioate) is one of the widespread and most toxic
insecticides. The microbial degradation of parathion has received extensive attention
among the other OP pesticides. The first organophosphorus degrading bacterium,
Flavobacterium sp. that could degrade parathion and diazinon was isolated and reported
by Sethunathan and Yoshida, (1973). Further, Siddaramappa et al., (1973) isolated a
Pseudomonas sp. capable of hydrolyzing parathion as well as its hydrolysis product, p-
nitrophenol, as a carbon and nitrogen source. Mineralization of parathion has been
reported where it has been used as a source of carbon (Rani and Lalithakumari, 1994) or
source of phosphorus (Rosenberg and Alexander, 1979). Moreover, a pathway of
parathion degradation was also studies by Munnecke and Hsieh, (1976).
Chapter 1 Introduction and Review of Literature
20
Hydrolysis of OP pesticides significantly reduces their toxicity towards
mammalian organisms, but sometimes hydrolysis products are more toxic compared to
the parent compound hence their degradation is relatively more important. However,
mostly the detoxification is the major concern of pesticide degradation; therefore further
metabolism of the degradation products is rarely studied. This can be explained by the
microbial degradation of chlorpyrifos which is one of the most extensively used OP
pesticides. Initially, Racke et al., (1990) reported that chlorpyrifos was resistant to the
phenomenon of enhanced degradation. It was suggested that production and
accumulation of first toxic metabolite, 3,5,6-trichloro-2-pyridinol (TCP), which has
antimicrobial properties, inhibits the proliferation of CP degrading microbes thereby
resisting the enhanced degradation of the pesticide (Racke et al., 1990).Toxicity of TCP
can be attributed to the existence of three chloride residues on the aromatic ring which
render it antimicrobial becoming more toxic and more persistent to microbial
degradation.
Chapter 1 Introduction and Review of Literature
21
Table 1.2: Microorganisms isolated for the biodegradation of organophosphate
pesticides [a modification of table described by Singh and Walker, (2006)]
Organophosphate
pesticides
Microorganisms
References
Chlorpyrifos
Fungi
Phanerochaete chrysosporium
Hypholoma fasciculare
Coriolus versicolor
Stereum hirsutum
Trichoderma harzianum
Penicillium brevicompactum
Bacteria
Enterobacter sp.
Flavobacterium sp. ATCC27551
Bacillus pumilus C2A1
Stenotrophomonas maltophilia
Pseudomonas putida NII 1117,
Klebsiella sp., NII 1118,
Pseudomonas stutzeri NII 1119,
Pseudomonas aeruginosa NII 1120
Gordonia sp JAAS1
Sphingobacterium sp. JAS3
Bumpus et al., (1993)
Bending et al., (2002)
Omar, (1998)
Singh et al., (2004)
Mallick et al., (1999)
Anwar et al., (2009)
Dubey and Fulekar, (2012)
Sasikala et al., (2012)
Abraham et al., (2013)
Abraham and Silambrasam, (2013)
Parathion
Flavobacterium sp. ATCC27551
Pseudomonas diminuta
Arthrobacter spp.
Bacillus spp.
Agrobacterium radiobacter
Xanthomonas sp.
Suthantthan and Yoshida, (1973)
Serdar et al., (1982)
Nelson et al., (1982)
Horne et al., (2002)
Rosenberg and Alexander, (1979)
Chapter 1 Introduction and Review of Literature
22
Continued from previous page
Table 1.2: Microorganisms isolated for the biodegradation of organophosphate pesticides [a
modification of table described by Singh and Walker, (2006)]
Organophosphate
pesticides
Microorganisms
References
Methyl parathion
Pseudomonas sp.
Bacillus sp.
Plesiomonas sp. M6
Pseudomonas putida
Pseudomonas sp. A3
Pseudomonas sp. WBC-3
Flavobacterium balustinum
Chaudry et al., (1988)
Sharmila et al., (1989)
Zhongli et al., (2001)
Rani and Lalitha-kumari, (1994)
Zhongli et al., (2002)
Chen et al., (2002)
Somara and Siddavattam, (1995)
Coumaphos
Nocardiodes simplex NRRL B24074
Agrobacterium radiobacter P230
Pseudomonas monteilli
Flavobacterium sp.
Mulbry, (2000)
Horne et al., (2002)
Horne et al., (2002)
Adhya et al., (1981)
Triazophos Bacillus Tap-1
Klebsiella sp. E6
Diaphorobacter sp.TPD-1
Diaphorobacter sp. GS-1
Ochrobactrum sp. mp-4
Roseomonas rhizosphaerae
Tang and You, (2012)
Wang et al., (2005)
Yang et al., (2011)
Liang et al., 2011
Dai et al., 2005
Chen et al., 2014
Profenofos Pseudomonas putida and
Burkholderia gladioli
Pseudomonas aeruginosa OW
Malghani et al., (2009a)
Malghani et al., (2009b)
Chapter 1 Introduction and Review of Literature
23
In recent years, another aspect of microbial degradation was highlighted by the
use of mixed microbial communities for the remediation of the soils contaminated with
chlorpyrifos. A variety of chlorpyrifos degrading microorganisms isolated from diverse
environments (including highly contaminated sites) have been used as the mixed cultures
(Chishti and Arshad, 2013: Bhagobaty et al., 2007).
Another organophosphate pesticide, monocrotophos has many environmental and
health concerns associated with its high solubility in water and potential toxicity towards
aquatic organisms which in turn makes it important to investigate its detoxification.
Several bacterial strains have been isolated from monocrotophos treated soils. These
include Clavibacter michiganense sp. and Pseudomonas aeruginosa (Singh and Singh,
2003) which were isolated from soil and could utilize monocrotophos as a phosphorus
source. Also few fungal isolates were found to degrade monocrotophos such as
Aspergillus oryzae (Bhalerao and Puranik, 2009). However, it could not utilize
monocrotophos as a carbon source). Further, a Pseudomonas mendocina was reported as
the most capable monocrotophos degrader with the plasmid based degrading capability
(Bhadbhade et al., 2002).
Fenitrothion, a broadly used insecticide (Hayatsu et al., 2000) was found to be
degraded by Burkholderia sp. strain NF100 as a source of carbon with the involvement of
two plasmids. The first plasmid, pNF2, was found to be involved in the hydrolysis of
fenitrothion to a metabolite, 3-methyl- 4-nitrophenol with subsequent removal of the nitro
group to form methyl hydroquinone. Second plasmid, pNF2, further metabolized the
hydroquinone (Hayatsu et al., 2000).
Biodegradation of diazinon has also been given attention and various bacterial
isolates were reported for its remediation. Initially, two strains of Arthrobacter sp. and
two Pseudomonas spp were isolated which utilized diazinon as a source of carbon and
energy (Rosenberg & Alexander, 1979). However, recently, more reports are available
which throw light on diazinon degrading microorganisms (Cycon et al., 2009; Cycon et
al., 2013). Dimethoate degradation has been evidenced by a plasmid based gene from a
P. aeruginosa strain (Deshpande et al., 2001). A novel dimethoate degrading enzyme was
purified and characterized from a fungal strain, Aspergillus niger (Liu et al., 2001). This
Chapter 1 Introduction and Review of Literature
24
enzyme could hydrolyze almost all of the compounds with phosphorothio linkage e.g.
fermothion and malathion but not the compounds with the phosphate linkage.
Ethoprophos and cadusafos are also two of the toxic OP pesticides. A
Pseudomonas putida strain was isolated with the potential to utilize ethoprophos as a sole
source of carbon (Karpouzas and Walker, (2000). Moreover, a Sphingomonas
paucimobilis and Flavobacterium sp. have also been reported by Karpouzas et al., (2005)
which can metabolize cadusafos. Similarly, several species of bacteria were isolated from
different environments which degrade OP pesticides in laboratory cultures and in soils
(Singh et al., 1999).
The metabolic regulation of microorganisms depends very strongly on effects of
organophosphate insecticides or pesticide left on particular organisms. For example, a
parathion degrading bacterium utilized parathion as a source of carbon and hydrolyzed it
to the diethyl phosphorothionate product but it could not metabolize it further, even in
the medium free of sulfur or phosphorus. Similarly, a variety of isolates have been
recognized that could use a pesticide as a sole source of phosphorus but not as a source
of carbon (Rosenberg & Alexander, 1979). A bacterial consortium was isolated that
degraded and used diethylthiophosphoric acid as a carbon source but failed to utilize it
as a source of sulfur or phosphorus. A possible explanation of difference in bacterial
metabolic behavior was provided earlier by Kertesz et al., (1994) who suggested that the
microbial enrichment conditions can potentially be crucial in the strain selection not
only with the most wanted degradative enzyme systems but also with specific regulation
mechanisms for the biodegradation pathways.
1.9 Factors affecting biodegradation of pesticides
Microbial degradation has been distinguished as an efficient strategy for
degradation of pesticides in soil which forms the basis for different strategies of
bioremediation and bioaugmentation. Consequently, conditions which support microbial
activity and growth in soil generally enhance the metabolic degradation of pesticides
(Gavrilescu, 2005). These environmental conditions are very crucial in the proliferation
and survival of microorganisms and also affect the chemical stability of the pesticide. In
soil, pesticide metabolism is influenced by abiotic and biotic factors which work in
succession and collaboration with one another. Completion of any bioremediation
Chapter 1 Introduction and Review of Literature
25
process depends on several environmental factors such as chemical and physical
characteristics of the pesticide or substrate (hydrophilicity and solubility), availability of
nutrients, pH, temperature and biotic factors such as inoculum density of the degrading
microbiota (Karpouzas and Walker, 2000). It was suggested that the characteristics,
number of microbial organisms and the metabolic activity are the determining factors
regarding the biodegradation feasibility for pesticide remediation (Racke et al., 1996).
Effect of different environmental conditions on bioremediation of fenamiphos and
chlorpyrifos in soil and water to study the bioremediation was reported earlier (Singh et
al., 2006).
The rate of degradation of different pesticides depends largely on the soil pH.
This is because microbial enzymes are largely affected by the pH and their activity is
reduced or increased as a function of change in pH. Moreover, pH is also important in
maintaining the stability of the chemical substances (pesticides in this case). An
increased degradation of atrazine was observed by a Pseudomonas sp. in the soil
containing higher organic matter and low pH (Kontchou and Gschwind, 1995) whereas
high soil pH was reported to have enhancing effect on chlorpyrifos degradation.
Pesticide concentration has also been reported to affect bioremediation process.
For any xenobiotic compound, the concentration serves as a limiting factor and above a
certain level of concentration, the process of remediation becomes indispensable and this
level is regarded as “remediation trigger level.” When pesticide is applied at normal
agricultural rates, almost 99% of applied pesticide may be removed over the course of a
growing season. Unfortunately, even when present in soil at very low levels, many
recalcitrant pesticides often spread around and reach water resources because they are
not degradable by the microbial activities.
The soil temperature is one of the most significant factors which have a profound
effect on microbial activity and consequently affect the overall process of microbial
degradation of pesticides. Generally, at very low or very high soil temperature, the
efficiency of microbial degradation of soil contaminants is reduced. For an effective
bioremediation process an optimum temperature is required which is toleratable by the
degrading microbiota. This is again due to the dependency of the bacterial enzymes on
the temperature which require a suitable temperature to work properly.
Chapter 1 Introduction and Review of Literature
26
Several researchers have demonstrated that the degradation of pesticides in soil
can be boosted by inoculation with appropriate population of the microorganisms.
Comeau et al., (1993) suggested that inoculum level of 106
to108
CFU/g of soil was
suitable for the pesticide removal in a contaminated site. However in another study it
was discovered that a lower inoculum size of an Agrobacterium sp. was adequate to
rapidly degrade atrazine (Struthers et al., 1998).
Bioremediation techniques attempt to increase the rate of naturally occurring
biodegradation processes by optimizing the degradation conditions (Semple et al., 2001).
Without suitable environmental conditions in a contaminated area, process of
bioremediation can be inhibited even if microbial populations are available for
biodegradation of a particular contaminant. In such cases, addition of nutrients manually
to the contaminated places, a process known as biostimulation or the addition of more
microbes (bioaugmentation) have been found effective in increasing the bioremediation
(Sasek, 2003; Mrozik et al., 2010). Although biostimulation may have poor
reproducibility and can be dependent on the characteristics of microbial populations but
still it is an efficient bioremediation strategy as it replaces the shortage of carbon and
nitrogen, O2, acid or bases for pH optimization, and sometimes water or specific
substrates to induce specific enzymes (Margesin et al., 2000). Bioaugmentation is
another efficient option. which introduces the exotic bacterial species to the site in
question. But a major advantage of bioaugmentation is that a full knowledge of process
and its conditions is mandatory as the different bacterial species are to be introduced. In
this case, the success of bioremediation is mainly dependent on the microbial
proliferation capability, competition of the introduced species and the bioavailability of
the pesticide (Gavrilescue, 2005). Bioavailability here means the acquirement of a
compound and its degradation to harmless products.
Sometimes microorganisms degrade an easily available carbon source and acquire
energy and enzyme induction for the degradation of xenobiotic compound. This kind of
metabolism is known as co-metabolism. Usually, biodegradation and co-metabolic
degradation occur at a time in soil. Bioremediation has been emerged as cheaper and
effective piece of technology in the recent era compared to parallel chemical and physical
Chapter 1 Introduction and Review of Literature
27
methods of remediation. Moreover, this strategy has a greater potential to cope with the
contaminated groundwater and soil ecosystems.
1.10 Organophosphate degrading enzymes
Microorganisms have been equipped with the extensive enzyme systems that can
catalyze the degradation of toxic OP pesticides. Most important of all OP degrading
enzymes are the hydrolases which are also called phosphotriesterases or esterases. These
enzymes can be constitutive or inducible and catalyze the hydrolysis of OPs during
detoxification. Very first time reported enzyme catalyzing OP degradation was
organophosphate hydrolase (OPH) that was isolated from Flavobacterium sp. and
Pseudomonas strains (Serdar et al., 1982; Somara and Siddavattam, 1995). After this
discovery, OP hydrolases and genes encoding these OP hydrolases were reported from
different bacterial or fungal genera. Mostly the OP degrading genes including opd and
mpd have been reported to be plasmid borne which encode organophosphate degrading
hydrolase (OPH) and methyl parathion enzyme hydrolase (MPH) respectively (Singh and
Walker, 2006). However, another enzyme organophosphorus acid anhydrolase (OPAA)
was identified in Agrobacterium radiobacter (Horne et al., 2002) and Alteromonas sp.
(Cheng et al., 1996). OPAA is encoded by opdA gene and has been found to have
chromosomal origin. From time to time various genes have been isolated and reported for
degradation of OPs in various organisms such as Ochrobactrum, Pseudaminobacter and
Burkholderia (Zhang et al., 2005; Goda et al., 2010). However, a very less extent of
similarity is present among the genes. There is a considerable need for further
investigation of OP degrading genes and enzymes. Few other OP degrading enzymes
include dehydrogenases, mono-oxygenases, dioxygenases.
1.11 Bioremediation of organophosphate contaminated soil
As mentioned in previous sections, excessive use of pesticides, their
accumulation and persistence in soil leads to the disastrous results every year (Singh and
Walker, 2006). Although OPs are easily biodegradable and less persistent than
organochlorines but the problem is associated with the quick biodegradation of the OP
pesticides in the soil to the degradation metabolites which are usually more toxic and
persistent than the parent compound hence ultimately their residues persist in the soil. In
Chapter 1 Introduction and Review of Literature
28
North Carolina chlorpyrifos residues were observed in 16 houses even long time after its
applications for insect control (Wright et al., 1994). Higher levels of chlorpyrifos and
TCP have been found in many soil samples by many researchers. In Pakistan, many
reports emphasis on the detection of pesticide residues in soil (Anwar et al., 2012)
Bioremediation has been proved to be a safer and gainful technology for the
treatment of pesticide contaminated soils as it converts the toxic pesticides into
undisruptive inorganic products (Cappello et al., 2007; Yang et al., 2005; Nawaz et al.,
2011). Numerous reports of bioremediation of CP contaminated or CP spiked soils are
available to date. A chlorpyrifos degrading Enterobacter strain B-14 was introduced by
Singh et al., 2004 into a CP contaminated soil containing a small indigenous population
of CP degrading bacteria. The strain B-14 efficiently remediated the contaminated soil.
Similarly, a Sphingomonas sp. has been reported to degrade about 98% chlorpyrifos in
10 days in CP spiked soil (Li et al., 2007). Profenofos has been reported as less
persistent in soil. Environmental fate studies of profenofos show that it is not very
mobile in soil and the route of degradation is hydrolysis that needs microbial processes.
However, first degradation metabolite, 4-bromo-2-chlorophenol is more persistent and
toxic than profenofos itself hence its remediation needs attention.
1.12 Plant microbe interaction for the remediation of pesticides/pollutants
Phytoremediation is a low-cost and economical technology that employs plants for the
cleanup of the environment contaminated with the pollutants (Pilon-Smits, 2005; Wang
et al., 2008). However, one of the few limitations of the phytoremediation is the
sensitivity of the plants to pollutants which adversely affect the plants in terms of growth
and physiology hence pollutant tolerant plants are also found to exhibit reduced growth
which consequently results in reduced effectiveness of pollutant remediation by the plant
(Gaskin et al., 2008; Weyens et al., 2009). Impaired germination and growth of rice
seeds and seedlings was observed as a result of imdacloprid applications (Stevens et al.,
2008). Moreover, alteration in the nitrogen metabolism and growth of Vigna radiata (L.)
in response to chlorpyrifos has also been documented (Parween et al., 2011). This
limitation has been compensated by the microbially-assisted phyto-remediation which
involves the use of plants and microbes together for the toxic pesticide remediation.
Plant-microbe interaction for pollutant remediation helps both the partners. Plant root
Chapter 1 Introduction and Review of Literature
29
exudates stimulate microbial growth and enhance the pollutant degradation properties of
the microbes. However, Plants might get profit from bacteria (and other microbes)
because plant associated rhizospheric and endophytic bacteria have been reported to
degrade the toxic pollutants in the contaminated soil and potentially improve the
phytoremediation (Afzal et al., 2012). Moreover, rhizobacteria and endophytic bacteria
have been reported to increase plant growth by different beneficial biochemical
processes such as mineral solubilization, phytohormone production and nitrogen fixation
thus alleviating the stress induced by the pollutant on the plant (Glick, 2010). Endophytic
bacteria reduce phytotoxicity by producing pollutant degrading enzymes inside plant
tissues thereby increasing the plant resistance to contaminants and ultimately improving
the plant growth (Tang et a.,l 2010; Fernández et a.l 2011).
The mechanism of plant interaction with microbes is given in Figure 1.7. The inoculation
of beneficial microbes to plants offers a feasible and inexpensive alternative technology
to clean up pesticide contaminated sites. However, little is known concerning the
potential of plant growth promoting rhizo and endophytic bacteria in the
phytoremediation of pesticides.
Figure 1.7 Plant-microbe interactions for remediation of pesticide contaminated soil
Chapter 1 Introduction and Review of Literature
30
1.13 Objectives of the study
Profenofos (PFF) and chlorpyrifos (CP) are among the commonly used OP
insecticides. They are biodegradable in soil but their degradation metabolites, being
aromatic in nature, are highly toxic and persistent. However, bacterial strains capable of
degrading these toxic metabolites are scarce. Therefore, the present study was designed to
isolate and characterize bacterial strains capable of complete degradation of PFF and CP
as well as their metabolite, 3,5,6 trichloro-2-pyridinol (TCP) and 4-bromo-2-
chlorophenol (BCP) respectively.
A well optimized bioremediation of pesticides is the basis of successful
remediation of the particular pesticide. Hence, study was planned to optimize culture
conditions of isolated bacterial strains that govern CP and PFF degradation, the kinetics
of CP and PFF biodegradation, accumulation and utilization of their toxic metabolites
and the governing constants thereafter. As, these parameters vary depending on bacterial
strains and concentration/nature of pollutant, a clear understanding of the biodegradation
kinetics of pesticides would determine suitability of the bacterial strain for in situ
bioremediation.
A little is known about the biochemical pathways of the two pesticides. It is
important to investigate, what metabolites are produced by the degradation of these
pesticides and whether they are further degraded or accumulate in the culture medium?
To answer these questions, biodegradation products of CP and PFF were studied and
identified by GC-MS analyses. Moreover, a trial was made to track genes involved in the
degradation of the two pesticides.
Chapter2 Materials and Method
31
Chapter 2
Materials and Methods
1.14 Chemicals
Analytical grade chlorpyrifos (CP, 98.6%) was obtained from Dr Ehren Stofer
GmbH (Germany). 3,5,6-trichloro-2-pyridinol (TCP), the major hydrolysis product of
CP, analytical grade profenofos (PFF, 95%) and its hydrolysis metabolite 4-bromo-2-
chlorophenol (BCP) were purchased from Chem Service (West Chester, Pennsylvania,
USA). Technical grade CP (95%) and PFF (92%) were purchased from Pak China
Chemicals Lahore. Dichloromethane (DCM), n-hexane, methanol, acetone and
acetonitrile (HPLC grade) were procured from Merk (Frankfurter, Germany). N, O-Bis
(trimethylsilyl) trifluoroacetamide (BSTFA) kit was purchased from Supelco, Bellefonte,
Pennsylvania, USA. All other chemicals (used in preparation of growth and minimal
media) were purchased from Merk, Sigma or Eldrich. Reagents used in molecular
techniques such as restriction enzymes, PCR and cloning reagents were purchased from
Fermentas.
1.15 Bacterial strains used in the study
Profenofos and chlorpyrifos degrading bacterial strains used in the study were
isolated indigenously (Table 2.1). Escherichia coli (E. coli) DH5 carrying pk18 vector
and Pseudomonas diminuta were kindly provided by Dr. Rebecca Parales, Department of
Microbiology, University of California, Davis, California, United States of America.
Escherichia coli DH5α carrying a broad host range ampicillin resistant (AmpR) plasmid
pBBRIMCS-4 harboring yfp gene was obtained from NBRC, NIBGE, Faisalabad,
Pakistan.
Chapter2 Materials and Method
32
Table 2.1: Bacterial strains used in the study
1.16 Soil collection
Soil samples were collected from fields of Ayub Agricultural Research Institute
(AARI) and NIBGE, Faisalabad, Pakistan. The soil samples had a long history of
organophosphate (OP) insecticides applications. Hence extensive use of the pesticide
made this soil vital for the isolation of selective pesticide degrading microbes.
1.17 Growth media
Growth media used in the study were Luria Bertani (LB), Minimal Salt Medium
(MSM), Focht solution, Pikovskaya medium, Yeast Extract Mannitol (YEM), Nitrogen
free medium, and Chloride free medium. Compositions of all growth media are given in
appendices.
2.4.1 Maintenance and preservation of the bacterial strains
Profenofos and chlorpyrifos degrading bacterial strains/consortia were maintained in
MSM supplemented with respective pesticide. Glycerol stocks (50% v/v) were prepared
by aseptically mixing bacterial cultures grown in LB broth and the 50% glycerol. The
stocks were preserved at -80°C for months. PFF degrading bacterial isolates were
maintained separately as well as in mixed culture in glycerol stocks.
Name of the strain Source Origin
Mesorhizobium sp. HN3 OP contaminated soil Pakistan, Isolated in the current study
Achromobacter xylosoxidans PF1 OP contaminated soil Pakistan, Isolated in the current study
Pseudomonas aeruginosa PF2 OP contaminated soil Pakistan, Isolated in the current study
Bacillus sp. PF3 OP contaminated soil Pakistan, Isolated in the current study
Citrobacter koseri PF4 OP contaminated soil Pakistan, Isolated in the current study
Chapter2 Materials and Method
33
2.5 Equipment used in the study
Most of the facilities and equipments used were available at NIBGE. These
included High Performance Liquid Chromatograph (HPLC) Varian Pro Star 325, UV VIS
detector; Spectrophotometer; Eppendorf centrifuge machines (models 5424 and 5816);
Biorad Thermocycler; Stereomicroscope; Rotary shaker; Light microscope; Olympus
Confocal Laser Scanning Microscope (CLSM) and Scanning Electron Microscope
(SEM). Agilent Gas Chromatograph Mass Spectrometry was availed at UC Davis, USA.
DNA sequencing was done using commercial sequencing facility of Macrogen, South
Korea, until otherwise mentioned.
2.6 Enrichment of profenofos and chlorpyrifos degrading bacterial strains
Enrichment culture technique was used to isolate pesticide degrading bacterial
strains from soil using MSM as enrichment medium. For this purpose, soil (10g) was
added to 250 ml Erlenmeyer flasks containing 100 ml sterile MSM (in duplicate)
supplemented with 50 and 100 mg/l (individually) of respective pesticide
(profenofos/chlorpyrifos). These flasks were incubated in a rotary shaker at 37°C and 100
rpm. Two weeks following the incubation, 5 ml suspension from each replicate was
transferred to flasks containing fresh MSM supplemented with 50 & 100 mg/l of the
respective pesticide. Similarly, four transfers were carried out by sub culturing 5 ml
inoculum into fresh MSM containing respective pesticide each time. In this way
enrichment cultures containing diverse number of pesticide degrading bacteria were
developed.
2.7 Isolation of pesticide degrading bacterial strains
The enrichment cultures were used for isolations of pure, pesticide degrading
bacterial strains. Two weeks following the last transfer, the enrichment cultures were
serially diluted (10-1
to 10-7
) in 0.9% saline solution. Selected dilutions 10-5
, 10-6
and 10-7
of each culture were used to spread (100 µL) in triplicates on solid LB agar plates
containing 100 mg/l respective pesticide. Following two days of incubation,
morphologically distinct bacterial colonies were separated and purified by repeated
streaking on LB agar plates.
Chapter2 Materials and Method
34
Once all the isolates were purified by repetitive sub culturing, their degradation potential
was investigated in terms of their growth on MSM agar plates containing respective
pesticide as the source of carbon and energy. Moreover, the pesticide degradation
efficiency of the isolates was also tested in MSM broth containing respective pesticide as
the only source of carbon (and incubated at 37°C). Turbidometric method described by
Jyothi et al., (2012) was employed for monitoring the growth of the degrading bacterial
cultures in MSM broth containing respective pesticide as a carbon source. Cell dry mass
was determined for the bacterial cultures having an OD600nm of 1.0 and was used as
standard for calculating cell dry mass of all the culture samples.
Liquid cultures were harvested after five days of incubation and the pesticide
residues were extracted using dichloromethane and analyzed by quantifying the residual
concentrations of respective pesticide on HPLC. Best degrading bacterial isolates were
characterized and used for further degradation studies.
2.8 Molecular characterization of bacterial isolates
2.8.1 DNA Isolation
Genomic DNA was extracted from bacterial isolates by CTAB (Cetyl Tri-methyl
Ammonium Bromide) Method (Mateen, 1998) as follow:
Bacterial cells were grown in MSM containing glucose at 37C overnight and harvested
by centrifugation at 8000 rpm.
Cells were re-suspended in 5 ml T.E buffer and 20 mg lysozyme was added to this
suspension.
Suspended cells were incubated at 37C for 5 min.
500 µl of 10% SDS, 25 µl proteinase K (25 mg/ml) and 3 µl RNAase were added to the
incubated suspension.
The contents were mixed thoroughly and incubated at 37C for 10 min.
After incubation, 0.9 ml 5M NaCl and 0.75 ml NaCl/CTAB were added, mixed thoroughly
and incubated at 65C for 20 min.
The protein contents were extracted (twice) with an equal volume of Phenol-
chloroform-isoamyl alcohol (25:24:1) and centrifuged for 10 min at 8000 rpm and 4C to
separate the organic and aqueous phase (containing DNA).
Chapter2 Materials and Method
35
Aqueous supernatant was separated in fresh falcon tube and 0.6 volume of isopropanol
was added and mixed thoroughly until a white DNA pellet precipitated out of solution.
The solution containing DNA was stored at -20°C overnight.
The solution containing DNA was centrifuged at 8000 rpm for 5 min and supernatant
was discarded.
The DNA pellet was washed with 70% ethanol (twice) and dried at room temperature.
Dried DNA pellet was re-suspended in 100 µl T.E and saved at -20°C until used.
2.8.2 Preparation of Heat shock competent cells (C-cells)
E. coli cells were grown overnight in 5 ml LB at 37°C with constant shaking.
0.25 ml of the overnight grown culture was inoculated into 50 ml LB and grown at 37°C
with constant shaking until the culture reached an OD600nm of approximately 0.4.
The culture was poured into cold Oakridge tubes and centrifuged for 5 min at 4,500
rpm.
The supernatant was discarded removing as much liquid as possible.
GENTLY each cell pellet was re-suspended in 10 ml COLD Frozen Storage Buffer (FSB,
Appendix 4), combined them into one tube and incubated on ice for 15 to 60 min, and
pelleted by centrifugation at 45,00 rpm for 5 min.
Cell pellet was gently re-suspended in 4 ml of cold FSB.
Pipetted 200 ul aliquots into COLD 75 12 mm polypropylene snap cap tubes and
stored the competent cells at –70˚C.
2.8.3 Amplification of 16S rRNA gene from bacterial isolates
16S rRNA gene of all bacterial isolates was amplified using forward primer FD1,
5-AGAGTTTGATCCTGGCTCAG-3 (E. coli bases 8–27) and reverse primer RP1, 5-
ACGGHTACC TTGTTACGACTT-3 (E. coli bases 1507–1492) (Wilson et al., 1990).
PCR reactions were performed in 50 µl reaction volumes containing 1 µl of Taq DNA
polymerase (2.5 U/µl), 5 µl of 10×PCR reaction buffer, 2 µl of each of the primers (10
µM), 2 µl dNTPs mixture (10 mM) and 38 µl of sterile distilled water. 2 µl of each
individual bacterial strain was used as template. Thermal cycler (Biorad) was used for
amplification from DNA which was programmed as: pre-heat treatment at 94C for 1 min
Chapter2 Materials and Method
36
followed by annealing at 52C for 1 min, and extension at 72C for 1.5 min and all the
three steps were repeated for 30 cycles.
2.8.4 Agarose gel electrophoresis
The amplified PCR products were analysed on 1 % agarose gel stained with
ethidium bromide (100 μg/ml). Amplified PCR products were mixed with 6X loading
dye (bromophenol blue) and loaded on the agraose gel immersed in 0.5X TAE buffer.
Samples were electrophoresed at 60-100 volts for about 1 to 1.5 h followed by the
examination of gel under UV transilluminator for analyzing the PCR products.
2.8.5 Ligation and cloning of the 16S rRNA gene
The 16S rRNA gene amplicons were ligated into TA cloning vector (PCR Product
cloning Kit, Fermentas) and the ligation mixtures were kept at 16°C overnight. The
following day, ligation mixtures were transformed into E. coli TOP10 competent cells by
heat shock methodology. Plasmids were isolated from E. coli using mini prep kit
(Fermentas) according to the manufacturer’s instructions and restricted with EcoRI
(restriction enzyme, Fermentas) to confirm the product size of the insert.
2.8.6 Sequencing of 16S rRNA gene and bacterial identification
The inserts were sequenced by using M-13 primers. The 16S rRNA gene
sequences were compared to the already known nucleotide sequences using BLAST
search algorithm (http://www.ncbi.nlm.nih.gov/BLAST) and molecular evolutionary
relationships were accomplished using MEGA 5.0 version with the Kimura two-
parameter model and the neighbor-joining algorithm (Saitou and Nei, 1987). The
sequences of the isolates obtained were submitted in GenBank.
2.9 Morphological and biochemical characteristics of the bacterial isolates
2.9.1 Morphological characterization
Bacterial isolates were examined for colony morphology (size, margins and
surface texture), cell morphology, pigmentation and motility as per the standard
procedures given by Barthalomew and Mittewer, (1950).
Chapter2 Materials and Method
37
2.9.2 Physiology and Biochemical characterization
A series of studies were conducted to find out the biochemical and physiological
characteristics of isolated bacterial strains. These characteristics include utilization of
different carbon sources (glucose, sucrose), enzymatic properties (oxidase, arginine).
Biochemical and physiological tests of the isolates were carried out using QTS-24
(Quick Test Strip) kit developed by Defense Science and Technology Organization
Laboratories (DESTO), Karachi, Pakistan. According to the manufacturer instructions,
the kit is based on dehydrated substrates contained in microcupules for different
enzymatic and assimilation reactions. Further, gram staining and antibiotic assays were
performed as described in the following sections:
2.9.2.1 Gram staining
The compositions of all the solutions used in Gram’s staining (the crystal violet
solution, iodine solution and safranin solution) are described in Appendix 5.
Following protocol was adapted for gram staining of bacterial isolates:
Bacterial strains were grown on LB agar and incubated overnight at 37C.
A single colony of each freshly grown culture (on LB agar plates) was picked with a
sterile loop and mixed in a drop of saline (0.9%) on a glass slide to make a thin
smear.
The slide was air dried, heat fixed and stained with primary stain, the crystal violet
solution for one min.
The smear was washed with distilled water and flooded with iodine solution for one
min.
Iodine solution was washed off with water and de-colorized with ethanol (70%) for
one and a half minute.
Again slide was washed with distilled water and stained with secondary stain,
safranin solution for one min.
Finally the slide was washed with distilled water, air dried and observed under light
microscope.
Chapter2 Materials and Method
38
2.9.2.2 Antibiotic resistance of isolates
For this purpose, 1-2 ml of a freshly grown bacterial cultures (in LB) were spread
(100 ml) aseptically onto the antibiotic sensitivity sulphonamide agar (ASS; Merk,
Germany) plates until the bacterial cultures were completely absorbed to the agar.
The intrinsic antibiotic resistance pattern of pesticide degrading bacterial isolates
was determined by disc diffusion method (Valverde et al., 2005) using ready to use
antibiotic discs (Bioanalyse, Turkey). The antibiotics used are given in Table 2.2.
Table 2.2 Antibiotics used in the study
No. Antibiotic Abbreviation Disk concentration
1 Chloramphenicol C 30µg
2 Ampicilin AM 10µg
3 Rifampicin RA 5µg
4 Streptomycin S 10µg
5 Carbenicillin PY 100µg
6 Erythromycin E 15µg
7 Gentamycin CN 10µg
8 Kanamycin K 30µg
9 Nalidixic Acid NA 30µg
10 Tetracycline TE 1.25µg
2.10 Inoculum preparation
The chlorpyrifos and profenofos degrading bacterial isolates were grown
aerobically in LB medium containing 100 mg/l respective pesticide in Erlenmeyer flasks
with constant shaking in a rotary shaker at 37°C. The overnight grown bacterial culture
was harvested centrifuged at 4600×g for 10 to 15 min and used for inoculum preparation
following Anwar et al., (2009). The cell pellet was washed with 0.9% saline solution
(Appendix 6) and re-suspended in the same to get an OD600nm of 0.8. Colony forming
units (CFU/ml) were determined by dilution plate count technique. This suspension (2%
v/v) was used as inoculum in biodegradation experiments until otherwise described.
Chapter2 Materials and Method
39
2.11 Experimental set up for pesticide degradation studies
Pesticide degradation studies were carried out in 250 ml Erlenmeyer flasks
containing 50 ml MSM supplemented with 100 mg/l respective pesticide and 2%
inoculum of respective pesticide degrading bacterium under various culture conditions as
described in respective sections. The flasks were incubated at 37°C (or at other
temperatures as per the requirement of experiment) and 100 rpm in rotary shaker for 10
days. For all the treatments, un-inoculated flasks served as controls and all the
experiments were performed in triplicates. Samples were periodically harvested for
analyzing the growth rates and residues of pesticide and its metabolites.
2.11.1 Determination of the detection wavelength of the pesticides
For a good chromatographic detection of PFF and CP (and others pesticides used
in Chapter 3), the wavelength, at which they display maximum absorption of UV
radiation, was determined spectrophotometrically. The optimum wavelength called
“λmax” was obtained by recording the UV absorption spectra of all the pesticides used in
this study. Moreover, for the confirmation, the λmax was evaluated using HPLC and
comparing the absorbance of the pesticides at about three different wavelengths.
2.11.2 Extraction of pesticide residues from liquid cultures
Pesticide residues were extracted using equal volumes of water immiscible solvent
(mostly dichloromethane, DCM). Culture samples (20 ml) were recovered from flasks after every
24 h and centrifuged at 4600×g for 10 min to obtain cell free medium. Pesticide residues were
extracted from supernatant using equal volume of dichloromethane (DCM) twice. Organic layer
of DCM was aspirated, pooled and evaporated using rotavapor at 37°C. The dried residues were
dissolved in HPLC grade acetonitrile (1 ml), and filtered through flouropore TM filter membrane
(0.45 μm FH) to remove any particles. Samples were finally diluted (if required) and analyzed by
High Performance Liquid Chromatography (HPLC).
2.11.3 HPLC conditions for pesticide residual analyses
Quantitative analyses of pesticides were carried out by High Performance Liquid
Chromatography (HPLC) equipped with ODS2 C18 reversed-phase column. The gradient
Chapter2 Materials and Method
40
mobile phase consisting of acetonitrile:water: acetic acid (20:80 to 80:20, Appendix 7) was
programmed at the flow rate of l ml/min. Retention time for the pesticide and its
metabolites were deduced by running the respective standards solutions (Anwar et al.,
2009). Concentration of pesticides in the culture medium and that in the unioculated
control samples was calculated using unit method.
2.12 Soil microcosm studies (Pot Experiments)
2.12.1 Soil collection for microcosm experiments
For pesticide degradation studies in soil microcosm, soil was collected randomly
from 0-25cm depth from an area in Faisalabad, Pakistan where no pesticides had been
applied. The samples were pooled, brought to the laboratory in polyethylene bags and
kept in refrigerator at 4°C to maintain the biological activity of the soil microbes until
used.
2.12.2 Determination of Maximum Water Holding Capacity (MWHC) of the soil
Oven dried soil samples (100g) were taken in funnel in triplicates. The funnels
having short length rubber tubing at their mouths with a clamp were used for this
purpose. Cotton swabs of equal weight were placed in the funnel at the top of the stem.
Water was transferred into soil slowly until it was saturated. As soon as first drop of the
water escaped from the funnel, water addition was stopped and all extra water was
allowed to come out of the funnel. After about half an hour, volume of the water run
away through the soil in the beaker below was measured. This volume of water retained
by the soil was used for calculating MWHC of soil.
2.12.3 Preparation of pesticide-contaminated soil
In order to conduct microcosm experiments, pesticide stock solutions were used
for spiking the soil in their respective experiments according to the procedure described
by Brinch et al., (2002) and is described below:
The pesticide in the form of acetonitrile solution was added to sand (25% of the
total quantity of dry soil), mixed thoroughly and left closed for few hours. The solvent
was volatilized under fume-hood and the spiked soil was mixed with rest of experimental
Chapter2 Materials and Method
41
non-contaminated soil. A metal spatula was used to mix sand and soil so as to mix the
pesticide homogeneously in the total soil and to obtain final required concentrations of
the pesticide for respective experiments. In this way heterogeneity of the soil is reduced
to maximum. The spiked soil was saved at room temperature.
2.12.4 Extraction and analysis of pesticide residues from soil
For pesticide extraction from soil, 5g soil was sampled from each pot of
experiment. The soil samples were transferred to a 20 ml glass tube. Acetonitrile (5 ml)
was added to each of the soil samples and the tubes were sealed. The sealed tubes were
vortexed for 3 to 5 min and placed in a sonication bath for 10 min. The tubes containing
the extracts and soil materials were centrifuged at 4600×g for about 15 min. The soil
pellet was discarded and the supernatant was separated containing the pesticide residues
from each sample was filtered through fluorropore ™ membrane filters (0.5 µm) and
stored at 4°C until analyzed through HPLC.
2.12.5 Optimization of soil moisture on pesticide degradation
The microcosm studies were carried out with soil contaminated with 50 mg/kg
pesticide in plastic pots. Triplicate soil samples (100 g) containing pesticide were
inoculated with respective pesticide degrading bacterial strains (2x109 CFU/g). Varying
soil moisture contents were adjusted and maintained at 20%, 40%, 60% and 80% of the
MWHC by adding sterile MSM. Un-inoculated soil samples served as controls. Pesticide
residues were extracted after every ten days and analysis was carried out for about 40
days.
2.12.6 Optimization of inoculum density for pesticide degradation in soil
Pesticide contaminated soil was inoculated with varying inoculum densities
prepared by a dilution series using overnight grown bacterial culture in nutrient broth.
Triplicate sterilized soil samples (100 g) at 40% MWHC of the soil, containing 50mg/kg
pesticide and were inoculated with pesticide degrading bacteria to achieve varying cell
densities (CFU/g) fresh weights and incubated at room temperature. Sampling and
Chapter2 Materials and Method
42
extraction of pesticide residues were carried out after every ten days and the experiment
was carried out for 40 days.
2.13 Identification of pesticide metabolites
Samples containing residues of chlorpyrifos and profenofos along with their
degradation metabolites, periodically obtained from culture flasks were extracted with
solvent (as described in previous sections) and derivatized with N, O-Bis-(trimethylsilyl)
-trifluoroacetamide (BSTFA, derivatizing reagent for Gas Chromatography) using
BSTFA kit according to the protocol as instructed by manufacturer (Supelco).
GC-MS analyses were performed with an Agilent 6890N Gas Chromatograph
equipped with a Supleco Equity-1 capillary column (30 m by 250 µm and 25 µm film
thickness), an auto-injector (7683 series), and an Agilent 5973 network mass selective
detector (Agilent Technologies, Palo Alto, Calif.). Helium was used as the carrier gas
with a constant flow rate of 0.5 ml/min. The injector and transfer lines were 220 and
300°C respectively. The chromatography program was as follows: total run time was 33
min; Initial temperature of column was 70°C, a temperature increase of 10°C/min and
final heating to 240°C. The ionization voltage and electron multiplier settings were 70eV
and 1,294 V, respectively. Product identities were confirmed by a comparison of
retention times and MS fragmentation profiles to authentic chemical standards of the
respective pesticides.
2.14 Study of potential genes encoding hydrolases/oxygenases in pesticide degrading
bacterial strains
2.14.1 Amplification of the OP degrading genes
Primers were designed and synthesized to amplify the potential genes encoding
hydrolases, hydroxylases or oxygenases from PFF and CP degrading bacterial isolates.
Primers already reported for OP hydrolase genes (opd, mpd & opdA) and oxygenases of
different aromatic compounds were selected from previously published work as
mentioned in Table 2.3. Some primers were also designed (Table 2.4) by retrieving
known sequences of OP hydrolase or oxygenase genes which have already been
submitted in the GenBank. These sequences were aligned using ClustalW software,
Chapter2 Materials and Method
43
conserved regions of the sequences were selected and tested in silico using the Primer3
program available online (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3.www.cgi).
PCR reactions were performed in 25 µl reaction volumes containing 0.5 µl of Taq
DNA polymerase (2.5 U/µl), 2.5 µl of 10×PCR reaction buffer, 0.75 µl of each of the
primers (10 µM), 1 µl dNTPs mixture (10 mM), 1 µl of the bacterial genomic DNA
(as the template) and 18.5 µl of sterile distilled water. The PCR amplification
protocol was: denaturation at 94C for 1 min, annealing at 52-65C (depending on
melting temperatures of primer pairs) for 30 seconds and extension at 72C for 1 min,
and all the three steps were repeated for 35 cycles.
2.14.2 Agarose gel electrophoresis, cloning and sequencing of the amplified gene
The amplicons of expected size obtained were analyzed on agarose gel (1 to
1.5%) depending on the size of the PCR product. Same protocol was followed as
described in Section 2.8.4 for 16S rRNA gene.
The amplified PCR products were purified using PCR purification kit (Fermentas),
ligated to pk18 vector and transformed in E. coli DH5 following heat shock method.
Plasmids were isolated from transformants using mini prep kit (Fermentas). Isolated
plasmid was digested with required restriction enzyme to confirm the product sizes of the
amplicons. The plasmids thus obtained were sequenced and the sequences obtained were
analyzed using the BLASTN search program of the GenBank database in National Center
for Biotechnology Information, NCBI.
Chapter2 Materials and Method
44
Table 2.3: Sequences of the previously reported primers used in this study
Primer Sequence
Product
size Reference
Gene/enzyme recognized
by the primer
OpdA-F1
OpdA-R1
5’GCACTGCAGATGCAAACGAGAAGAGATGCACTT-3
5- GTCGAATTCTCATCGTTCGGTATCTTGACGGGG-3’
1155bp Sharaf et al., 2006
OPDA enzyme, a natural
variant of OPH enzyme
OpdA-F2
OpdA-R2
5'GCGATGTTCCGGTAACCACTCACA3'
5'GCAACACTCTCAGAGGGACGAAGG3'
412bp Ali et al., 2011 OPDA enzyme, a natural
variant of OPH enzyme
Opd-F1
Opd-R1
5'GCAAGGGTTGTGCTCAAGTCTGC 3'
5'GACCAATAAACTGACGTCGCGAC 3'
327bp Ali et al., 2011 Organophosphate Hydrolase
(OPH)
Mpd-F1
Mpd-R1
5'GAAAAGCAGGTCGACGAGATCTAC3'
5'ACCTTTGACGACCGAGTAGTTCAC3'
547bp Ali et al., 2011
Methyl parathion hydrolase
(MPH)
NAH-F
NAH-R
5' CAAAA(A/G)CACCTGATT(C/T)ATGG 3'
5' (C/T)(A/G)CG(A/G)G(C/G)GACTTCTTTCAA 3'
377bp Baldwin et al., 2003
Naphthalene dioxygenase
TOD-F
TOD-R
5' ACCGATGA(A/G)GA(C/T)CTGTACC 3'
5' CTTCGGTC(A/C)AGTAGCTGGTG 3' 757bp Baldwin et al., 2003
Toluene dioxygenase
TOL-F
TOL-R
5' TGAGGCTGAAACTTTACGTAGA 3'
5' CTCACCTGGAGTTGCGTAC 3' 475bp Baldwin et al., 2003
Toluene monoxygenase
BPH1-F
BPH1-R
5' GGACGTGATGCTCGA(C/T)CGC 3'
5'TGTT(C/G)GG(C/T)ACGTT(A/C)AGGCCCAT 3'
671bp Baldwin et al., 2003
Biophenyl dioxygenase
BPH2-F
BPH2-R
5' GACGCCCGCCCCTATATGGA 3'
5' AGCCGACGTTGCCAGGAAAAT3'
724bp Baldwin et al., 2003
Biophenyl dioxygenase
PHE-F
PHE-R
5' GTGCTGAC(C/G)AA(C/T)CTG(C/T)TGTTC 3'
5' CGCCAGAACCA(C/T)TT(A/G)TC 3' 206bp Baldwin et al., 2003
Phenol hydroxylase
PCAHF
PCAHR
5' GAGRTSTGGCARGCSAA[Y] 3'
5' CCG[Y]SSAGCACGATGTC 3' 390bp Azhari et al., 2007
Protocatechuate 1,2,
dioxygenase
Chapter2 Materials and Method
45
Table 2.4: Primer sequences designed by aligning the already reported
organophosphate degrading genes
Primer Sequence Product size Gene/enzyme recognized
by the primer
Opd-F2
Opd-R2
5' AGGTGGTGTTCCGGTAACCACT 3'
5' GGACTGAGCGCCTTGATCAAGA 3' 276bp Organophosphate
degrading hydrolase
Opd-F3
Opd-R3
5' ACAGTGTTCCGGTAACCACTCACAC 3'
5' CCGGCTCAAATCGTCAGTATCATCG 3' 474bp Organophosphate
degrading hydrolase
Opd-F4
Opd-R4
5' AAAGCGGCTGGCGTGCGAACGAT 3'
5' GAGGTTCACGCGATCCATCACGT 3'
691bp
Organophosphate
degrading hydrolase
OpdUpF
OpdDnR
5' GACAGGATTCTTGCGTGCTTGGC 3'
5' CAACAACCCGAACAGCCAGTCATTC 3' 752bp Organophosphate
degrading hydrolase
mpdUpF
mpdDnR
5' GAAACAAGCTGGTGCTGGTGGACAC 3'
5' CATAGTATCAGGTCGCCGAGCAGG 3' 530 bp Methyl Parathion
degrading hydrolase
Chapter 4 Biodegradation of profenofos
46
Chapter 3
Isolation, characterization and degradation potential of profenofos
degrading bacterial strains
1.20 Introduction
Profenofos (PFF) [(O-4-bromo-2-chlorophenyl)-O-ethyl-S-propylphophorothioate]
is a phosphorothioate organophosphate insecticide (Figure 3.1) which is a broad spectrum,
non-systemic and foliar insecticide. It is also used as acaricide i.e. to kill mites on a wide
range of crops including cotton, maize, sugar beet, soya beans, potatoes, vegetables and
tobacco (Reddy and Rao, 2008). It was developed for controlling insect pests that were
resistant to chlorpyrifos and other OPs (Worthing and Hance, 1991). It is one of the widely
used pesticides in Pakistan (Ismail et al., 2009) and other countries e.g. India, Australia,
Korea and USA (Rao et al., 2003; Kumar and Chapman, 2001; Min and Cha, 2000;
Dadson et al., 2013). One reason for the extensive use of PFF is a deceptive view of its
short half life in soil but it has been recognized as highly persistent and toxic at even low
concentrations (Zhao et al., 2008).
Figure 3.1 Chemical structure of profenofos
According to World Health Organization (WHO) this compound has been
classified as a moderately hazardous (Toxicity class II) pesticide (Abass et al., 2007;
Malghani et al., 2009a). Many reports reveal the toxicity of PFF to non target aquatic and
terrestrial organisms such as fish & earthworms (Kavitha and Rao, 2009; Liu et al., 2012).
Genotoxic effects of PFF on fish have also been reported (Prabhavathy et al., 2006;
Pandey et al., 2011). Moreover, it interferes with the biochemical activity in non target
insects, birds, animals and humans (Rao et al., 2003, McDaniel et al., 2004; Abass et al.,
2007). Generally, like other OP pesticides, PFF also exhibits acute neurotoxicity by
Chapter 4 Biodegradation of profenofos
47
inhibiting acetyl cholinesterase enzyme (Costa, 2006). Other health effects include the
induced oxidant stress and consequent nephrotoxicity at high doses (Lin, et al., 2003).
Due to the toxicity concerns of PFF, remediation of this pesticide from
contaminated soils and water needs serious attention. In this context microbial degradation
is considered to be a potential strategy for the remediation of pesticide residues from
contaminated sites (Watanabe, 2001). Considerable attention has been given towards the
naturally existing bacterial isolates bestowed with pesticide degrading capacities. Natural
degraders endow the environment with the prospect of both eco-friendly and in situ
detoxification. Moreover, they exhibit efficient degradation in a wide range of
environmental conditions (Abe et al., 2011; Latifi et al., 2012).
Regarding the microbial degradation of PFF, limited number of bacterial strains
have been reported to date which include Pseudomonas putida & Burkholderia gladioli
(Malghani et al., 2009a), Pseudomonas aeruginosa (Malghani et al., 2009b) and Bacillus
subtilis (Salunkhe et al., 2013). These strains were found to hydrolyze PFF to produce 4-
bromo-2-chlorophenol (BCP). Further degradation of BCP by the isolated bacteria has not
been reported yet. BCP has also been proved to be toxic and a specific and sensitive
exposure biomarker for PFF (Dadson et al., 2013).
In addition to pure bacterial isolates, bacterial consortia obtained from highly
contaminated sites have also been found very efficient in removing the contaminants at
high concentrations (Krishna and Philip, 2008). While isolating the bacteria using
enrichment culture technique, highly efficient bacterial consortia are obtained for the
degradation of the pesticides. Sometimes, single pure isolates are not able to withstand
stress induced by the toxic pesticide metabolites; hence complete degradation of the
pesticide is resisted. However, bacterial consortium, a composite of some suitable bacterial
strains, helps in complete transformation of a pesticide into potentially harmless end
products. This can be attributed to the mutual activity of constitutive bacterial strains
which work in harmony with each other to overcome the toxic effects of pesticide.
The fate of pesticides in soil depends on both biotic and abiotic factors such as
physical and chemical characteristics of the substrate, nutrients status, pH, pesticides
characteristics (hydrophilicity, level of solubility), temperature and biotic factors such as
inoculum density (Karpouzas and Walker, 2000). These factors collaborate and harmonize
Chapter 4 Biodegradation of profenofos
48
one another in the microenvironment to affect the process of bioremediation. Racke et al.,
(1990) suggested that the composition and size of soil microbial populations as well as the
status of metabolic activity are the determining factors regarding the biodegradation
feasibility as a remediation option. Bioremediation techniques endeavor to speed up the
naturally occurring biodegradation process by optimizing the conditions under which it
occurs. Although suitable microbial populations may be available for biodegradation of a
given contaminant, environmental conditions may limit or even inhibit this process in
many contaminated areas. In such type of cases, bio-stimulation of the degrading potential
of native microbial populations and/or the bioaugmentation of selected degrading
microorganisms to contaminated soil have been found efficient at enhancing pesticide
metabolism (Margesin et al., 2000; Sasek, 2003).
Generally, studies regarding the optimization of pesticide degradation involve one
factor at a time. But in the recent years, these have been found to be laborious and might
also lead to misinterpretations of the results. Therefore, a statistically developed model or
set of experiments, response surface methodology (RSM) was employed. RSM,
supported by the software, a statistical design of experiments, is a pragmatic modelization
technique derived for the estimation of the relationship of a set of controlled experimental
variables and the observed results. This method was developed to create a set of designed
experiments to find an optimum response of different variables (Box and Wilson, 1951).
However, central composite design based on response surface methodology (RSM) has
been found to effectively cope with most of the limitations encountered in the
optimization of pollutant degradation processes (Sridevi et al., 2011).
Although biodegradation of profenofos has been reported, such studies are scarce
or do not exist as yet for agricultural soils in Pakistan. Its extensive use and high
persistence determines its presence in agricultural lands where it is applied repeatedly. The
environmental concern of profenofos or its metabolites, therefore, has prompted to pay
attention towards the biodegradation of this pesticide. It has become increasingly
important to isolate microorganisms indigenously that are capable of degrading profenofos
and it would greatly hamper the problems associated with the agricultural and non-
agricultural use of PFF.
Chapter 4 Biodegradation of profenofos
49
Here we aim to achieve scientific understanding of the metabolism of profenofos
and its degradation products by indigenously isolated bacterial strains/consortia in liquid
media and contaminated soil. Moreover, Central Composite Design (CCD) based on RSM
was employed for the optimization of various culture conditions for biodegradation of PFF
by the bacterial consortium. “CCD is a standard design of RSM and is well suited for
fitting process optimization.” This design is quite efficient in reducing the number of
experiments and gaining desired results and generating useful information about a
process.” This study can be an important asset in the area of developing processes for the
enhanced biodegradation/bioremediation of profenofos contaminated soils, sediments and
groundwater which would provide valid information for the environmental risk assessment
related to pesticide profenofos and attracting the attention of environmental scientists
towards this pesticide which has been neglected yet from the bioremediation point of view.
1.21 Materials and Methods
1.21.1 Development of profenofos degrading bacterial consortium
Soil samples were collected from cotton fields with prior history of PFF
applications and used for the isolation of PFF degrading bacteria. Repeated enrichment
culture technique was employed for the development of a bacterial consortium (Lakshmi
et al., 2009) using 250 ml Erlenmeyer flasks containing soil (10g), 100 ml MSM
supplemented with 1 ml/l Focht trace element solution (Appendix 8) and 50 and 100 mg/l
PFF as described in Chapter 2 Section 2.6. However, after three successive transfers into
the fresh MSM containing PFF a consortium named as PBAC was developed with PFF
degrading capability. For isolation of bacterial strains the consortium was serially diluted
and plated on MSM agar medium containing 100 mg/l PFF. The colonies presenting
visually distinct morphology were purified by repeated streaking and eight distinct
colonies were obtained which were named as PF-A, PF-B, PF-C, PF-D, PF-E, PF-F, PF-
G and PF-H. Growth of all the isolated strains and the consortium (PBAC) in MSM broth
with PFF was monitored spectrophotometerically in terms of optical density (OD) at 600
nm.
Chapter 4 Biodegradation of profenofos
50
1.21.2 Molecular identification of PFF degrading bacterial strains comprising the
consortium PBAC
Ribosomal Intergenic Spacer Analysis (RISA) is a method of microbial
community analysis which provides means of comparing specie-specific sequences of
microbes in a community. Therefore, 16S-23S intergenic spacer region of all the eight
isolates (PF-A to PF-H) was amplified using primers IGS-forward (5′-
TGCGGCTGGATCACCTCCT-3′) and IGS-reverse (5′- GGCTGCTTCTAAGCCAAC-
3′) as described earlier (Yousaf et al., 2010). PCR products (10 μl) were digested with
EcoRI & HindIII (10U/µl, Fermentas) and the resulting DNA fragments were separated
by agarose gel (1% w/v) electrophoresis in TAE buffer to carry out the Restriction
Fragment Length Polymorphism (RFLP) analysis of 16S-23S IGS of the bacterial strains
in the consortium. Molecular identification was confirmed by 16S rRNA gene analysis
and evolutionary relationships of the isolates were studied as described in Chapter 2
Section 2.8. The 16Sr RNA gene sequences of the isolates were submitted in GenBank.
1.21.3 Morphology and biochemical analysis of PFF degrading bacterial isolates
Profenofos degrading bacterial strains were characterized by the standard
morphological and biochemical methods as described earlier (Chapter 2 Section 2.9).
1.21.4 Biodegradation of PFF by pure cultures and bacterial consortium PBAC
Degradation experiments with PFF as a sole source of carbon were carried out in
Erlenmeyer flasks containing 50 ml MSM (pH 7.0) supplemented with 100 mg/l PFF,
inoculated with pure isolates or the consortium (PBAC) to give final culture density of
0.6 g/l. Flasks were incubated at 37°C in a rotary shaker at 100 rpm. Un-inoculated flasks
served as controls and all the experiments were performed in three replicate.
1.21.5 Extraction and HPLC analysis of PFF residues
Cultures were harvested after regular intervals (24 h) and PFF residues were
extracted using equal volumes of dichloromethane and analyzed using HPLC as
described in Chapter 2 Section 2.11.1 - 2.11.3. A mixture of acetonitrile and water
(80:20) was used as mobile phase. However, PFF and its degradation product were
Chapter 4 Biodegradation of profenofos
51
detected and quantified at a wavelength of 275 nm. Retention time for PFF and 4-bromo-
2-chlorophenol were 7.5 and 2.7 min respectively.
1.21.6 Optimization of culture conditions for PFF degradation using Response
surface Methodology (RSM)
The preliminary studies showed that pH, temperature and inoculum size (as
explained in Section 3.2.6) significantly affect the degradation of PFF by the consortium
PBAC. To optimize the interactive effects of three factors on PFF degradation, response
surface methodology (RSM) was employed. The analyzed response was the degradation of
PFF after three days of incubation. Using Design Expert software (trial version 8, Stat-
Ease, Inc., MN, USA), a 23 full factorial central composite design (CCD) with total 20
runs was employed. pH, temperature and inoculum density are the three experimental
factors. The symbols and levels of the three variables are given in Table 3.1. General
experimental setup (Chapter 2 Section 2.11) was followed to perform all 20 experiments
with modifications according to the variable ranges. Samples were harvested, extracted
and analyzed by HPLC as described above (Section 3.2.5).
Table 3.1: Experimental ranges and levels of independent variables
Independent variables Symbols Coded levels (Range)
Low (-1) Centre (0) High (+1)
pH of medium X1 6.0 7.0 8.0
Incubation temperature (°C) X2 30 37 40
Inoculum size of the culture (g/l) X3 0.2 0.4 0.6
X1, X2 and X3 are the short notations for the independent variables pH, temperature and inoculums size respectively.
These are the culture conditions which affect the rate of degradation of pesticide in liquid culture (and in soil)
In the system involving three variables, a mathematical relationship of the
response (PFF % degradation) of these variables was approximated by the quadratic
polynomial equation given below:
Y= a0 + a1X1 + a2X2 + a3X3 + a12X1X2 + a13X1X3 +
a23X2X3 + a11X12
+ a22X22 + a33X3
2 Eq. (1)
Chapter 4 Biodegradation of profenofos
52
Where Y is the predicted response value, a0 is the constant, a1, a2 and a3 are the linear
coefficients; a12, a13 and a23 are the cross product coefficients; a11, a22 and a33 are the
quadratic coefficients.
1.21.7 PFF degradation by PBAC at different initial concentrations
Degradation experiments with various initial PFF concentrations (50–300 mg/l)
as the sole carbon source were performed in 250 ml Erlenmeyer flasks containing 50 ml
sterile MSM using PBAC as inoculum. Profenofos was introduced in the form of
acetonitrile solution. The cultures were incubated at 37°C and 100 rpm in a rotary
shaker for 192 h (8 days). Each treatment was set in triplicates with un-inoculated
samples as control. The extraction and analysis of PFF residues was carried out to
assess the potential of PBAC to tolerate and degrade PFF.
1.21.8 Soil microcosm studies for PFF degradation
Biodegradation of profenofos in soil (50 mg/kg, dry weight) was studied at
different soil moisture levels (20%, 40% 45% and 60%) as described in Section 2.12.
Moreover, PFF degradation was also studied in sterilized soil containing 50 mg/kg PFF
and different inoculum densities (1.6×105
, 1.6×10
6 and 1.6×10
7 and 1.6×10
8 CFU/g) of
bacterial consortium PBAC.
1.21.9 Identification of PFF metabolites
Samples containing residues of PFF and its metabolites obtained from culture
flasks were extracted with n-hexane-acetone (80:20) following Malghani et al., (2009a)
and dehydrated with anhydrous sodium sulphate. The solvent was evaporated with
rotavapor, dried residues were dissolved in dried acetonitrile, derivatized and analyzed by
Agilent Gas Chromatograph as described in Chapter 2, Section 2.13.
1.21.10Study of potential genes encoding OP hydrolases/oxygenases
Amplification of genes encoding organophosphate degrading hydrolases and
mono- or di-oxygenases in PFF degrading bacterial consortium PBAC was carried out
using primers mentioned in Table 2.4 and 2.5 as described in Chapter 2, Section 2.14.
Chapter 4 Biodegradation of profenofos
53
1.21.11Biodegradation of other pesticides
Degradation experiments were carried out using various pesticides including
organophosphates (chlorpyrifos, diazinon, methyl-parathion, triazophos and
imidacloprid) and pyrethroids (cypermethrin) at 50 mg/l concentration as sole source
of carbon to evaluate the degradation spectrum of the PFF degrading bacterial
consortium PBAC. Minimal salt medium supplemented with each pesticide
individually was inoculated with PBAC. Cultures were harvested after 3 days of
incubation and pesticides residues were extracted. Cypermethrin was extracted two
times with n-hexane, separated layer of n-hexane containing pesticide was
evaporated and the dried residues were dissolved in methanol. A mobile phase
containing methanol and water was used for analyzing cypermethrin residues using
HPLC. All other pesticides used in the experiment, were extracted and analyzed as
described in section 3.2.5. However, detection wavelengths (λmax) were measured for
all other pesticides as described in Chapter 2, Section 2.12.1.
1.21.12Data analysis
Degradation rates and percent degradation were calculated as described in El-
Helow et al., (2013). Using following formulae:
(1). Degradation (%) = [initial profenofos concentration − residual profenofos
concentration]/initial pesticide concentration) × 100.
(2). Degradation rate (mg/h) = profenofos biodegradation (mg/l)/ time (h).
Kinetic model was determined by plotting log profenofos residues against time.
Degradation rate constant (k, 1/h) and half-life in days (DT50) were determined using Eq.
(2) and Eq. (3) as described in Cycon et al., (2009) and Jabeen et al., (2014).
Ct = C0e-kt
Eq. (2)
T1/2 = ln (2) / k Eq. (3)
Ct and C0 indicate the pesticide concentration at time “t” and time “zero”
respectively. Statistical analyses were performed on three replicates of data obtained from
all treatments. The significance of differences were treated statistically by one, two or
Chapter 4 Biodegradation of profenofos
54
three way ANOVA and evaluated by post hoc comparison of means using Tukey’s test in
Statistica 6.0 software.
1.22 Results
1.22.1 Molecular identification of PFF degrading bacterial isolates
Following RFLP analysis of 16S to 23S IGS amplicons it was found that the
bacterial consortium PBAC was comprised of four bacterial strains based on the
restriction pattern. Restriction patterns of isolates B, D, G and H were found to be similar
(Figure 3.2A & B). Similarly, the restriction patterns of isolates E and F were similar
using both the enzymes indicating that they might be the same strains. However, isolates
A and C showed unique restriction patterns. Further, the sequence similarity deduced
from the 16S rRNA gene analysis and database comparison was in correspondence with
RFLP results. The isolates were identified as Achromobacter xylosoxidans PF1,
Pseudomonas aeruginosa PF2, Bacillus sp. PF3 and Citrobacter koseri PF4. Accession
numbers of PF1, PF2 PF3 and PF4 are KF201649, KF207917, KF207918 and KJ561165
(Table 3.2). Phyllogenetic relationship of the four bacterial strains showed that PF1, PF2,
PF3 and PF4 were placed with the well supported branches of Achromobacter
xylosoxidans, Pseudomonas aeruginosa, Bacillus sp. and Citrobacter koseri respectively
(Figure 3.3-3.6).
Table 3.2: Percent (%) similarity of profenofos degrading bacterial strains with
reported 16SrRNA gene sequences in the GenBank alongwith the GenBank
accession numbers
Bacterial Isolate Similarity with %
Similarity
PF1 (KF201649) Achromobacter xylosoxidans strain J2 (GU014534.1) 99%
PF2 (KF207917) Pseudomonas aeruginosa strain JKCM-H-2B (LC010673.1) 100%
PF3 (KF207918) Bacillus sp. strain 2DT (LM655315.1) 99%
PF4 (KJ561165) Citrobacter koseri isolate URMITE (LK054630.1) 99%
Numbers in parentheses indicate the GenBank accession numbers
Chapter 4 Biodegradation of profenofos
55
Figure 3.2 Restriction Fragment Length Polymorphism of IGS gene from PF-A to PF-H
(Lane 1-8) restricted with A) EcoR1 and B) HindIII. PF-A displays a unique restriction
pattern (named as PF1); restriction pattern of PF-B, PF-D, PF-G and PF-H, are similar
(named as PF2); PF-C also displays a unique pattern (named as PF3); restriction patterns
of PF-E and PF-F are similar (named as PF4). M indicates the 1Kb Marker.
A
B
Chapter 4 Biodegradation of profenofos
56
Figure 3.3 Neighbor joining tree showing the phyllogenetic relationship of strain PF1
with the related species based on the 16S rRNA gene sequences. Bootstrap values that are
expressed as the percentages of 1000 replications are shown at the nodes of the branches.
Achromobacter spanius LMG 5911 025686.1
Achromobacter piechaudii EY3860 (027186.1)
Achromobacter xylosoxidans A8 (074754.1)
Achromobacter insolitus LMG 6003 (025685.1)
Achromobacter denitrificans DSM 30026 (042021.1)
Achromobacter ruhlandii EY3918 (027197.1)
Achromobacter xylosoxidans Hugh 2838(044925.1)
Achromobacter xylosoxidans PF1 (KF201649.1)
Bordetella avium ATCC 35086 (041769.1)
Bordetella hinzii LMG 13501 (027537.1)
Bordetella pertussis CS (103933.1)
Bordetella parapertussis 522 (025950.1)
Bordetella petrii Se-1111R (025369.1)
Bordetella petrii DSM 12804 (074291.1)
Herbaspirillum huttiense subsp. putei 7-2 (028656.1)
Azohydromonas lata IAM 12599 (041244.1)
Burkholderia andropogonis LMG 2129 (104960.1)
Burkholderia soli GP25-8 (043872.1)
Burkholderia multivorans Struelens (029358.1)
Burkholderia latens R-5630 (042632.1)100
82
100
80
100
93
42
100 76
69
95
96
94
68
62
67
84
0.01
Chapter 4 Biodegradation of profenofos
57
Figure 3.4 Neighbor joining tree showing the phyllogenetic relationship of strain PF2
with the related species based on the 16S rRNA gene sequences. Bootstrap values that are
expressed as the percentages of 1000 replications are shown at the nodes of the branches.
Pseudomonas_peli_R-20805_16S_(042451)
Pseudomonas_guineae_M8_(042607
Pseudomonas_cuatrocienegasensis_1N_(044569)
Pseudomonas_borbori_strain_R-20821(042450)
Pseudomonas_fulva_12-X_strain_(074659)
Pseudomonas_marincola_KMM_3042_(041592)
Pseudomonas_alcaliphila_AL15-21_(024734)_
Pseudomonas_psychrotolerans_C36_(042191)
Pseudomonas_stutzeri_A1501_(074829
Pseudomonas_stutzeri_ATCC_17588__LMG_11199_(103934)
Pseudomonas_stutzeri_ATCC_17588__LMG_11199_(041715)
Pseudomonas_otitidis_MCC10330_(043289)
Pseudomonas_resinovorans_NBRC_106553_(103921)
Pseudomonas_resinovorans_LMG_2274_(026534)_
Pseudomonas_aeruginosa_DSM_(026078)
Pseudomonas_aeruginosa_PF2_(KF207917)
Pseudomonas_aeruginosa_PAO1_(074828)
Pseudomonas_azotifigens_6H33b_16S_(041247)
Pseudomonas_denitrificans_ATCC_13867_(102805)
Pseudomonas_knackmussii_B13_16S_(041702)
Pseudomonas_delhiensis_RLD-1(04373184
100
100
83
80
100
100
54
29
60
86
73
37
48
39
86
36
0.005
Chapter 4 Biodegradation of profenofos
58
Figure 3.5 Neighbor joining tree showing the phyllogenetic relationship of strain PF3
with the related species based on the 16S rRNA gene sequences. Bootstrap values that are
expressed as the percentages of 1000 replications are shown at the nodes of the branches.
Bacillus pocheonensis Gsoil 420 (041377.1)
Bacillus ginsengisoli DCY53 (109068.1)
Bacillus niacini IFO15566 (024695.1)
Bacillus vireti R-15447 (025590.1)
Bacillus circulans ATCC 4513(104566.1)
Bacillus siralis 171544 (028709.1)
Bacillus purgationiresistens DS22 (108492.1)
Bacillus firmus IAM 12464 (025842.1)
Bacillus flexus IFO15715 (024691.1)
Bacillus megaterium IAM 13418 (043401.1)
Bacillus megaterium QM B1551 (074290.1)
Bacillus sp. PF3 (KF207918.1)
Bacillus endophyticus 2DT (025122.1)
Bacillus humi LMG 22167(025626.1)
Bacillus niabensis 4T19 (043334.1)
Bacillus seohaeanensis BH724 (043083.1)
Bacillus aquimaris TF-12 (025241.1)
Bacillus isabeliae CVS-8(042619.1)
Bacillus carboniphilus JCM9731 (024690.1)
Bacillus sporothermodurans M215 (026010.1)
Bacillus shack letonii LMG 18435 (025373.1)
100
97
100
88
45
95
84
44
59
38
75
93
51
68
52
41
21
67
0.005
Chapter 4 Biodegradation of profenofos
59
Figure 3.6 Neighbor joining tree showing the phyllogenetic relationship of strain PF4
with the related species based on the 16S rRNA gene sequences. Bootstrap values that are
expressed as the percentages of 1000 replications are shown at the nodes of the branches.
Salmonella enterica subsp. enterica serovar Paratyphi A str. AKU_12601 (074935.1)
Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150 (074934.1)
Salmonella enterica subsp. enterica serovar Paratyphi C RKS4594 (074899.1)
Salmonella enterica subsp. enterica serovar Choleraesuis str. SC-B67 (074800.1)
Salmonella enterica subsp. houtenae DSM 9221 (044371.1)
Salmonella enterica subsp. salamae DSM 9220 (044372.1)
Salmonella enterica subsp. enterica serovar Typhi str. Ty2 (074799.1)
Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 (074910.1)
Salmonella bongori NCTC 12419 (074888.1|)
Citrobacter farmeri CDC 2991-81 (024861.1)
Citrobacter koseri ATCC BAA-895 (102823.1)
Citrobactor koseri PF5
Citrobacter koseri CDC-8132-86 (104890.1)
Shigella flexneri 2a str. 301 (074882.1)
Shigella flexneri ATCC 29903 (026331.1)
Shigella sonnei CECT 4887 (104826.1)
Shigella boydii Sb227 Sb227 (074893.1)
Shigella boydii P288 (104901.1)98
97
59
100
52
85
9485
5227
49
72
83
89
86
0.002
Citrobactor koseri PF4
Chapter 4 Biodegradation of profenofos
60
1.22.2 Morphological and biochemical characterization of PFF degrading bacterial
isolates
Morphological and biochemical characterization of all eight isolates is described
in Table 3.3. Based on the comparison with Bergey’s Manual of Determinative
Bacteriology following observations were recorded:
PF-A was found to resemble to Achromobacter.
PF-B, PF-D, PF-G and PF-H resembled to Pseudomonas sp.
PF-E and PF-F resembled to Citrobacter
PF-C resembled to Bacillus.
Hence these results were in harmony with the molecular identification of the bacterial
consortium. Morphology of the four strains in shown in Figure 3.7.
Chapter 4 Biodegradation of profenofos
61
Table 3.3: Biochemical characteristics of profenofos degrading bacteria
Bacterial strain Morphology Biochemical characters
Colony
Morphology
Cell
morphology Gram’ s Staining
Sucrose/glucose
/Maltose
Oxidase/Orthinin
/arginine
PF-A
Round,
Smooth,
margin, shiny,
small, convex,
Rod
Motile
Gram negative -/+/- +/-/-
PF-B
Oval, Irregular
margin,
medium size,
shiny, green ,
flat,
Rod shaped
Motile
Gram negative +/+/+ +/-/+
PF-C
Off-white to
white, regular,
opaque
Short rods
Motile Gram positive +/+/- -/-/+
PF-D
Oval, Irregular
margin,
medium size,
shiny, green ,
flat,
Rod shaped
Motile
Gram negative +/+/+ +/-/+
PF-E
Round,
smooth,
larger,
convex,
creamy color
Rods, Motile Gram negative +/-/- -/+/+
PF-F
Round,
smooth,
larger,
convex,
creamy color
Rods, Motile Gram negative +/-/- -/+/+
PF-G
Oval, Irregular
margin,
medium size,
shiny, green ,
flat,
Rod shaped
Motile
Gram negative +/+/+ +/-/+
PF-H
Oval, Irregular
margin,
medium size,
shiny, green ,
flat,
Rod shaped
Motile
Gram negative +/+/+ +/-/+
Chapter 4 Biodegradation of profenofos
62
Figure 3.7 Profenofos degrading pure bacterial strains grown on LB agar medium
Chapter 4 Biodegradation of profenofos
63
1.22.3 Antibiotic resistance assay
Response of all four PFF degrading bacterial strains to different antibiotics is
presented in Table 3.4.
Table 3.4: Response of profenofos degrading bacterial strains to different
antibiotics
Bacterial strains
PF1 PF2 PF3 PF4
Antibiotics Symbols
Kanamycin K Sensitive Resistant Sensitive Sensitive
Rifamycn RA Resistant Resistant Sensitive Resistant
Tetracycline TE Resistant Resistant Sensitive Sensitive
Chloramphenicol C Resistant Resistant Sensitive Sensitive
Nalidixic acid NA Resistant Resistant Sensitive Sensitive
Streptomycin S Resistant Resistant Sensitive Resistant
Erythromycin E Resistant Resistant Sensitive Sensitive
Gentamycin CN Resistant Sensitive Sensitive Sensitive
Carbenicillin PY Resistant Resistant Resistant Resistant
Ampicillin AM Resistant Sensitive Resistant Sensitive
Chapter 4 Biodegradation of profenofos
64
1.22.4 Biodegradation of PFF in aqueous medium by pure cultures and PBAC
A comparative analysis of the degradation abilities of the consortium PBAC and
that of the pure bacterial cultures was carried out (Figure 3.8A). After 24 h of inoculation,
PBAC metabolized 37% of the added PFF while pure cultures of A. xylosoxidans PF1, P.
aeruginosa PF2, Bacillus sp. PF3 and C. koseri PF4 metabolized 9%, 12%, 10% and 7%
of added PFF respectively. PFF degradation by the PBAC significantly increased (P <
0.05) with incubation time, reaching 100% PFF within 72 h. However, none of the pure
cultures could significantly metabolize PFF to an extent as high as the consortium could.
The accumulation and subsequent degradation of 4-bromo-2-chlorophenol (BCP),
the major hydrolysis product of PFF was also monitored (Figure 3.8B). Maximum
amount of BCP was observed in the cultures containing PBAC where 20 mg/l BCP was
found after 48 h which was in line with the degradation of PFF. The concentration of
BCP decreased subsequently as the experiment proceeded. However, the scenario was
different in case of the individual bacterial cultures. It was found that after 72 h of
incubation 8, 9.7, 7.8 and 4 mg/l BCP was produced in the cultures inoculated with PF1,
PF2, PF3 and PF4 respectively. Further, the concentration of BCP was decreased to 7,
4.3, and 5.6 mg/l in the cultures containing PF1, PF2 and PF3 respectively. Noticeably,
no observable degradation of BCP by the strain PF4 was found as it continued to increase
until the end of experiment (120 h). Hence, degradation of both PFF and BCP was
significantly higher in cultures containing consortium PBAC. No significant degradation
was observed in un-inoculated controls.
The degradation followed the first order reaction as a straight line was produced
by plotting the log (ln) values (Ct/C0) of PFF residues against respective hours. The data
was interpreted statistically for the calculation of regression equation and first order
kinetic parameters (Table 3.5). Regression coefficient (R2) ranging from 0.8 to 0.998
indicated a good fit. The kinetic constant k (day-1
) was significantly higher for the PBAC
than that for the pure cultures. Similarly, the observed half lives of PFF in the cultures
containing pure PF1, PF2, PF3 and PF4 were significantly higher than that for the
cultures containing PBAC. An un-inoculated control showed a half life of 38.5 days.
Based on these observations the PBAC containing all four bacterial isolates was
considered for further PFF degradation studies.
Chapter 4 Biodegradation of profenofos
65
Figure 3.8 Degradation (%) of profenofos and its metabolite BCP by pure
bacterial isolates and the bacterial consortium PBAC: A) Degradation (%) of PFF
(100 mg/l) and B) accumulation and degradation of BCP as a result of PFF
degradation by PBAC () and pure isolates PF1 (), PF2 (), PF3 (), PF4 ()
and control (). Each value is the mean of three replicates and error bars show
the standard error.
B
A
Chapter 4 Biodegradation of profenofos
66
Table 3.5: Degradation kinetics of profenofos by pure cultures and consortium
PBAC
Treatments
MSM+PFF (100 mg/l) +
bacterial culture
Regression equation k (d-1
) t1/2 (Days) R2
A. xylosoxidans PF1 ln(Ct/C0)= 4.598-0.100x 0.100±0.003 6.9 0.964
P.aeruginosa PF2 ln(Ct/C0)= 4.623-0.151x 0.151±0.009 4.6 0.998
Bacillus sp. PF3 ln(Ct/C0)= 4.611-0.120x 0.120±0.009 5.8 0.958
C. koseri PF4 ln(Ct/C0)= 4.602-0.080x 0.080±0.006 8.7 0.989
Bacterial consortium
(PBAC) ln(Ct/C0)= 5.497-1.444x 1.444±0.003 0.5 0.970
Un-inoculated control ln(Ct/C0)= 4.601-0.018x 0.018±0.001 38.5 0.860
Chapter 4 Biodegradation of profenofos
67
1.22.5 Biodegradation of PFF with different initial concentrations by PBAC
Dynamic curves of PFF degradation and subsequent accumulation and
degradation of BCP at different initial concentrations of PFF (Figure 3.9) indicate a
higher rate of PFF degradation at its lower initial concentrations. At 25, 50 and 100 mg/l,
added PFF completely disappeared within 24, 36 and 72 h respectively (Figure 3.9 A, B
and C). However, rate of PFF degradation slowed down at relatively higher
concentrations (Figure 3.9 D and E) as indicated by 95% and 80% degradation at 200 and
300 mg/l initial PFF concentration respectively.
A concomitant accumulation and degradation of BCP was observed at different
initial concentrations of PFF. As described in Section 3.3.4, in the cultures where higher
PFF was degraded, higher BCP concentration was observed. However, BCP production
decreased with increasing the initial PFF concentration which was in line with the slow
rate of PFF degradation at higher concentrations. After 24 h of incubation, 8 and 7 mg/l
BCP was observed at 25 and 50 mg/l PFF which was disappeared after 24 and 48 h
respectively. At 100 mg/l PFF, 22 mg/l BCP was observed after 48 h which decreased to
11 and 7 mg/l after 72 and 96 h respectively and completely disappeared after 120 h of
experiment.
Nevertheless, at higher concentration of PFF (200 and 300 mg/l), BCP
concentration continued to increase at a slow rate concomitantly with PFF degradation
and small degradation of BCP was observed at higher concentrations of PFF. These
results indicate that accumulation of higher concentrations of PFF and BCP caused
inhibitory effect on microbial growth and activity hence degradation of PFF and
subsequently the BCP is reduced.
Chapter 4 Biodegradation of profenofos
68
Figure 3.9 Degradation of profenofos by the PBAC at different initial concentrations of
profenofos as a sole source of carbon and energy in MSM at 37°C and pH 7.0, (A) 25
mg/l, (B) 50 mg/l, (C) 100 mg/l, (D) 200 mg/l and (E) 300 mg/l indicating disappearance
of PFF (), accumulation and degradation of BCP () & un-inoculated control ().
Values are the Means of three replicates and error bars show the standard error.
Chapter 4 Biodegradation of profenofos
69
1.22.6 Optimization of culture conditions for PFF degradation using RSM
Based on the CCD, 20 experiments were performed consisting of 8 full factorial
points, 6 central and 6 axial points located at the central and the extreme levels with 6
centre points designated as replications (Table 3.6). By applying the multiple linear
regression analysis on the experimental data, a polynomial quadratic equation was found
to represent the % PFF degradation as given by the following mathematical expression:
Y= – 417.17 + 47.20X1 + 14.37X2 + 346.25X3 + 0.61X1X2
– 27.33X1X3+1.77X2X3 – 3.76X12
–0.28X22
–192X32
(4)
X1, X2 and X3 denote three independent variables i.e. pH, incubation temperature
and inoculums size (of the culture) respectively. The negative and positive signs of the
regression coefficients indicate the antagonistic and synergistic effects of each variable
respectively. In this case an antagonistic effect associated with X13, X12, X2
2and X3
2
while a synergistic effect associated with X1, X2, X3, X1X2 and X2X3 can be concluded
from the regression equation.
The predicted values of PFF degradation (%) using Eq. (4) along with the
experimental values are given in Table 3.7. The parity plot (Figure 3.10) indicates a
satisfactory correlation (R2= 0.968) between the predicted and the actual (observed)
response values of % PFF degradation. R2 is the determination coefficient which is used
to measure the goodness of fit for the model. Value of R2 closer to 1 is an indication of
the stronger model and good prediction of the response. Hence a good value of the R2
(0.968) in this case is the evidence of the best fit of the model which shows a good
correlation between predicted and observed response.
The results of the quadratic response surface model fitting in the form of analysis
of variance (ANOVA) are given in Table 3.8. It is required to test the significance and
adequacy of the model. Moreover, the Fisher variance ratio (F-statistics) is the valid
measure of how well the variables describe the variation in the data about its mean. The
greater F-value indicates that the factors adequately explain the variation in the data and
the estimated factors are real. Hence the current model is highly significant as indicated
by the Fisher’s F-test (Fmodel= 31) and very low p-value (p>F= 0.0001). Moreover, p-
values and the F- statistics were calculated for the coefficient of each term (Table 3.8).
Chapter 4 Biodegradation of profenofos
70
This implies that the main effects of pH, temperature and inoculum size were highly
significant as indicated by their p-values. This indicates that the three factors can act as
the limiting factor and small increase in values can alter the degradation rate of PFF. The
interaction effect of pH & temperature and pH & inoculum size were found to be very
significant (p<0.05) while interaction effect of temperature & inoculum size was
insignificant (p>0.05). However, the p-value of the model was 0.0001 implying that the
model is significant.
Chapter 4 Biodegradation of profenofos
71
Table 3.6: The 23 factorial and central composite design for experiment
Run no. Order no. Variables in coded levels Comment
X1 (pH) X2 (incubation
Temperature)
X3 (Inoculum size)
1 5 -1 -1 -1 Full factorial
2 11 1 -1 -1 Full factorial
3 19 -1 1 -1 Full factorial
4 13 1 1 -1 Full factorial
5 7 -1 -1 1 Full factorial
6 14 1 -1 1 Full factorial
7 6 -1 1 1 Full factorial
8 15 1 1 1 Full factorial
9 4 -2 0 0 Axial
10 16 2 0 0 Axial
11 3 0 -2 0 Axial
12 1 0 2 0 Axial
13 10 0 0 -2 Axial
14 12 0 0 2 Axial
15 9 0 0 0 Center
16 18 0 0 0 Center
17 20 0 0 0 Center
18 17 0 0 0 Center
19 8 0 0 0 Center
20 2 0 0 0 Center
Chapter 4 Biodegradation of profenofos
72
Figure 3.10 The parity plot of PFF degradation (%)
Chapter 4 Biodegradation of profenofos
73
Table 3.7: The CCD matrix showing actual values (%) along with the experimental
values of PFF degradation
Standard no. Variables in un-coded levels Response (PFF degradation %)
X1(pH) X2 (Incubation temperature) X3 (Inoculum size) Actual Predicted
1 6.0 30 0.2 56.00 54.00
2 8.5 30 0.2 68.00 69.00
3 6.0 40 0.2 38.00 38.84
4 8.5 40 0.2 68.00 68.66
5 6.0 30 0.6 85.00 87.52
6 8.5 30 0.6 73.10 74.57
7 6.0 40 0.6 75.00 78.63
8 8.5 40 0.6 74.24 81.13
9 5.15 37 0.4 63.00 61.46
10 9.43 37 0.4 85.00 80.84
11 7.0 26 0.4 75.12 73.61
12 7.0 43 0.4 69.21 65.64
13 7.0 37 0.06 45.00 45.98
14 7.0 37 0.74 93.00 86.32
15 7.0 37 0.4 87.60 87.80
16 7.0 37 0.4 88.34 87.80
17 7.0 37 0.4 87.70 87.80
18 7.0 37 0.4 88.10 87.80
19 7.0 37 0.4 87.90 87.80
20 7.0 37 0.4 86.80 87.80
Chapter 4 Biodegradation of profenofos
74
Table 3.8: Analysis of Variance (ANOVA) for the response (% degradation of PFF)
Source Degree of freedom F-value p-value
Prob>F
Model 9 31.25 < 0.0001*
X1 1 15.42 0.0028*
X2 1 5.19 0.0459*
X3 1 31.93 <0.0001*
X1X2 1 8.43 0.0157*
X1X3 1 24.74 0.0006*
X2X3 1 1.78 0.2122
X1X1 1 32.18 0.0002*
X2X2 1 40.15 <0.0001*
X3X3 1 10.30 <0.0001*
Residual 10
Lack of fit 5 105.59 <0.0001*
*Significant (p<0.05)
Adjusted R square = 0.9657
Predicted R square= 0.8578
Adeqate precision= 17.813
Chapter 4 Biodegradation of profenofos
75
1.22.7 Response surface plots for PFF degradation
To better understand the relationship between the response (% degradation of
PFF) and the experimental variables (X1, X2 & X3) two dimensional surface plots were
analyzed. Figure 3.11 indicates that at optimum inoculum size, an increase in temperature
with pH up to an optimum point resulted in the increased % PFF degradation. However,
the trend is reversed with further increase in pH and temperature.
Figure 3.12 indicates the maximum % degradation of PFF at high inoculum size
and an optimum pH value. Hence effect of inoculum size was dependent on pH value. A
similar trend was observed by the inoculum size and temperature interaction (Figure
3.13). Hence effect of inoculum size increase on % degradation of PFF was dependent on
pH and temperature.
The predicted optimized % degradation of PFF was found to be 93.39% (~ 94%)
based on software at optimized values of variables i.e. pH 6.83, temperature 34.59°C (~
35°C) and inoculum size 0.59 g/l. Experiments were performed with the optimized values
deduced by software (Figure 3.14) to confirm the validity of the applied model and hence
94% degradation was obtained. This value is very close to the predicted % PFF
degradation (93.39%~94%) indicating the adequacy of the obtained model for PFF
degradation.
Chapter 4 Biodegradation of profenofos
76
Figure 3.11 Contour plot (A) and Response surface plot (B) for profenofos
degradation (%) as a result of interaction of pH and temperature at constant
inoculum size (0.59 g/l) and 100 mg/l initial concentration of PFF.
Chapter 4 Biodegradation of profenofos
77
Figure 3.12 Contour plot (A) and response surface plot (B) for profenofos
degradation (%) as a result of interaction of pH and inoculum size at constant
temperature (35°C) and 100 mg/l initial concentration of PFF.
Chapter 4 Biodegradation of profenofos
78
Figure 3.13 Contour plot (A) and response surface plot (B) for profenofos
degradation (%) as a result of interaction of temperature and inoculum size at
constant pH (6.83) and 100 mg/l initial concentration of PFF.
Chapter 4 Biodegradation of profenofos
79
Figure 3.14 Optimization ramp for profenofos degradation
Chapter 4 Biodegradation of profenofos
80
1.22.8 Soil microcosm studies of PFF degradation
1.22.8.1 Optimization of soil moisture contents for PFF degradation
Biodegradation of PFF was found to be influenced significantly (P<0.05) by the
soil moisture contents. Data indicated that with increasing from 20 to 40% of soil
moisture contents (MC), PFF degradation increased from 20% to 31% of the added PFF
(50 mg/kg) after 10 days of experiment (Figure 3.15). After 40 days of experiment, the
56.5% and 92% PFF was degraded at 20% and 40% MC. However, increasing the MC to
45%, further increased PFF degradation and all of the added PFF was degraded by the
end of experiment. Further increase in soil moisture resulted in the retardation of PFF
degradation process as it is obvious from the data at 60% MWHC where only 48%
degradation was achieved after 40 days of experiment.
Effect of soil moisture contents on BCP accumulation (as a result of PFF
degradation by the consortium PBAC) and subsequent degradation was also monitored
and data showed that accumulation of BCP was increased in soils with 20 and 60% MCs
compared to that in the soil with 40 and 45% MWHC. Hence 45 % MC of soil was taken
as optimum for PFF and BCP degradation in soil by the PBAC. Further soil experiments
were performed at 45% soil MC.
1.22.8.2 Optimization of inoculum density for PFF degradation in sterilized soil
Soil was sterilized to clearly identify the efficiency of bacterial strains of the
PBAC in soil and optimize its inoculums size for the efficient PFF degradation. Data
showed that after 10 days of experiment, 37% of added PFF was degraded in soil
containing 1.6×108 CFU/g soil which completely disappeared by the 40 days of
experiment. Soils containing 1.6×105
, 1.6×10
6 and 1.6×10
7 CFU/g soil showed a slower
rate of PFF disappearance compared to that at 1.6×108. However, extending the
incubation period might lead to the complete degradation even at lower inoculums sizes.
BCP accumulation and degradation was also dependent on inoculum size and
minimum accumulation and maximum degradation of BCP was found at highest
inoculum density compared to that at lower ones (Figure 3.16). It was observed that
accumulation of BCP was increased to 5, 9, 10 and 8 mg/kg at 1.6×105
, 1.6×10
6 and
1.6×107 and 1.6×10
8 CFU/g respectively after 10 days of incubation. By the end of
Chapter 4 Biodegradation of profenofos
81
experiment, no BCP was observed in the soil samples at 1.6×108
CFU/g soil inoculum
size. However at lower inoculums sizes, BCP tended to accumulate with slow rate of
degradation in the soil until the end of experiment which might be attributed to the fact
that lower inoculum size does not produce sufficient enzymatic activity to degrade the
PFF metabolite.
Chapter 4 Biodegradation of profenofos
82
Figure 3.15 Degradation (%) of profenofos by bacterial consortium PBAC in the
sterilized soil at different moisture contents (MC) of soil; 20% (), 40% (),
45% () and 60% (), un-inoculated controls at 20% (), 40% (), 45 () and
60% () Solid lines indicate % profenofos degradation and dashed lines with
same marker indicate BCP accumulation and degradation at respective moisture
levels. Values are the means of three replicates and error bars represent the
standard error.
Chapter 4 Biodegradation of profenofos
83
Figure 3.16 Degradation (%) of profenofos by bacterial consortium PBAC in the
sterilized soil at different inoculums densities: 1.6105 (), 1.610
6 (),
1.6107
(), 1.6108
() and un-inoculated control ().
Solid lines indicate
PFF degradation (%) and dashed lines with same marker indicate BCP
accumulation and subsequent degradation (mg/kg) at respective inoculum
densities. Values are the means of three replicates and error bars represent the
standard error.
Chapter 4 Biodegradation of profenofos
84
1.22.9 Identification of profenofos metabolites
Time course analysis of the PFF degradation was carried out to get a clear idea of
production and subsequent degradation PFF metabolites using GC-MS as mentioned in
Materials and Methods.
Different metabolites were observed based on different retention times (RT) in
samples harvested at different time intervals. The sample at zero time showed a peak at
17.79 min as the major peak (peak 1) corresponding to PFF (Figure 3.17). Mass spectrum
of this peak was identical to that of authentic PFF standard showing molecular ion peak
with m/z 373 (Figure 3.18). Peak 1 was found to reduce in abundance in the
chromatograms of sample extracts obtained after 24 h and some new peaks (2,3,4,5 and
6) appeared at 10.37, 9.58, 8.25, 13.02 and 16.83 minutes respectively (Figure 3.19). All
of these peaks started decreasing in abundance as found in the TIC of samples harvested
after 72 h (Figure 3.20). Interestingly, in the TIC of samples obtained after 96 h (Figure
3.21), peak 2 again rose up compared to that in the previous TIC. Furthermore, two new
peaks appeared (7 and 8) at 7.63 and 16.99 min
Metabolites of PFF were identified on the basis of mass spectrum analysis. The
peaks 2 and 3 with m/z 208 and 183 appeared in the form of trimethylsilyl (TMS)
derivatives with m/z 280 and 241 respectively (Figure 3.22-3.23). These were identified
as 4-bromo-2-chlorophenol (BCP) and O- ethyl-S-propyl-O-hydrogen phosphorothioate
(EPHP). Peak 7 observed in the TIC of samples obtained after 96 h was identified to be
ethylene glycol with m/z 62 that was present in the form of TMS derivative with m/z 208
(Figure 3.24). Other peaks (4, 5, and 8) corresponded to some unknown metabolites. Peak
6 corresponding to m/z 356 was identified to be 4-bromo-2-chlorophenyl ethyl propyl
phosphate (BCPEPP) (Figure 3.25). The BCPEPP indicates the replacement of sulphur
by oxygen forming profenofos oxon. The formation of 4-bromo-2-cholorophenol
(molecular weight 208) proves the breaking of ester bond linkage of the parent compound
by the bacterium. Further disappearance of hydrolysis products in the subsequent samples
indicates their degradation to smaller products. Hence the bacterial consortium PBAC is
efficient enough to degrade profenofos and its metabolites. Based on these observations a
degradation pathway of PFF was predicted (Figure 3.26). Table 3.9 presents the summary
of identified metabolites and their detail.
Chapter 4 Biodegradation of profenofos
85
Table 3.9: Different metabolites of profenofos and their detail
Name Adduct
m/z
Retention
time (RT
min)
m/z of original
compound
4-bromo-2-chlorophenol (BCP) 280 10.35 208
O-ethyl-S-propyl-hydrogen
phosphate 256 9.58 183
Ethylene glycol 208 7.63 62
4-bromo-2-chlorophenyl ethyl
propyl phosphate (BCPEPP) - 16.83 356
Chapter 4 Biodegradation of profenofos
86
At zero time
Figure 3.17 Total ion chromatogram (TIC) of the extract of the spent culture
medium containing profenofos at zero time showing the only peak corresponding
to profenofos at 17.79 min as the most abundant or major peak. No metabolite
peaks were found in this TIC.
Retention Time
Chapter 4 Biodegradation of profenofos
87
Profenofos
Figure 3.18 Mass spectrum of profenofos
Br
Cl
OP
S
OO
Chapter 4 Biodegradation of profenofos
88
After 24 h
Figure 3.19 Total ion chromatogram (TIC) of the extract of the spent culture
medium containing profenofos harvested after 24 h. Peak 1 is reduced in
abundance while new peaks 2, 3, 4 5 and 6 appeared at different retention times.
Retention Time
Chapter 4 Biodegradation of profenofos
89
After 72 h
Figure 3.20 Total ion chromatogram (TIC) of the extract of the spent culture
medium containing profenofos harvested after 72 h. Peak 1 is reduced further
compared to that in previous TIC. Peaks 2, 3, 4 and 6 decreased in abundance
while peak 5 disappeared.
Retention Time
Chapter 4 Biodegradation of profenofos
90
After 96 h
Figure 3.21 Total ion chromatogram (TIC) of the extract of the spent culture
medium containing PFF harvested after 96 h. Abundance of peak 1 is reduced
very much, of peak 2 increased compared to previous TICs. Other peaks
disappeared with the appearance of two new peaks 7 and 8 which were not found
in previous TICs.
Retention Time
Chapter 4 Biodegradation of profenofos
91
4-bromo-2-chlorophenol
Figure 3.22 Mass spectrum of 4-bromo-2-chlorophenol (BCP), the major
hydrolysis product of profenofos, formed in the culture medium after 1
day of incubation.
OH
Cl
Br
Chapter 4 Biodegradation of profenofos
92
O- ethyl-S-propyl-O-hydrogen phosphorothioate (EPHP)
Figure 3.23 Mass spectrum of O- ethyl-S-propyl-O-hydrogen
phosphorothioate (EPHP), the second hydrolysis products of profenofos,
formed in the culture medium after 1 day of incubation.
P
OO•
OS
Chapter 4 Biodegradation of profenofos
93
Ethylene glycol
Figure 3.24 Mass spectrum of ethylene glycol, a proposed ring cleavage
product of BCP, formed in the culture medium after 3 days of incubation.
Chapter 4 Biodegradation of profenofos
94
4-bromo-2-chlorophenyl ethyl propyl phosphate (BCPEPP)
Figure 3.25 Mass spectrum of 4-bromo-2-chlorophenyl ethyl propyl
phosphate (BCPEPP)
Chapter 4 Biodegradation of profenofos
95
Figure 3.26 Proposed biodegradation pathway of profenofos by the bacterial consortium
PBAC: 1) Profenofos is hydrolyzed to EPHP and a halogenated metabolite, 4-bromo-2-
chloropheno (BCP); 2) Debromination of BCP; 3) Hydroxyl radical attack on 2-
chlorophenol to produce hydroquinone; 4) Conversion of hydroquinone to benzoquinone;
5) Ring cleavage of quinone and (proposed) formation of ethylene glycol (OTMS); 6)
Production of ethylene glycol
Chapter 4 Biodegradation of profenofos
96
1.22.10Detection of OP degrading genes in PFF degrading bacterial strains (PF1-
PF4)
PCR was carried out with opd, opdA, mpd and oxygenase primers (Table 2.3 &
2.4). Chapter 2, Section 2.15, Potentially opdA gene was amplified from genomic DNA
of the profenofos degrading bacterial isolates by using primers described in Sharaf et al.,
(2006) (Chapter 2, Table 2.3). PCR product of expected size i.e. 1155 bp was obtained
which was confirmed by agrarose gel electrophoresis (Figure 3.27). The variants of opdA
in different bacteria encode enzyme (organophosphate hydrolase, OPH) capable of
hydrolyzing a variety of organophosphate pesticides.
Although potential opdA with expected product sizes were obtained, further quest
into the opdA gene sequence analysis revealed no definitive success because the
sequences of the potential opdA genes (amplified in this study) did not match any of the
previously known hydrolase gene sequences reported in the GenBank.
Figure 3.27 Amplification of opdA gene potentially encoding an OP hydrolase
(OPAA) in PFF degrading bacterial strains PF1, PF2, PF3 & PF4 (Lanes 3, 4, 5 and
6 respectively). M indicates 1 Kb marker.
Chapter 4 Biodegradation of profenofos
97
1.22.11Biodegradation of other pesticides by the bacterial consortium PBAC
Degradation capability of the PBAC was studied by inoculating the consortium
PBAC in minimal media containing different pesticide substrates as sole source of carbon.
Medium containing PFF served as a positive control for biodegradation activity of PBAC
and PFF was degraded completely within 3 days. All other pesticides were detected at their
respective detection wavelength (λmax) that were found to be 275 nm, 290 nm, 245 nm, 280
nm, 254 nm, 270 nm and 254 nm for profenofos, chlorpyrifos, triazophos, methyl
parathion, diazinon, imidacloprid and cypermethrin respectively.
Among all substrates (other than PFF), significantly higher degradation (69.3%) of
cypermethrin was observed and lowest degradation was observed for imidacloprid.
Interestingly, similar extent of degradation of all organophosphates tested (other than PFF)
was observed. Chlorpyrifos, methyl parathion, triazophos and diazinon were degraded to
55, 59, 57.3 and 57.7% within 3 days of incubation (Figure 3.28). Hence the PFF
degrading PBAC had a broad spectrum of degradation. This is the first report describing
the biodegradation affinity of PFF degrading microorganisms for diverse class of
chemicals.
Chapter 4 Biodegradation of profenofos
98
PFF= Profenofos CP= Chlorpyrifos IMD= Imidacloprid
CYP= Cypermethrin TR= Trizophos M.P=Methyl parathion
Dia= Diazinon
C = indicates un-inoculated control for the respective pesticide
Figure 3.28 Degradation of PFF and other pesticides (50 mg/l) as a sole source of
carbon by PBAC (after 3 days of incubation). Data are the means of three
replicates and error bars show the standard error. Values with different letters are
significantly different statistically (p<0.05, Tukey’s test).
Chapter 4 Biodegradation of profenofos
99
1.23 Discussion
In the present study, complete degradation of PFF and its hydrolysis metabolite,
BCP by a bacterial consortium was observed. In contrast, individual strains viz.
Achromobacter xylosoxidan, Pseudomonas aeruginosa, Bacillus sp. and Citrobacter
koseri degraded PFF and BCP inefficiently and the extent of degradation was
significantly lower compared to that by the PBAC. Effectiveness of bacterial consortium
has been attributed to the combined and collaborative activity of all the bacterial isolates
that constitute a consortium and help one another to withstand the stressed conditions
produced due to the generation of toxic pollutant metabolites (Nestler, 2001). Our
findings are in line with the above statement as bacterial consortium displayed the
complete degradation of PFF and its toxic metabolite, BCP. However, within the same
incubation period, incomplete degradation of PFF was obtained by pure isolates.
Moreover, capability of PFF degrading consortium to degrade high concentration
of PFF (200 mg/l) and its toxic metabolite, BCP might be regarded as the result of the
synergistic effect of different bacterial members of the PBAC. Malghani et al., (2009b)
reported PFF degradation by a pure P. aeruginosa at lower PFF concentration. Similar
enhanced and effective degradation of many recalcitrant pollutants has been reported by
the pesticide-degrading bacterial consortia enriched from various crop soils (Sørensen et
al., 2002, 2008). Some reports of bacterial consortia include those degrading 4-
nitrophenol (Laha and Petrova, 1998), endosulfan (Awasthi et al., 2000), chlorpyrifos
(Lakshmi et al., 2009) and methyl parathion & chlorpyrifos simultaneously (Pino and
Penuela, 2011).
The bacterial consortium PBAC was found to embrace the bacterial strains which
belong to metabolically active and diverse genera such as Bacillus and Pseudomonas are
known to be metabolically very active genera capable of degrading a variety of
organophosphates including the diazinon, chlorpyrifos, methyl parathion and other
chemicals (Ghassempour et al., 2002; Lakshami et al., 2008; Anwar et al., 2009).
Literature survey reveals that no report is available for the PFF degradation by
Achromobacter xylosoxidans and Citrobacter koseri yet both are important candidates for
the biodegradation of many other compounds. A. xylosoxidans has been reported to
degrade nitro compounds such as p. nitrophenol (Wan et al., 2007) and organochlorines
Chapter 4 Biodegradation of profenofos
100
(Singh and Singh, 2011). C. koseri is a facultative anaerobe and belongs to
Enterobacteriaceae which is a large family consisting of gram negative harmless
symbiotic as well as many human pathogenic bacteria. Interestingly, most of them have
been helpful in biodegradation of OP and other pollutants (Singh et al., 2004; Cycon et
al., 2013; Ghanem et al., 2007).
Previous studies showed inoculum size, temperature and pH to be significant
factors, affecting biodegradation of pollutants (Awasthi, 2000; Diez, 2010; Wolski et al.,
2005). This may be due to the environmental stresses such as high concentrations of the
pollutant, variations in pH and temperature which may be responsible for retarding or
enhancing the growth of the degrading bacteria. Temperature has been reported as an
important factor to affect the degradation of hazardous chemical compounds (Zhao et al.,
2008). Therefore, in the present study such parameters were optimized for the
degradation of PFF and regarding the effect of pesticide concentration,
In contrast to the conventional “single factor at a time experiments”, we report the
interaction and simultaneous effect of various factors; pH, temperature and initial
inoculum size on PFF degradation following RSM which greatly reduced the time,
explained the effect of different factors in a more pronounced way as well as described
the interactive effect of different variables on PFF degradation. The PFF degrading
consortium was capable of degrading PFF at all the tested pH, temperature and inoculums
sizes which can be attributed to the combined activities of the bacterial strains in the
consortium. However, RSM model helped to get maximum degradation at a set of
optimized range of conditions.
Increasing the inoculums size, no doubt, increased the degradation of PFF but this
effect was in turn dependent of pH and temperature. At optimum pH and temperature,
high population of degrading bacteria can degrade the pollutant more quickly and
efficiently. Effect of temperature and pH on PFF degradation is evident from Ali and
Badawy, 1982 who demonstrated remarkable effect of temperature of on PFF
degradation. Contrary to Malghani et al., (2009b) who described that lower pH was more
supportive for PFF degradation than the higher pH; our study revealed that PBAC was
capable of exhibiting higher PFF degradation at higher pH. It might be possible that some
Chapter 4 Biodegradation of profenofos
101
key enzymes of the current bacterial strains involved in PFF degradation would be active
at neutral to high pH.
The current study was also extended to optimize PFF degradation in soil. For such
studies bioaugmentation of selected species of microorganism has proved an excellent
approach (Gentry et al., 2004). Successful remediation of pesticide contaminated soils by
the use of bacteria has been reported extensively for parathion (Barles et al., 1979),
ethoprophos (Karpouzas et al., 2005) and chlorpyrifos (Lakshami et al., 2008). The
optimization of bioremediation processes in soil depends on many factors such as the soil
properties (moisture contents, soil pH) and the survival and population of the degrading
cultures. Optimum soil moisture plays important role in the remediation or removal of the
pollutants from the soil (Johnson et al., 1998).
In a soil remediation system, inoculum size plays a key role for degrading the
organic pollutants (Labana et al., 2005). High initial density of bacteria could compensate
for the initial population decline, degrade the toxic pollutant and multiply (Comeau et al.,
1993). The present study was consistent with the previous findings in that longer lag
phase was observed at low initial inoculum densities as compared to that at higher
inoculum densities. These results signify the importance of optimizing the inoculums
density while studying pollutant degradation.
Previous studies regarding the PFF degradation described the formation of BCP
through ester bond breakage but no further metabolites were investigated. In this study an
attempt was made to predict the biodegradation pathway of PFF. Being in line with
previous studies, hydrolysis was found to be the first step in degradation of PFF
producing 4-bromo-2-chlorophenol (BCP) and O- ethyl-S-propyl-O-hydrogen
phosphorothioate (EPHP). However, our study provided the insights into the further
degradation of BCP accompanied by ring cleavage. Identification of ethylene glycol
helped to predict a pathway for PFF degradation. BCP was predicted to undergo
debromination followed by the hydroxyl radical attack which resulted in various oxidized
products (catechol, quinones). Ethylene glycol was assumed to be produced through ring
cleavage of quinone (Hong et al., 2003). The quinone is not phenolic hence TMS
derivative was not possible. Therefore being unstable, quinone was not detected
throughout the course of experiment. However, we strongly assume the generation of
Chapter 4 Biodegradation of profenofos
102
ethylene glycol through further cleavage of the quinone in this study. This is the first
report of biodegradation of BCP by profenofos degrading bacteria and predicted
biodegradation pathway of profenfos. These results put forward the candidacy of PFF
degrading consortium for remediation of PFF contaminated sites. However, the full
degradation pathway and mineralization of intermediates require further investigation.
The PFF degrading bacterial consortium proved a good candidate for
biodegradation of other organophosphate pesticides and pyrethroids as it efficiently
degraded cypermethrin and other tested OP pesticides (diazinon, methyl parathion,
imidacloprid) This aspect reveals the diverse metabolic and enzymatic activities of the
bacterial strains comprising the consortium which help in inducing each other’ s enzyme
systems for utilizing different pollutants and hence allow the consortium to quickly adapt
to pesticide contaminated environments. Therefore, we conclude that the isolated
bacterial consortium can potentially be used for the bioremediation of not only
organophosphate pesticides but also pyrethroid contaminated sites.
Potentially, organophosphate degrading gene, opdA was amplified in the PFF
degrading bacterial strains. This gene encodes organophosphate hydrolase which
hydrolyzes many OP pesticides. There are many reports that emphasize the involvement
of opdA gene in OP degrading organisms (Horne et al., 2002; Sharaf et al., 2006).
However, no report is yet available for the existence of opdA in PFF degrading bacteria.
In the present study, we hypothesized that potentially, opdA like gene could be involved
in the hydrolysis of PFF to 4-bromo-2-chlorophenol (BCP) and O- ethyl-S-propyl-O-
hydrogen phosphorothioate (EPHP). However, the sequence of the amplicon regarded as
probable “opdA gene” did not match with any of the reported OP degrading genes in the
GenBank. This aspect of the study needs further research and analysis to identify the
gene(s)/enzymes involved in the hydrolysis of PFF.
Chapter 4 Biodegradation of chlorpyrifos
103
Chapter 4
Isolation, characterization and degradation potential of chlorpyrifos
degrading bacterial strains
4.1 Introduction
Chlorpyrifos [O, O diethyl- O (3, 5, 6 trichloro-2-pyridyl phosphorothioate)]
(CP), is one of the widely used, toxic and broad spectrum organophosphate (OP)
insecticides. Chemical structure is shown in Figure 4.1. It is an important ingredient of
various household formulations which are effective against termites, bees, flies and
mosquitoes (Bicker et al., 2005; Mohan et al., 2007). Chorpyrifos is also used extensively
against agricultural insect pests of a variety of vital crops such as cotton, cereals,
vegetables since many years (Fang et al., 2006; Wang et al., 2007). Although, many OP’s
including CP were initially regarded as less persistent and toxic, there is escalating
concern that these pesticides or there metabolites are highly persistent in the environment
as well as toxic and hence lead to undesirable health issues (Ragnarsdottir 2000; Alavanja
et al., 2013).
Figure 4.1 Chemical structure of chlorpyrifos
A consequence of continuous domestic and agricultural use of CP is widespread
contamination of environment leading to serious damage to non-target organisms and
ecosystems (Rovedatti et al., 2001; Anderson and Hunta, 2003; Vogel et al., 2008; Farag
et al., 2010). In the environment, CP is converted to TCP, a persistent metabolite which is
resistant to biotic and abiotic degradation owing to the presence of three chloride residues
on the N-aromatic ring (Racke et al., 1996; Robertson et al., 1998; Singh et al., 2003;
Chapter 4 Biodegradation of chlorpyrifos
104
Chishti and Arshad, 2013). Moreover, TCP has higher water solubility as compared to the
parent compound; hence it leaches to the water bodies causing widespread contamination
of aquatic environments (Xu et al., 2008; Grzelak et al., 2012; Watts, 2012). CP and TCP
toxicity has been linked to broad-spectrum effects including neurological disorders,
developmental disorders, autoimmune disorders and interruption of many vital functions
in higher animals and humans (Sogorb et al., 2004; Mehta et al., 2008; Alavanja and
Bonner, 2012; Ventura et al., 2012; Estevan et al., 2013). However, TCP contributes
more than CP to pollute the environment due to its antimicrobial nature and hence
leaches to and persists in the water bodies (Vogel et al., 2008; Xu et al., 2008).
All these concerns imply that elimination of both CP and TCP from the
environment to alleviate their hazardous effects is imperative. Conventionally, many
approaches, including chemical treatment, photodecomposition and incineration can be
applied for the remediation of contaminants (Olexsey and Parker, 2006), however, most
of them are expensive, environmental unfriendly and not applicable for contamination at
low concentration. Bioremediation approaches which mainly involve microorganisms or
plants with the right metabolic pathways seem to be the most feasible technology for
remediation of CP, TCP and related contaminants (Thengodkar and Sivakami, 2010).
Contrary to the earlier findings that TCP, being highly toxic, inhibits the
proliferation of CP degrading microorganisms in soil (Racke et al., 1990), many bacterial
strains capable of degrading CP and TCP as a sole source of carbon and energy have been
isolated and characterized during recent years (Feng et al., 1997; Lu et al., 2013). Most of
them can utilize CP co-metabolically. A review of CP and TCP biodegradation studies
has been presented by Maya et al., (2011). A modified and updated review of CP and
TCP degrading microorganisms during last decade has been given in Table 4.1. Recently
reported CP and TCP degrading bacterial strains include Bacillus cereus (Liu et al.,
2012), a Stenotrophomonas maltophilia strain MHF ENV20 (Dubey and Fulekar, 2012)
and Cupriavidus sp. DT-1 (Lu et al., 2013).
It has also been generally recognized that microbial degradation of CP may be
affected by many biotic and abiotic factors such as tolerance to initial pesticide
concentration, microbial population, optimum growth temperatures and optimum pH. It
has been well established that tolerance to these environmental factors vary from one
Chapter 4 Biodegradation of chlorpyrifos
105
microorganism to another (Karpouzas and Walker, 2000; Sharma, 2012; Singh et al.,
2003; Chishti et al., 2013). Either biotic or abiotic, degradation of CP in the environment
results in the production of TCP and diethyl thiophosphoric acid (DETP) (Racke et al.,
1996; Robertson et al., 1998; Singh et al., 2003 Chishti et al., 2013). Recently, more
attention has been given to metabolism of CP indicating TCP degradation and few de-
chlorination products of TCP have been reported by researchers few years back.
Complete metabolism of CP and its metabolites has not yet been reported.
In the present study, Mesorhizobium sp. HN3 a novel CP degrading bacterial
strain also capable of degrading TCP under different culture conditions was isolated and
characterized. The kinetics of CP biodegradation including accumulation and utilization
of TCP and the governing constants thereafter were also determined, as these parameters
vary depending upon bacterial strains and concentration/nature of pollutants, a clear
understanding of the biodegradation kinetics of CP and TCP is prerequisite for in situ
bioremediation. Moreover, degradation products of CP and TCP were also identified.
Chapter 4 Biodegradation of chlorpyrifos
106
Table 4.1: Previously reported chlorpyrifos and TCP degrading bacteria
No.of
reports
Chlorpyrifos degrading
bacteria
Degradation efficiency (%) of CP
& TCP References
1. Enterobacter strain B-14 100% of 250 mg/l CP in 2 days Singh et al., 2004
2. Alcaligenes faecalis DSP3 i)100% of 100 mg/l CP in 10 days
ii) 100% of 100 mg/l TCP in 10
days
Yang et al., 2005
3. Agrobacterium tumefaciens
ASM-5 50% of 100 mg/l CP in 14 days
Sharaf et al.,
2006
4. Stenotrophomonas sp. YC-1 100% of 100 mg/l CP in 24 h Yang et al., 2006
5. Sphingomonas sp. i) 100% of 100 mg/l CP in 24 h
ii).100% of 20 mg/l TCP in 2 days Li et al., 2007
6. Pseudomonas fluorescens,
Brucella melitensis, Bacillus
subtilis, Bacillus cereus,
Klebsiella species, Serratia
marcescens and Pseudomonas
aeruginosa
i) 75–87% of 50 mg/l CP in 20 days
by Pseudomonas aeruginosa
ii) 67% of 2.5 mg/l TCP in 12 h
only by Pseudomonas aeruginosa
Lakshami et al.,
2008
7. Sphingomonassp.Dsp-2
Stenotrophomonas sp Dsp-4,
Brevimundus sp.Dsp-7
Bacillus sp Dsp-6
100% of 100 mg/l CP in 24 h
Li et al., 2008
8. Paracoccus sp. TRP i) 100% of 50 mg/l CP in 4 days
ii) 100% of 50 mg/l TCP in 4 days Xu et al., 2008
9. Bacillus firmus 50% of 25 mg/l CP in 20 h Sabdono, 2008
10. Pseudomonas aeruginosa 52% of 50-75 mg/l CP Fulekar and
Geetha, 2008
11. Bacillus pumilus C2A1 i) 89% of 1000 mg/l CP in 15 days
ii) 100 % of 300 mg/l TCP in 8
days
Anwar et al.,
2009
12. Pseudomonas sp. 84% of 10 mg/l CP in 120 h Singh et al., 2009
13. Leuconostoc mesenteroides
WCP907, Lactobacillus
brevis WCP902,
Lactobacillus plantarum
WCP931, and Lactobacillus
sakei WCP904.
100% of 30 mg/l CP after 8 days
Cho et al., 2009
14. Bacillus licheniformis ZHU-1 99% of 100 mg/l CP in 10 days Zhu et al., 2010
Chapter 4 Biodegradation of chlorpyrifos
107
Continued from previous page
Table 4.1: Previously reported chlorpyrifos and TCP degrading bacteria
15. Four Pseudomonas spp. Two
Agrobacterium spp. One
Bacillus sp.
i) 76-84% of 100 mg/l CP in 10days
by four Pseudomonas spp.
ii) 87.5-90% of 90 mg/l in 10 days 10
days by Pseudomonas spp.
iii) 62.7 & 64% of 75 mg/l CP in 10
days by two Agrobacterium spp
iv) 76.8 and 77.5% of 60 mg/l TCP
by Agrobacterium spp
v) 52% of 50 mg/l CP by Bacillus sp.
vi) 79.5% of 45 mg/l TCP by
Bacillus sp.
Maya et al.,
2011
16. Acinetobacter sp,
Pseudomonas
putida, Bacillus sp,
Pseudomonas aeruginosa,
Citrobacter freundii,
Stenotrophomonas sp,
Flavobacterium sp,
Proteus vulgaris,
Pseudomonas sp,
Acinetobacter sp, Klebsiella
sp and Proteus sp.
i) 39% of 150 mg/l CP after 5 days
ii) 100% of 150 mg/l CP after 5 days
in the presence of glucose
Pino and
Peñuela, 2011
17. Stenotrophomonas
maltophilia MHF ENV20
100% of 50 mg/l CP in 2 days Dubey and
Fulekar, 2012
18. Bacillus cereus 78.85% of <150 mg/l CP in 5 days Liu et al., 2012
19. Streptomyces sp. AC5 and
Streptomyces sp. AC7 90% of 25 and 50 mg/l CP after 24 h
Briceno et al.,
2012
20. Pseudomonas putida NII
1117,
Klebsiella sp NII 1118,
Pseudomonas stutzeri NII
1119,
Pseudomonas aeruginosa NII
1120
70.84% of 500 mg/l of CP by
consortium after 30 days in soil
Sasikala et al.,
2012
21. Cupriavidus sp. DT-1 i) 100% of 100 mg/l CP in 6 h
ii) 100% of 100 mg/l TCP in 6 h Lu et al., 2013
22. Cupriavidus pauculus P2 100% of 100 mg/l TCP in 10 h Cao et al., 2012
23.
24. Alcaligenes sp JAS1.
300 mg/l of CP in 12 h
Silambarasan
and Abraham,
2013
Chapter 4 Biodegradation of chlorpyrifos
108
4.2 Materials and methods
4.2.1 Enrichment and isolation of CP degrading bacterial strains
Three different agricultural soil samples were collected from fields with previous
history of OP (including CP) applications. Chlorpyrifos degrading bacteria were isolated
by enrichment culture technique following Anwar et al., (2009) as described in Chapter
2, Section 2.6-2.7.
Once all the isolates were purified by repetitive sub culturing, their growth and
CP degradation potential was monitored on MSM agar plates containing CP (100 mg/l)
as the only source of carbon and energy and incubated at 37°C until growth appeared.
Growth and CP degradation potential of the isolates were also observed in liquid
cultures (MSM) supplemented with 100 mg/l CP as the only source of carbon and energy.
Degradation potential of all the isolates was determined and compared by quantifying the
residual concentration of chlorpyrifos using HPLC. On the basis of degradation
capability, a bacterial isolate named as HN3 was selected for further CP degradation
studies.
4.2.2 Identification and characterization of selected strain HN3
Total genomic DNA of the isolate HN3 was extracted. Molecular identification
was carried out by 16S rRNA gene analysis and evolutionary relationships of the isolate
were studied as described in Chapter 2 Section 2.8. The 16S rRNA gene sequence of the
isolate was submitted in GenBank.
Biochemical and morphological characterization were carried out as described in
Chapter 2 Section 2.9. Moreover, morphology was also studied using Scanning Electron
Microscopy (SEM).
4.2.3 Experimental set up for CP degradation studies
Inoculum of strain HN3 was prepared and biodegradation experiments were
performed as described in Chapter 2 Section 2.10-2.11. Chlorpyrifos degradation studies
were carried out in 250 ml Erlenmeyer flasks containing 50 ml MSM supplemented with
2% HN3 inoculum and 100 mg/l CP under various culture conditions as described in
respective Sections. The flasks were incubated at 37°C and 100 rpm in rotary shaker
Chapter 4 Biodegradation of chlorpyrifos
109
unless otherwise mentioned. For all the treatments, un-inoculated flasks served as
controls and all the experiments were performed in triplicates. Samples of the liquid
medium were periodically removed for analyzing the growth rates and the residues of CP
and TCP.
4.2.4 Extraction and analysis of CP residues
Extraction and analysis of CP residues were carried out following the method
described in Chapter 2 Section 2.11.1-2.11.3. CP and TCP were detected at a wavelength
of 290 nm. Retention time for CP and TCP were 8 and 4.47 min respectively.
4.2.5 Turbidometric study to monitor the growth of the bacterial strain, HN3
A Turbidometric method as described in Jyothi et al., (2012) was employed for
monitoring the growth of the strain HN3 wherever required throughout the course of this
study. Increase in turbidity of the culture was due to the growth of the HN3 by utilizing
the pesticide (Maya et al., 2011). Cell dry mass was determined for the Mesorhizobium
culture having an OD600nm of 1.0 and was used as standard for calculating cell dry mass
for all the cultures (of HN3) of different optical densities.
4.2.6 Optimization of temperature and pH for biodegradation of CP by HN3
To optimize temperature for degradation of CP by strain HN3, culture flasks
containing MSM (pH 7.0) were incubated at 30, 37 and 40°C in rotary shaker at 100 rpm.
Degradation capacity of CP by Mesorhizobium sp. HN3 was also monitored at different
initial pH i.e. acidic (6.0), basic (8.0) and neutral (7.0). MSM with different pH
(maintaining buffered conditions) was prepared as described by Anwar et al., (2009),
supplemented with CP (100 mg/l), inoculated with HN3 and incubated at 37°C.
4.2.7 CP degradation in minimal and complex media
To explore the degrading potential of Mesorhizobium sp. HN3 at a range of initial
pesticide concentrations, MSM containing different initial concentrations of CP i.e., 10 to
300 mg/l as sole source of carbon and energy was used.
Chapter 4 Biodegradation of chlorpyrifos
110
To investigate if HN3 can utilize CP as a sole source of carbon and nitrogen, a
nitrogen free medium (Appendix 9) was prepared and used. The medium was
supplemented with 100 mg/l CP that served as a source of carbon and nitrogen.
To determine if Mesorhizobium sp. HN3 can degrade CP in the presence of easily
available carbon source, MSM was supplemented with CP (100 mg/l) and glucose (1 g/l).
4.2.8 Kinetics of CP degradation by HN3 at different initial concentrations of CP
Biodegradation of CP by strain HN3 was investigated at different initial
concentrations (50, 100, 200, 300 and 400 mg/l) and kinetic parameters were determined
as described by Pirt, (1975). Rates of pesticide degradation (Qs), metabolite production
(QP) and cell mass productivity (Qx) were determined by calculating the slope in their
respective plots versus time (h). Product yields (Yp/s) and cell mass yield (Yx/s) were
determined by dP/dS and dX/dS where dP, dS and dX are the changes in concentrations of
product, pesticide and the bacterial cell mass respectively per unit time. Specific growth
rate (), the growth of a bacterial cell per unit cell per unit time, was determined by
plotting the ln(X/X0) versus time, where X0 and X are the initial cell mass (g/l) and cell
mass (g/l) at time ‘t’ respectively (calculated during exponential phase at different time
intervals). Specific productivity (qp) and specific rate of CP degradation (qs) were
multiple of and Yp/x and Yx/s.
4.2.9 Biodegradation of TCP (primary metabolite of CP)
4.2.9.1 Biodegradation of TCP in minimal and complex media
MSM supplemented with different initial concentrations of TCP (25, 50, 100, 200
and 300 mg/l) was inoculated with Mesorhizobium sp. HN3 and incubated at 37°C and
100 rpm in rotary shaker. Degradation of TCP was also investigated in the presence of
easily available carbon source, by adding glucose (1 g/l) along with the TCP (100 mg/l)
in the culture medium.
4.2.9.2 Extraction and analysis of TCP residues
Extraction and analysis of TCP residues were performed as described in this
Chapter Section 4.2.4.
Chapter 4 Biodegradation of chlorpyrifos
111
4.2.9.3 Detection of chloride ions produced during CP and TCP degradation
To investigate the production of chloride ions as a result of CP and TCP
degradation, a chloride assay described by Cao et al., (2012) was used with some
modifications to determine the concentration of chloride ions released due to degradation
of CP and TCP. For this purpose, MSM was replaced by a chloride free medium
(Appendix 10). Two initial concentrations of CP and TCP in (independent experiments)
i.e., 100 and 200 mg/l were employed (in triplicates) to study accumulation of chloride
ions in the media.
Mesorhizobium was inoculated in chloride free medium containing 100 mg/l and
200 mg/l CP separately (in duplicates). Un-inoculated flasks served as controls. After
three days of incubation at 37oC and 100 rpm, samples from all replicates were harvested
and centrifuged. During each sampling, 20 ml culture was centrifuged at 12,000 rpm for
15 minutes and the supernatant was treated to estimate the chloride ions concentration in
the culture media. Similarly the chloride ion concentration was also determined for the
cultures containing 100 and 200 mg/l TCP.
Supernatant (10 ml) of each sample was taken in Erlenmeyer flasks. A 0.5 ml of
potassium dichromate (K2CrO4) was added to each sample and titrated with 0.0141 molar
solution of silver nitrate until a reddish brown color appeared. Chloride ion was
calculated according to the following formula:
C (mg/l) = 24.99225 (V1-V2)/V1*1000
Where C is the concentration of chloride ions, V1 and V2 represent the titration volume
of sample and of control respectively.
4.2.10 Soil microcosm studies of CP
Biodegradation of chlorpyrifos was studied in soil at different moisture levels and
inoculum densities as described in Section 2.12. Moreover, a comparison of CP
biodegradation was carried out in sterilized and unsterilized soil to test the efficacy of
Mesorhizobium sp. HN3.
Chapter 4 Biodegradation of chlorpyrifos
112
4.2.11 Identification of CP metabolites
Samples containing residues of CP and its metabolites, periodically obtained from
culture flasks were extracted with dichloromethane and derivatized with N, O-Bis-
(trimethylsilyl) -trifluoroacetamide (BSTFA, a derivatizing reagent for Gas
Chromatography) and analyzed by gas chromatography-mass spectrometry (GC-MS) as
described in Chapter 2 Section 2.13.
4.2.12 Study of potential genes encoding OP hydrolases/oxygenases
Amplification and analyses of opd, mpd, opdA encoding hydrolases and different
oxygenase genes encoding mono- or di-oxygenases in Mesorhizobium sp. HN3 were
carried out using primers mentioned in Tables 2.4 and 2.5 in Chapter 2, Section 2.14.
4.2.13 Data Analysis
Statistical analyses were performed on three replicates of data obtained from all
treatments. The significance of differences were treated statistically by one, two or three
way ANOVA and evaluated by post hoc comparison of means using Tukey’s test in
Statistica 6.0 software.
Kinetic model of CP degradation was determined by plotting log CP residues
against time. A straight line was obtained for all test concentrations of CP (50- 400 mg/l),
following first order kinetics model. Therefore, degradation rate constant (k, h-1
) and half-
life (T1/2) in days were determined using Eq. (2) and Eq. (3) as described in Chapter 3
Section 3.2.12.
Ct = C0e-kt
Eq. (2)
T1/2 = ln (2) / k Eq. (3)
4.3 Results
4.3.1 Isolation and selection of CP degrading bacterial strain
Following enriched culture technique sixteen bacterial isolates were obtained
initially. These isolates were streaked individually and purified on LB agar plates
containing 100 mg/l CP. Eight of the sixteen bacterial isolates were found to grow on
Chapter 4 Biodegradation of chlorpyrifos
113
MSM agar as well as in MSM broth containing 100 mg/l CP as a sole source of carbon
and energy (Figure 4.2). One isolate HN3, showing complete degradation of CP (100
mg/l) within 5 days of incubation was considered to be the most efficient. Chlorpyrifos
degradation by this strain was further investigated under a range of culture conditions
and in soil.
Figure 4.2 Degradation (%) of chlorpyrifos as a sole source of carbon and energy in the
MSM by 8 selected bacterial strains: HN1 (), HN2 (), HN3 (), HN4 (), HN5
(), HN6 (), HN7 () and HN8 () and in un-inoculated control () at 37C and 7.0
pH. Values are the means of three replicates and error bars represent standard error.
Chapter 4 Biodegradation of chlorpyrifos
114
4.3.2 Molecular, morphological and biochemical identification of strain HN3
Morphological and biochemical characters of isolate HN3 were compared to those
described by Jarvis et al., (1997) which confirmed strain HN3 to be a Mesorhizobium sp
(Table 4.2). Morphology is apparent from Figure 4.3 and 4.4. The 16S rRNA gene
sequence of the strain HN3 showed 99% identity with 16S rRNA gene sequence of
Mesorhizobium sp. STM 4018, GenBank accession number. EF100516.1 and it was
grouped in a well-supported branch with various Mesorhizobium spp. (Figure 4.5).
GenBank accession number of the Mesorhizobium sp. HN3 16s rRNA gene is JN119831.
4.3.3 Antibiotic resistance assay
Antibiotic assay showed that Mesorhizobium sp. HN3 was resistant to kanamycin,
nalidixic acid, streptomycin, rifamycin, tetracycline, and carbenicillin while it showed
sensitivity towards gentamycin, erythromycin and chloramphenicol and ampicilin.
Chapter 4 Biodegradation of chlorpyrifos
115
Figure 4.3 Mesorhizobium sp. HN3 grown on LB-agar plate after 48 h of incubation
Figure 4.4 Scanning Electron Microscopy Image of Mesorhizobium sp. HN3
Chapter 4 Biodegradation of chlorpyrifos
116
Figure 4.5 UPGMA tree showing the phyllogenetic relationship of strain HN3 with the
related species based on the 16S rRNA gene sequences. Bootstrap values that are
expressed as the percentages of 1000 replications are shown at the nodes of the branches.
Mesorhizobium_metallidurans_(NR_042685.1)
Mesorhizobium_tarimense_(NR_044051.1)
Mesorhizobium_gobiense_(NR_044052.1|)
Mesorhizobium_tianshanense_(NR_024880.1)
Mesorhizobium_mediterraneum_(NR_042483.1)
Mesorhizobium_temperatum_(NR_025253.1)
Mesorhizobium_huakuii_(NR_043390.1)
Mesorhizobium_amorphae(NR_024879.1)
Mesorhizobium_loti_(NR_074162.1)
Mesorhizobium_opportunistum_(NR_074209.1)
Mesorhizobium_plurifarium_(NR_026426.1)
Mesorhizobium_thiogangeticum_(NR_042358.1)
Mesorhizobium_sp.(HQ836166.1)
HN3_(JN119831.1)
Mesorhizobium_sp.(EF100516.1)
Mesorhizobium_sp.(HQ836191.1)
Sinorhizobium_terangae_(NR_044842.1)
Sinorhizobium_kostiense_(NR_042484.1)
Sinorhizobium_saheli(NR_026096.1)
98
75
96
95
71
56
67
32
100
76
40
100
71
99
0.0000.0050.0100.015
Chapter 4 Biodegradation of chlorpyrifos
117
Table 4.2: Biochemical and morphological characteristics of Mesorhizobium sp. HN3
Biochemical Tests Colony and cell
Morphology
Test Reaction with
Mesorhizobium sp. HN3 Result Colony shape Round
Sucrose Yellow green + Size Small
Maltose Orange - Surface Shiny
Innocitol Brown + Odour Plant
like
Mannose Yellow green + Elevation Flat
Raffinose Yellow green + Margins Smooth
O-nitrophenyl B-
galactopyraoside (ONPG)
Yellow + Cell motility Motile
Cell shape Short
rods
Lysin decarboxylase Orange _ Gram’ s
reaction
Gram
positive
Arginin dihydrolase Light green +
Ornithine decarboxylase Green _
Tryptophane deaminase Yellow _
H2S Off white _
Urea Pink +
Melonic acid Brown +
ADON Green _
Chapter 4 Biodegradation of chlorpyrifos
118
4.3.4 Biodegradation of CP by Mesorhizobium sp. HN3
4.3.4.1 Optimum temperature for the CP degradation by Mesorhizobium sp. HN3
Data indicating the effect of temperature on the biodegradation of CP by
Mesorhizobium sp. HN3 is shown in Figure 4.6. In the presence of 100 mg/l CP, 33 and
18% of the added pesticide was degraded after 24 h of incubation at 37 and 40°C which
was significantly higher compared to that at 30°C where only 5% degradation was
observed. After 5 days of incubation, complete CP degradation was observed at 37°C
compared to 85% and 55% at 40 and 30C respectively. At 30°C complete degradation
was achieved after 10 days of incubation. Results indicate that the temperature
significantly affected the rate of CP degradation.
4.3.4.2 Optimization of pH for CP degradation by Mesorhizobium sp. HN3
Efficient degradation of CP was achieved at all the three initial pH tested. At 100
mg/l initial concentration, at pH 7.0, the entire added CP was degraded after 5 days of
incubation (Figure 4.7). Degradation was relatively slow at alkaline pH (8.0) whereby
100% degradation was achieved after 7 days of incubation and a further decline in the
degradation was observed at acidic pH (6.0) as 100% degradation was observed after 8
days of incubation. Among the three pH conditions tested for CP degradation by
Mesorhizobium sp. HN3, pH 7.0 was found to be optimum.
4.3.4.3 Biodegradation of CP at different initial concentrations
Mesorhizobium sp. HN3 was able to degrade CP efficiently up to 400 mg/l initial
concentration in MSM whereby degradation was achieved in concentrations dependent
manner. Chlorpyrifos degradation and bacterial biomass production at different initial CP
concentrations after 3 days of incubation are presented in Figure 4.8A. In the cultures
containing 50 and 100 mg/l CP, 100 and 85 % degradation was achieved respectively
whereas at 200, 300 and 400 mg/l initial concentrations, 45%, 33% and 15% CP was
degraded respectively. After three days of incubation, cell biomass (g/l) was highest at
100 mg/l initial CP concentration and declined gradually at concentrations beyond this.
As depicted in Figure 4.8B, specific rate of CP degradation was dependent on initial
concentration with an increase in specific degradation rate at lower initial CP
Chapter 4 Biodegradation of chlorpyrifos
119
concentrations (50-100 mg/l) and a decline in the rate at higher initial CP concentrations.
Mesorhizobium sp. HN3 could tolerate higher CP concentration, with delayed
degradation i.e., 40% and 30% respectively after 16 days of incubation at 1000 and 1200
mg/l CP (data not shown). Complete degradation of CP was achieved after 5, 7, 9 and 10
days at 100, 200, 300 and 400 mg/l respectively.
Chapter 4 Biodegradation of chlorpyrifos
120
Figure 4.6 Degradation (%) of chlorpyrifos by Mesorhizobium sp. HN3 as a sole source
of carbon and energy at different incubation temperatures; 30C (), 37C () and 40C
(). Dashed lines show un-inoculated controls; 30C (), 37C () and 40C ().
Values are the means of three replicates and error bars represent standard error.
Chapter 4 Biodegradation of chlorpyrifos
121
Figure 4.7 Degradation (%) of chlorpyrifos by Mesorhizobium sp. HN3 as a sole
source of carbon and energy at different initial pH; 6.0 (), 7.0 () and 8.0 ().
Dashed lines indicate un-inoculated controls at pH 6.0 (), 7.0 () and 8.0 ().
Values are the means of three replicates and error bars represent the standard
error.
Chapter 4 Biodegradation of chlorpyrifos
122
Figure 4.8 A) Degradation of chlorpyrifos by Mesorhizobium sp. HN3 at different initial
concentrations of chlorpyrifos in MSM as a sole source of carbon and energy after 3 days
of incubation () and consequent growth of Mesorhizobium sp. HN3 (). Values are the
means of three replicates and error bars represent the standard error. B) Effect of initial
CP concentrations on specific degradation rate of CP (, qs).
Chapter 4 Biodegradation of chlorpyrifos
123
4.3.4.4 Kinetics of CP degradation and TCP accumulation and degradation
thereafter
Effect of initial concentrations of CP on kinetic parameters viz. specific
degradation rate (qs), specific growth rate (µ),substrate (CP) consumption variables (Qs,
Qx, Yx/s, qs) and product (TCP) formation parameters (Qp, Yp/s, qp) are presented in Table
4.3. The CP consumption and TCP production parameters were high at lower CP
concentrations i.e., (50-100 mg/l) followed by a decline at higher concentrations (200-
400 mg/l). Rate of TCP accumulation (QP) increased with the increase in CP
concentrations up to 200 mg/l with a gradual decrease at higher concentrations. TCP
yield (Yp/s) and qp were highest at 100 mg/l initial concentration and decreased at higher
concentrations. As illustrated in Figure 4.9, at 50 and 100 mg/l, maximum concentration
of TCP was observed after 48 hrs of incubation and all of the TCP produced as a result of
CP hydrolysis was degraded after 96 and 144 hrs respectively. At higher concentrations,
TCP was detected in the culture media even after 240 hrs of incubation which might be
due to the continuous production and slow degradation. Lag phase of bacterial growth
was extended with an increase in initial CP concentration beyond 100 mg/l.
Figure 4.10 shows the fitting results of the kinetic model based on the
experimental data of CP degradation. The degradation followed the first order reaction as
a straight line was produced by plotting the ln values (Ct/C0) of CP residues against
respective hrs. The residue data were therefore, interpreted statistically for the calculation
of regression equation and first order kinetic parameters (Table 4.4). Regression
coefficient indicating the degradation rate further supported the findings that the CP
persistence increases with increasing initial concentration.
Chapter 4 Biodegradation of chlorpyrifos
124
Figure 4.9 Kinetics of CP degradation at 37C by Mesorhizobium sp. HN3 as a sole
source of carbon and energy at different initial concentrations; a) 50 mg/l, b) 100 mg/l,
c) 200 mg/l and d) 300 mg/l showing residual CP concentration (), TCP
concentration () and cell biomass of Mesorhizobium sp. HN3 () in the culture
media. Values are the means of three replicates and error bars represent the standard
error.
Chapter 4 Biodegradation of chlorpyrifos
125
Table 4.3: Kinetic parameters* for chlorpyrifos degradation and product (TCP)
formation thereafter by Mesorhizobium sp. HN3 in liquid cultures containing different
initial concentrations of the pesticide
Each value is the means of three replicates± standard errors. All the values differ from
each other significantly at p< 0.05
*Kinetic parameters:
µ (/h): specific growth rate
Qs: mg substrate consumed /l/h
Qx: mg cell mass produced /l/h
Yx/s: mg cells /mg substrate utilized
qs: mg substrate consumed /mg cells /h
Qp: mg TCP produced /l/h
Yp/s: mg TCP produced /mg substrate consumed
qp: mg TCP produced /mg cells /h
Initial CP
concentration
(mg/l)
Substrate utilization parameters
µ
(/h)
Qs
(mg/l/h)
Qx
(mg/l/h)
Yx/s
(mg/mg/h)
qs
(mg/mg/h)
50 0.090±0.000 1.15±0.01 1.52±0.01 1.24±0.005 0.080±0.001
100 0.280±0.005 1.43±0.02 4.60±0.05 1.70±0.040 0.164±0.002
200 0.058±0.000 1.30±0.01 2.88±0.00 0.78±0.003 0.075±0.001
300 0.023±0.000 0.72+0.00 2.56+0.03 0.45±0.001 0.050±0.000
400 0.025±0.000 0.26+0.00 2.21+0.01 0.35±0.003 0.045±0.001
Product formation parameters
QP
(mg/l/h)
YP/S
(mg/mg/h)
qp
(mg/mg/h)
50 1.15±0.010 0.40±0.005 0.015±0.040
100 2.24±0.020 0.81±0.010 0.073±0.030
200 2.67±0.010 0.50±0.020 0.013±0.010
300 1.08±0.030 0.23±0.010 0.005±0.000
400 0.99±0.001 0.17±0.000 0.002±0.000
Chapter 4 Biodegradation of chlorpyrifos
126
Figure 4.10 First order kinetics of chlorpyrifos degradation in MSM at different initial
concentrations; 50 mg/l (), 100 mg/l (), 200 mg/l (), 300 mg/l () and 400 mg/l
().
Chapter 4 Biodegradation of chlorpyrifos
127
Table 4.4: First order kinetics parameters for chlorpyrifos degradation by Mesorhizobium
sp. HN3 in liquid cultures containing different initial concentrations of the pesticide
CP Concentration
(mg/l) Rate constant (h
-1)
t1/2
(Days) R
2
Regression
equation
50 0.025 1.16 0.917 3.853-0.025x
100 0.023 1.26 0.977 4.699-0.023x
200 0.015 1.93 0.933 5.557-0.015x
300 0.014 2.06 0.911 6.161-0.014x
400 0.012 2.41 0.900 6.451-0.012x
Chapter 4 Biodegradation of chlorpyrifos
128
4.3.4.5 Co-metabolic degradation of CP by Mesorhizobium sp. HN3
Co-metabolic degradation of CP by Mesorhizobium sp. HN3 was monitored by
comparing the pesticide degradation by adding glucose in the culture medium. Higher CP
degradation was observed in the cultures containing glucose as compared to those
without glucose. After 2 days of incubation, 75% and 59% CP was degraded in the
cultures with and without glucose respectively. After 4 days of incubation no CP residues
were recovered in cultures containing glucose while 9% CP was still present in cultures
without glucose that also vanished completely by the 5th
day (Figure 4.11).
Figure 4.11 Co-metabolic degradation of chlorpyrifos by Mesorhizobium sp. HN3.
Degradation of chlorpyrifos by Mesorhizobium sp. HN3 in MSM containing chlorpyrifos
and added glucose () and in MSM containing chlorpyrifos as a sole source of carbon
and energy () with respective un-inoculated controls () and ().Values are the means
of three replicates and error bars represent the standard error.
Chapter 4 Biodegradation of chlorpyrifos
129
Degradation of CP as a sole source of carbon and nitrogen by HN3
In nitrogen free medium, efficient degradation of CP by Mesorhizobium sp. HN3
was achieved as 100% of the added CP was degraded within 6 days of incubation. By the
7th
day of incubation no CP could be recovered from the cultures (Figure 4.12).
Figure 4.12 Degradation of chlorpyrifos (100 mg/l) by Mesorhizobium sp. HN3 in
nitrogen free medium (), bacterial biomass () and un-inoculated control ().Values
are the means of three replicates and error bars represent the standard error.
Chapter 4 Biodegradation of chlorpyrifos
130
4.3.5 Biodegradation of TCP by Mesorhizobium sp. HN3
4.3.5.1 Biodegradation of TCP at different initial concentrations
Chlorpyrifos degrading bacterium, Mesorhizobium sp. HN3 was found to degrade
TCP, a more toxic chlorinated metabolite of CP. At different initial concentrations, TCP
was degraded in concentration dependent manner similar to the observations recorded for
CP degradation. At 25, 50, 100 and 200 mg/l initial concentrations of TCP complete
degradation was observed after 3, 5, 6 and 9 days (of incubation) respectively. However,
with increasing concentrations of TCP up to 300 mg/l biodegradation rate was relatively
slower with 88% degradation after 10 days of incubation (Figure 4.13). In another
experiment, addition of glucose in the medium containing TCP at 100 mg/l resulted in
enhanced biodegradation as it shortened the duration of TCP utilization from 6 to 4 days
of incubation (Figure 4. 14).
4.3.5.2 Release of chloride ions in culture media containing CP and TCP
Release of chloride ions in the culture media as a result of biodegradation of CP
and TCP was investigated to understand dehalogenation potential of Mesorhizobium sp.
HN3. The calculated equimolar concentrations of chloride ions in 100 and 200 mg/l CP is
30.4 and 60 mg/l respectively and is equivalent to the total of three chloride ions from
one molecule of CP. Hence in our study, estimated amount of chloride ions in the culture
medium (containing 100 and 200 mg/l CP) was 20.1 and 40 mg/l after three and four
days respectively. These chloride concentrations are corresponding to the release of two
chloride ions in the culture media from one molecule of CP. As the experiment
proceeded, concentration of chloride ions in the above mentioned media increased to
almost 30.4 and 60 mg/l after 7 and 9 days respectively showing the release of all three
chloride ions (Figure 4.15).
In case of TCP, calculated equimolar concentrations of chloride ions in 100 and
200 mg/l TCP is equal to 53.7 and 106 mg/l that corresponds to total three chloride ion.
Hence during the TCP degradation by Mesorhizobium sp. HN3, chloride ions
concentration reached almost 53.7 and 106 mg/l in the media with 100 and 200 mg/l
initial TCP after 7 and 10 days respectively indicating the release of total three chloride
ions (Figure 4.16).
Chapter 4 Biodegradation of chlorpyrifos
131
Figure 4.13 Degradation (%) of TCP by Mesorhizobium sp. HN3 as a sole source of
carbon and energy at different initial concentrations: 25 mg/l (), 50 mg/l (), 100 mg/l
(), 200 mg/l (), 300 mg/l () and un-inoculated control (). Values are the means of
three replicates and error bars represent the standard error.
Chapter 4 Biodegradation of chlorpyrifos
132
Figure 4.14 Co-metabolic degradation of TCP. Degradation of TCP by Mesorhizobium
sp. HN3 in MSM containing TCP and added glucose (), in MSM containing TCP as a
sole source of carbon and energy () and respective un-inoculated controls () and
().Values are the means of three replicates and error bars represent the standard error.
Chapter 4 Biodegradation of chlorpyrifos
133
Figure 4.15 Analysis of chloride ions produced as a result of chlorpyrifos degradation in
a chloride free medium. Biodegradation and release of chloride ions is shown side by
side. Biodegradation of chlorpyrifos in the chloride free culture medium containing CP
100 mg/l (), CP 200 mg/l (), concentration of chloride ions released at CP 100 mg/l
() and CP 200 mg/l ().Values are the means of three replicates and error bars represent
the standard error.
Chapter 4 Biodegradation of chlorpyrifos
134
Figure 4.16 Analysis of chloride ions produced as a result of TCP degradation in a
chloride free medium. Biodegradation and release of chloride ions is shown side by side.
Biodegradation of TCP in the chloride free culture medium containing TCP 100 mg/l ()
and 200 mg/l (). Concentration of chloride ions released at CP 100 mg/l () and CP
200 mg/l ().Values are the means of three replicates and error bars represent the
standard error.
Chapter 4 Biodegradation of chlorpyrifos
135
4.3.6 Soil microcosm studies of CP
4.3.6.1 Optimization of soil moisture level for CP degradation in unsterilized soil
Biodegradation of CP was found to be affected significantly by the soil moisture
contents. Data showed that as the soil moisture was increased from 20% to 40% of
maximum water holding capacity (MWHC) of soil, CP degradation was increased from
18% to 55% of the added CP (50 mg/l) after 10 days of experiment (Figure 4.17).
However, in the soils with higher MCs i.e. 60% and 80%, about 21% and 13% of the
added CP was respectively left in the soil extracts after 10 days of experiment. At the end
of experiment (40 days), 59%, 100%, 69% and 37% of the added CP was degraded in soil
with 20%, 40%, 60% and 80% MCs respectively.
In inoculated soil, effect of soil moisture contents on TCP accumulation (as a
result of CP degradation) and degradation was also monitored and data showed that
accumulation of TCP was higher in soils with 20%, 60% and 80% MCs compared to the
soil with 40% MC. As with CP, TCP degradation was also supported at 40% MC of soil.
Hence 40% MC of soil was considered to be the optimized moisture level for CP and
TCP degradation by Mesorhizobium sp. HN3 and further soil experiments were
performed at 40% soil MC.
4.3.6.2 Biodegradation of CP in sterilized and unsterilized soil
Degradation efficiency of Mesorhizobium sp. HN3 (2x109 CFU/ g of soil) in
sterilized and un-sterilized soil was studied. The treatments to be compared included
followings:
1. Un-sterilized and un-inoculated soil (control-1, T1)
2. Un-sterilized soil inoculated with Mesorhizobium sp. HN3 (T2)
3. Sterilized and un-inoculated soil (control-2, T3)
4. Sterilized soil inoculated with Mesorhizobium sp. HN3 (T4)
The comparative analyses of all four treatments showed that HN3 not only degraded CP
in the sterilized soil but it also enhanced the degradation in the un-sterilized soil.
After 10 days of experiment, only 19% CP was degraded in the un-sterilized &
un-inoculated soil (T1) followed by a non significant increase in further CP degradation
(only 38% at the end of experiment). In un-sterilized soil containing HN3 (T2) and
Chapter 4 Biodegradation of chlorpyrifos
136
sterilized soil containing HN3 (T4), 58% and 50% CP was degraded respectively,
followed by the complete degradation of CP at the end of experiment. No CP residues
were detected in the samples harvested at the end of experiment (Figure 4.18).
A similar trend was observed in case of TCP degradation. In un-sterilized control
soil (T1), more TCP was accumulated than that in the un-sterilized containing HN3 (T2)
and sterilized soil containing HN3 (T4). Moreover, very small CP degradation and
negligible TCP residues were observed in the sterilized and un-inoculated soil (T3).
We can conclude that Mesorhizobium HN3 is an efficient tool in the
bioremediation of CP contaminated soil where it can work equally well alone as well as
in collaboration with the existing indigenous microbial communities of soil.
4.3.6.3 Optimization of inoculum density for CP degradation in sterilized soil
Soil was sterilized to clearly identify the efficiency of HN3 strain and optimize its
inoculums size for the efficient CP degradation. Data indicated that after 20 days of
experiments, in soil containing 2×109 CFU/g soil, 75% of the added CP was degraded
which was completely disappeared by the 30 days of experiment. Soils containing 2×105
and 2×107 CFU/g soil, showed a slower rate of CP disappearance compared to that at
2×109.
TCP accumulation and degradation was also dependent on inoculum size and
minimum accumulation and maximum degradation of TCP was found at highest
inoculum density compared to that at lower ones (Figure 4.19).
Chapter 4 Biodegradation of chlorpyrifos
137
Figure 4.17 Degradation (%) of chlorpyrifos by Mesorhizobium sp. HN3 in the
unsterilized soil at different soil moistures: 20% (), 40% (), 60% () and 80% ().
Solid lines indicate CP degradation (%) and dashed lines with same marker indicate TCP
accumulation and degradation (mg/kg) at respective moisture level. Un-inoculated
controls are indicated by 20% (), 40% (), 60% () and 80% (). Values are the
means of three replicates and error bars represent the standard error.
Chapter 4 Biodegradation of chlorpyrifos
138
Figure 4.18 Degradation (%) of chlorpyrifos by Mesorhizobium sp. HN3 in the
unsterilized and sterilized soil. Un-sterilized control soil (un-inoculated) (), Un-
sterilized soil inoculated with HN3 (), Sterilized control soil (un-inoculated) (),
Sterilized soil inoculated with HN3 (). Solid lines indicate CP degradation (%) and
dashed lines with same marker indicate TCP accumulation and degradation (mg/kg) at
respective moisture level. Values are the means of three replicates and error bars
represent the standard error.
Chapter 4 Biodegradation of chlorpyrifos
139
Figure 4.19 Degradation (%) of chlorpyrifos by Mesorhizobium sp. HN3 in the sterilized
soil at different inoculums densities: 2109 (), 210
7 () and 2 10
5 () and un-
inoculated control (). Solid lines indicate CP degradation (%) and dashed lines with
same marker indicate TCP accumulation and subsequent degradation (mg/kg) at
respective inoculum densities. Values are the means of three replicates and error bars
represent the standard error.
Chapter 4 Biodegradation of chlorpyrifos
140
4.3.7 Identification of Chlorpyrifos metabolites
Biodegradation of CP was confirmed by GC-MS analysis of the extracts
obtained from the spent culture media containing CP as a source of carbon and energy.
Metabolites of CP were identified on the basis of mass spectrum analysis. Presence of CP
was indicated at a retention time of 16.02 min and the peak corresponding to CP was
designated as peak 1 (Figure 4.20). Mass spectrum of this peak was identical to that of
authentic CP standard showing molecular ion peak with m/z 351 (Figure 4.21). The time
course GC-MS analysis of bacterial culture extracts containing CP and its metabolites
showed that peak corresponding to CP disappeared as the metabolism proceeded and in
the meanwhile some new peaks appeared at different retention times. Hence in the TIC of
48 h extracts five peaks designated as 2, 3, 4, 5 and 6 appeared at the RT of 10.23, 11.39,
7.72, 7.30 and 18.98 min (Figure 4.22).
Mass spectra of peaks 2, 3 and 4 were further analyzed. Base peaks at m/z 197
and 169 were identified to be the hydrolysis products TCP (peak 2) and DETP (peak 3)
respectively. While peak at m/z 210 was identified to be 3,5,6, trichloro-2-
methoxypyridine, TMP (peak 4). TCP was found to be the predominant metabolite in the
initially harvested culture extracts. TMP indicated the O-methylation of TCP. Mass
spectra of TCP, DETP and TMP are shown in Figure 4.23-4.25. The metabolite DETP,
being unstable was not found persistently and disappeared subsequently.
In the TIC of samples extracted after 72 h, peak corresponding to TCP increased
further while TMP peak disappeared completely. Peaks 5 and 6 further reduced and a
new peak 7 appeared at RT 14.89 (Figure 4.26). Analysis of mass spectra of peaks 5, 6
and 7 showed them to be the dechlorination products of TCP and TMP and they were
identified as viz 3,5 dichloropyridine, 3-chloro-2-pyridinol and 3,5-trichloro-2-
methoxypyridine corresponding to m/z 147, 129 and 179 respectively (Figure 4.27, 4.28
and 4.29). Appearance of these three metabolites strengthens the degradation of TCP and
TMP through reductive dechlorination as their structure indicates the removal of one or
two chlorine atoms from TCP and TMP structure.
In the TIC of 120 h (5 days) extracts, a new peak 8 appeared which was not
found in the TICs of previous sample extracts (Figure 4.30). Peak corresponding to CP
disappeared completely and TCP peak was reduced compared to that in the previous day
Chapter 4 Biodegradation of chlorpyrifos
141
culture TICs. Further, peak 8 corresponding to m/z 117 was identified to be maleamic
acid with a chemical structure indicating a ring cleavage product (Figure 4.31). Hence,
the appearance of a ring cleavage product further supports the capability of
Mesorhizobium sp. HN3 for efficient degradation of CP and its toxic metabolites
containing aromatic rings. On the basis of the above findings, we predicted pathway for
the CP biodegradation by Mesorhizobium sp. HN3 as shown in Figure 4.32.
Chapter 4 Biodegradation of chlorpyrifos
142
At zero time
Figure 4.20 Total ion chromatogram (TIC) of the extract of the spent culture medium
containing CP at zero time showing the only peak (peak 1) corresponding to CP at 16.02
min as the most abundant or major peak. No metabolite peaks were found in this TIC.
Retention Time
Peak 1
Chapter 4 Biodegradation of chlorpyrifos
143
Chlorpyrifos
Figure 4.21 Mass spectrum of chlorpyrifos (CP)
N
Cl
Cl
Cl
O
PO
SO
CH3
CH3
Chapter 4 Biodegradation of chlorpyrifos
144
After 48 h (2 days)
Figure 4.22 Total ion chromatogram (TIC) of the extract of the spent culture
medium containing CP harvested after 48 h (2 days). Peak 1 is reduced in
abundance while new peaks 2, 3, 4 5 and 6 appeared at different retention times.
Retention Time
Retention Time
Chapter 4 Biodegradation of chlorpyrifos
145
3,5,6 trichoro-2-pyridinol (TCP)
Figure 4.23 Mass spectrum of 3,5,6-trichloro-2-pyridinol (TCP)
Chapter 4 Biodegradation of chlorpyrifos
146
Diethylthiophosphate (DETP)
Figure 4.24 Mass spectrum of Diethylthiophosphate (DETP)
Chapter 4 Biodegradation of chlorpyrifos
147
3,5,6-trichloro-2-methoxypyridine (TMP)
Figure 4.25 Mass spectrum of 3,5,6 trichloro-2-methoxypyridine (TMP)
Chapter 4 Biodegradation of chlorpyrifos
148
After 72 h (3 days of incubation)
Figure 4.26 Total ion chromatogram (TIC) of the extract of the spent culture
medium containing CP harvested after 72 h (3 days). Abundance of peak 1 is
reduced further, of peak 2 increased, of 3, 5 and 6 decreased and peak 4 (which
was present in the previous TIC) is totally disappeared in this. Peak 7 is a new
peak which was not found in previous TICs.
Retention Time
Chapter 4 Biodegradation of chlorpyrifos
149
3,5-dichloropyridine
Figure 4.27 Mass spectrum of 3,5-dichloropyridine
Chapter 4 Biodegradation of chlorpyrifos
150
3-chloro-2-pyridinol
Figure 4.28 Mass spectrum of 3-chloro-2-pyridinol
Chapter 4 Biodegradation of chlorpyrifos
151
3,5-dichloro-2-methoxy Pyridine
Figure 4.29 Mass spectrum of 3,5-trichloro-2-methoxypyridine
Chapter 4 Biodegradation of chlorpyrifos
152
After120 h (5 days of incubation)
Figure 4.30 Total ion chromatogram (TIC) of the extract of the spent culture medium
containing CP harvested after 120 h (5 days) of incubation. Abundance of peak 1 is
reduced almost to its complete, of peak 2 decreased, of 3 and 6 decreased and peak 5
(which was present in the previous TIC) is totally disappeared in this TIC. Peak 7 is
larger relative to previous TIC and a new peak, 8 is present at 13.62 that was not found in
previous TICs.
Retention Time
Chapter 4 Biodegradation of chlorpyrifos
153
Maleamic acid (Ring cleavage product)
Figure 4.31 Mass spectrum of maleamic acid
C
COOH
O
NH2
Chapter 4 Biodegradation of chlorpyrifos
154
Figure 4.32 Predicted biodegradation pathway of chlorpyrifos
Chapter 4 Biodegradation of chlorpyrifos
155
4.3.8 Detection of OP degrading genes in Mesorhizobium sp. HN3
Various primers were used for amplifying different OP hydrolases and oxygenases
(Tables 2.3 & 2.4). However, only opdA and protocatechuate (pcaH) genes were
amplified from genomic DNA of CP degrading Mesorhizobium sp. HN3 by using primers
described in Sharaf et al., (2006) and Azhari et al., (2007). PCR products of expected
sizes i.e. 1155 and 390 bp were obtained for opdA and pcaH gene respectively (Figure
4.33 and 4.34). As in case of PFF degrading bacterial isolates (Chapter 3), potential opdA
gene PCR product of expected size was obtained, but further sequence analysis revealed
no similarity with the sequences of any of the previously known hydrolase gene
sequences reported in the GenBank.
However, the sequence of the pcaH gene was found to be 81% identical to the beta
subunit of protocatechuate 3,4- dioxygenase gene of Cupriavidus necator striain
(Accession number JMP131).
Chapter 4 Biodegradation of chlorpyrifos
156
Figure 4.33 Amplification of opdA gene encoding an OP hydrolase (OPAA) in CP
degrading Mesorhizobium sp. HN3 (Lanes 1 & 2). M indicates the 1Kb marker.
Figure 4.34 Amplification pcaH gene encoding an protocatechuate dioxygenase in CP
degrading Mesorhizobium sp. HN3 (Lanes 1). M indicates the 1Kb marker.
Chapter 4 Biodegradation of chlorpyrifos
157
4.4 Discussion
This study describes the isolation and characterization of a novel bacterial strain
Mesorhizobium sp. HN3 capable of complete degradation of chlorpyrifos, a chlorinated
organophosphate pesticide. To date many bacterial strains capable of CP degradation
have been reported including a few PGPRs i.e. Pseudomonas sp. (Fulekar and Geetha,
2008), Bacillus sp. (Zhu et al., 2010), Klebseilla sp. (Ghanem et al., 2007). However,
PGPR belonging to Rhizobia group have never been reported to degrade pesticides and
related contaminants.
Initially, the isolation of CP degrading bacteria was considered difficult
potentially due to the accumulation of TCP (an antimicrobial metabolite of CP) in the
culture media and in soil which hindered the enhanced degradation of CP (Racke et al.,
1990). However, in recent years due to the long exposure to CP, microorganisms might
have developed capabilities not only to survive in its presence but also to degrade it
(Singh et al., 2003; Chen et al., 2012). Hence CP as well as TCP degradation potential of
some bacterial isolates has been reported (Maya et al., 2011; Briceno et al., 2012; Chishti
and Arshad, 2013).
Notably, temperature and pH of the soil and water greatly affect the pesticide
degrading activity of the microorganisms (Goda et al. 2010). Different bacterial species
have been reported to show different optimal temperatures for CP degradation (Li et al.
2007; Lu et al., 2013). However, strain HN3 performed well at a range of temperatures
i.e. 30-40°C.
Concerning the effect of pH on CP degradation, the study indicated that all of the
tested pH supported the biodegradation of CP by Mesorhizobium sp. HN3. However, an
efficient degradation of CP was observed at neutral (7.0) and basic (8.0). This was in
contrast to the findings of Racke et al. (1996) who exclaimed that high pH had a co-
relation with hydrolysis of CP in soil and Singh et al. (2003) who demonstrated that high
(basic) pH support microbial hydrolysis of CP.
Mesorhizobium sp. HN3 degraded CP over a wide range of initial concentrations
in contrast with previous reports showing inhibition of bacterial growth and CP
degradation rates at concentrations < 300 mg/l (Singh et al. 2004; Singh et al. 2006; Li et
al. 2007). Kinetic parameters deduced for CP consumption and TCP and bacterial
Chapter 4 Biodegradation of chlorpyrifos
158
biomass production give a good picture of TCP production as a consequence of CP
degradation. High rate of TCP production and complete TCP removal at relatively lower
initial CP concentrations might be because HN3 would have more easily adapted to lower
TCP concentrations accumulated in the culture media as a result of CP degradation.
Further, higher specific growth rate (µ), cell mass formation rate (QX) and the substrate
uptake rate (QS) at 50-100 mg/l initial CP concentration indicated a remarkable impact of
initial concentration on CP degradation rate. CP degradation by Mesorhizobium sp. HN3
followed first order kinetics with a dramatic decrease in degradation rate with increasing
initial concentration. A similar trend for CP degradation have been reported earlier
(Dubey and Fulekar, 2012).
Efficient degradation of CP by Mesorhizobium sp. HN3 was observed in the
presence and absence of glucose, whereby degradation was higher in former case
indicating co-metabolism of CP. There are few reports showing simultaneous utilization
of CP and glucose by bacterial isolates including Actinobacteria (Briceno et al., 2012)
and Paracoccus sp. TRP (Xu et al., 2008). The present studies showed that
Mesorhizobium sp. HN3 degrades CP better in the presence of an easily available carbon
source and supports the idea that co-metabolism enhances the degradation of recalcitrant
compounds by enhancing the growth of bacteria which in turn enhances utilization of
xenobiotics (De Schrijver and Mot, 1999).
Mesorhizobium sp. HN3 inoculated in the medium deprived of inorganic nitrogen
was capable to scavenge the nitrogen from the pyridine ring of the chlorpyrifos. The lag
phase of the HN3 was relatively longer (48 h) potentially due to the inavailability of the
nutrients and it took time to acclimate to the stressed culture condition after which the
growth started rapidly. As the only nitrogen source available for growth of HN3 in the
culture medium was that in the pyridine ring of CP, the results indicate ring cleavage to
make the nitrogen available for growth. Use of CP as a source of nitrogen by
Acremonium sp. strain GFRC-1 (a fungal isolate) has been reported (Kulshrestha and
Kumari, 2010). However, such data for the bacterial isolates is meagerly available.
Mesorhizobium sp HN3 was also capable of degrading TCP at high
concentrations when provided as a sole source of carbon in MSM. More recently, Lu et
al., (2013) isolated a bacterial strain, DT-1 that can degrade TCP efficiently but
Chapter 4 Biodegradation of chlorpyrifos
159
increasing the TCP concentration beyond 50 mg/l subsequent decrease in growth was
observed followed by inhibition 100 mg/l. In contrast to this, Mesorhizobium sp. HN3
appears to be more efficient as it can degrade both CP and TCP even at higher
concentrations.
CP and its metabolite TCP contain three chloride atoms on the aromatic ring thus
behaving like an organochlorine and posing a great threat to the environment. For this
reasons, it is important to know the fate of chloride ions during CP and TCP degradation.
Investigation of chloride ions release during biodegradation of CP and TCP further
supported the complete degradation of CP and TCP by Mesorhizobium sp. HN3 whereby
degradation was correlated with the rhythm of chloride ions release in the culture
medium. According to Feng et al., (1998), the TCP mineralization proceeds through
reductive dechlorination under anaerobic conditions. HN3 proves to be one of the best CP
as well as TCP degrading organisms to date that can not only hydrolyze CP but also
release chloride ions and scavenge nitrogen from the aromatic ring of TCP.
CP degradation by Mesorhizobium sp. HN3 was also investigated in soil. A
number of reports indicate the CP remediation in soil by microbial isolates such as
parathion (Barles et al. 1979), ethoprophos (Karpouzas et al., 2005) and chlorpyrifos
(Lakshami et al., 2008). The optimization of bioremediation processes depends on many
factors as the soil properties (moisture contents, soil pH) and the survival and population
of the degrading cultures (Duquenne, et al., 1996). The present study was conducted to
optimize the soil moisture levels and inoculums density of the degrading bacterial
consortium for efficient degradation of CP. Soil moisture contents are very important for
the effective remediation of pesticide contaminated soil as they are one of the key factors
which affect the proliferation of the degrading cultures (Van Veen et al., 1997). The
optimum soil moisture for CP degradation by the bacterial consortium was found to be
40% and an increase or decrease in this moisture produced undesirable results. The
present study was consistent with the previous findings in that longer lag phase was
observed at low initial inoculum density compared to that at higher inoculum densities.
However, inoculation of HN3 in the soil resulted in maximum pesticide degradation both
in sterilized as well as unsterilized soil. The degradation of CP by Mesorhizobium sp.
HN3 was higher in un-sterilized soil than that in sterilized soil. Higher degrading activity
Chapter 4 Biodegradation of chlorpyrifos
160
of HN3 in the un-sterilized soil can be attributed to the presence of native microbial
communities, some of which might be capable of CP degradation. Therefore, inoculation
of HN3 further enhanced the degradation of chlorpyrifos in un-sterilized soil. Whereas in
sterilized soil, no indigenous microbial population was present therefore, HN3 was alone
to cope with CP contamination. These results signify the importance of optimizing the
inoculums density while studying pollutant degradation.
Mass spectrometric analysis of CP degradation revealed that first step of the
metabolic pathway is hydrolysis of O-P ester linkage to produce TCP and DETP. As
mentioned earlier that samples extracted from the culture media were derivatized with
BSTFA, the trimethyl-silyl portion (m/z 73) attaches to hydroxyl group of TCP and
DETP giving aggregates with m/z 270.619 ~ 271 and 241 for TCP and DETP
respectively. Most of the CP degrading bacteria reported earlier could hydrolyze CP to
TCP by the hydrolysis of O-P bond thus leaving phosphorus atoms to be utilized as a
source of phosphorus by the microorganisms (Singh et al., 2004; Singh and walker 2006;
Chen et al., 2012; Lu et al., 2013). TCP and DETP were not persistently found during the
course of experiments and disappeared subsequently. Singh et al., (2004) suggested that
DETP is utilized as a carbon and energy source by microorganisms for further
degradation of TCP. Moreover, strain HN3 was also capable to grow in phosphorus free
medium containing CP as the only P source (data not shown) indicating utilization of
DETP as P source. Importantly, detection of methylation product of TCP that is TMP is
another discovery about the potential of the strain HN3. Furthermore, subsequent
disappearance of TMP obviously supports degradation of TMP as well.
Identification of dechlorination products viz 3,5 dichloropyridine, 3-chloro-2-
pyridinol and 3,5-trichloro-2-methoxypyridine confirms the degradation of TCP and
TMP because as their structures indicate the removal of chlorine atoms from them.
Further appearance of a ring cleavage product, maleamic acid is a strong evidence of
breakage of pyridine ring and consequently TCP degradation. Moreover, the mass
spectrum of CP contains three peaks corresponding to m/z 314, 258 and 286 were
observed. According to Reddy et al., (2012) peak with m/z 314 corresponds to [M-HCl]
and that with 286 and 258 are obtained after removal of one and two ethylene molecules
form m/z 314 respectively. These findings enabled us to predict a pathway for the CP
Chapter 4 Biodegradation of chlorpyrifos
161
biodegradation which can be a very good addition to the existing repertoire of knowledge
about biodegradation of chlorpyrifos. Concerning the investigation of degrading genes in
Mesorhizobium sp. HN3, we could only amplify the opdA gene. The variants of opdA
gene have been reported in different bacteria capable of hydrolyzing a variety of
organophosphate pesticides (Horne et al., 2002; Sharaf et al., 2006). However,
identification of protocatechuate dioxygenase (PCD) encoding gene (pcaH) indicate the
capability of the strain HN3 to degrade aromatic compounds as PCD is the key enzyme
involved in the β-keto adipate pathway which is the main pathway for the degradation of
aromatic compounds (Azhari et al., 2007). Therefore, identification of pcaH in the
chlorpyrifos degrading HN3 strain indicates the efficacy of the strain in breaking
aromatic pyridine ring thus degrading the pesticide to harmless products.
Further, genetic mechanism involved in the hydrolysis of chlorpyrifos degrading
bacteria could not be determined conclusively hence it leaves a speculation of some novel
genetic degradation pathway.
Chapter 5 Bio-stimulation
162
Chapter 5
Bio-stimulation: Microbe Assisted Phytoremediation
5.1 Introduction
CP has low water solubility (2 mg/l) and strong affinity for organic matter and
soil particles, hence, its residues remain in the environment for undefined period of time
(DeLorenzo, 2001; Gavrilescu, 2005). The absorption and translocation of CP residues by
wheat and oil seed rape roots and other crop systems have been reported (Wang et al.,
2007) and its residues have also been detected in vegetables, cattle meat and fruits
(Parveen et al., 2004; Mohammad et al., 2010). Exposure and uptake of CP may
adversely affect the plant in terms of its growth and physiology such as delayed
emergence of seedlings (Sinclair et al., 1992) and deformities in fruits (Beck et al.,
1991). The problems associated with CP pose serious concerns regarding the health of
environment as well as inhabitants of the environment which in turn arouse need to pay
utmost attention towards remediation of CP in eco-friendly and cheaper way described
earlier in the context of bioremediation.
Phytoremediation, use of plants for the detoxification of pollutants in the
environment, is accomplishing a significant level of public attention and becoming a
rapidly expanding field owing to its ‘green’ approach, (Aken et al., 2010; Huang et al.,
2011). In this regard, biovailavility and phytotoxicity of the contaminant and
biodegradation/biotransformation capability of the plant are important parameters to be
considered (Wang et al., 2008; Abhilash et al., 2013). However, one of the limitations is
that pollutants adversely affect the plant growth resulting in reduced biomass which in
turn could influence the phytoremediation process (Gaskin et al., 2008; Weyens et al.,
2009). This limitation has been compensated by the combined use of plants and
microorganisms for the remediation of contaminated sites (Khan et al., 2012; Segura et
al., 2009). Term rhizoremediation has been employed for microbe assisted
phytoremediation which involves mutual interactions of plant and rhizospheric
microorganisms exhibiting contaminant degradation activities. More recently, enhanced
pollutant removal by plants in combination with bacterial endophytes capable of
degrading a certain contaminant has been demonstrated as a promising approach to
Chapter 5 Bio-stimulation
163
alleviate contaminant induced stress on the plant and increase remediation efficiency
(Kang et al., 2012; Ho et al., 2013).
In some cases, it has been demonstrated that plants can stimulate the pesticide
degradation by microbial communities (Yu et al., 2003; Sun et al., 2004).
Phytoremediation of CP and involvement of associated microbes is also limited to few
studies (Moore et al., 2002; Lee et al., 2012; Dubey and Fulekar, 2012). The present
study describes the inoculation of a chlorpyrifos degrading Mesorhizobium sp. HN3 in
the rhizosphere of ryegrass for enhancing the degradation of the pesticide. Ryegrass is a
good choice to exploit plant-microbe interactions for degradation of contaminants
because of its extensive root system that helps in improving the growth of microbes in its
rhizosphere and in turn the remediation potential of the system is enhanced (Korade and
Fulekar, 2009a). Mesorhizobium sp. HN3 is a CP degrading bacterium isolated and
characterized in our research group (Jabeen et al., 2014). It belongs to plant growth
promoting rhizobia and survives in the plant rhizosphere as well as in the bulk soil.
Moreover, its ability to live as plant endophyte was exploited for the degradation and
removal of CP residues accumulated in plant roots and shoots hence rendering it a good
candidate for the detoxification of CP.
5.2 Materials and Methods
5.2.1 Soil fortification with CP
The experimental soil was without background contamination of pesticides.
Technical grade CP (5% stock solution in acetonitrile) was used to spike 20 g sand and
mixed with 25 % of the experimental soil. The solvent (acetonitrile) was allowed to
disperse and evaporate completely at room temperature for about 24 hours. The spiked
soil was mixed with the rest of the experimental soil to obtain a final concentration of 50
mg/kg (w/w). The experimental soil was the mixture of soil and sand (for aeration,
drainage and storage capacity of water and nutrients).
5.2.2 Bacterial strains used in the study
Mesorhizobium sp. HN3 was employed in this study. E. coli DH5α carrying a
broad host range ampicillin resistant (AmpR) plasmid pBBRIMCS-4 (Kovach et al.,
Chapter 5 Bio-stimulation
164
1995) containing yfp (yellow fluorescent protein) cassette was obtained from National
Institute for Biotechnology and Genetic Engineering, NIBGE, Biotechnology Resource
Centre (NBRC), Faisalabad.
5.2.3 Plasmid used for transformation
Plasmid DNA (AmpR, plasmid pBBRIMCS-4 containing yfp cassette) was
isolated from E.coli srain DH5 following Mini-prep standard protocol. The
composition of the solutions used for mini-prep is described in Appendix 11.
E. coli was grown overnight in LB broth containing ampicillin (50 mg/ml) in a
rotary shaker at 37°C and 100 rpm with constant shaking. Culture (5 ml) was transferred
into eppendorff tubes, centrifuged at 8000 rpm for one minute and supernatant was
discarded. The pellet was resuspended in 100 µl ice-cold Solution 1 followed by the
addition of 150 µl Solution 2. The suspension was incubated at room temperature for 5
min and immediately after incubation, 200 µl Solution 3 was added and incubated on ice
for 10 min. The chilled suspension was centrifuged for 5 min at 8000 rpm and the
supernatant was transferred to fresh micro centrifuge tubes.
1 ml of absolute ethanol was added to the supernatant and incubated for 20 min at
-20°C and centrifuged at 14000 rpm for 5 min. Supernatant was discarded and the pellet
was washed twice with 70% ethanol. The washed pellet was dried and re-suspended in 30
µl TE buffer (Tris-EDTA buffer). The plasmid DNA was separated through
electrophoresis using 1% agarose gel.
5.2.4 Preparation of electrocompetent cells of Mesorhizobium sp. HN3
Electrocompetent cells of Mesorhizobium sp. HN3 were prepared following Wu
et al., (2010). 48 h grown culture of Mesorhizobium sp. HN3 was harvested and 5 ml
was used to inoculate a secondary culture in 500 ml flask containing 250 ml LB medium
which was again incubated in rotary shaker at 37°C until the cell density reached
OD600nm=0.6. The culture was transferred aseptically into ice cold 45 ml falcon tubes,
incubated on ice for 30 minutes and centrifuged at 6000 rpm for 10 minutes at 4°C. The
pellet was re-suspended in 45 ml sterile cold 10% glycerol and centrifuged. Cells were
re-suspended in 25 ml 10 % glycerol and centrifuged followed by the re-suspension in 18
Chapter 5 Bio-stimulation
165
ml cold 10% glycerol and centrifugation. Finally the cells were re-suspended in 1 ml
filter sterilized cold 10 % (v/v) glycerol and cell aliquots of 200 µl were prepared and
stored at -80ºC.
5.2.5 Electroporation of yfp gene into Mesorhizobium sp. HN3
Frozen electro-competent cells were allowed to thaw on ice. Plasmid DNA
pBBRIMCS-4 conatining yfp was introduced into the Mesorhizobium sp. HN3 by
electroporation following Shahid et al., (2012). For this purpose, an electroporator, Gene
Probe set at a R5 (129 ohm) resistor, 25 µF capacitor and 12.5 KV/cm field strength, was
used. Desired pulse length was 5-6 msec. Mixture of HN3 cells (200 µl) and plasmid
DNA (1 µl = 0.1 µg) was transferred into the electroporation cuvette. Following a short
electric pulse, 1 ml LB medium was mixed gently to the transformation mixture; the
whole mixture was transferred into a fresh 1.5 ml eppendorff tube and incubated at 37°C
for 45 minutes with constant shaking.
The transformed cells were screened on LB-ampicillin (50 µg/µl) agar plates and
the transformed colonies were confirmed under Confocal Laser Scanning Microscope
(CLSM) at 530 nm. The transformed bacterium was named as Mesorhizobium sp.
HN3yfp. Inoculum of HN3yfp (10
7 CFU/ml) was prepared as described in Chapter 2
Section 2.10 and used for CP remediation studies.
5.2.6 Experimental design
Ryegrass (RG, Lolium multiflorum var Taurus) previously reported to tolerate CP
(Korade and Fulekar, 2009a; Ahmad et al., 2012) was used in these studies. For the
experiment, the plastic pots (1.5 kg soil each) were filled with agricultural soil spiked
with CP (50 mg/kg). The study included following treatments:
1. CP contaminated soil (Soil+CP)
2. CP contaminated soil inoculated with HN3yfp (Soil+CP+HN3yfp).
3. Ryegrass planted in un-contaminated soil (Soil+RG)
4. Ryegrass planted in CP contaminated soil (Soil+RG+CP)
5. Ryegrass planted in CP contaminated soil and inoculated with HN3yfp
(Soil+RG+CP+HN3yfp)
Chapter 5 Bio-stimulation
166
The seeds of the Lolium multiflorum were surface sterilized, soaked in bacterial
suspension (except for the un-inoculated treatments) and finally sown in each pot (150
seeds/pot) containing CP spiked soil. For the inoculated treatments, the soil was mixed
with 50 ml bacterial suspension (3.3×105 CFU/g of soil) and with 0.85% NaCl for the un-
inoculated control treatments before sowing. The plants were grown in green house at a
temperature of 25±2°C with 16 h light and 8 h dark. The pots were watered when needed
for 45 days. One week following seed germination, seedlings were counted, poor
emerging were removed and 100 plants were maintained per pot. Plants were harvested
after 15, 30 and 45 days of experiment and shoots were cut 2 cm above ground, roots
were separated from the bulk soil and the soil from each pot was mixed thoroughly to get
homogenized samples for CP residue analysis. CP concentration in the rhizosphere of
ryegrass, bulk soil and within plant tissues, plant growth parameters, bacterial population
in soil and roots were observed. Whole experiment was performed in triplicates.
5.2.7 Extraction and analysis of chlorpyrifos residues in the soil and plant
CP and TCP residues were extracted from rhizospheric (planted) and bulk (un-
planted) soil following the protocol described in chapter 2 Section 2.12.4 for extraction of
soil from the soil. CP residues were extracted from residues from roots and shoots
following Ahmad et al., (2012). The protocol is described in Appendix 12. The
estimation of CP and TCP in soil, root and shoot samples was carried out using HPLC as
described in Chapter 4 Sections 4.2.4.
5.2.8 Detection and enumeration of the bacteria in the soil
Rhizospheric soil was collected by removing soil adhered to roots and suspended
in 10 ml 0.85 % saline solution. The suspension was agitated for 1h at 37°C, the soil
particles were allowed to settle down and 10 fold dilutions were prepared. Same
procedure was adopted for bulk soil. By spreading these dilutions on LB-CP-ampicillin
(50 µg/ml) agar plates and incubating, HN3yfp colonies were counted. Ampicillin
resistance is the result of an enzyme, beta lactamase which breaks down the ampicillin.
Ampicillin resistant gene usually serves as a useful selectable marker and bacteria that
are subjected to introduce a foreign DNA into a cell are grown on the medium containing
Chapter 5 Bio-stimulation
167
ampicillin. The bacterial colonies which successfully grow on the ampicillin containing
medium are taken up and selected for the expression of the introduced DNA/gene. The
colonies morphologically similar to Mesorhizobium sp. HN3yfp were further confirmed
by restriction fragment length polymorphism (RFLP) analysis of 16S-23S rDNA
intergenic spacer region (IGS) using genomic DNA of the randomly selected bacterial
colonies as described earlier (Chapter 3 Section 3.2.2).
5.2.9 Root and shoot colonization by Mesorhizobium sp. HN3yfp
For observing colonization of Mesorhizobium sp. HN3yfp in the plant tissues, 15,
30 and 45 days old roots and shoots of the ryegrass were washed separately with sterile
distilled water as soon as they were harvested. The washed root and shoot samples were
examined under CLSM (Olympus Fluoview Version 1.3) at 4X and 10X magnifications
for observing the colonization of Mesorhizobium sp. HN3yfp within ryegrass root hairs,
root and shoot surfaces and inside the tissues.
1. Measurement of growth parameters
Plant growth parameters measured were length and weights (fresh and dry) of root
and shoot at each harvest. Elongation of roots and shoots was measured using a ruler.
Fresh weights were measured by directly weighing the freshly separated and cleaned
roots and shoots with a physical balance. For assessing the dry weights, the roots and
shoots were dried in oven at 65°C for 8-12 hours until a constant weight was achieved.
5.2.11 Phosphate solubilization
Capability of the chlorpyrifos degrading isolate HN3 to solubilize phosphate was
also explored to check its potential in plant growth promotion. For this purpose,
Pikovskaia (1948) medium was prepared with Pikovskaia’s agar and tri-calcium
phosphate as insoluble phosphate. Overnight grown bacterial culture of LB media (10 µl)
was spotted onto the plates containing the above media. The plates were incubated at
37°C until a clear zone appeared around the culture spots. This clear zone was considered
as a sign of positive result for phosphate solubilization.
Chapter 5 Bio-stimulation
168
5.2.12 Indoleacetic acid production
A colorimetric assay was performed for indoleacetic acid (IAA) production from
Mesorhizobium sp. HN3 (Gordon and Weber, 1951). For this purpose a fully grown
bacterial culture (100 µl) was transferred into eppendorf vials containing LB (200 µl)
supplemented with 100 mg/l tryptophane (as a precursor of IAA) in three replicates.
Eppendorf vials were incubated at 30°C without shaking. The incubated cultures were
mixed with Salkowski reagent (Appendix 13) in 96-well microtitre plate. IAA standard
(100 µl) was mixed with the same volume of Salkowski reagent. The isolates were
observed instantly for the development of pink, purple or purplish pink color after mixing
for 30 minutes. Quantitative estimation of IAA was carried out following Tien et al.,
(1979). Bacterial culture was grown for 7 days in LB- broth supplemented with
tryptophan (100 mg/l). Cells were harvested at 8000 rpm, culture supernatant was
acidified with hydrochloric acid (to get a pH 2.8) and extracted twice with an equal
volume of ethyl acetate. The extracts were collected, dried, re-suspended in ethanol and
analyzed on HPLC.
5.2.13 Data analysis
Statistical analyses of plant biomass and CP & TCP degradation in soil, roots and
shoots were performed on three replicates of data obtained from all treatments. Standard
error and the significance of differences were treated statistically by the ANOVA and
evaluated by post hoc comparison of means using Tukey’s test in Statistica 6.0 software.
The degradation rate constants and theoretical half-life values (DT50) of CP
degradation in soil and were determined using algorithms Ct/C0= e-kt
and from the linear
regression equation between ln(Ct/C0) and time as already described in previous chapters.
Chapter 5 Bio-stimulation
169
5.3 Results
5.3.1 Biodegradation of CP in the planted and un-planted soil
The residual concentration of the CP was determined to assess the effect of
ryegrass and Mesorhizobium sp. HN3yfp partnership on CP degradation in contaminated
soil. CP degradation and TCP accumulation and removal were compared between three
treatment soils i.e., planted (un-inoculated), un-planted (inoculated), and
planted+inoculated soil (Figures 5.1A & B). After 15 days of sowing, 22% of the added
CP was degraded in the planted soil (un-inoculated) whereas in the inoculated (un-
planted) soil, 36% degradation was achieved. On the other hand when the planted soil
was inoculated with Mesorhizobium sp. HN3yfp, 44% of the total applied pesticide was
degraded. At the end of the experiment (45 days), the CP degradation was 79% and 91%
in the planted (un-inoculated) and inoculated (un-planted) soils respectively whereas
complete degradation was achieved in the planted+inoculated soil as no residual pesticide
was detected in the soil samples (planted+inoculated soil) . Hence inoculation of
Mesorhizobium sp. HN3 in the planted soils significantly enhanced the removal of CP as
compared to un-inoculated soils. Furthermore, kinetic analysis (Table 5.1) showed that
higher degradation rate and lower half-life values of CP were achieved in the plant-
bacterial system as compared to those containing plants or bacteria solely.
Regarding the accumulation and degradation of TCP, at the first harvest (15 days
of the experiment) 9 and 10 mg/kg TCP was observed in the solely planted and solely
inoculated soils respectively which continued to increase upto 30 days and then declined
towards the end of experiment leaving 11 and 7 mg/kg TCP. Whereas, higher TCP
concentration (15 mg/kg) was found in the planted+inoculated soil at the first harvest
which further indicate higher CP degradation in this treatment. However, it decreased
gradually and more rapidly as compared to other treatments leaving only 3 mg/kg after 45
days.
Chapter 5 Bio-stimulation
170
Figure 5.1 Degradation of CP (A) and accumulation and subsequent disappearance of
TCP (B) as a result of CP hydrolysis by ryegrass (Lolium multiflorum) and
Mesorhizobium sp. HN3 in different treatment soils at different time ntervals. Each value
is the mean of three replicates with error bars representing the standard error
B
A
Chapter 5 Bio-stimulation
171
Table 5.1: First order kinetics parameters of chlorpyrifos degradation in planted
and un-planted soils.
Where, k = First order rate constant for degradation
C0 = Initial CP concentration
Ct = CP concentration at time (t)
t1/2 = Half-life of CP
R2 = Regression coefficient
Treatments Regression equation R2 k (Day
-1) t1/2(Days)
Control ln(Ct/C0)= -0.0042x+3.915 0.995 0.0042 165
Planted ln(Ct/C0)= -0.0353x+4.038 0.963 0.0353 20.5
Inoculated ln(Ct/C0)= -0.0532x+4.094 0.956 0.0532 13
Planted+inoculated ln(Ct/C0)= -0.0858x+4.291 0.929 0.0858 8
Chapter 5 Bio-stimulation
172
5.3.2 Chlorpyrifos uptake by plant
Residual concentrations of chlorpyrifos in vegetative parts (root and shoot) of
ryegrass indicating uptake of the pesticides by the plant are presented in Table 5.2. Plants
vegetated in un-inoculated soil exhibited significantly higher concentration of CP in roots
and shoots as compared to plants vegetated in HN3yfp inoculated soil.
Table 5.2: CP uptake and accumulation in roots and shoots of ryegrass.
Values are the means of three replicates for CP uptake and followed by the standard error
(in the parentheses). For control no pesticide was added to the soil.
Treatments CP uptake (µg/g plant dry mass)
Roots Shoots
50 mg/kg
Control
(Un-inoculated) 0.41 (0.03) 0.22 (0.025)
Inoculated
(HN3yfp
) 0.13 (0.04) Not found
Chapter 5 Bio-stimulation
173
5.3.3 Colonization of Mesorhizobium sp. HN3 in soil
In general, Mesorhizobium sp. HN3yfp population declined with time in the un-
planted or bulk soil. However, in the planted or rhizospheric soil, the inoculant
proliferated above the initially inoculated level and reached 106 CFU/g (Table 5.3).
However, the population declined towards the end of experiment. In sum, total
population of bacteria was higher in the rhizospheric soil than in the bulk soil throughout
the course of experiment.
5.3.4 Colonization of Mesorhizobium sp. HN3 in the roots and shoots ryegrass
Use of fluorescently (yfp) tagged Mesorhizobium sp. HN3 and CLSM enabled to
demonstrate that HN3yfp actively colonized the ryegrass roots. The entire colonization
process i.e. starting from the attachment of bacteria with root hairs and lateral roots to
invasion into the internal tissues of the roots was observed. At each harvest, fluorescence
denoted the presence of bacterial aggregates on root hairs and the junctions between the
primary and lateral root surfaces indicating the possible points of entry into the ryegrass
roots. Maximum colonization was observed on the lateral root surfaces, root tips and the
zone of elongation and differentiation (Figure 5.2-5.4). Fluorescence was not detected in
un-inoculated control. These results confirmed the colonization of Mesorhizobium sp.
HN3 inside ryegrass roots rendering it active endophyte
Chapter 5 Bio-stimulation
174
Figure 5.2 CLSM images of Mesorhizobium sp. HN3yfp colonization in ryegrass roots
after 15 days of inoculation. (A) In vitro grown cells at 100X (B) time course
colonization process of Lolium multiflorum (ryegrass) roots by yfp-tagged
Mesorhizobium sp. HN3 to show bacterial colonization on root tip surfaces, (C) inside the
lateral roots and root hairs. Arrows indicate the aggregates of bacterial cells (bright
green) attached inside or outside the roots surfaces, the root tip and root hairs.
Chapter 5 Bio-stimulation
175
Figure 5.3 CLSM images (10X) of time course colonization process of Lolium
multiflorum (ryegrass) roots by Mesorhizobium sp. HN3yfp after 30 days of inoculation
to show bacterial colonization on lateral roots (A, C), inside the roots (B) and inside the
root tip and root hairs (D). Arrows indicate the aggregates of bacterial cells (bright green)
attached inside or outside the roots surfaces, the root tip and root hairs
Chapter 5 Bio-stimulation
176
Figure 5.4 CLSM images (10X) of time course colonization process of Lolium
multiflorum (ryegrass) roots by Mesorhizobium sp. HN3yfp after 45 days of inoculation
to show bacterial colonization inside the root hairs (A), inside and outside the root
surfaces and root tip (B,C,D). Arrows indicate the aggregates of bacterial cells (bright
green) attached inside or outside the roots surfaces, the root tip and root hairs.
Chapter 5 Bio-stimulation
177
Table 5.3: Colonization of Mesorhizobium sp. HN3yfp in planted (ryegrass) and un-
planted soil
Each value is a mean of three replicates.
Treatments CFU/g soil
Zero day 15 Days 30 Days 45 Days
50 mg/kg
Control (inoculated with HN3yfp)
3.3105
2.1105
1.4104
4.9103
Ryegrass and inoculated (HN3yfp) 3.3105 8.510
5 6.610
6 2.110
5
Chapter 5 Bio-stimulation
178
5.3.5 Plant biomass
Contamination of soil with CP drastically decreased plant growth as indicated by
various growth parameters of plant such as root length (RL), shoot length (SL), root &
shoot fresh weights (RFW & SFW) and root & shoot dry weights (RDW & SDW). A
significant decline was observed in RL and SL of ryegrass planted in the CP
contaminated soil, however, both the parameters increased in HN3yfp inoculated soil.
Similarly a significant decrease in the RFW and SFW was observed in the CP
contaminated soil as compared to un-contaminated soil. When CP contaminated soil was
inoculated with HN3yfp significantly (P<0.05) higher RFW and SFW were observed
(Table 5.4). Root and shoot dry weights corresponded with the RFW and SFW of
ryegrass in all the treatments. Difference in the root and shoot length of different
treatment plants is shown in Figure 5.5.
Chapter 5 Bio-stimulation
179
Figure 5.5 A comparison of shoot lengths (A) and root lengths (B) among
different treatments of experiment: control ryegrass plant (a), ryegrass plant
grown in CP contaminated soil (b) and ryegrass plants grown in CP contaminated
soil inoculated with Mesorhizobium sp. HN3 (c).
a c b A
c b a B
Chapter 5 Bio-stimulation
180
Table 5.4: Effect of chlorpyrifos on plant growth parameters {root length (RL), shoot
length (SL), root fresh weight (RFW), shoot fresh weight (SFW), root dry weight (RDW)
and shoot dry weight (SDW)}
Each value is mean of three replicates. Means in the same column followed by the
different letters are significantly different at a 5 % level of significance. Standard error of
three replicates is presented in parenthesis.
Sampling
days Treatments RL (cm) SL (cm) RFW (g) SFW (g) RDW (g) SDW (g)
15 Ryegrass only
8.20e(0.1) 8.39e(0.39) 3.00f(0.05) 3.70f(0.06) 0.52ef(0.03) 0.65e(0.02)
CP+ Ryegrass
7.75e(0.25) 7.50e(0.50) 2.56f (0.170) 2.87f (0.09) 0.45e(0.01) 0.51e(0.03)
CP+HN3 yfp +Ryegrass
9.87de(0.07) 9.59e(0.185) 3.32ef (0.31) 4.32f (0.03) 0.62f (0.04) 0.81f (0.04)
30 Ryegrass only 11.50cd(0.5) 17.5d(0.50) 7.44de(0.26) 15.00e(0.50) 1.23e(0.00) 2.63de(0.11)
CP+ Ryegrass 10.25b(0.25) 14.65c(0.35) 6.67cd(0.45) 13.50d(0.50) 1.19cd(0.20) 2.41de(0.01)
CP+HN3yfp+Ryegrass 15.25b(0.95) 19.90bc(0.90) 9.38c(0.56) 20.00d(1.00) 1.76d(0.15) 3.76d(1.00)
45 Ryegrass only 16.60bc(0.5) 30.00b(2.0) 17.15a(1.15) 30.00c(0.50) 3.01b(0.44) 5.27c(0.40)
CP+ Ryegrass 13.27a(1.23) 25.50a(0.50) 14.05b(0.25) 26.96b(0.15) 2.51a(0.05) 4.82b(0.50)
CP+HN3 yfp +Ryegrass 20.83a(0.47) 34.50a(0.50) 18.62a(0.19) 35.75a(0.45) 3.49c(0.15) 6.72a(1.00)
Chapter 5 Bio-stimulation
181
5.3.6 Plant growth promoting properties of Mesorhizobium strain HN3
5.3.6.1 Indoleacetic acid production
Indoleacetic acid (IAA) production by the Mesorhizobium strain HN3 was recorded upto
5.34 pp. Moreover, colorimetric method indicated the color change in the medium from
colorless to purplish pink which was very close to the color of the standard solution
(Figure 5.6).
5.3.6.2 Phosphate solubilization
A clear zone was formed by solubilizing tricalcium phosphate on the Pikoviskaya
medium plates inoculated with Mesorhizobium sp HN3 which indicates the high
capability of the strain HN3 to solubilize phosphate (Figure 5.7).
Ability of Mesorhizobium sp. HN3 to solubilize phosphate and IAA production
along with CP degrading potential demonstrate its high ability to promote plant growth
which would render this strain a very good tool in plant growth promotion in the polluted
soils.
Clear zone of Phosphate -
solubilization
Clear zone of P-solubilization
Figure 5.7 Qualitative test of phosphate
solubilization by Mesorhizobium sp. HN3 on
Pikoviskaya medium
Figure 5.6 Qualitative test of IAA production by
Mesorhizobium sp. HN3 using Ferric chloride.
A). Standard solution for IAA. B). IAA
production by Mesorhizobium sp. HN3
Chapter 5 Bio-stimulation
182
5.4 Discussion
Bioremediation of toxic pollutants employing bacteria that possess pollutant
removing capability towards a given contaminant is generally considered as a safe and
advantageous technology. However, sometimes bacteria cannot successfully thrive in the
contaminated sites. In such cases bio-stimulation i.e. use of nutrients and electron
acceptors might help bacteria to survive/multiply and hence enhance bioremediation
process. Although, phytoremediation (use of green plants for the pollutants remediation)
is emerging as a promising technology due to its low cost and minimal environmental
disturbances, however, use of plants along with microorganisms (also referred to as
phyto-stimulation) is a contemporary approach for enhancing the removal of
environmental contaminants (Segura et al., 2009; Weyens et al., 2009).
Inoculation of organic pollutant degrading bacteria in the plant rhizosphere has
recently been reported as a useful strategy for bioremediation (McGuinness and Dowling,
2009). Among other plants, ryegrass (Lolium multiflorum) has been revealed as a good
candidate for such studies because of its extensive root system and capability to support
the microorganisms in its rhizosphere which in turn enhance pollutant degradation.
In the current study suitability of plant-bacteria partnership using a CP degrading
Mesorhizobium sp. HN3yfp and ryegrass plant for the remediation of CP contaminated
soil was investigated. A comparative study of CP degradation in the rhizospheric and
bulk soil (planted and un-planted soil respectively) was carried out. Lower rates of CP
and TCP degradation were observed in soils solely planted with ryegrass or solely
inoculated with HN3yfp whereas the rates increased to maximum following the combined
use of the two. Higher rate of bacterial degradation of CP in the rhizospheric soil as
compared to that in the bulk soil displays the importance of plant root exudates (vitamins,
amino acids and other nutrients) that can nourish microbes in the rhizosphere and also
induce biochemical pathways which in turn display the enhanced CP degradation. It has
already been reported that even though many endophytic bacteria are capable of living in
bulk soil, their pollutant degradation efficiency is higher in the rhizospheric soil because
they need plant exudates to boost up the pollutant degrading enzyme activities (Leigh et
al., 2002).
Chapter 5 Bio-stimulation
183
Relatively low concentrations of CP in the roots of the inoculated plants were
observed as compared to the un-inoculated plants. Very interestingly, in the presence of
HN3yfp, no CP was detected in the shoots as compared to the shoots of un-inoculated
plants. A possible explanation for this finding could be the extensive colonization of the
Mesorhizobium sp. inside the roots of ryegrass which would be responsible for maximum
degradation of CP accumulated within the roots and hence no CP could move towards
shoots.
Colonization studies of HN3yfp in the soil and inside the plant revealed that
HN3yfp colonized both in the rhizosphere and inside the roots of ryegrass which is not
surprising because most of the endophytes have been reported as capable of surviving
outside their host plant (Di Fiori and Del Gallo, 1995). Higher proliferation of HN3yfp in
the rhizospheric soil as compared to that in the bulk soil can be attributed to the fact that
plant roots release exudates that can nourish microbes in the rhizosphere (Leigh et al.,
2002). Moreover, root exudates also stimulate chemo tactic movements in bacterial cells.
Further, a decline in the rhizospheric population of the inoculant at the end of the
experiment could mean that HN3yfp tended to move into the plant roots from rhizosphere
and built up its population inside the plant. It also supports the previously established
view that endophytic pollutant degrading bacteria get more abundant inside the plant
tissues in contaminated sites (Siciliano et al., 2001) and that endophytic bacteria existing
in the rhizosphere make their path towards internal plant parts (Sturz et al., 2000; Prieto
et al., 2011).
The inoculants, HN3yfp was found densely populated on the root surface and
inside roots including zone of differentiation and elongation, inside the tip, the root hairs
and other root parts. Although, bacterial colonization inside root hairs has been scarcely
reported, in the present studies, ryegrass root hairs were intensely colonized by HN3yfp.
Root hairs can be regarded as the possible entry points for the inoculants. Shoot
colonization of the inoculants was not observed which is in harmony with the fact that
high densities of endophytes are generally observed in the roots and decrease from stem
to the leaves (Prieto et al 2011; Moore et al., 2006; Weyens et al., 2012).
Although, numerous reports indicate the role of rhizospheric bacteria in
improving the phytoremediation of pollutants (Gerhardt et al., 2009; Afzal et al., 2011),
Chapter 5 Bio-stimulation
184
effective use of endophytic bacteria to improve phytoremediation of organic
contaminants is a relatively new concept (Germaine et al., 2006; Ho et al., 2012, 2013).
The current results compliment to some recent findings that phytoremediation of
aromatic contaminants can be enhanced by inoculation of functional endophytic bacterial
species.
Root and shoot growth decreased in the CP contaminated soil as compared to the
un-contaminated soil which might be attributed to the toxic effects of CP and TCP.
Pesticides are known to inhibit the plant growth by disrupting the synthesis of DNA and
proteins in the cells (Sinclair et al., 1992; Pereira et al., 2010). Reduction in the seed
germination of ryegrass with increasing the CP concentration has been reported
previously (Korade and Fulekar, 2009b) and attributed to different kinds of impairments
associated with the cell division apparatus. It was further explained that the CP induced
toxicity in cell division stages ultimately induces abnormalities in the seedlings hence
seed germination is adversely affected.
An increase in the plant growth parameters in contaminated soil in the presence of
inoculant, Mesorhizobium sp. HN3yfp can be explained by the fact that the inoculant is an
efficient degrader of CP and TCP. We believe that due to degradation of CP and TCP by
the HN3yfp, toxic effects of the pesticide were alleviated and hence root and shoot
growth was not hindered. Microorganisms (rhizospheric or endophytic) are known to
play a central role in conferring tolerance to plant against specific xenobiotics (Siciliano
et al., 2001). Moreover, HN3yfp belongs to PGPR owing to IAA production and P-
solubilization activity and hence can impart its role in enhancing ryegrass growth.
Proliferation of the bacterium in the rhizosphere and within the roots of ryegrass also
supports the fact that HN3yfp might have enhanced the plant growth owing to its plant
growth promoting activities. Our findings are in line with the previous studies showing
the importance of PGPR inoculation in relieving the contaminant stress in the plant
environment (Glick, 2003).
Here we conclude that Mesorhizobium sp. HN3 used in the present study is
interestingly an example of facultative endophyte that can also colonize the rhizosphere
and efficiently degrades CP in the rhizosphere and within the roots. A few endophytes of
Lolium multiflorum have been reported that settle in its roots and shoots and assist in
Chapter 5 Bio-stimulation
185
degrading hydrocarbons (Yousaf et al., 2010), Mesorhizobium sp. as a root endophyte of
this plant has never been reported. Moreover, colonization of the pesticide degrading
endophytic bacteria inside the ryegrass roots has not been reported earlier.
Mesorhizobium sp. HN3 hindered the translocation of the pesticide inside plant parts and
hence can potentially be employed for controlling CP movement into plant tissues.
Chapter 6 General Discussion
186
Chapter 6
General discussion
Aim of thesis
The pesticides entered into the environment as the beneficial tools to cope with
agricultural problems. They resulted in a great revolution in agricultural products as they
control the insect vector of different diseases, pests of plants and crops thus improving
the crop protection. However, extensive applications of toxic chemical pesticides played
havoc with human and other life forms as their residues persist in the environment for the
variable period of time. These toxic pesticide residues significantly disturb the ecosystem
by affecting the non target micro & macro flora and fauna. Initially organochlorines
(OCs) were introduced and they were found effective for pest control but appeared to be
very much persistent as well as toxic for non target aquatic and terrestrial life and hence
had a negative impact on the environment. To combat this problem, OPs, carbamates and
pyrethroids were introduced. They were considered less persistent and less toxic than
OCs. However, later on, the researchers found that OP, carbamates and pyrethroids also
had the toxic impact on disturbing the ecological balance and health of humans and
animals (Reviewed in chapter 1).
In the recent years, the use of organophosphate pesticides and their metabolites
have been recognized as an emerging worldwide problem and their impacts are now
becoming a subject of wider scientific and the social interest. Previous reports have
shown that microorganisms are the key players that work in the diverse range of the
environment and can survive against environmental fluctuations. Repeated applications
of a same pesticide at a particular site help microorganisms adapt capabilities to utilize
the pesticide as a source of carbon and energy. This phenomenon is called “enhanced
biodegradation” which has already been discussed in chapter 1. Hence this capability of
the microorganism is exploited for the benefit of the mankind, wildlife and also for
reducing the xenobiotic stress on the environment.
Therefore, the exploitation of bacterial potential to degrade pesticides was a main
gizmo of this study. Microbial degradation studies were established to investigate the
complete degradation of two model organophosphate pesticides, profenofos and
chlorpyrifos (Chapter 3, 4) by indigenously isolated bacterial strains. Various
Chapter 6 General Discussion
187
environmental factors were optimized for maximum degradation of the two pesticides.
An attempt was made to elucidate the biochemical pathway for both the pesticides. The
main purpose of our study was to achieve systematic understanding of the metabolism of
pesticides by microorganisms and to develop methods for accelerating these metabolic
processes for the bioremediation of contaminated soils and groundwater. Moreover, it
was desired 1) to gain scientific understanding of in situ bioremediation by performing
laboratory and field research on biotransformation and biodegradation of pesticides, and
2) accelerating in situ biodegradation by bio augmentation and bio stimulation processes.
Main findings
The bacterial consortium PBAC
While screening the bacterial strains for the degradation of profenofos, an
efficient bacterial consortium PBAC was obtained. PBAC was found to degrade
profenofos, containing halogenated aromatic moiety, within a week upto 300 mg/L. Its
ability was also checked to remediate the profenofos contaminated soil at lab scale and it
worked remarkably to degrade profenofos as well as its toxic metabolite, BCP which is
rarely reported previously. Its potential was also studied to degrade other pesticides of the
same chemical class and others (Pyrethroids) as well. Surprisingly, it was capable of
degrading all the tested pesticide which is a significant aspect of this bacterial
consortium. Hence this consortium will prove to be a potential candidate for the removal
of organophosphate pesticides from the liquid culture, soil and sediments.
Response surface methodology (RSM) was employed for the optimization of
different environmental factors for degradation of profenofos by PBAC. It was found to
be a useful tool to elucidate the different culture conditions as it enabled us to study three
variables at a time with changing two variables and keeping one constant thus developing
a polynomial equation. This equation can predict % degradation of profenofos for
different levels of variables and can also be helpful for the future researchers and
scientists to predict % degradation for profenofos. RSM is a three-dimentional (3-D)
graphical representation of the data which looks beautiful enough to capture the attention
of viewers and develop an immediate understanding of the trend of the response (%
biodegradation in this case). Another significant aspect of this strategy is that it shifted
Chapter 6 General Discussion
188
the trend of laborious and tedious one-factor-at a time approach towards the study of
multiple factors at a time. In this way it is a time effective approach with maximum
understanding of interaction of multiple variants on the response.
Mesorhizobium sp. HN3, a novel strain
Another key to the thesis was the achievement of a novel chlorpyrifos degrading
Mesorhizobium sp. HN3 which is a rhizobial strain (dwelling in the rhizo-sphere of the
plant). The novelty of the strain lies in the fact that it was a first report of a rhizobial
degradation of xenobiotics, importantly the pesticides. It presented a high capability of
chlorpyrifos degradation at high concentrations. The studies to optimize different culture
conditions depicted the marvellous efficacy of the Mesorhizobium sp. HN3 to tolerate
wider range of the media pH, temperature, inoculum density and different initial pesticide
concentrations. Kinetic analysis of the CP degradation by Mesorhizobium sp. HN3
revealed that this bacterium was helpful to degrade not only the parent compound but its
subsequent toxic hydrolysis metabolite, TCP which had long been known to be a main
culprit causing resistance to CP degradation (Racke et al., 1990). Luckily this strain was
useful to utilize TCP as a carbon source in the presence /or absence of a readily available
carbon source, glucose. This happened to be another important finding of this study.
Bio stimulation of Mesorhizobium sp. HN3 by ryegrass
Mesorhizobium sp. HN3 being a rhizobial strain, was believed (also investigated
in this study) to harbour plant growth promoting properties (PGPR) such as phosphate
solubilisation, indoleacetic acid (IAA) production. These characteristics of PGPR
bacteria are known to help in improving plant growth. Keeping in view these PGPR
properties of the strain (its ability to reside in the rhizosphere of the plant) and its
potential to degrade chlorpyrifos, a microbe assisted phytoremdiation system was
developed using yfp-tagged variant of the strain HN3. The aim of this technology was to
assess the enhanced degradation of chlorpyrifos in the rhizosphere and different parts of
the model plant (ryegrass). yfp tagging of the Mesorhizobium sp. HN3 enabled us to get
visual proof (as confirmed by the CLSM) of the colonization of the HN3 inside the
ryegrass roots. Further, extraction of CP residues from ryegrass roots and shoots and
Chapter 6 General Discussion
189
HPLC analysis provided the evidence of Mesorhizobium sp. HN3 being an efficient
isolate to alleviate the stress on the plant induced by the chlorpyrifos (chapter 5). This
was a remarkable on site preliminary application of the Mesorhizobium sp. HN3. In this
way it appeared to be an exclusively new approach for remediation of pesticide
contaminated soil.
Metabolic pathways
During the bioremediation process, it is important to investigate the fate of
xenobiotics in the environment. To achieve this goal, it was important to elucidate the
biochemical pathways of the two pesticides in question (profenofos and chlorpyrifos) by
their respective isolates. GC-MS was employed for metabolites analysis in a time course
fashion. Successfully both the pesticides were found to be degraded to potentially
harmless products (results discussed in chapter 3 and 4). This finding enabled us to
demonstrate the fate of the two pesticides which can enable the future researchers to
investigate the genes/enzymes involved in the different steps/chemical reactions like
hydrolysis, dehalogenation, oxygenation and ring cleavage of the xenobiotics.
However, in this study, we attempted to find genes involved in different chemical
reactions during the biodegradation of chlorpyrifos and profenofos. Unfortunately no
success was achieved in this area of the study. Although, the primers were designed
based on the previously reported OP degrading genes but their sequences did not show
homology to previously reported OP degrading gene sequences present in the NCBI
database. This indicates that the present isolates might have some novel genes which
need further investigation.
Future recommendations specific to this thesis
1. Microbe assisted phyto-remediation system comprising profenofos degrading
consortium PBAC and ryegrass as model plant can be employed to check the
efficacy of the PBAC for the degradation of profenofos in a way as
determined for the remediation of chlorpyrifos by Mesorhizobium sp. HN3.
Moreover, this strategy can also be applied using other grasses and crops such
as wheat, cotton and rice where the two pesticides are commonly sprayed.
Chapter 6 General Discussion
190
2. On site remediation of profenofos and chlorpyrifos using bacterial consortium
PBAC and Mesorhizobium sp. HN3 respectively in the contaminated soils
(micro plots, field trials) under different environmental conditions can be
carried out. Using this technology, it will be possible to get rid of
contaminating pesticides and hence improving soil quality without any
environmental risks. The process will also be beneficial to farmers interested
in organic farming as it will make it possible to get rid of the pesticide
residues in their lands and hence the products. This is an important step to
meet the quality standards and increasing the export of agricultural and other
products by minimizing the pesticide residues.
3. Identification of unknown metabolites of the chlorpyrifos and profenofos
should be given attention as in the current study, in the total ion
chromatograms of culture extracts of the two pesticides; some peaks were
observed which remained unknown. The investigation of these unknown
metabolites would provide an insight into the metabolic pathways of the
pesticides through GCMS, LCMS or MS/MS.
4. As the genes and enzymes involved in the degradation remained un-identified,
hence study can be planned to solely throw the light on the investigation of
OP degrading genes and enzymes of the isolates of this study. Identification of
genes would help in identifying the enzymes. Based on the concept of
enhanced biodegradation, a comparison can be made between induced and
non induced bacterial cultures using protein expression assays.
Chapter 7 References
191
Chapter 7
References
Abass, K., Reponen, P., Jalonen, J., Pelkonen, O., 2007. In vitro metabolism and interaction
of profenofos by human, mouse and rat liver preparations. Pestic. Biochem. Physiol.
87, 238–247.
Abe, K., Takahashi, S., Kera, Y., 2011. Organophosphorus compounds-degrading bacteria
and enzymes, and their application. In: Koukkou, A. I., (Ed.), Microbial
Bioremediation of Non-Metals: Current Research. Caister Academic Press: Norfolk,
UK, pp.45-54.
Abhilash, P. C., Singh, B., Srivastava, P., Schaeffer, A., Singh, N., 2013. Remediation of
lindane by Jatropha curcas L: Utilization of multipurpose species for
rhizoremediation. Biomass Bioenerg. 51, 189-193.
Abraham, J., Shanker, A., Silambarasan, S., 2013. Role of Gordonia sp JAAS1 in
biodegradation of chlorpyrifos and its hydrolysing metabolite 3, 5,
6‐trichloro‐2‐pyridinol. Lett. Appl. Microbiol. 57, 510-516.
Abraham, J., Silambarasan, S., 2013. Biodegradation of chlorpyrifos and its hydrolyzing
metabolite 3,5,6-trichloro-2-pyridinol by Sphingobacterium sp. JAS3. Process
Biochem. 48, 1559-1564.
Adhya, T. K., Barik, S., Sethunathan, N., 1981. Hydrolysis of selected organophosphorus
insecticides by two bacteria isolated from flooded soil. J. Appl. Microbiol. 50, 167-
172.
Afzal, M., Yousaf, S., Reichenauer, T.G., Kuffner, M., Sessitsch, A., 2011. Soil type affects
plant colonization, activity and catabolic gene expression of inoculated bacterial strains
during phytoremediation of diesel. J. Hazard. Mater. 186, 1568-1575.
Chapter 7 References
192
Afzal,M., Yousaf, S., Reichenauer, T.G., Sessitsch, A. 2012. The inoculation method affects
colonization and performance of bacterial inoculant strains in the phytoremediation of
soil contaminated with diesel oil. Int. J. Phytorem., 14, 35–47
Ahmad, F., Iqbal, S., Anwar, S., Afzal, M., Islam, E., Mustafa, T., Khan, Q. M., 2012.
Enhanced remediation of chlorpyrifos from soil by using ryegrass (Lolium multiflorum)
and chlorpyrifos-degrading bacterium Bacillus pumilus C2A1. J. Hazard. Mater. 237-
238, 110-115.
Aken, B.V., Correa, P.A., Schnoor, J.L., 2010. Phytoremediation of polychlorinated
biphenyls: new trends and promises. Environ. Sci. Technol. 44, 2767-2776.
Alavanja, M.C.R., Bonner, M.R., 2012. Occupational pesticide exposures and cancer risk: A
review. J. Toxicol. Environ. Health B-Crit. Rev. 15, 238-263.
Alavanja, M.C.R., Ross, M.K., Bonner, M.R., 2013. Increased cancer burden among
pesticide applicators and others due to pesticide exposure. CA: A Cancer . J. Clin. 63,
120-142.
Ali, M., Naqvi, T.A., Kanwal, M., Rasheed, F., Hameed, A., Ahmed, S., 2012. Detection of
the organophosphate degrading gene opdA in the newly isolated bacterial strain
Bacillus pumilus W1. Annals Microbiol. 62, 233-239.
Ali, O.A., Badawy, M.I., 1982. Hydrolysis of organophosphate insecticides in aqueous
media. Environ. Int. 7, 373 – 377.
Anderson, B.S., Hunta, J.W., 2003. Integrated assessment of the impacts of agricultural
drain water in the Salinas River (California, USA). Environ. Pollut. 124, 523-532.
Anwar, S., Liaquat, F., Khan, Q.M., Khalid, Z.M., Iqbal, S., 2009. Biodegradation of
chlorpyrifos and its hydrolysis product 3, 5, 6-trichloro-2-pyridinol by Bacillus
pumilus strain C2A1. J. Hazard. Mater. 168, 400-405.
Anwar, T., Ahmed, I., Tahir, S., 2012. Determination of pesticide residues in soils of
Nawabshaw district Sindh, Pakistan. Pak. J. Zool. 44, 87-93.
Chapter 7 References
193
Awasthi, N., Ahuja, R., Kumar, A., 2000. Factors influencing the degradation of soil-
applied endosulfan isomers. Soil Biol. Biochem. 32, 1697–1705.
Azhari, N.E., Chabaud, S., Percept, A., Bru, D., Martin-Laurent, F., 2007. pcaH, a
molecular marker for estimating the diversity of the protocatechuate-degrading
bacterial community in the soil environment. Pest Manag. Sci. 63, 459-467.
Baig, S.A., Akhtera, N.A., Ashfaq, M., Asi, M.R., 2009. Determination of
organophosphorus pesticide in vegetables by High-Performance Liquid
Chromatography. American-Eurasian J. Agric. Environ. Sci. 6, 513-519.
Baldwin, B.R., Nakatsu, C.H., Nies, L., 2003. Detection and enumeration of aromatic
oxygenase genes by multiplex and real-time PCR. Appl. Environ. Microbiol. 69,
3350-3358.
Bano, A., Siddique, S., Pinowski, J., Kavanagh, B., Gorski, W., Pankun, S., et al. 1991.
Chlorinated hydrocarbons [DDT, HCH, Heptachlor, DDE and dieldrin] in the
sediments from the coastal waters of Karachi Pakistan]. Pak. J. Sci. Indus Res. 34.
Barles, R.W., Daughton, C.G., Hsieh, D.P.H., 1979. Accelerated parathion degradation in
soil inoculated with acclimated bacteria under field conditions. Arch. Environ.
Contam. Toxicol. 8, 647-660.
Barthalomew, J.W., Mittewer, T., 1950. A simplified bacterial strain. Strain Technol. 25,
153.
Beck, N.G., Arpaia, M.L., Eckard, K.J., Reints, J.S., Lord, E.M., 1991. The effect of
chlorpyrifos on flower and fruit development in grapefruit, Citrus paradisi
Macfayden. Sci. Horticul. 47, 35–50.
Beketov, M.A., Liess, M., 2008. Acute and delayed effects of the neonicotinoid insecticide
thiacloprid on seven freshwater arthropods. Environ. Toxicol. Chem. 27, 461-470.
Chapter 7 References
194
Bending, G.D., Friloux, M., Walker, A., 2002. Degradation of contrasting pesticides by
white rot fungi and its relationship with ligninolytic potential. FEMS Microbiol.
Lett. 212, 59-63.
Bhadbhade, B.J., Dhakephalkar, P.K., Sarnik, S.S., Kanekar, P.P., 2002. Plasmid-associated
biodegradation of an organophosphorus pesticide, monocrotophos by Pseudomonas
mendocina. Biotechol. Lett. 24, 647-650.
Bhagobaty, R.K., Joshi, S.R., Malik, A., 2007. Microbial degradation of organophosphorous
pesticide: chlorpyrifos (mini-review). J. Microbiol. 4, 1-12.
Bhalerao, T.S., Puranik, P.R. 2009. Microbial degradation of monocrotophos by Aspergillus
oryzae. Int. Biodeterior. Biodegrad. 63, 503-508.
Bicker, W., Lammerhofer, M., Genser, D., 2005. A case study of acute human chlorpyrifos
poisoning: novel aspects on metabolism and toxico-kinetics derived from liquid
chromatography-tandem mass spectrometry analysis of urine samples. Toxicol.
Lett.159, 235-251.
Bidlan, R., Manonmani, H.K., 2002. Aerobic degradation of
dichlorodiphenyltrichloroethane (DDT) by Serratia marcescens DT-1P. Process
Biochem. 38, 49-56.
Blasco, R., Ramos, J. L., Wittich, R.M., 2008. Pseudomonas aeruginosa strain RW41
mineralizes 4-chlorobenzenesulfonate, the major polar by-product from DDT
manufacturing. Environ. Microbiol. 10, 1591-1600.
Booth, L.H., Hodge, S. K., Halloran, O., 2000. Use of cholinesterase in aporrectodea
caliginosa (Oligochaeta; Lumbricidae) to detect organophosphate contamination:
comparison of laboratory tests, mesocosms, and field studies. Environ. Toxicol.
Chem. 19, 417-422.
Box, G. E. P., Wilson, K.B., 1951. On the Experimental Attainment of Optimum Conditions
(with discussion). J. R stat Soc Series B Series B. 13, 1–45.
Chapter 7 References
195
Briceño G., Fuentes, M.S., Palma, G., Jorquera, M.A., Amoroso, M.J., Diez , M.C., 2012.
Chlorpyrifos biodegradation and 3,5,6-trichloro-2-pyridinol production
by actinobacteria isolated from soil. Int. Biodeterior. Biodegrad. 7, 1-7.
Brinch, U.C., Ekelund, F., Jacobsen, C.S., 2002. Method for spiking soil samples with
organic compounds. Appl. Environ. Microbial. 68, 1808–1816.
Bull, D., 1982. A Growing Problem: Pesticides and the Third World Poor. OXFAM
Publications, Oxford, UK.
Bumpus, J.A., Kakkar, S.N., Coleman, R.D., 1993. Fungal degradation of
organophosphorus insecticides. Appl. Biochem. Biotechnol. 39, 715-726.
Cao, L., Liu, H., Zhang, H., Huang, K., Gu, T., Ni, H., Hong, Q., Li, S., 2012.
Characterization of a newly isolated highly effective 3,5,6-trichloro-2-pyridinol
degrading strain Cupriavidus pauculus P2. Curr. Microbiol. 65, 231–236.
Cappello, S., Caruso, G., Zampino, D., Monticelli, L.S., Maimone, G., Denaro.R., Tripodo,
B., Troussellier, M., Yakimov, M., Giuliano, L., 2007. Microbial community
dynamics during assays of harbour oil spill bioremediation: a microscale simulation
study. J. Appl. Microbiol. 102, 184–194.
Chandrasekara, H.U., Pathiratne, A., 2005. Influence of low concentrations of trichlorfon on
haematological parameters and brain acetylcholine esterase activity in common carp.
Cyprinus carpio. L. Aquac. Res. 36, 144-149.
Chaudhry, G.R., Chapalamadugu, S., 1991. Biodegradation of halogenated organic
compounds microbiological reviews.Microbiol. Mol. Biol. Rev. 55, 59-79.
Chaudry, G.R., Ali, A.N., Wheeler, W.B., 1988. Isolation of a methyl parathion-degrading
Pseudomonas sp. that possesses DNA homologous to the opd gene from a
Flavobacterium sp. Appl. Environ. Microbiol. 54, 288-293.
Cheema, A.A., Shah, F.H., 1987. Pesticide residues in fruits and vegetables. Pak. J. Sci. Ind.
Res. 30, 511–512.
Chapter 7 References
196
Chen, Q., Li-na Sun, L., Zhang., He, J., Kwon, S.W., Zhang, J., Li, S.P., , J.G. 2014.
Roseomonas rhizosphaerae sp. nov., a triazophos-degrading bacterium isolated from
soil. Int. J. Syst. Evol. Microbiol. Doi, 10.1099/ijs.0.057000-0.
Chen, S.H., Liu, C.L., Peng, C.Y., Liu, H.M., Hu, M.Y., 2012. Biodegradation of
chlorpyrifos and its hydrolysis product 3,5,6-trichloro-2-pyridinol by a new fungal
strain Cladosporium cladosporioides Hu-01. PLoS ONE. 7, e47205.
Chen, Y., Zhang, X., Liu, H., Wang, Y., Xia, X., 2002. Study on Pseudomonas sp. WBC-3
capable of complete degradation of methyl parathion. Wei Sheng Wu Xue Bao. 42,
490-497.
Cheng, T.C., Harvey, S.P., Chen, G.L., 1996. Cloning and expression of a gene encoding a
bacterial enzyme for decontamination of organophosphorus nerve agents and
nucleotide sequence of the enzyme. Appl. Environ. Microbiol. 62, 1636-1641.
Chishti, Z., Arshad, M., 2013. Growth linked biodegradation of chlorpyrifos by
Agrobacterium and Enterobacter spp. Int. J. Agric. Biol. 15, 19-26.
Chishti, Z., Hussain, S., Arshad, K.R., Khalid, A., Arshad, M., 2013. Microbial degradation
of chlorpyrifos in liquid media and soil. J. Environ. Manage. 114, 372-380.
Cho, K. M., Math, R. K., Islam, S. M. A., Lim, W. J., Hong, S. Y., Kim, J. M., Yun, H. D.,
Yun, M.G., Cho, J.J., Yun, H.D.,2009. Biodegradation of chlorpyrifos by lactic acid
bacteria during kimchi fermentation. J. Agric. food chem. 57, 1882-1889.
Clark, R.F., 2006. Insecticides: organic phosphorus compounds and carbamates. In:
Flomenbaum, N.E., Goldfrank, L.R., Hoffman, R.S., et al., (Eds). Goldfrank’s
Toxicologic Emergencies. 8th edition. New York: McGraw-Hill. pp. 1497–1512.
Coats, J.R., Symonik, D.M., Bradbury, S.P., Dyer, S.D., Timson, L.K., Atchison, G.J.,
1989. Toxicology of synthetic pyrethroids in aquatic organisms: an overview.
Environ. Toxicol. Chem. 8, 671-679.
Chapter 7 References
197
Colosio, C., Tiramani, M., Brambilla, G., Colombi, A., Moretto, A., 2009.
Neurobehavioural effects of pesticides with special focus on organophosphorus
compounds: Which is the real size of the problem? Neurotoxicology. 30, 1155-1161.
Comeau, Y., Greer, C.W., Samson, R., 1993. Role of inoculum preparation and density on
the bioremediation of 2, 4-D contaminated soil by bioaugmentation. Appl.
Microbiol. Biotechnol. 38, 681-687.
Copplestone, J.F., 1988. The development of the WHO recommended classification of
pesticides by hazard. Bulletin of the World Health Organization. 66, 545–551
Costa, L.G., 2006. Current issues in organophosphate toxicology. Clin. Chim. Acta. 366, 1–
13.
Cycoń, M., Wójcik, M., Piotrowska-Seget, Z., 2009. Biodegradation of the
organophosphorus insecticide diazinon by Serratia sp. and Pseudomonas sp. and
their use in bioremediation of contaminated soil. Chemosphere. 76, 494–501.
Cycoń, M., Żmijowska, A., Wójcik, M., Piotrowska-Seget, Z., 2013. Biodegradation and
bioremediation potential of diazinon-degrading Serratia marcescens to remove other
organophosphorus pesticides from soils. J. Environ. Manage. 117, 7–16.
Dadson, O.A., Ellison, C.A., Singleton, S.T., Chi, L.H., McGarrigle, B.P., Lein, P.J.,
Farahat, F.M., Farahat, T., Olson, J.R., 2013. Metabolism of profenofos to 4-bromo-
2-chlorophenol, a specific and sensitive exposure biomarker. Toxicology. 306, 35–
39.
Dai, Q.H., Zhang, R.F., Jiang, J.D., Gu, L.F., Li, S.P., 2005. Isolation, identification and
characterization of triazophos degrading bacterium mp-4. Acta. Pedol. Sin. 42, 111-
115.
Damalas, C.A., 2009. Understanding benefits and risks of pesticide use. Sci. Res. Essay. 4,
945-949.
Das, S., 2013. A review of Dichlorvos toxicity in fish. Curr. World Environ. 8, 143-149.
Chapter 7 References
198
De Schrijver, A., De Mot, R., 1999. Degradation of pesticides by actinomycetes. Crit. Rev.
Microbiol. 25, 85-119.
Debarati, P., Gunjan, P., Janmejay, P., Rakesh, V.J.K., 2005. Accessing microbial diversity
for bioremediation and environmental restoration. Trends Biotechnol. 23, 135-142.
DeLorenzo, M.E., Scott, G.I., Ross, P.E., 2001.Toxicity of pesticides to aquatic
microorganisms: a review. Environ. Toxicol. Chem. 20, 84-98.
Deshpande, N.M., Dhakephalkar, P.K., Kanekar, P.P., 2001. Plasmid-mediated dimethoate
degradation in Pseudomonas aeruginosa MCMB-427. Lett. Appl. Microbiol. 33,
275-279.
Di Fiori, S., Del Gallo, M., 1995. Endophytic bacteria: their possible role in the host plant.
in: Fcndrik, I., Del Gal1o, M., Vanderleyden, J., De Zamaroczy, M., (Eds.),
Azospirillum VI and related organisms. Springer. Verlag, Berlin, Germany, pp. 169-
187.
Diaz, E., 2004. Bacterial degradation of aromatic pollutants: a paradigm of metabolic
versatility. Int. Microbiol. 7, 173-180.
Diez, M.C., 2010. Biological aspects involved in the degradation of organic pollutants. J.
Soil. Sci. Plant Nutr. 10, 244- 267.
Dua, M., Singh, A., Sethunathan, N., Johri, A.K., 2002. Biotechnology and bioremediation:
successes and limitations. Appl. Microbiol. Biotech. 59, 143-152.
Dubey, K.K., Fulekar, M.H., 2011. Effect of pesticides on the seed germination of Cenchrus
setigerus and Pennisetum pedicellatum as monocropping and co-cropping system:
implications for rhizospheric bioremediation. Rom. Biotechnol. Lett. 16, 5909-5918.
Dubey, K.K., Fulekar, M.H., 2012. Chlorpyrifos bioremediation in Pennisetum rhizosphere
by a novel potential degrader Stenotrophomonas maltophilia MHF ENV20. World J.
Microbiol. Biotechnol. 28, 1715-1725.
Chapter 7 References
199
Duong, M.H., Penrod, S.L., Grant, S.B., 1997. Kinetics of p-Nitrophenol degradation by
Pseudomonas sp. An experiment illustrating bioremediation. J. Chem. Educ. 74,
1451-1454.
Duquenne, P., Parekh, N.R., Catroux, G., Fournier, J.C., 1996. Effect of inoculant density,
formulation, dispersion and soil nutrient amendment on the removal of carbofuran
residues from contaminated soil. Soil Biol. Biochem. 28, 1805-1811.
Eaton, D.L., Daroff, R.B., Autrup, H., Bridges, J., Buffler, P., Costa, L.G., Coyle,
J., McKhann, G., Mobley, W.C., Nadel, L., Neubert, D., Schulte-Hermann,
R., Spencer, P.S., 2008. Review of the toxicology of chlorpyrifos with an emphasis
on human exposure and neurodevelopment. Crit. Rev. Toxicol. 38, 1-125.
El-Helow, E.R., Badawy, M.E., Mabrouk, M.E., Mohamed, E.A., El-Beshlawy, Y.M., 2013.
Biodegradation of chlorpyrifos by a newly isolated Bacillus subtilis strain, Y242.
Biorem. J. 17, 113-123.
Eskenazi, B., Harley, K., Bradman, A., Weltzien, E., Jewell, N.P., Barr, D.B., Furlong C.E.,
Holland, N.T., 2004. Association of in utero organophosphate pesticide exposure
and fetal growth and length of gestation in an agricultural population. Environ.
Health Perspect. 112, 1116.
Estevan, C., Vilanova, E., Sogorb, M.A., 2013. Chlorpyrifos and its metabolites alter gene
expression at non-cytotoxic concentrations in D3 mouse embryonic stem cells under
in vitro differentiation: Considerations for embryotoxic risk assessment. Toxicol.
Lett. 217, 14-22.
Fang, H., Dong, B. Yan, H., Tang, F., Yunlong, Y., 2010. Characterization of a bacterial
strain capable of degrading DDT congeners and its use in bioremediation of
contaminated soil. J. Hazar. Mater. 184, 281-289.
Fang, H., Yu, Y.L., Wang, X., Shan, M., Wu, X.M., Yu, J.Q., 2006. Dissipation of
chlorpyrifos in pakchoi-vegetated soil in a greenhouse. J. Environ. Sci., 18, 760-764.
Chapter 7 References
200
Farag, A.T., Radwan, A.H., Sorour, F.E.l., Okazy, A., El-Agamy, E.S., El-Sebae, A.E.K.,
2010. Chlorpyrifos induced reproductive toxicity in male mice. Reprod. Toxicol. 29,
80-85.
Felsot, A., Maddox, J.V., Bruce, W., 1989. Enhanced microbial degradation of carbofuran
in soils with histories of carbofuran use. Bull. Environ. Contam. Toxicol. 26, 781-
788.
Feng, Y., Racke, K.D., Bollag, J.M., 1997, Isolation and characterization of a chlorinated
pyridinol degrading bacterium. Appl. Environ. Microbiol. 63, 4096-4098.
Feng, Y.E., Minard, R.D., Bollag, J.M., 1998. Photolytic and microbial degradation of
3,5,6-trichloro-2-pyridinol. Environ. Toxicol. Chem. 17, 814–819.
Fernández, M.D., Pro, J., Alonso, C., Aragonese, P., Tarazona, J.V., 2011. Terrestrial
microcosms in a feasibility study on the remediation of diesel-contaminated soils.
Ecotoxicol. Environ. Saf. 74, 2133–2140.
Finley, S.D., Broadbelt, L.J., Hatzimanikatis, V., 2010. In Silico Feasibility of Novel
Biodegradation Pathways for 1,2,4-Trichlorobenzene. BMC Syst. Biol. 4, 4-14.
Food and Agricultural Organization (FAO). FAO/WHO global forum of food safety
regulators. Marrakech, Morocco, 28–30 January; 2002. [http://www.
fao.org/DOCREP/MEETING/004/AB428E.HTM Agenda Item 4.2 a, GF/ CRD Iran-
1].
Fuentes, M.S., Briceno, G.E., Saez, J.M., Benimeli, C.S., Diez, M.C., Amoroso, M.J., 2013.
Enhanced removal of a pesticides mixture by single cultures and consortia of free
and immobilized Streptomyces strains. Biomed. Res. Int. 2013, 392573. doi:
10.1155/2013/392573.
Fukuto, T.R., 1990. Mechanism of action of organophosphorus and carbamate insecticides.
Environ. Health Perspect. 87, 245-254.
Chapter 7 References
201
Fulekar, M.H., Geetha, M., 2008. Bioremediation of chlorpyrifos by Pseudomonas
aeruginosa using scale up technique.J. Appl. Biosci. 12, 657-660.
Garry, V.F., 2004. Pesticides and children. Toxicol. Appl. Pharmacol. 198, 152-163.
Gaskin, S., Soole, K., Bentham, R., 2008. Screening of Australian native grasses for
rhizoremediation of aliphatic hydrocarbon-contaminated soil. Int. J.
Phytoremediation. 10, 378-389.
Gavrilescu, M., 2005. Fate of pesticides in the environment and its bioremediation. Eng.
Life Sci. 5, 497-526.
Gentry, T., Rensing, C., Pepper, I., 2004. New approaches for bioaugmentation as a
remediation technology. Crit. Rev. Environ. Sci. Technol. 34, 447-494.
Gerhardt, K.E., Huang, X.D., Glick, B.R., Greenberg, B.M., 2009. Phytoremediation and
rhizoremediation of organic soil contaminants: potential and challenges. Plant Sci.
176, 20-30.
Germaine, K.J., Liu, X., Cabellos, G.G., Hogan, J.P., Ryan, D., Dowling, D.N., 2006.
Bacterial endophyte-enhanced phytoremediation of the organochlorine herbicide 2,4-
dichlorophenoxyacetic acid. FEMS Microbiol. Ecol. 57, 302-310.
Ghanem, I., Orfi, M., Shamma, M., 2007. Biodegradation of chlorpyrifos by Klebsiella
sp.isolated from an activated sludge sample of waste water treatment plant in
Damascus. Folia Microbiol. 52, 423-427.
Ghassempour, A., Mohammadkhah, A., Najafi, F., Rajabzadeh, M., 2002. Monitoring of the
pesticide diazinon in soil, stem and surface water of rice fields. Anal. Sci. 18, 779–
783.
Ghisari, M., Bonefeld-Jorgensen, E.C., 2005. Impact of environmental chemicals on the
thyroid hormone function in pituitary rat GH3 cells. Mol. Cell Endocrinol. 244, 31-
41.
Chapter 7 References
202
Glick, B.R., 2003. Phytoremediation: synergistic use of plants and bacteria to clean up the
environment. Biotechnol. Adv. 21, 383-393.
Goda, S.K., Elsayed, I.E., Khodair, T.A., El-Sayed, W., Mohamed, M.E., 2010. Screening
for and isolation and identification of malathion-degrading bacteria: cloning and
sequencing a gene that potentially encodes the malathion-degrading enzyme,
carboxylestrase in soil bacteria. Biodegradation. 21, 903-913.
Gomez, M.J., Pazos, F., Guijarro, F.J., De Lorenzo, V., Valencia, A., 2007. The
environmental fate of organic pollutants through the global microbial metabolism.
Mol. Syst. Biol. 3, 1-11.
Gordon, S.A., Weber, R.P., 1951. Colorimetric estimation of indoleacetic acid. Plant
Physiol. 26, 192.
Grzelak, B., Michalowicz, J., Dukowska, M., 2012. Bioaccumulation of phenol, guaiacol
and some chlorophenols by selected freshwater species of leeches. Bull. Environ.
Contam. Toxicol. 88, 976-984.
Hansen, D.J., Goodman, L.R., Moore, J.C., Higdon, P.K., 1983. Effects of the synthetic
pyrethroids AC 222, 705, permethrin and fenvalerate on sheepshead minnows in
early life stage toxicity tests. Environ. Toxicol. Chem. 2, 251-258.
Hayatsu, M., Hirano, M., Tokuda, S., 2000. Involvement of two plasmids in fenitrothion
degradation by Burkholderia sp. strain NF1000. Appl. Environ. Microbiol. 66, 1737-
1740.
Hazen, T.C., 1997. Bioremediation, In: Amy, P., Haldeman, D. (Eds.), Microbiology of the
Terrestrial Subsurface. CRC Press, Boca Raton. pp. 247-266.
Ho, Y.N., Hsieh, J.L., Huang, C.C., 2013. Construction of a plant-microbe
phytoremediation system: Combination of vetiver grass with a functional endophytic
bacterium, Achromobacter xylosoxidans F3B, for aromatic pollutants removal.
Bioresour. Technol. 145, 43-47.
Chapter 7 References
203
Ho, Y.N., Mathew, D.C., Hsiao, S.C., Shih, C.H., Chien, M.F., Chiang, H.M., Huang, C.C.,
2012. Selection and application of endophytic bacterium Achromobacter
xylosoxidans strain F3B for improving phytoremediation of phenolic pollutants. J.
Hazard. Mater. 219, 43-49.
Hong J., Kim, D.G., Seo, J.J., Lee, C., Chung, C., Kim, K.W., 2003. Identification of
electrical degradation products of 4-chlorophenol in water. Anal. Sci. 19, 537-42
Hong, Q., Zhang, Z., Hong, Y., Li, S., 2007. A microcosum study on bioremediation of
fenitrothion-contaminated soil using Burkholderia sp. FDS-1. Int. Biodeterior.
Biodegrad. 59, 55-61.
Horne, I., Sutherland, T.D., Harcourt, R.L., Russell, R.J., Oakeshott, J.G., 2002.
Identification of an opd (organophosphate degradation) gene in an Agrobacterium
isolate. Appl. Environ. Microbiol. 68, 3371-3376.
Huang, H.G., Yu, N., Wang, L.J., Gupta, D.K., He, Z.L., Wang, K., Zhu, Z.Q., Yan, X.C.,
Li, T.Q., Yang, X.E., 2011. The phytoremediation potential of bioenergy crop
Ricinus communis for DDTs and cadmium cocontaminated soil. Bioresour. Technol.
102,11034-11038.
Iranzo, M., Sainz-Padro, I., Boluda, R., Sanchez, J., Mormeneo, S., 2001. The use of
microorganisms in environmental engineering. Ann. Microbiol. 51, 135-143.
Ismail, M., Ali, R., Ali, T., Waheed, U., Khan, Q.M., 2009. Evaluation of the acute toxicity
of profenofos and its effects on the behavioral pattern of fingerling common carp
(Cyprinus carpio L., 1758), Bull. Environ. Toxicol, 82, 569–573.
Jabeen, H., Iqbal, S., Anwar, S. 2014. Biodegradation of chlorpyrifos and 3, 5, 6-trichloro-
2-pyridinol by a novel rhizobial strain Mesorhizobium sp. HN3. Water Environ. J.
DOI: 10.1111/wej.12081.
Jain, R.K., Kapur, M., Labana, S., Lal, B., Sarma, P.M., Bhattacharya, D., Thakur, I.S.,
2005. Microbial diversity: Application of microorganisms for the biodegradation of
xenobiotics. Curr. Sci. 89, 101-112.
Chapter 7 References
204
Jarvis, B.D.W., Berkum, P.V., Chen, W.X., Nour, S.M., Fernandez, M.P., Cleyet-Marel,
J.C.,Gillis, M., 1997. Transfer of Rhizobium loti, Rhizobium huakuii, Rhizobium
ciceri, Rhizobium mediteraneum, Rhizobium tianshanense to Mesorhizobium. gen.
nov. Int. J. Syst. Bacteriol. 47, 895–898.
Johnson, T.A., Sims, G.K., Ellsworth, I.T.R., Balance, A.R., 1998. Effects of moisture and
sorptionon bioavailability of p-hydroxy-benzoicacid to Arthrobacter sp. in soil.
Microbiol. Res. 53, 349-353.
Jokanovic, M., Prostran, M., 2009. Pyridinium oximes as cholinesterase reactivators.
Structure-activity relationship and efficacy in the treatment of poisoning with
organophosphorus compounds.Curr. Med. Chem. 16, 2177-2188.
Juwarkar, A., Singh, S., Mudhoo, A., 2010. A comprehensive overview of elements in
bioremediation. Rev. Environ. Sci. Biotechnol. 9, 215-288.
Jyothi, K., Surendra, B.K., Nancy, C.K., Kashyap, A., 2012. Identification and isolation of
hydrocarbon degrading bacteria by molecular characterization. Helix. 2, 105-111.
Kamanyire, R., Karalliedde, L., 2004. Organophosphate toxicity and occupational exposure.
Occup. Med. 54, 69-75.
Kang, J.W., Khan, Z., Doty, S.L., 2012. Biodegradation of trichloroethylene by an
endophyte of hybrid poplar. Appl. Environ. Microbiol. 78, 3504-3507.
Karpouzas, D. G., Fotopoulou, A., Menkissoglu‐Spiroudi, U., Singh, B. K., 2005.
Non‐specific biodegradation of the organophosphorus pesticides, cadusafos and
ethoprophos by two bacterial isolates. FEMS Microbiol. Ecol. 53, 369-378.
Karpouzas, D.G. Walker, A., 2000. Factors influencing the ability of Pseudomonas putida
strains epI and II to degrade the organophosphate ethoprophos. J. Appl. Microbiol.
89, 40-48.
Chapter 7 References
205
Karpouzas, D.G., Singh, B.K., 2006. Microbial degradation of organophosphorus
xenobiotics: metabolic pathways and molecular basis. Adv. Microbial. Physiol. 51,
119-185.
Kavitha, P., Rao, J.V., 2009. Sub-lethal effects of profenofos on tissue specific antioxidative
responses in a Euryhyaline fish, Oreochromis mossambicus. Ecotoxicol. Environ.
Saf, 72,1727–1733.
Kertesz, M.A., Cook, A.M., Leisinger, T., 1994. Microbial metabolism of sulfur and
phosphorus-containing xenobiotics.FEMS Microbiol. Rev. 15, 195-215.
Khan, D.I., Hashmi, I., Mahjabeen, W., Naqvi, T.A., 2010. Monitoring health implications
of pesticide exposure in factory workers in Pakistan. Environ. Monit. Assess. 168,
231-240.
Khan, S., Afzal, M., Iqbal, S., Khan, Q.M., 2012. Plant-bacteria partnerships for the
remediation of hydrocarbon contaminated soils. Chemosphere. 90, 1317-1332.
Khanna, S., (1994-1999). Environmental Decadense in India. National Report. INMS.Indian
National Science Academy.181-226.
Kontchou, C.Y., Gschwind. N., 1995. Mineralization of the herbicide atrazine in soil
inoculated with a Pseudomonas strain. J. Agric. Food Chem. 43, 2291-2294.
Korade, D.L., Fulekar, M.H., 2009a. Rhizosphere remediation of chlorpyrifos in
mycorrhizospheric soil using ryegrass. J. Hazard. Mater. 172, 1344-1350.
Korade, D.L., Fulekar, M.H., 2009b. Effect of organic contaminants on seed germination of
Lolium multiflorum in soil. Biol. Med. 1. 28-34.
Kovach, M.E., Elzer, P.H., Hill, D.S., Robertson, G.T., Farris, M.A., Roop, R.M., Peterson,
K.M.,1995. Four new derivatives of the broad-host-range cloning vector pBBRIMCS
carrying different antibiotic-resistance cassettes. Gene. 166, 175–176.
Chapter 7 References
206
Krishna, K., Philip, L., 2008. Biodegradation of mixed pesticides by mixed pesticide
enriched cultures. J. Environ. Sci. Health Part B. 44, 18-30.
Kulshrestha, G., Kumari, A., 2010. Fungal degradation of chlorpyrifos by Acremonium sp.
strain (GFRC-1) isolated from a laboratory-enriched red agricultural soil. Biol.
Fertil. Soils. 47, 219-225.
Kumar, A., Chapman, J.C., 1998. Profenofos toxicity to the eastern rainbow fish
(Melanotaenia duboulayai). Environ. Toxicol. Chem. 17, 1799–1806.
Kumar, A., Chapman, J.C., 2001. Profenofos residues in wild fish from cotton-growing
areas of New South Wales, Australia, J. Environ. Qual. 30, 740–750.
Labana, S., Singh, O.V., Basu, A., Pandey, G., Jain, R.K., 2005. A microcosm study on
bioremediation of nitrophenol-contaminated soil using Arthrobacter protophormiae
RKJ100. Environ. Biotech. 68, 417-424.
Lah, K., 2011. Pesticide-History [online]. Available at
http://www.toxipedia.org/display/toxipedia/ Pesticides+-+History. [Accessed 1
April, 2014].
Laha, S., Petrova, K.P., 1998. Biodegradation of 4-nitrophenol by indigenous microbial
populations in Everglades soils. Biodegradation. 8, 349–356.
Lakshmi, C., Kumar. M., Khanna, S., 2008. Biotransformation of chlorpyrifos and
bioremediation of contaminated soil. Int. Biodeterior. Biodegrad. 62, 204–209.
Lakshmi, C.V., Kumar, M., Khanna, S., 2009. Biodegradation of chlorpyrifos in soil by
enriched cultures. Curr. Microbiol. 58, 35–38.
Latifi, A. M., Khodi, S., Mirzaei, M., Miresmaeili, M., Babavalian, H., 2012. Isolation and
characterization of five chlorpyrifos degrading bacteria. Afr. J. Biotechnol. 11, 3140-
3146.
Chapter 7 References
207
Lee, K.Y., Strand, S.E., Doty, S.L., 2012. Phytoremediation of chlorpyrifos by Populus and
Salix. Int. J. Phytoremediation.14, 48–61.
Leigh, M.B., Fletcher, J.S., Fu, X., Schmitz, F.J., 2002. Root turnover: an important source
of microbial substrates in rhizosphere remediation of recalcitrant contaminants.
Environ. Sci. Technol. 36, 1579-1583.
Li, X., He, J., Li, S., 2007. Isolation of a chlorpyrifos-degrading bacterium Sphingomonas
sp. strain Dsp-2 and cloning of the mpd gene. Res. Microbiol. 158, 143-149.
Li, X., Jiang, J., Gu, L., Ali, S. W., He, J., Li, S., 2008. Diversity of chlorpyrifos-degrading
bacteria isolated from chlorpyrifos-contaminated samples. Int. Biodeterior.
Biodegrad. 62, 331-335.
Liang, B., Yang, C., Gong, M., Zhao, Y., Zhang, J., Zhu, C., Jiang, J., Li, S., 2011.
Adsorption and degradation of triazophos, chlorpyrifos and their main hydrolytic
metabolites in paddy soil from Chaohu Lake, China. J. Environ. Manage. 92, 2229-
2234.
Lin, L., Liu, J., Zhang, K., Chen, Y., 2003. An experimental study of the effects of
profenofos on anti-oxidase in rabbits. Wei Sheng Yan Jiu. 32, 434-435.
Liu, Y.H., Chung, Y.C., Xiong, Y., 2001. Purification and characterization of a dimethoate-
degrading enzyme of Aspergillus niger ZHY256, isolated from sewage. Appl.
Environ. Microbiol. 67, 3746-3749.
Liu, Y.R., Zheng, Y.M., He, J.Z., 2012. Toxicity of profenofos to the springtail, Folsomia
candida, and ammonia-oxidizers in two agricultural soils. Ecotoxicol. 21, 1126–
1134.
Liu, Y.Z., Chen, X., Shi, Y., Su, Z.C., 2012. Bacterial degradation of chlorpyrifos by
Bacillus cereus. Adv. Mat. Res. 356-360, 676-680.
Lu, P., Li, Q., Liu, H., Feng, Z., Yan, X., Hong, Q.,Li, S., 2013. Biodegradation of
chlorpyrifos and 3,5,6-trichloro-2-pyridinol by Cupriavidus sp. DT-1. Bioresour.
Tech. 127, 337-342.
Chapter 7 References
208
Luo, W., Zhao, Y.H., Ding, H.T., Lin, X.Y., Zheng, H.B., 2008. Co-metabolic degradation
of bensulfuron-methyl in laboratory conditions. J. Hazard. Mater. 158, 208–214.
Malghani, S., Chatterjee, N., Hu, X.Y., Zejiao, L., 2009a. Isolation and identification of
profenofos degrading bacteria. Brazil. J. Microbiol. 40, 893−900.
Malghani, S., Chatterjee, N., Hu, X.Y., Zejiao, L., 2009b. Isolation and characterization of a
profenofos degrading bacterium. J. Environ. Sci. 21, 1591−1597.
Mallick, B.K., Banerji, A., Shakil, N.A., Sethunathan, N.N., 1999. Bacterial degradation of
chlorpyrifos in pure cultures and in soil. Bull. Environ. Contam. Toxicol. 62, 48-54.
Margesin, R., Zimmerbauer, A., Schinner, F., 2000. Monitoring of bioremediation by soil
biological activities. Chemosphere. 40, 339-346.
Masud, S.Z., Farhat, S., 1985. Pesticide residues in foodstuffs in Pakistan: organochlorine
pesticides in fruits and vegetables. Pak. J. Sci. Ind. Res, 28, 417–22.
Mateen, A., 1998. Purification of enzymes and cloning of the gene involved in hydrolysis of
carbofuran by Pseudomonas sp. 50423. PhD thesis: National Center for Excellence
in Molecular Biology, University of Punjab, Lahore.
Maya, K., Singh, R.S., Upadhyay, S.N., Dubey, S.K., 2011. Kinetic analysis reveals
bacterial efficacy for biodegradation of chlorpyrifos and its hydrolyzing metabolite
TCP. Process Biochem. 46, 2130-2136.
Mazari, R.B., 26th July; 2005. Country report on international code of conduct on the
distribution and use of pesticides. Department of Plant Protection, Ministry of Food,
Agriculture and Livestock Government of Pakistan.
[http://www.fao.org/world/regional/rap/meetings/2005/Jul26/Documents/Pakistan%20R
eport.doc].
Chapter 7 References
209
McDaniel, K.L., Moser, V.C., 2004. Differential profiles of cholinesterase inhibition and
neurobehavioral effects in rats exposed to fenamiphos or profenofos. Neurotoxicol.
Teratol. 26, 407–415.
McGuinness, M., Dowling, D., 2009. Plant-associated bacterial degradation of toxic organic
compounds in soil. Int. J. Environ. Public Health. 6, 2226-2247.
Mehta, A., Verma. R.S.,Srivastava, N.,2008. Chlorpyrifos-induced DNA damage in rat liver
and brain. Environ. Mol. Mutagen. 49, 426-433.
Middlemore-Risher, M.L., Buccafusco, J.J., Terry, A.V.Jr., 2010. Repeated exposures to
low-level chlorpyrifos results in impairments in sustained attention and increased
impulsivity in rats. Neurotoxicol.Teratol. 32, 415-424.
Min, K.J., Cha, C.G., 2000. Determination of the bioconcentration of phosphamidon and
profenofos in zebrafish (Brachydanio rerio). Bull. Environ. Contam. Toxicol, 65,
611–617.
Mir, F.A., Shah, G.M., Jan, U., Mir, J.I., 2012. Studies on Influences of Sublethal
Concentrations of Organophosphate Pesticide; Dichlorvos (DDVP) on
Gonadosomatic Index (GSI) of Female Common Carp, Cyprinus carpio communis.
American-Eurasian J. Toxicol. Sci. 4, 67-71.
Mishra, S., Jyot, J., Kuhad, R.C., Lal, B., 2001. Evaluation of inoculum addition to
stimulate in situ bioremediation of oily-sludge-contaminated soil. Appl. Environ.
Microbiol. 67, 1675-1681.
Mohan, S.V., Sirisha, K., Rao, R.S., Sarma, P.N., 2007. Bio-slurry phase remediation of
chlorpyrifos contaminated soil: process evaluation and optimization by Taguchi
design of experimental (DOE) methodology. Ecotoxicol. Environ. Saf. 68, 252-262.
Moore, F.P., Barac, T., Borremans, B., Oeyen, L., Vangronsveld, J.,vanderLelie, D.,
Campbell, C.D., Moore, E.R., 2006. Endophytic bacterial diversity in poplar trees
Chapter 7 References
210
growing on a BTEX-contaminated site: the characterisation of isolates with potential
to enhance phytoremediation. Syst. Appl. Microbiol. 29, 539-556.
Moore, M.T., Schulz, R., Cooper, C.M., Smith, S., Jr., Rodgers, J. H., Jr., 2002. Mitigation
of chlorpyrifos runoff using constructed wetlands. Chemosphere. 46, 827-835.
Mrozik, A., Piotrowska-Seget, Z., 2010. Bioaugmentation as a strategy for cleaning up of
soils contaminated with aromatic compounds. Microbiol. Res. 165, 363-375.
Muangphra, P., Kwankua, W., Gooneratne, R., 2012. Genotoxic effects of glyphosate or
paraquat on earthworm coelomocytes. Environ.Toxicol. 29, 612-620.
Muhammad, F., Akhtar, M., Rahman, Z.U., Farooq, H.U., Khaliq, T., Anwar, M.I., 2010.
Multi-residue determination of pesticides in the meat of cattle in Faisalabad
Pakistan. Egypt. Acad. J. Biol. Sci, 2, 19–28.
Mulbry, W.W., 2000. Characterization of a novel organophosphorus hydrolase from
Nocardiodes simplex NRRL B-24074. Microbiol. Res. 154, 285-288.
Munnecke, D.M., Hsieh, D.P. 1976. Pathways of microbial metabolism of parathion. Appl.
Environ. Microbiol. 31, 63-69.
Nadeau, L.J., Menn, F.M., Breen, A., Sayler, G.S., 1994. Aerobic degradation of 1,1,1-
trichloro-2,2-bis(4-chlorophenyl) ethane (DDT) by Alcaligenes eutrophus A5. Appl.
Environ. Microbiol. 60, 51-55.
Nawaz, K., Hussain, K., Choudary, N., Majeed, A., Ilyas, U., Ghani, A., Lin, F., Ali, K.,
Afghan, S., Raza, G., Lashari, M.I., 2011. Eco-friendly role of biodegradation
against agricultureal pesticide hazards. Afr. J. Microbiol. 5, 177-183.
Nelson, L.M., 1982. Biologically induced hydrolysis of parathion in soil: isolation of
hydrolysing bacteria. Soil Biol. Biochem. 14, 223-229.
Chapter 7 References
211
Nestler, C., 2001. Remediation of soil PAH: comparison of biostimulation and
bioaugmentation. in: Magar, V.S., Fahnestock, F.M., Leeson, A., (Eds.), Ex Situ
Biological Treatment Technologies. Battelle Press, Columbus, OH, 43–50.
Olexsey, R.A., Parker, R.A., 2006. Current and future in situ treatment techniques for the
remediation of hazardous substances in soil, sediments and ground water. in:
Twardowska, I., Allen, H.E., Häggblom, M.M., Stefaniak, S., (Eds.), Soil and water
pollution monitoring, protection and remediation. Springer, Dordrecht, The
Netherlands, pp. 211-219.
Omar, S.A., 1998. Availability of phosphorus and sulfur of insecticide origin by fungi.
Biodegradation. 9, 327-336.
Ortiz-Hernández, M.L., Sánchez-Salinas, E., Olvera-Velona, A., Folch-Mallol, J.L., 2011.
Pesticides in the environment: impacts and their biodegradation as a strategy for
residues treatment. Pesticides-Formulations, Effects, Fate. ISBN, 978-953.
Pakistan Economic Survey, 2012-2013. Ministry of Finance, Government of Pakistan.
http://www.finance.gov.pk/survey/chapters_13/Statistical_Appendix_12_13.zip
Pal, R., Chakrabarti, K., Chakraborty, A., Chowdhury, A., 2005. Pencycuron application to
soils: degradation and effect on microbiological parameters. Chemosphere. 60, 1513-
1522.
Pandey, A.K., Nagpure, N.S., Trived, S.P., Kumar, R., Kushwaha, B., 2011. Profenofos
induced DNA damage in freshwater fish, Channa punctatus (Bloch) using alkaline
single cell gel electrophoresis. Mutat. Res. 726, 209-214.
Parveen, Z., Afridi, I.A.K., Masud, S.Z., Baig, M.M.H., 1996. Monitoring of multiple
pesticides residues in cotton seeds during three crop seasons. Pak. J. Sci. Ind. Res.
39, 146–9.
Parveen, Z., Khuhro, M.I., Rafiq, N., Kausar, N., 2004. Evaluation of multiple pesticide
residues in apple and citrus fruits, 1999-2001. Bull. Environ. Contam. Toxicol. 73,
312-318.
Chapter 7 References
212
Parween, T., Jan, S., Fatma, T., 2011. Alteration in nitrogen metabolism and plant growth
during different developmental stages of green gram (Vigna radiata L.) in response
to chlorpyrifos. Acta Physiol. Plant. 33, 2321-2328.
Pereira, R.C., Monterroso, C., Macías, C.F., 2010. Phytotoxicity of hexachlorocyclohexane:
Effect on germination and early growth of different plant species. Chemosphere. 79,
326-333.
Pikovskaya, R.I., 1948. Mobilization of phosphorus in soil connection with the vital activity
of some microbial species. Microbiologiya. 17, 362-370.
Pilon-Smits, E., 2005. Phytoremediation. Ann. Rev. of Plant Biol. 56, 15-39.
Pino, N., Peñuela, G., 2011. Simultaneous degradation of the pesticides methyl parathion
and chlorpyrifos by an isolated bacterial consortium from a contaminated site. Int.
Biodeterior. Biodegrad. 65, 827-831.
Pirt, S.J., 1975. Principles of Microbe and Cell Cultivation. New York: John Wiley and
sons. pp. 274.
Prabhavathy, D.G., Pasha, S.A., Jamil, K., 2006. Cytotoxicity and genotoxicity induced by
the pesticide profenofos on cultured human peripheral blood lymphocytes. Drug
Chem. Toxicol. 29, 313–322.
Prieto, P., Schiliro, E., Maldonado-Gonzalez, M., Valderrama, R., Barroso-Albarracin, J.B.,
Mercado-Blanco, J., 2011. Root hairs play a key role in the endophytic colonization
of olive roots by Pseudomonas spp. with biocontrol activity. Microb. Ecol. 62, 435-
445.
Racke, K.D., Coats, J.R., 1988. Comparative degradation of organophosphorus insecticides
in soil: specificity of enhanced microbial degradation. J. Agric. Food Chem. 38,
193–199.
Racke, K.D., Laskowski, D.A., Schultz, M.R., 1990. Resistance of chlorpyrifos to enhanced
biodegradation in soil. J. Agric. Food Chem. 38, 1430-1436.
Chapter 7 References
213
Racke, K.D., Steele, K.P., Yoder, R.N., Dick, W.A., Avidov, E., 1996. Factors affecting the
hydrolytic degradation of chlorpyrifos in soil. J. Agric. Food Chem. 44, 1582-1592.
Ragnarsdottir, K.V., 2000. Environmental fate and toxicology of organophosphate
pesticides. J. Geol. Soc. 157, 859-876.
Rani, N.L., Lalitha-kumari, D., 1994. Degradation of methyl parathion by Pseudomonas
putida.Can. J. Microbiol. 4, 1000-1004.
Rao, J.V., Shilpanjali, D., Kavitha, P., Madhavendra, S.S., 2003. Toxic effects of profenofos
on tissue acetylcholinesterase and gill morphology in a euryhaline fish, Oreochromis
mossambicus. Arch. Toxicol. 77, 227–232.
Reddy, A.V.B., Madhavi, V., Reddy, K.G., Madhavi, G., 2013. Remediation of chlorpyrifos-
contaminated soils by laboratory-synthesized zero-valent nano iron particles: effect of pH
and aluminium salts, J. Chem. Article ID 521045, 7 pages, 2013.
doi:10.1155/2013/521045
Reddy, N.C., Rao, J.V., 2008. Biological response of earthworm, Eisenia foetida (Savigny)
to an organophosphorous pesticide, profenofos. Ecotoxicol. Environ. Saf. 71, 574–
582.
Reinecke, S.A., Reinecke, A.J., 2007. Biomarker response and biomass change of
earthworms exposed to chlorpyrifos in microcosms. Ecotoxicol. Environ. Saf. 66,
92-101.
Relyea, R.A., Hoverman, J.T., 2008. Interactive effects of predators and a pesticide on
aquatic communities. Oikos. 117, 1647-1658.
Robertson, L.N., Chandler, K.J., Stickley, B.D.A., Cocco, R.F., Ahmetagic, M., 1998.
Enhanced microbial degradation implicated in rapid loss of chlorpyrifos from the
controlled-release formulation suSCon Blue in soil. Crop Prot. 17, 29-33.
Rosenberg, A., Alexander, M., 1979. Microbial cleavage of various organophosphorus
insecticides. Appl. Environ. Microbiol. 37, 886-891.
Chapter 7 References
214
Rovedatti, M.F., Castane, P.M., Topalian, M.L., Salibian, A., 2001. Monitoring of
organochlorine and organophosphorus pesticides in the water of the Reconquista
River (Buenos Aires, Argentina). Water Res. 35, 3457-3461.
Sabdono, A., 2006. Biodegradation of chlorpyrifos by a marine bacterium Bacillus firmus
strain BY6 associated with branching coral Acropora sp. J. Coastal Dev. 10, 1410–
5217.
Saitou, N., Nei, M., 1987. The neighbor-joining method: a new method for reconstructing
phylogenetic trees Mol. Biol. Evol. 4, 406–425.
Salunkhe, V.P., Sawant, I.S., Banerjee, K., Rajguru, Y.R., Wadkar, P.N., Oulkar, D.P.,
Naik, D.G., Sawant, S.D., 2013. Biodegradation of profenofos by Bacillus subtilis
isolated from grapevines (Vitis vinifera). J. Agric. food chem. 61, 7195-7202.
Sasek, V., 2003. Why mycoremediations have not yet come into practice, in: Sasek, V.,
Glaser, J.A., Baveye, P. (Eds.), The utilization of bioremediation to reduce soil
contamination: problems and solutions. Kluwer Academic Publishers, Dordrecht,
The Netherlands, pp. 247-276.
Sasikala, C., Jiwal, S., Rout, S., Ramya, M., 2012. Biodegradation of chlorpyrifos by
bacterial consortium isolated from agriculture soil. World J. Microbiol. Biotechnol.
28, 1301-1308.
Segura, A., Rodriguez-Conde, S., Ramos, C., Ramos, J.L., 2009. Bacterial responses and
interactions with plants during rhizoremediation. Microb. Biotechnol. 2, 452-464.
Semple, K.T., Reid, B.J., Fermor, T.R., 2001. Impact of composting strategies on the
treatment of soils contaminated with organic pollutants. Environ. Pollut. 112, 269-
283.
Serdar, C.M., Gibson, D.T., Munnecke, D.M., Lancaster, J.H., 1982. Plasmid involvement
in parathion hydrolysis by Pseudomonas diminuta. Appl. Environ. Microbiol. 44,
246-249.
Chapter 7 References
215
Sethunathan, N., 1971. Biodegradation of diazinon in paddy field as a cause of loss of its
efficiency for controlling brown plant hoppers in rice fields. PNAS. 17, 18-19.
Sethunathan, N., Yoshida, T., 1973. A Flavobacterium that degrades diazinon and
parathion. Can. J. Microbiol. 19, 873-875.
Shahid, M., Hameed, S., Imran, A., Ali, S., Van Elsas J.D., 2012. Root colonization and
growth promotion of sunflower (Helianthus annuus L.) by phosphate solubilizing
Enterobacter sp. Fs-11. World J. Microbiol. Biotechnol. 28, 2749-2758.
Shalaby, E.M., Abdou, G.Y., 2010. The influence of soil microorganisms and bio- or -
organic fertilizers on dissipation of some pesticides in soil and potato tube . J. Plant
Prot. Res. 50, 86-92.
Sharaf, A.N., Soliman, M.H., Ibrahim, M.A., Moustafa, S.A., Abdel Hadi, Abdel Hadi A.,
2006. Molecular identification and cloning of organophosphate degradation gene in
some bacterial isolates. Arab. J. Biotechnol. 10, 259-274.
Sharma, S., 2012. Bioremediation: Features, strategies and applications. Asian J. Pharm.
Life Sci. 2, 202-213.
Sharmila, M., Ramanand, K., Sethunathan, N., 1989. Effect of yeast extract on the
degradation of organophosphorus insecticides by soil enrichment and bacterial
cultures. Can. J. Microbiol. 35, 1105-1110.
Shukla, K.P., Singh, N.K., Sharma, S., 2010. Bioremediation: developments, current
practices and perspectives. Gen. Eng. Biotechnol. J. 3, 1-20.
Siciliano, S.D., Fortin, N., Mihoc, A., Wisse, G., Labelle, S., Beaumier, D., Ouellette, D.,
Roy, R., Whyte, L.G., Banks, M.K., Schwab, P., Lee, K., Greer, C.W., 2001.
Selection of specific endophytic bacterial genotypes by plants in response to soil
contamination. Appl. Environ. Microbiol. 67, 2469-2475.
Siddaramappa, R., Rajaram, K.P., Sethunathan, N.N., 1973. Degradation of parathion by
bacteria isolated from flooded soil. Appl. Microbiol. 26, 846-849.
Chapter 7 References
216
Silambarasan, S., Abraham, J., 2013. Kinetic studies on enhancement of degradation of
chlorpyrifos and its hydrolyzing metabolite TCP by a newly isolated Alcaligenes sp.
JAS1. J. Taiwan Inst. Chem. Eng. 44, 438-445.
Sinclair, P.J., Neeson, R.J., Williams, P.A., 1992. Phytotoxicity of some organophosphate
insecticides to onions and carrots during germination and emergence. Plant Prot.
Quart. 7, 23-25.
Singh, B.K., 2009. Organophosphorus-degrading bacteria: ecology and industrial
applications. Nat. Rev. Microbiol.7, 156-164.
Singh, B.K., Kuhad, R.C., Singh, A., Lal, R., Triapthi, K.K., 1999. Biochemical and
molecular basis of pesticide degradation by microorganisms. Crit. Rev. Biotechnol.
19, 197-225.
Singh, B.K., Walker, A., 2006. Microbial degradation of organophosphorus compounds.
FEMS Microbiol. Rev. 30, 428-471.
Singh, B.K., Walker, A., Morgan, J.A., Wright, D.J., 2004. Biodegradation of chlorpyrifos
by Enterobacter sp. strain B-14 and its use in bioremediation of contaminated soils.
Appl. Environ. Microbiol. 70, 4855-4863.
Singh, B.K., Walker, A., Morgan, J.A.W., Wright, D.J., 2003. Effect of soil pH on the
biodegradation of chlorpyrifos and isolation of a chlorpyrifos-degrading bacterium.
Appl. Environ. Microbiol. 69, 5198-5206.
Singh, B.K., Walker, A., Wright, D.J., 2002. Degradation of chlorpyrifos, fenamiphos and
chlorothalonil alone and in combination and their effect on soil microbial activity.
Environ. Toxicol. Chem. 21, 2600-2605.
Singh, B.K., Walker, A., Wright, D.J., 2005. Cross-enhancement of accelerated
biodegradation of organophosphorus compounds in soils: dependence on structural
similarity of compounds. Soil Biol. Biochem. 37, 1675–1682.
Chapter 7 References
217
Singh, B.K., Walker, A., Wright, D.J., 2006. Bioremedial potential of fenamiphos and
chlorpyrifos degrading isolates: influence of different environmental conditions. Soil
Biol. Biochem. 38, 2682-2693.
Singh, D.K., 2008. Biodegradation and bioremediation of pesticide in soil: concept, method
and recent developments. Indian J. Microbiol. 48, 35-40.
Singh, N.S., Singh, D.K., 2011. Biodegradation of endosulfan and endosulfan sulfate by
Achromobacte rxylosoxidans strain C8B in broth medium. Biodegradation. 22, 845-
857.
Singh, P. B., Sharma, S., Saini, H.S., Chadha, B.S., 2009. Biosurfactant production by
Pseudomonas sp. and its role in aqueous phase partitioning and biodegradation of
chlorpyrifos. Lett. Appl. Microbiol. 49, 378-383.
Singh, S., Singh, D.K., 2003. Utilization of monocrotophos as phosphorus source by
Pseudomonas aeruginosa F10B and Clavibacter michiganense subsp. insidiosum
SBL 11. Can. J. Microbiol. 49, 101-109.
Sogorb, M.A., Vilanova, E., Carrera, V., 2004. Future application of phosphotriesterases in
the prophylaxis and treatment of organophosphorous insecticide and nerve agent
poisoning. Toxicol. Lett. 151, 219-233.
Somara, S., Siddavattam, D., 1995. Plasmid mediated organophosphate pesticide
degradation by Flavobacterium balustinum. Biochem. Mol. Biol. Int. 36, 627-631.
Sørensen, S.R., Aamand, J., Christian, N.A., 2008. Rapid mineralization of the phenylurea
herbicide diuron by Variovorax sp. strain SRS16 in pure culture and within a two-
member consortium. Appl. Environ. Microbiol. 74, 2332–2340.
Sørensen, S.R., Ronen, Z., Aamand, J., 2002. Growth in coculture stimulates metabolism of
the phenylurea herbicide is oproturon by Sphingomonas sp. strain SRS2. Appl.
Environ. Microbiol. 68, 3478–3485.
Chapter 7 References
218
Sridevi, V., Lakshmi, M.V.V,C., Swamy, A.V.N., Rao, M.N., 2011. Implementation of
Response Surface Methodology for phenol degradation using Pseudomonas putida
(NCIM 2102). J. Bioremed. Biodegrad. 2-121.
Stevens, M.M.1., Reinke, R.F., Coombes, N.E., Helliwell, S., Mo, J., 2008. Influence of
imidacloprid seed treatments on rice germination and early seedling growth. Pest
Manage. Sci. 64, 215-222.
Struthers, J.K., Jayachandran, K., Moorman, T.B.,1998. Biodegradation of atrazine by
Agrobacterium radiobacter J14a and use of this strain in bioremediation of
contaminated soil. Appl. Environ. Microbiol. 64, 3368-3375.
Sturz, A.V., Christie, B.R., Nowak. J., 2000. Bacterial endophytes: potential role in
developing sustainable systems of crop production. Crit. Rev. Plant Sci. 19, 1-30.
Sun, H., Xu, J., Yang, S., Liu, G., Dai, S., 2004. Plant uptake of aldicarb from contaminated
soil and its enhanced degradation in the rhizosphere. Chemosphere. 54, 569-574.
Tang, J. Wang, R. Niu, X. Wang, M. Zhou, Q., 2010. Characterization on the
rhizoremediation of petroleum contaminated soil as affected by different influencing
factors. Biogeosci. Discuss. 7, 4665–4688.
Tang, M., You, M., 2012. Isolation, identification and characterization of a novel
triazophos-degrading Bacillus sp. (TAP-1). Microbiol. Res. 167, 299-305.
Tariq, M.I., 2005. Leaching and degradation of cotton pesticides on different soil series of
cotton growing areas of Punjab, Pakistan in Lysimeters. Ph. D. Thesis, University of
the Punjab, Lahore, Pakistan.
Tariq, M.I., Afzal, S., Hussain, I., Sultana, N., 2007. Pesticide exposure in Pakistan: a
review. Environ. Int. 33, 1107–1122.
Chapter 7 References
219
Thengodkar, R.R.M., Sivakami, S., 2010. Degradation of chlorpyrifos by an alkaline
phosphatase from the cyanobacterium Spirulinaplantensis. Biodegradation. 21, 637-
644.
Tien, T.M., Gaskins, M.H., Hubbell, D.H., 1979. Plant growth substances produced by
Azospirillum brasilense and their effect on the growth of pearl millet (Pennisetum
americanum L.). Appl. Environ. Microbiol. 37, 1016-1024.
Tsai, W.T., 2010. Current status and regulatory aspects of pesticides considered to be
persistent organic pollutants (POPs) in Taiwan. Int. J. Environ. Res. Public Health.
7, 3615-3627.
U.S. Environmental Protection Agency (USEPA) Interim registration eligibility decision for
chlorpyrifos. 2002. Prevention, Pesticides and Toxic Substances (7508C), EPA. 738.
Vaccari, D.A., Strom, P.F., Alleman, J.E., 2006. Environmental Biology for Engineers and
Scientists, in: John, W. (Eds.), Sons Inc., Hoboken, New joursy and Canada, pp.
688.
Valverde, A., Velazquez, E., Fernandez-Santos, F., Vizcaíno, N., Rivas, R., Gillis, M.,
Mateos, P.F., Martínez-Molina, E., Igual, J.M., Willems, A., 2005. Phyllobacterium
trifolii sp. nov. nodulating Trifolium and Lupinus in Spanish soils. Int. J. Syst. Evol.
Microbiol. 55, 1985–1989
Van Veen, J.A., Van Overbeek, L.S., Van Elsas, J.D., 1997. Fate and activity of
microorganisms introduced into soil. Microbiol. Mol. Biol. Rev. 61, 121-135.
Ventura, C., Nunez, M., Miret, N., Lamas, D.M., Randi, A., Venturino, A., Rivera, E.,
Cocca, C., 2012. Differential mechanisms of action are involved in chlorpyrifos
effects in estrogen-dependent or -independent breast cancer cells exposed to low or
high concentrations of the pesticide. Toxicol.Letts.213, 184-193.
Vogel, J.R., Majewski, M.S., Capel, P.D., 2008. Pesticides in rain in four agricultural
watersheds in the United States. J. Environ. Qual., 37, 1101-1115.
Chapter 7 References
220
Walker, A., Suett, D.L., 1986. Enhanced degradation of pesticide in soils: a potential
problem for continued pest, disease and weed control. Asp. Appl. Biol. 12, 95-103.
Wan, N.S., Gu, J.D., Yan, Y., 2007. Degradation of p-nitrophenol by Achromobacter
xylosoxidans Ns isolated from wetland sediment. Int. Biodeterior. Biodegrad. 59,
90–96.
Wang, L., Jiang, X., Yan., D., Wu, J., Bian, Y., Wang, F., 2007. Behaviour and fate of
chlorpyrifos introduced into soil crop systems by irrigation. Chemosphere. 66, 391-
396.
Wang, L.H., Zhang, L., Chen, H.L., 2005. Isolation of a triazophos-degrading strain
Klebsiella sp. E6 effectively utilizing triazophos as sole nitrogen source. FEMS
Microbiol. Lett. 253, 259-265.
Wang, X., Wu, N., Guo, J., Chu, X., Tian, J., Yao, B., Fan, Y., 2008. Phytodegradation of
organophosphorus compounds by transgenic plants expressing a bacterial
organophosphorus hydrolase. Biochem. Bioph. Res. Commun. 365, 453-458.
Wang, X.D., Liu, X.J., Yang, S., Li, A.L., Yang, Y.L., 2007. Removal and toxicological
response of triazophos by Chlamydomonas reinhardtii. Bull. Environ. Contam.
Toxicol. 78, 67-71.
Watanabe, K., 2001. Microorganisms relevant to bioremediation. Curr. Opin. Biotechnol. 12,
237-241.
Watts, M., 2012. Chlorpyrifos as a possible global POP [online]. Available at
http://www.pan-europe.info/News/PR/121009_Chlorpyrifos_as_POP_final.pdf
[accessed 10 August 2013].
Weyens, N., Boulet, J., Adriaensen, D., Timmermans, J.P., Prinsen, E., Oevelen, S.D.,
Haen, J., Smeets, K., Lelie, D., Taghavi, S., Vangronsveld, J., 2012. Contrasting
colonization and plant growth promoting capacity between wild type and a gfp-
Chapter 7 References
221
derivative of the endophyte Pseudomonas putida W619 in hybrid poplar. Plant Soil.
356, 217-230.
Weyens, N., van der Lelie, D., Taghavi, S., Vangronsveld, J., 2009. Phytoremediation:
plant-endophyte partnerships take the challenge. Curr. Opin. Biotechnol. 20, 248-
254.
Whyatt, R.M., Rauh, V., Barr, D. B., Camann, D. E., Andrews, H. F., Garfinkel, R.,
Hoepner, L.A., Diaz, D., Dietrich, J., Reyes, A., Tang, D., Kinney, P.L., Perera, F.P.
2004. Prenatal insecticide exposures and birth weight and length among an urban
minority cohort. Environ. Health Perspect. 112, 1125.
Wilson, K.H., Blitchington, R.B., Greene, R.C., 1990. Amplification of bacterial 16S
ribosomal DNA with polymerase chain reaction. J. Clin. Microbiol. 28, 1942-1946.
Wolski, E.A., Murialdo, S.E., Gonzalez, J.F., 2005. Effect of pH and inoculum size on
pentachlorophenol degradation by Pseudomonas sp. Water SA. 32, 93-98.
Worthing, C.R., Hance, R.J., 1991. The pesticide manual - A World Compendium 9th ed.
The British Crop Protection Council: Farnham, Surrey, U.K.
Wright, C.G., Leidy, R.B., Dupree, H.E. Jr., 1994. Chlorpyrifos in the air and soil of houses
eight years after its application for termite control. Bull. Environ. Contam. Toxicol.
52, 131-134.
Wu, N., Matand, K., Kebede, B., Acquaah, G., Williams, S., 2010. Enhancing DNA
electrotransformation efficiency in Escherichia coli DH10B electrocompetent cells.
Electron J. Biotechnol. 13, 12-22.
Xu, G., Zhang, W., Li, Y., 2008. Biodegradation of chlorpyrifos and 3, 5, 6 trichloro-2-
pyridinol by a newly isolated Paracoccus sp. strain TRP. Int. Biodeterior.
Biodegrad. 62, 51-56.
Yair, S., Ofer, B., Arik, E., Shai, S., Yossi, R., Tzvika, D., Amir, K., 2008.
Organophosphate degrading microorganisms and enzymes as biocatalysts in
environmental and personal decontamination. Crit. Rev. Biotechnol. 28, 265- 275.
Chapter 7 References
222
Yang, C., Li, R., Song, Y., Chen, K., Li, S., Jiang, J., 2011. Identification of the
biochemical degradation pathway of triazophos and its intermediate in
Diaphorobacter sp. TPD-1. J. Curr. Microbiol. 62, 1294-1301.
Yang, C., Liu, N., Guo, X., Qiao, C., 2006. Cloning of mpd gene from chlorpyrifos-
degrading bacterium and use of this strain in bioremediation of contaminated soil.
FEMS Microbiol. Lett. 265, 118-125.
Yang, L., Zhao, Y.H., Zhang, B., Yang, C.H., Zhang, X., 2005. Isolation and
characterization of a chlorpyrifos and 3, 5, 6‐trichloro‐2‐pyridinol degrading
bacterium. FEMS Microbiol. Lett. 251, 67-73.
Yousaf, S., Andria, V., Reichenauer, T.G., Smalla, K., Sessitsch, A., 2010. Phylogenetic
and functional diversity of alkane degrading bacteria associated with Italian ryegrass
(Lolium multiflorum) and Birdsfoot trefoil (Lotus corniculatus) in a petroleum oil-
contaminated environment. J. Hazard. Mater. 184, 523-532.
Yu, Y. L., Chen, Y.X., Luo, Y.M., Pan, X.D., He, Y.F., Wong, M.H., 2003. Rapid
degradation of butachlor in wheat rhizosphere soil. Chemosphere. 50, 771-774.
Yu, Y.L., Fang, H., Wang, X., Wu, X.M., Shan, M., Yu, J.Q., 2006. Characterization of a
fungal strain capable of degrading chlorpyrifos and its use in detoxification of the
insecticide on vegetables. Biodegrad. 17, 487-494.
Zaki, M.H., Moran, D., Harris, D., 1982. Pesticides in ground water: the aldicarb story in
Suffolk country New York. Am. J. Public Health. 72, 1391-1395.
Zhang, C., Bennett, G.N., 2005. Biodegradation of xenobiotics by anaerobic bacteria. Appl.
Microbiol. Biotechnol, 67, 600-618.
Zhang, R., Cui, Z., Jiang, J., He, J., Gu, X., Li, S., 2005. Diversity of organophosphorus
pesticide-degrading bacteria in a polluted soil and conservation of their
organophosphorus hydrolase genes. Can. J. Microbiol. 51, 337-343.
Chapter 7 References
223
Zhao, W.Y., Shen, C.L., Ding, N., Jia, S.M., Fan, Z.X., 2008. Residual analysis of
profenofos in cotton and soil. J. Qingdao Univ. Sci. Technol. 29, 305–309.
Zhongli, C., Ruifu, Z., Jian, H., Shunpeng, L., 2002. Isolation and characterization of a p-
nitrophenol degradation Pseudomonas sp. strain p3 and construction of a genetically
engineered bacterium. Wei Sheng Wu Xue Bao. 42, 19-26.
Zhongli, C., Shunpeng, L., Guoping, F., 2001. Isolation of methyl parathion-degrading strain
M6 and cloning of the methyl parathion hydrolase gene. Appl. Environ. Microbiol. 67,
4922-4925.
Zhu, J., Zhao, Y., Qiu, J., 2010. Isolation and application of a chlorpyrifos-degrading
Bacillus licheniformis ZHU-1. Afr. J. Microbiol .Res. 4, 2410-2413.
Appendices
Appendix 1
Minimal Salt Media (MSM) preparation
Component Composition (g/l)
Na2 H PO4 5.8 g/l
KH2PO4 3.0 g/l
NaCl 0.5 g/l
NH4Cl 1.0 g/l
MgSO4.7H2O 0.25 g/l
pH 6.8-7.00
Appendix 2
Luria Bertani medium
Appendix 3
Preparation of standard stock solutions
Standard stock solutions of chlorpyrifos, TCP, profenofos and BCP (1%) were prepared
in acetonitrile/methanol. The stocks were mixed well, filter sterilized and stored at 4°C
until used. Stock solutions of antibiotics (ampicillin, kanamycin), IPTG and X-gal etc
were prepared and stored at -20°C until used.
Component Composition (g/l)
Trypton 10 g/l
Yeast extract 5 g/l
NaCl 5 g/l
pH 7.2±0.2
Appendices
Appendix 4
Frozen Storage Buffer (FSB)
Before preparing FSB, prepare 1M KCO2CH3:
Dissolve 9.8 g KCO2CH3 into 80 ml water. Adjust pH to 7.5 with KOH. Make
up final volume to 100 ml with water. Autoclave and store at 4˚C.
So the composition of FSB is as follow
Dispense into bottles and autoclave. Store at 4˚C.
Appendix 5
Solutions for Gram’s reaction
Appendix 5.1
Crystal violet solution
Component Amount to be used for 400 ml
Crystal violet 10g
Ammonium oxalate 4 g
Ethanol 100 ml
Component Amount to be used for 1 litre
KCl 7.4 g
CaCl2-2H2O 7.5 g
Glycerol 100 ml
1M KCO2CH3 10 ml
pH 6.2
Appendices
Appendix 5.2
Iodine solution
Component Amount to be used for 25 ml
Iodine 1g
Potassium iodide 2 g
Ethanol 10 ml
Appendix 5.3
Safranin solution
Component Amount to be used for 100 ml
safranin 2.5g
Ethanol 10 ml
Appendix 6
Saline solution (0.9%)
Appendix 7
Mobil phase for used HPLC
Component Amount to be used for 800 ml
Acetonitrile 800 ml
Water(deionized) 200 ml
Acetic acid 2.5 ml
Sonicated and used
for the HPLC.
Component Amount to be used
Distilled water 100 ml
NaCl 0.9 g
Appendices
Appendix 8
Focht solution
The Focht trace element solution (Malghani et al., 2009) contains:
Component Composition (mg/L)
MnSO4.H2O 169 mg/l
ZnSO4.7H2O 288 mg/l
CuSO4.5H2O 250 mg/l
NiSO4.6H2O 26 mg/l
CoSO4 28 mg/l
NaMoO4.2H2O 24 mg/l
pH 7.2±0.2
Appendix 9
Nitrogen free medium (NFM)
Component Composition (g/l)
Na2 H PO4 5.8 g/l
KH2PO4 3.0 g/l
NaCl 0.5 g/l
MgSO4.7H2O 0.25 g/l
pH 6.8-7.00
Appendix 10
Chloride free medium (CFM)
Component Composition g/l
Distilled water 1L
Na2 H SO4 5.8 g/l
KH2SO4 3.0 g/l
MgSO4.7H2O 0.25 g/l
pH 6.8-7.00
Appendices
Appendix 11
Solutions for standard Miniprep protocol
Solution 1 (Suspension Buffer)
Component Concentration
Tris (pH 8.0) 50 mM
EDTA 10 mM
RNAase A 100 mM
Solution 2
Component Amount to be used
NaOH 200 mM
(SDS) 10%
Solution 3 (pH 4.8-5.0)
Component Amount to be used
Potassium acetate 3.0 mM
Glacial acetic acid 11.5 ml/l
Appendix 12
Extraction of pesticide residues from roots and shoots
Column preparation
Took a glass column with stopper at its one end
Placed the glass wool at the base of the column above the stopper and fill it with
charcoal
Conditioned the charcoal with solvent (acetone)
Poured the sample into the column and let it to be filtered under gravity
Washed the column with acetone than with distilled water thrice to remove any
remnants of the first sample
Appendices
Sample preparation and purification
Took 5 g sample of shoots/roots
Dipped into the liquid nitrogen and macerate into the piston Morton to obtain cell
extract
Mixed the cell extract with acetone
Passed this extract through the column to remove the cell debris
Saved the filtrate
Extracted the CP with dichloromethane
The solvent, dichloromethane was allowed to evaporate
Dissolved the residues of CP in acetonitrile and filtered for analysis on HPLC
Appendix 13
Salkowski reagent
Component Amount to be used for 50 ml
Distilled water 50 ml
Ferric chloride0.5M 1 ml
Sulphuric acid
with (Specific gravity
1.84)
30 ml
Publications
Jabeen, H., Iqbal, S., Anwar, S. 2014. Biodegradation of chlorpyrifos and 3, 5, 6-
trichloro-2-pyridinol by a novel rhizobial strain Mesorhizobium sp. HN3. Water
and Environment Journal (Published Online on 7th
March, 2014)
Biodegradation of chlorpyrifos and 3, 5, 6-trichloro-2-pyridinolby a novel rhizobial strain Mesorhizobium sp. HN3Hina Jabeen1,2, Samina Iqbal1,2 & Samina Anwar1
1Soil and Environmental Biotechnology Division, National Institute for Biotechnology and Genetic Engineering (NIBGE), Faisalabad, Pakistan and 2Pakistan
Institute of Engineering and Applied Sciences (PIEAS), Islamabad, Pakistan
Keywords3,5,6-trichloro-2-methoxypyridine;
3,5,6-trichloro-2-pyridinol; biodegradation;
chlorpyrifos; Mesorhizobium sp.
CorrespondenceSamina Iqbal, Soil and Environmental
Biotechnology Division, National Institute for
Biotechnology and Genetic Engineering
(NIBGE), PO Box 577, Jhang Road, Faisalabad
38000, Pakistan. Email: siqbaleb@gmail.com
doi:10.1111/wej.12081
Abstract
A chlorpyrifos (CP) and 3,5,6-trichloro-2-pyridinol (TCP) degrading bacterial strain,Mesorhizobium sp. HN3, was isolated and characterized. Mesorhizobium sp. HN3degraded CP efficiently up to 400 mg/L initial concentration at wide range of tem-peratures (30–40°C) and pH (6.0–8.0). However, optimal degradation of CP wasachieved at 37°C and neutral pH (7.0) at an initial inoculum density 2 × 107 colonyforming unit/mL of culture medium. Kinetic parameters for CP degradation byMesorhizobium sp. HN3 were estimated at different initial concentrations. Culturesexhibited significant variation (P ≤ 0.05) in the specific growth rate (μ), cell massformation rate (QX) and the substrate uptake rate (QS) during degradation of CP. Thevalues of kinetic parameters increased up to 100 mg/L CP and decreased at higherconcentration. Investigation of degradation metabolites indicated that CP is con-verted to diethylthiophosphate and TCP that leads to the formation of 3,5,6-trichloro-2-methoxypyridine.
Introduction
Chlorpyrifos [O,O-diethyl-O (3,5,6-trichloro-2-pyridyl phos-phorothioate)] (CP) is a moderately toxic and broad spectrumorganophosphate (OP) insecticide. It is an important ingredi-ent of common household formulations that are effectiveagainst mosquitoes, termites, bees, flies, etc. (Bicker et al.2005; Mohan et al. 2007). CP is also extensively used in agri-culture to kill the insect pests of a variety of crops such ascereals, cotton, fruits and vegetables since many years (Fanget al. 2006; Wang et al. 2007). Although many OPs includingCP were initially regarded as less persistent and toxic, there isescalating concern that these pesticides or their metabolitesare highly persistent in the environment as well as toxic andhence lead to undesirable health issues (Ragnarsdottir 2000;Alavanja et al. 2013).
A consequence of continuous domestic and agriculturaluse of CP is a widespread contamination of environmentleading to serious damage to nontarget organisms and eco-systems (Rovedatti et al. 2001; Anderson & Hunta 2003; Vogelet al. 2008). In the environment, CP is converted to 3,5,6-trichloro-2-pyridinol (TCP), a persistent metabolite that isresistant to biotic and abiotic degradation owing to the pres-ence of three chloride residues on the N-aromatic ring (Rackeet al. 1996; Robertson et al. 1998; Singh et al. 2003; Chishti &Arshad 2013). Moreover, TCP has higher water solubility ascompared with the parent compound; hence, it leaches to the
water bodies causing widespread contamination of aquaticenvironments (Vogel et al. 2008; Xu et al. 2008; Grzelak et al.2012; Watts 2012). CP and TCP toxicity has been linked tobroad-spectrum effects including neurological disorders,developmental disorders, autoimmune disorders and inter-ruption of many vital functions in higher animals and humans(Sogorb et al. 2004; Mehta et al. 2008; Alavanja & Bonner2012; Ventura et al. 2012; Estevan et al. 2013).
All these concerns imply that removal of both CP and TCPfrom the environment to alleviate their hazardous effects isimperative. A number of approaches including chemical treat-ment, photodecomposition and incineration can be appliedfor the remediation of contaminants (Olexsey & Parker 2006);however, most of them are expensive, environmentally unfa-vourable and not applicable for diffused contamination at lowconcentration. Use of microorganisms having the right meta-bolic pathways seems to be the most feasible technology forremediation of CP, TCP and related contaminants (Thengodkar& Sivakami 2010; Singh et al. 2011).
Bacterial strains capable of degrading CP and TCP as a solesource of carbon and energy as well as cometabolically havebeen isolated and characterized during recent years. Asummary of biodegradation studies of CP and TCP has beenreviewed by Maya et al. (2011). Recently reported CP degrad-ing bacterial strains include Bacillus cereus (Liu et al. 2012),Stenotrophomonas maltophilia strain MHF ENV20 (Dubey &Fulekar 2012) and Cupriavidus sp. DT-1 (Lu et al. 2013). It has
bs_bs_banner
Water and Environment Journal. Print ISSN 1747-6585
1Water and Environment Journal (2014) © 2014 CIWEM.
also been generally recognized that microbial degradation ofCP can be affected by many biotic and abiotic factors andtolerance to initial pesticide concentration, microbial popula-tion, optimum growth temperatures and optimum pH varyfor different microorganisms (Singh et al. 2003; Anwar et al.2009; Sharma 2012). The objectives of the present studywere to isolate and characterize bacterial strain capable ofcomplete degradation of CP and TCP, optimize culture condi-tions that govern CP degradation by the isolate and investi-gate the pathway of degradation. The kinetics of CPbiodegradation, accumulation and utilization of TCP, and thegoverning constants thereafter were also determined. As,these parameters vary depending on bacterial strains andconcentration/nature of pollutant, a clear understanding ofthe biodegradation kinetics of CP and TCP would determinesuitability of the bacterial strain for in situ bioremediation.
Materials and methods
Chemicals
Analytical standard and technical grade CP were purchasedfrom Dr Ehren Stofer GmbH (Germany) and Chem Service(Web Chester), respectively. Dichloromethane (DCM) andhigh performance liquid chromatography (HPLC) grade sol-vents were purchased from Merck. N,O-Bis (trimethylsilyl)trifluoroacetamide (BSTFA) kit was purchased from Supelco,Bellefonte, PA, USA.
Enrichment, isolation and selection of CPdegrading bacterial strains
Three different agricultural soil samples were collected fromfields where CP had been applied frequently. CP degrading bac-teria were isolated by enrichment culture technique followingAnwar et al. (2009). Initially, CP utilization by the isolates wasmonitored on minimal salt medium (MSM) agar plates contain-ing CP (100 mg/L). Growth and CP degradation potential of theisolates was also observed in liquid cultures (MSM) sup-plemented with 100 mg/L CP as the only source of carbon andenergy. A bacterial isolate, HN3 was found most efficient for CPutilization and hence selected for further studies.
Identification of isolate HN3
Total genomic DNA of the Mesorhizobium sp. HN3 was iso-lated, and 16S rRNA gene was amplified using universalprimers FD1 (5'-AGAGTTTGATCCTGGCTCAG-3'; Escherichiacoli bases 8-27) and RP1 (5'-ACGGHTACCTTGTTTACGACTT-3';E. coli bases 1507-1492) (Wilson et al. 1990). Polymerasechain reaction product was cloned into TA cloning vector(pTZ57R) and sequenced. Biochemical and physiologicaltests of the strain HN3 were carried out using QTS-24 kitdeveloped by Defense Science and Technology Organization
Laboratories, Karachi, Pakistan according to the manufac-turer instructions.
Inoculum preparation of HN3 forbiodegradation studies
The overnight grown culture of strain HN3 in Lauria Bertanimedium containing 100 mg/L CP was harvested and centri-fuged at 4600 g for 10 min. The cell pellet was washed with0.9% normal saline and suspended in the same solution toobtain an optical density of 0.8 at 600 nm (OD600nm). Dilutionplate count technique was used to determine the colonyforming units/mL, and 2% of this suspension was used asinoculum in CP biodegradation experiments until otherwisestated.
Experimental set-up for CP degradation studiesby HN3
CP degradation studies were carried out in 250-mL Erlen-meyer flasks containing 50-mL MSM supplemented with 2%HN3 inoculum and 100 mg/L CP under various culture condi-tions as described in respective sections. The flasks wereincubated at 37°C and 100 rpm in rotary shaker for 10 days.For all the treatments, uninoculated flasks served as controls,and all the experiments were performed in triplicate. Sampleswere periodically harvested for analysing the growth rates andresidues of CP and TCP. Extraction and HPLC analysis of pesti-cide residues was carried out as described in Anwar et al.(2009). Biodegradation was estimated by comparing theremoval of CP in samples and controls over time. Turbi-dometric method described by Jyothi et al. (2012) wasemployed for monitoring the growth of the Mesorhizobiumsp. HN3. Cell dry mass was determined for the Mesorhizobiumculture having an OD600nm of 1.0 and was used as standard forcalculating cell dry mass of samples.
Optimization of temperature and pH forbiodegradation of CP by HN3
To optimize temperature for degradation of CP by strain HN3,culture flasks containing MSM (pH 7.0) were incubated at 30,37 and 40°C in rotary shaker at 100 rpm. Degradation capac-ity of CP by Mesorhizobium sp. HN3 was monitored in MSMwith different initial pH, that is, acidic (6.0), basic (8.0) andneutral (7.0) prepared according to Anwar et al. (2009).
Kinetics of CP degradation by HN3 at differentinitial concentrations of CP
Biodegradation of CP by strain HN3 was investigated at differ-ent initial concentrations (50, 100, 200, 300 and 400 mg/L) andkinetic parameters were determined as described by Pirt
Biodegradation of CP and TCP H. Jabeen et al.
2 Water and Environment Journal (2014) © 2014 CIWEM.
(1975). Rates of pesticide degradation (Qs), metabolite pro-duction (QP) and cell mass productivity (Qx) were determinedby calculating the slope in their respective plots versus time(h). Product yields (Yp/s) and cell mass yield (Yx/s) were deter-mined by dP/dS and dX/dS where dP, dS and dX are thechanges in concentrations of product, pesticide and the bac-terial cell mass, respectively, per unit time. Specific growthrate (μ) was determined by plotting the ln(X/X0) versus time,where X0 and X are the initial cell mass (g/L) and cell mass (g/L)at time ‘t’, respectively (calculated during exponential phaseat different time intervals). Specific productivity (qp) and spe-cific rate of CP degradation (qs) were multiple of μ and Yp/x andYx/s.
Kinetic model was determined by plotting log CP residuesagainst time. A straight line was obtained for all CP concen-trations (50–400 mg/L), following first-order kinetics model.Therefore, degradation rate constant (k, h−1) and half-life (T1/2)in days were determined using Eqs (1) and (2) as described inDubey and Fulekar (2012).
C C ett= × −
0k (1)
T1 2 2= ( )ln k (2)
Identification of CP metabolites
Samples containing residues of CP and its metabolitesobtained from culture flasks were extracted with DCM andderivatized with BSTFA [CF3C=NSi(CH3)3OSi(CH3)3] usingBSTFA kit according to the protocol. Gas chromatography-mass spectrometry (GC-MS) analyses were performed withan Agilent 6890N gas chromatograph, equipped with aSupleco Equity-1 capillary column (30 m by 250 μm and25 μm film thickness), an auto-injector (7683 series) and anAgilent 5973 network mass selective detector (Agilent Tech-nologies, Palo Alto, CA, USA).
Helium was used as the carrier gas with a constant flowrate of 0.5 mL/min. The injector and transfer lines were 220and 300°C, respectively. The chromatography program wasas follows: total run time 33 min, initial temperature ofcolumn 70°C, a temperature increase of 10°C/min and finalheating to 240°C. The ionization voltage and electron multi-plier settings were 70 eV and 1294 V, respectively. Metabo-lites were identified by comparison of retention time (RT) andMS fragmentation profile of the metabolites to those ofauthentic standards.
Statistical analysis
All of the experiments were performed in triplicate. Meansand the standard deviations were determined using StatisticAnalysis System (SAS 9.0) software packages.
Results
Isolation and selection of CP degradingbacterial strain
Sixteen bacterial isolates capable to grow on MSM agarplates containing CP were obtained initially. Eight of theseisolates utilized CP (100 mg/L) as a sole source of carbon andenergy in MSM broth. One of the isolates, HN3, showing com-plete degradation of CP (100 mg/L) within 5 days of incuba-tion was recognized as most efficient and employed forfurther CP degradation studies.
Molecular, morphological and biochemicalidentification of strain HN3
The 16S rRNA gene sequence of the strain HN3, Gene bankaccession number JN119831, showed > 97% identity with cor-responding sequences of Mesorhizobium spp. and wasgrouped in a well-supported branch with various Mesor-hizobium spp. (Fig. 1). Morphological and biochemical charac-ters of isolate HN3 were compared with those described byJarvis et al. (1997) that also confirmed strain HN3 to be aMesorhizobium sp.
Biodegradation of CP by Mesorhizobiumsp. HN3
Optimum temperature for the degradation of CPby Mesorhizobium sp. HN3
Data indicating the effect of temperature on biodegradationof CP by Mesorhizobium sp. HN3 is shown in Fig. 2. In thepresence of 100 mg/L CP, 33 and 18% of the added pesticidewas degraded after 24 h of incubation at 37 and 40°C thatwas significantly higher as compared with that at 30°C whereonly 5% degradation was observed. After 5 days of incuba-tion, complete CP degradation was observed at 37°C as com-pared with 85 and 55% at 40 and 30°C, respectively, indicatinga significant effect of temperature on CP degradation rate.
Optimization of pH for CP degradation byMesorhizobium sp. HN3
Efficient degradation of CP was achieved at all the three initialpH levels tested (Fig. 3). At 100 mg/L initial concentration, atpH 7.0, the entire added CP was degraded after 5 days ofincubation (Fig. 3). Degradation was relatively slow at alkalinepH (8.0), whereby 100% degradation was achieved after 7days of incubation and a further decline in the degradationwas observed at acidic pH (6.0) as 100% degradation wasobserved after 8 days of incubation. Among the three pHconditions tested for CP degradation by Mesorhizobium sp.HN3, pH 7.0 was found to be optimum.
H. Jabeen et al. Biodegradation of CP and TCP
3Water and Environment Journal (2014) © 2014 CIWEM.
Mesorhizobium_metallidurans_(NR_042685.1)
Mesorhizobium_tarimense_(NR_044051.1)
Mesorhizobium_gobiense_(NR_044052.1|)
Mesorhizobium_tianshanense_(NR_024880.1)
Mesorhizobium_mediterraneum_(NR_042483.1)
Mesorhizobium_temperatum_(NR_025253.1)
Mesorhizobium_huakuii_(NR_043390.1)
Mesorhizobium_amorphae(NR_024879.1)
Mesorhizobium_loti_(NR_074162.1)
Mesorhizobium_opportunistum_(NR_074209.1)
Mesorhizobium_plurifarium_(NR_026426.1)
Mesorhizobium_thiogangeticum_(NR_042358.1)
Mesorhizobium_sp.(HQ836166.1)
HN3_(JN119831.1)
Mesorhizobium_sp.(EF100516.1)
Mesorhizobium_sp.(HQ836191.1)
Sinorhizobium_terangae_(NR_044842.1)
Sinorhizobium_kostiense_(NR_042484.1)
Sinorhizobium_saheli(NR_026096.1)
98
75
96
95
7156
67
32
100
76
40
100
71
99
0.0000.0050.0100.015
Fig. 1. Unweighted pair group mean average tree showing the phylogenetic relationship of strain HN3 with the related species based on the 16S rRNA
gene sequences. Bootstrap values that are expressed as the percentages of 1000 replications are shown at the nodes of the branches.
CP
degr
adat
ion
(%)
Time in days
0102030405060708090
100
0 1 2 3 4 5 6 7 8 9 10
Fig. 2. Degradation of chlorpyrifos (CP) by Mesorhizobium sp. HN3 as a
sole source of carbon and energy at different incubation temperatures;
30 (◆), 37 (■) and 40°C (▲). Dashed lines show uninoculated controls; 30
(◇), 37 (□) and 40°C (△). Values are the means of three replicates and
error bars represent standard error.
Time in days
CP
degr
adat
ion
(%)
0102030405060708090
100
0 1 2 3 4 5 6 7 8
Fig. 3. Degradation of chlorpyrifos (CP) by Mesorhizobium sp. HN3 as a
sole source of carbon and energy at different initial pH; 6.0 (◆), 7.0 (■)
and 8.0 (▲). Dashed lines show uninoculated controls at pH 6.0 (◇), 7.0
(□) and 8.0 (△). Values are the means of three replicates, and error bars
represent the standard error.
Biodegradation of CP and TCP H. Jabeen et al.
4 Water and Environment Journal (2014) © 2014 CIWEM.
Biodegradation of CP at differentinitial concentrations
Mesorhizobium sp. HN3 was able to degrade CP efficiently upto 400 mg/L initial concentration in MSM, whereby degrada-tion was achieved in concentration-dependent manner. CPdegradation and bacterial biomass production at differentinitial CP concentrations after 3 days of incubation are pre-sented in Fig. 4(a). In the cultures containing 50 and 100 mg/LCP, 100 and 85% degradation was achieved, respectively,whereas at 200, 300 and 400 mg/L initial concentrations, 45,33 and 15% CP was degraded, respectively. After 3 days ofincubation, cell biomass (g/L) was highest at 100 mg/L initialCP concentration and declined gradually at concentrationsbeyond this. As depicted in Fig. 4(b), specific rate of CP deg-radation was dependent on initial concentration with anincrease in specific degradation rate at lower initial CP con-centrations (50–100 mg/L) and a decline in the rate at higherinitial CP concentrations. Mesorhizobium sp. HN3 could tol-erate higher CP concentration, with delayed degradation,that is, 40 and 30%, respectively, after 16 days of incubation at1000 and 1200 mg/L CP (data not shown). Complete degra-dation of CP was achieved after 5, 7, 9 and 10 days at 100,200, 300 and 400 mg/L, respectively.
Kinetics of CP degradation and TCP accumulationand degradation thereafter
Effect of initial concentrations of CP on kinetic parametersviz. specific degradation rate (qs), specific growth rate (μ) sub-strate (CP) consumption variables (Qs, Qx, Yx/s) and product(TCP) formation parameters (Qp, Yp/s, qp) are presented in
Table 1. The CP consumption and TCP production parameterswere high at lower CP concentrations (50–100 mg/L) followedby a decline at higher concentrations (200–400 mg/L). Rate ofTCP accumulation (QTCP) increased with the increase in CPconcentrations up to 200 mg/L with a gradual decrease athigher concentrations. TCP yield (Yp/s) and qp were highest at100 mg/L initial concentration and decreased at higher con-centrations. As illustrated in Fig. 5, at 50 and 100 mg/L,maximum concentration of TCP was observed after 48 h ofincubation, and all of the TCP produced as a result of CPhydrolysis was degraded after 96 and 144 h, respectively. Athigher concentrations, TCP was detected in the culturemedia even after 240 h of incubation that might be due to thecontinuous production and slow degradation. Lag phase ofbacterial growth was extended with an increase in initial CPconcentration beyond 100 mg/L.
Figure 6 shows the fitting results of the kinetic modelbased on the experimental data of CP degradation. The deg-radation followed the first-order reaction as a straight linewas produced by plotting the ln values (Ct/C0) of CP residuesagainst respective hours. The residue data were thereforeinterpreted statistically for the calculation of regression equa-tion and first-order kinetic parameters (Table 2). Regressioncoefficient indicating the degradation rate further supportedthe findings that the CP persistence increases with increasinginitial concentration.
Identification of CP metabolites andpathway prediction
Metabolites of CP were identified by GC-MS analysis ofsamples obtained from culture media containing CP as a
Initial CP concentration (mg/L)
CP
degr
adat
ion
(%)
Cel
l Bio
mas
s (dr
y w
t. g
/L)
0
0.05
0.1
0.15
0.2
0
20
40
60
80
100
50 100 200 300 400
a
Initial CP concentration (mg/L)
Spec
ific
CP
degr
adat
ion
rate
(h- 1
)
0
0.02
0.04
0.06
0.08
0.1
0.12
0.14
0.16
0.18
0 50 100 150 200 250 300 350 400
b
Fig. 4. (a) Degradation of chlorpyrifos (CP) by Mesorhizobium sp. HN3 at different initial concentrations as a sole source of carbon and energy after 3 days
of incubation (●) and consequent growth of Mesorhizobium sp. HN3 (■). Values are the means of three replicates and error bars represent the standard
error. (b) Effect of initial CP concentrations on specific degradation rate of CP (◆, qs).
H. Jabeen et al. Biodegradation of CP and TCP
5Water and Environment Journal (2014) © 2014 CIWEM.
Table 1 Kinetic parametersa for chlorpyrifos (CP) degradation and product [3,5,6-trichloro-2-pyridinol (TCP)] formation thereafter by Mesorhizobium sp.
HN3 in liquid cultures containing different initial concentrations of the pesticide
Initial CP concentration (mg/L)
Substrate utilization parameters
μ (/h) Qs (mg/L/h) Qx (mg/L/h) Yx/s (mg/mg/h) qs (mg/mg/h)
50 0.090 ± 0.000 1.15 ± 0.01 1.52 ± 0.01 1.24 ± 0.005 0.080 ± 0.001
100 0.280 ± 0.005 1.43 ± 0.02 4.60 ± 0.05 1.70 ± 0.040 0.164 ± 0.002
200 0.058 ± 0.000 1.30 ± 0.01 2.88 ± 0.00 0.78 ± 0.003 0.075 ± 0.001
300 0.023 ± 0.000 0.72 + 0.00 2.56 + 0.03 0.45 ± 0.001 0.050 ± 0.000
400 0.025 ± 0.000 0.26 + 0.00 2.21 + 0.01 0.35 ± 0.003 0.045 ± 0.001
Product formation parameters
QP (mg/L/h) YP/S (mg/mg/h) qp (mg/mg/h)
50 1.15 ± 0.010 0.40 ± 0.005 0.015 ± 0.040
100 2.24 ± 0.020 0.81 ± 0.010 0.073 ± 0.030
200 2.67 ± 0.010 0.50 ± 0.020 0.013 ± 0.010
300 1.08 ± 0.030 0.23 ± 0.010 0.005 ± 0.000
400 0.99 ± 0.001 0.17 ± 0.000 0.002 ± 0.000
Each value is the means of three replicates ± standard errors. All the values differ from each other significantly at P < 0.05.aKinetic parameters: μ (/h), specific growth rate; Qs, mg substrate consumed/L/h; Qx, mg cell mass produced/L/h; Yx/s, mg cells/mg substrate utilized; qs,
mg substrate consumed /mg cells /h; Qp, mg TCP produced/L/h; Yp/s, mg TCP produced/mg substrate consumed; qp, mg TCP produced /mg cells/h.
CP/
TC
P co
ncen
trat
ion
and
cell
biom
ass (
mg
/L)
Time in hours
a
c
b
d
Fig. 5. Kinetics of chlorpyrifos (CP) degradation at 37°C by Mesorhizobium sp. HN3 as a sole source of carbon and energy at different initial concentra-
tions; (a) 50, (b) 100, (c) 200 and (d) 300 mg/L showing residual CP concentration (△), 3,5,6-trichloro-2-pyridinol (TCP) concentration (○) and cell biomass
of Mesorhizobium sp. HN3 (●) in the culture media. Values are the means of three replicates, and error bars represent the standard error.
Biodegradation of CP and TCP H. Jabeen et al.
6 Water and Environment Journal (2014) © 2014 CIWEM.
source of carbon and energy. In the total ion chromatogram(TIC), CP was indicated at an RT of 16.02 min. Mass spectrumof this peak was identical to that of authentic CP standardshowing molecular ion peak with an m/z value of 351. In theTIC of samples obtained after 3 days of incubation, peak cor-responding to CP disappeared as the metabolism proceeded,and some new peaks appeared at different RTs. These peakswere identified as (a) TCP at RT of 10.23 min, (b)diethylthiophosphate (DETP) at RT of 11.39 min and (c) 3,5,6-trichloro-2-methoxypyridine (TMP) at RT of 7.72 min (Fig. 7).As mentioned earlier, the extracted samples were derivatizedwith BSTFA, trimethylsilyl group (m/z 73) attached to thehydroxyl group of TCP and DETP. The derivatives thus hadmasses of ∼271 and 241 for TCP and DETP, respectively, dem-onstrating a mass of 198 for TCP and 169 for DETP. Peakscorresponding to these three metabolites were not detectedin TIC of cultures by the end of experiments. The resultsindicate that Mesorhizobium sp. HN3 efficiently hydrolysedCP to TCP and DETP. TCP was converted to TMP, whichwas further degraded as indicated by appearance ofdechlorination and ring cleavage metabolites in the subse-quent cultures (data not shown). On the basis of the previousfindings, a pathway was predicted for CP biodegradation byMesorhizobium sp. (Fig. 8).
Discussion
The present study describes the isolation and characteriza-tion of a novel bacterial strain Mesorhizobium sp. HN3capable of complete degradation of CP, a chlorinated OP pes-ticide. To date, many bacterial strains capable of CP and TCPdegradation have been reported (Chishti & Arshad 2013;Chishti et al. 2013) including a few PGPRs, that is,Pseudomonas sp. (Fulekar & Geetha 2008), Bacillus sp.(Zhu et al. 2010), Flavobacterium sp. (Mallick et al. 1999),Klebseilla sp. (Ghanem et al. 2007), etc. However, PGPRbelonging to Rhizobia group have rarely been reported todegrade pesticides and related contaminants.
Notably, temperature and pH of the soil and water greatlyaffect the efficiency of the microorganisms to degrade pesti-cides (Goda et al. 2010). Different bacterial species havebeen reported to show different optimal temperatures for CPdegradation (Li et al. 2007; Lu et al. 2013). However, strainHN3 performed well at a range of temperatures, that is,30–40°C. Although, neutral pH was found to support the bio-degradation of CP by Mesorhizobium sp. HN3, efficient deg-radation was also achieved at acidic (6.0) and basic (8.0) pH.This was in contrast with the findings of Racke et al. (1996)who exclaimed that high pH had a co-relation with hydrolysis
R² = 0.917 R² = 0.977R² = 0.933
R² = 0.911
R² = 0.900
00.5
11.5
22.5
33.5
44.5
55.5
66.5
7
0 24 48 72 96 120 144 168 192 216 240
lnR
esid
ues o
f CP
Time in hours
Fig. 6. First-order kinetics of chlorpyrifos (CP)
degradation in minimal salt medium at differ-
ent initial concentrations; 50 (◆), 100 (■), 200
(▲), 300 (✗) and 400 mg/L (●).
Table 2 First-order kinetics parameters for chlorpyrifos degradation by Mesorhizobium sp. HN3 in liquid cultures containing different initial
concentrations of the pesticide
CP concentration (mg/L) Rate constant (h−1) T1/2 (days) R2 Regression equation
50 0.025 1.16 0.972 3.853 − 0.025x
100 0.023 1.26 0.977 4.699 − 0.023x
200 0.015 1.93 0.933 5.557 − 0.015x
300 0.014 2.06 0.911 6.161 − 0.014x
400 0.012 2.41 0.900 6.451 − 0.012x
H. Jabeen et al. Biodegradation of CP and TCP
7Water and Environment Journal (2014) © 2014 CIWEM.
of CP in soil and Singh et al. (2003) who demonstrated thathigh (basic) pH support microbial hydrolysis of CP.
Mesorhizobium sp. HN3 degraded CP over a wide range ofinitial concentrations (50–400 mg/L) in contrast with previousreports showing inhibition of bacterial growth and CP degra-dation rates at concentrations < 400 mg/L (Singh et al. 2004,2006; Li et al. 2007). Higher specific growth rate (μ), cell massformation rate (QX) and the substrate uptake rate (QS) at
50–100 mg/L initial CP concentration indicated a remarkableimpact of initial concentration on CP degradation rate. CPdegradation by Mesorhizobium sp. HN3 followed first-orderkinetics with a dramatic decrease in degradation rate withincreasing initial concentration. A similar trend for CP degra-dation has been reported earlier (Dubey & Fulekar 2012).
High rate of TCP production and complete TCP removal atrelatively lower initial CP concentrations (50–100 mg/L) wasobserved, which might be attributed to the easy adaptation ofHN3 to low TCP concentrations in the culture media accumu-lated as a result of CP degradation. Delay in complete disap-pearance of CP and TCP at higher concentrations might be dueto the antimicrobial/inhibitory effect of relatively higher con-centration of TCP produced towards Mesorhizobium sp. HN3.Generally, the lag phase of bacterial growth and CP degrada-tion was extended with the increase in initial CP concentra-tion. These results are consistent with the previous reportsthat reveal the extended lag phase at higher CP concentra-tions (Singh et al. 2006; Anwar et al. 2009; Chen et al. 2012).
Mass spectrometric identification of the metabolites pro-duced during CP degradation indicated that first step of themetabolic pathway is hydrolysis of O-P ester linkage toproduce TCP and DETP. However, TCP and DETP were notpersistently found during the course of experiments and dis-appeared subsequently. Singh et al. (2004) suggested thatDETP is utilized as a carbon and energy source by microor-ganisms for further degradation of TCP. Strain HN3 was alsocapable to grow in phosphorus-free medium containing CP asthe only P source (data not shown) indicating utilization ofDETP as P source as well. Importantly, O-methylation of TCPto produce TMP and its subsequent disappearance wasobserved, which substantiates that TMP was furtherdegraded. Biodegradation of TCP is a crucial part in the reme-diation of CP contaminated sites. If left accumulated, TCP willaffect the beneficial microbial communities in the soilbecause of its antimicrobial properties. These findings makestrain HN3 an efficient tool for remediation of CP, TCP andrelated contaminants.
Conclusions
(1) Mesorhizobium sp. strain HN3 is capable of degrading CPat a wide range of initial concentrations, temperatures andpH.(2) HN3 degrades CP through P-O-C bond hydrolysis produc-ing DETP and TCP that leads to the formation of TMP.(3) TCP and TMP produced as a result of CP metabolism arefurther degraded.(4) Kinetic parameters indicate that fairly faster CP and TCPdegradation by Mesorhizobium sp. HN3 can be obtained atrelatively lower concentrations.(5) Mesorhizobium sp. HN3 can potentially be used for thebiodegradation and bioremediation of CP and TCP.
─Si (CH3)3
m/z 197 m/z 73.19 m/z 271
NCl OH
ClCl
NCl O
ClCl
Si(CH3)3
a
m/z 210
c
N
Cl
OCH3
Cl
Cl
m/z 169 m/z 73.19 m/z 241
PS
HO
O
OCH3
CH3─Si (CH3)3 P
S
O
O
OCH3
CH3
Si(CH3)3
b
Fig. 7. (a) Mass spectra of 3,5,6-trichloro-2-pyridinol; (b) diethylt-
hiophosphate and (c) 3,5,6-trichloro-2-methoxypyridine formed in the
culture medium after 3 days of incubation corresponding to peaks
obtained at retention time of 7.72, 10.23 and 11.39 min, respectively, in
the total ion chromatogram.
Biodegradation of CP and TCP H. Jabeen et al.
8 Water and Environment Journal (2014) © 2014 CIWEM.
Acknowledgements
The present research was financially supported by HigherEducation Commission (HEC), Pakistan. Dr. Sajjad Mirza andDr. Ghulam Rasool, National Institute for Biotechnology andGenetic Engineering, are greatly acknowledged for grantingaccess to HPLC facility. Authors are grateful to Professor Dr.Mohammad Ibrahim Rajoka for guidance in kinetic analysis ofdata.
To submit a comment on this article please go to
http://mc.manuscriptcentral.com/wej. For further information please
see the Author Guidelines at wileyonlinelibrary.com
References
Alavanja, M.C.R. and Bonner, M.R. (2012) Occupational PesticideExposures and Cancer Risk: A Review. J. Toxicol. Environ.Health B Crit. Rev., 15, 238–263.
Alavanja, M.C.R., Ross, M.K. and Bonner, M.R. (2013) IncreasedCancer Burden among Pesticide Applicators and Others Dueto Pesticide Exposure. CA Cancer J. Clin., 63, 120–142.
Anderson, B.S. and Hunta, J.W. (2003) Integrated Assessment ofthe Impacts of Agricultural Drain Water in the Salinas River(California, USA). Environ. Pollut., 124, 523–532.
Anwar, S., Liaquat, F., Khan, Q.M., Khalid, Z.M. and Iqbal, S.(2009) Biodegradation of Chlorpyrifos and Its HydrolysisProduct 3, 5, 6-Trichloro-2-Pyridinol by Bacillus pumilus StrainC2A1. J. Hazard. Mater., 168, 400–405.
Bicker, W., Lammerhofer, M. and Genser, D. (2005) A Case Studyof Acute Human Chlorpyrifos Poisoning: Novel Aspects onMetabolism and Toxico-Kinetics Derived from LiquidChromatography-Tandem Mass Spectrometry Analysis of UrineSamples. Toxicol. Lett., 159, 235–251.
Chen, S.H., Liu, C.L., Peng, C.Y., Liu, H.M. and Hu, M.Y. (2012)Biodegradation of Chlorpyrifos and Its Hydrolysis Product
3,5,6-Trichloro-2-Pyridinol by a New Fungal StrainCladosporium cladosporioides Hu-01. PLoS ONE,7, e47205.
Chishti, Z. and Arshad, M. (2013) Growth Linked Biodegradationof Chlorpyrifos by Agrobacterium and Enterobacter spp. Int. J.Agric. Biol., 15, 19–26.
Chishti, Z., Hussain, S., Arshad, K.R., Khalid, A. and Arshad, M.(2013) Microbial Degradation of Chlorpyrifos in Liquid Mediaand Soil. J. Environ. Manage., 114, 372–380.
Dubey, K.K. and Fulekar, M.H. (2012) Chlorpyrifos Bioremediationin Pennisetum Rhizosphere by a Novel Potential DegraderStenotrophomonas maltophilia MHF ENV20. World J.Microbiol. Biotechnol., 28, 1715–1725.
Estevan, C., Vilanova, E. and Sogorb, M.A. (2013) Chlorpyrifosand Its Metabolites Alter Gene Expression at Non-CytotoxicConcentrations in D3 Mouse Embryonic Stem Cells under invitro Differentiation: Considerations for Embryotoxic RiskAssessment. Toxicol. Lett., 217, 14–22.
Fang, H., Yu, Y.L., Wang, X., Shan, M., Wu, X.M. and Yu, J.Q.(2006) Dissipation of Chlorpyrifos in Pakchoi-Vegetated Soil ina Greenhouse. J. Environ. Sci., 18, 760–764.
Fulekar, M.H. and Geetha, M. (2008) Bioremediation ofChlorpyrifos by Pseudomonas aeroginosa Using Scale UpTechnique. J. Appl. Biosci., 12, 657–660.
Ghanem, I., Orfi, M. and Shamma, M. (2007) Biodegradation ofChlorpyrifos by Klebsiella sp. Isolated from an ActivatedSludge Sample of Waste Water Treatment Plant in Damascus.Folia Microbiol., 52, 423–427.
Goda, S.K., Elsayed, I.E., Khodair, T.A., El-Sayed, W. andMohamed, M.E. (2010) Screening for and Isolation and Identifi-cation of Malathion-Degrading Bacteria: Cloning and Sequenc-ing a Gene that Potentially Encodes the Malathion-DegradingEnzyme, Carboxylestrase in Soil Bacteria. Biodegradation, 21,903–913.
Grzelak, B., Michalowicz, J. and Dukowska, M. (2012)Bioaccumulation of Phenol, Guaiacol and Some Chlorophenols
Chlorpyrifos(CP)
Diethylthiophosphoricacid (DETP)
3,5,6-trichloro-2-methoxypyridine
(TMP)
O-methylation
3,5,6-trichloro-2-pyridinol (TCP)
Hydrolysis
dechlorination and ring cleavage
Further breakdown
NCl
OP
O
CH3
S OCH3Cl
Cl
PS
HO
O
OCH3
CH3NCl OH
ClCl
N
Cl
OCH3
Cl
Cl
Fig. 8. Proposed pathway for biodegradation
of chlorpyrifos by Mesorhizobium sp. HN3 in
liquid cultures.
H. Jabeen et al. Biodegradation of CP and TCP
9Water and Environment Journal (2014) © 2014 CIWEM.
by Selected Freshwater Species of Leeches. Bull. Environ.Contam. Toxicol., 88, 976–984.
Jarvis, B.D.W., Berkum, P.V., Chen, W.X., Nour, S.M., Fernandez,M.P., Cleyet-Marel, J.C. and Gillis, M. (1997) Transfer ofRhizobium loti, Rhizobium huakuii, Rhizobium ciceri,Rhizobium mediteraneum, Rhizobium tianshanense toMesorhizobium. gen. nov. Int. J. Syst. Bacteriol., 47,895–898.
Jyothi, K., Surendra, B.K., Nancy, C.K. and Kashyap, A. (2012)Identification and Isolation of Hydrocarbon Degrading Bacteriaby Molecular Characterization. Helix, 2, 105–111.
Li, X., He, J. and Li, S. (2007) Isolation of a Chlorpyrifos-DegradingBacterium Sphingomonas sp. Strain Dsp-2 and Cloning of thempd Gene. Res. Microbiol., 158, 143–149.
Liu, Y.Z., Chen, X., Shi, Y. and Su, Z.C. (2012) Bacterial Degrada-tion of Chlorpyrifos by Bacillus cereus. Adv. Mater. Res., 356–360, 676–680.
Lu, P., Li, Q., Liu, H., Feng, Z., Yan, X., Hong, Q. and Li, S. (2013)Biodegradation of Chlorpyrifos and 3,5,6-Trichloro-2-Pyridinolby Cupriavidus sp. DT-1. Bioresour. Technol., 127, 337–342.
Mallick, B.K., Banerji, A., Shakil, N.A. and Sethunathan, N.N.(1999) Bacterial Degradation of Chlorpyrifos in Pure Culturesand in Soil. Bull. Environ. Contam. Toxicol., 62, 48–54.
Maya, K., Singh, R.S., Upadhyay, S.N. and Dubey, S.K. (2011)Kinetic Analysis Reveals Bacterial Efficacy for Biodegradationof Chlorpyrifos and Its Hydrolyzing Metabolite TCP. ProcessBiochem., 46, 2130–2136.
Mehta, A., Verma, R.S. and Srivastava, N. (2008) Chlorpyrifos-Induced DNA Damage in Rat Liver and Brain. Environ. Mol.Mutagen., 49, 426–433.
Mohan, S.V., Sirisha, K., Rao, R.S. and Sarma, P.N. (2007) Bio-Slurry Phase Remediation of Chlorpyrifos Contaminated Soil:Process Evaluation and Optimization by Taguchi Design ofExperimental (DOE) Methodology. Ecotoxicol Environ. Safety,68, 252–262.
Olexsey, R.A. and Parker, R.A. (2006) Current and Future in situTreatment Techniques for the Remediation of Hazardous Sub-stances in Soil, Sediments. In Twardowska, I., Allen, H.E.,Häggblom, M.M. and Stefaniak, S. (eds). Soil and Water Pollu-tion, Monitoring, Protection and Remediation, pp. 211–219.Springer, Dordrecht, The Netherlands.
Pirt, S.J. (1975) Principles of Microbe and Cell Cultivation, p. 274.John Wiley and Sons, New York.
Racke, K.D., Steele, K.P., Yoder, R.N., Dick, W.A. and Avidov, E.(1996) Factors Affecting the Hydrolytic Degradation ofChlorpyrifos in Soil. J. Agric. Food Chem., 44, 1582–1592.
Ragnarsdottir, K.V. (2000) Environmental Fate and Toxicology ofOrganophosphate Pesticides. J. Geol. Soc., 157, 859–876.
Robertson, L.N., Chandler, K.J., Stickley, B.D.A., Cocco, R.F. andAhmetagic, M. (1998) Enhanced Microbial Degradation Impli-cated in Rapid Loss of Chlorpyrifos from the Controlled-Release Formulation suSCon® Blue in Soil. Crop Prot., 17,29–33.
Rovedatti, M.F., Castane, P.M., Topalian, M.L. and Salibian, A.(2001) Monitoring of Organochlorine and Organophosphorus
Pesticides in the Water of the Reconquista River (BuenosAires, Argentina). Water Res., 35, 3457–3461.
Sharma, S. (2012) Bioremediation: Features, Strategies and Appli-cations. Asian J. Pharm. & Life Sci., 2, 202–213.
Singh, B.K., Walker, A., Morgan, J.A.W. and Wright, D.J. (2003)Effect of Soil pH on the Biodegradation of Chlorpyrifos andIsolation of a Chlorpyrifos-Degrading Bacterium. Appl. Environ.Microbiol., 69, 5198–5206.
Singh, B.K., Walker, A., Morgan, J.A. and Wright, D.J. (2004) Bio-degradation of Chlorpyrifos by Enterobacter sp. Strain B-14and Its Use in Bioremediation of Contaminated Soils. Appl.Environ. Microbiol., 70, 4855–4863.
Singh, B.K., Walker, A. and Wright, D.J. (2006) Bioremedial Poten-tial of Fenamiphos and Chlorpyrifos Degrading Isolates: Influ-ence of Different Environmental Conditions. Soil Biol.Biochem., 38, 2682–2693.
Singh, J.S., Abhilash, P.C., Singh, H.B., Singh, R.P. and Singh, D.P.(2011) Genetically Engineered Bacteria: An Emerging Tool forEnvironmental Remediation and Future Research Perspectives.Gene, 480, 1–9.
Sogorb, M.A., Vilanova, E. and Carrera, V. (2004) Future Applica-tion of Phosphotriesterases in the Prophylaxis and Treatmentof Organophosphorous Insecticide and Nerve Agent Poison-ing. Toxicol. Lett., 151, 219–233.
Thengodkar, R.R.M. and Sivakami, S. (2010) Degradation ofChlorpyrifos by an Alkaline Phosphatase from theCyanobacterium Spirulina plantensis. Biodegradation, 21,637–644.
Ventura, C., Nunez, M., Miret, N., Lamas, D.M., Randi, A.,Venturino, A., Rivera, E. and Cocca, C. (2012) DifferentialMechanisms of Action are Involved in Chlorpyrifos Effects inEstrogen-Dependent or -Independent Breast Cancer CellsExposed to Low or High Concentrations of the Pesticide.Toxicol. Lett., 213, 184–193.
Vogel, J.R., Majewski, M.S. and Capel, P.D. (2008) Pesticides inRain in Four Agricultural Watersheds in the United States. J.Environ. Qual., 37, 1101–1115.
Wang, X.D., Liu, X.J., Yang, S., Li, A.L. and Yang, Y.L. (2007)Removal and Toxicological Response of Triazophos byChlamydomonas reinhardtii. Bull. Environ. Contam. Toxicol.,78, 67–71.
Watts, M. (2012) Chlorpyrifos as a possible global POP [online].http://www.pan-europe.info/News/PR/121009_Chlorpyrifos_as_POP_final.pdf [accessed 10 August 2013].
Wilson, K.H., Blitchington, R.B. and Greene, R.C. (1990) Amplifica-tion of Bacterial 16S Ribosomal DNA with Polymerase ChainReaction. J. Clin. Microbiol., 28, 1942–1946.
Xu, G., Zhang, W. and Li, Y. (2008) Biodegradation of Chlorpyrifosand 3, 5, 6 Trichloro-2-Pyridinol by a Newly IsolatedParacoccus sp. Strain TRP. Int. Biodet. Biodeg., 62, 51–56.
Zhu, J., Zhao, Y. and Qiu, J. (2010) Isolation and Application of aChlorpyrifos-Degrading Bacillus licheniformis ZHU-1. Afr. J.Microbiol. Res., 4, 2410–2413.
Biodegradation of CP and TCP H. Jabeen et al.
10 Water and Environment Journal (2014) © 2014 CIWEM.
top related