rogen - mcgill universitydigitool.library.mcgill.ca/thesisfile68254.pdf · there was a hierarchy in...
Post on 17-Feb-2019
215 Views
Preview:
TRANSCRIPT
~------------------------------ ----
STRUCTURE-FUNCTION ANALYSIS OF THREE WIDELY DISPERSED POINT MUTATIONS IN THE HORMONE-BINDING DOMAIN OF THE HUMAN A..J,,(f\ROGEN
RECEPTOR.
NELLY SABBAGHIAN Department of B iology
McGill Univers ity Montréa l, Québec
Hay 1994.
A thesis submi tted to the Faculty of Graduate studi es and Research in partial fulfillment of the requirements for the
degree of Haste! of Science.
Nelly Sabbaghian (c) 1994
Structurc-function analysis of mutations in the hUlnan androgen receptor
ThiS thes \ ~ carr J es a
tOt:.~.L of ,), crec\i ts
1
crerHt welght of 3'3 credits, frem a
requirt:-d for the Haster 's deqree.
Gra.dllate cr~ci ~ ts a.e e a measure of the t lme ass igned te a
give n tas!{ lr '"he qr,;tdlp,tE! program. They are based on the
consider-:>·. ~t'f" ~ .lt cl term of full-time qraduate work is
eqili ValE::I 1 ~,' _ ',0 16 crodits, depending on the intensity
of the pr.'1gram.
ii
ABSTRACT
Three point. mutations have been .round in the hormone
olnding domain (HBD) of the human androgen receptor (hAR):
one in the N-terminal end [Ile663A3n in a family with
partial androgen insensitivlty syndrome (PAIS)]; on...: in the
middle, (Leu82.oVal in a family with PAIS); and one in the C
terminal end (Pro9.o3Ser, in a family with complete AIS).
The positions 663 and 9.03 were the most terminal mutation
sites in the HBD found to date. The three mutant hARs have
been pr ev i ous ly char acter i zed b i ochemi cally in gen ital s k in
fibroblasts. In the family with the Leu820Val substitution,
the mother and the grandmother were found to be carriers for
the same mutation. To prove their pathogenicity, each of
the three mutat ions has been reproduced in an hAR e:-:press ion
vector that was transfected into COS-l cells. In COS-l
ce l1s, the complexes fr om Pr 0 9.0 3Ser and Leua 2 aVal had:
increased thermolability; increased dissociation rates;
decreased affinitYi and abnormal transactivation. There was
a hierarchy in the sever i ty of the mutations expressed in
kine+::ic and transactivation assays that correlated with the
severity of the cliplcal phenotype. The pathogenicity cf
the Pro903Ser and the Leu820Vai mutations was thereby
confirmed. In COS-l cells, the AR with Ile663Asn had normal
thermolability, normal dissociation rates, and normal
transactivation, but a decreased aH lnity. Although this
sequence al teration has only been found in a PAl S patient,
l ts pathogenic i ty is not cons idered to be proven. More
sens i t ive assays ar e needed for this purpose.
i i i
RESUME
TI: ois mutat i ons dans le r éeepteur androgène huma in ont
été identifiées dans trois familles atteintes par le
~yndrorne de l'insensibilité aux androgènes. La première,
(isoleucine663asparagine, trouvée dans une famille atteinte
de la forme partielle du syndrome) est située à l'extrémité
N-termi nale, l'autre (l eue i ne 8 20va li ne, trouvée dans une
famille atteinte par la forme partielle) au centre, et la
troisième (proline 903 serine, trouvée dans une famille avec
la forme complète) à l' extrémi té C-termi nale du doma ine de
liaison avec l'hormone. Le caractère biochimique du
récepteur androgène a été étudié auparavant dans les
fibroblastes géni taux des patients. Dans l'une des
familles, la mère et la grand-mère maternelle ont été
trouvées hétérozygotes pour le syndrome. Les tro is
mutat i ons ont été repr odui tes, sépar émen t, dans un vecteur
qui a été exp?:imé dans les cellules COS-l. Cette méthode a
été utilisée pour prouver leur pathoqénie. Dans les
cellules COS-l, les mutations Pro903Ser et Leu820Val se sont
manifestées par: une sensIbilité thermale élevée des
complexes hormones-récepteurs; des dissociatlons rapides des
complexes; une affinité affaiblie aux androgènes; et une
act i v i té de transcr ipt i on d imi nuée. Nous avons cons taté une
corrélation entre la sévér i té des mutat ions, démontI: ée par
les essais de liaison avec l'hormone et de l'activité de
transcr ipt i on, et le phénotype clin i que des pat lents. Cec i
a prouvé la pathogénie de ces deux mutat ions. Cependant, la
mutation à la position 663, exprimée dans les cellules COS-
iv
l, a produ i t un récepteur mu tant f orman t des comp 1 exes
stables avec une augmentation de température; des taux de
dissociation normaux; et une activité de transcription
normale, mais une affinité réduite. La pathogénie de cette
muta t i on n' a pas é té pro uvée. Des expér l ences plus
sensibles seralent nécessaires à cette fin.
v
ACKNOWLEDGEHENTS
1 would like ta thank: Dr. Leonard Plnsky for qlvinq me
the opportunity to further my studies, and for hlS gUIdance
ln preparing this thesis; Dr. MorrIs Kautman, Dr. Mark
Triflro and Parsa Kazemi-Esfarjani for helpful discusslons;
Dr. Lenore Beitel for the help ln subcloning in the
baculov i r us plasmid; Rose Lumbr osa for techn ica l he Ip in
ampl if yi rig exon 1; Dana Shko Iny f or inter est i ng d iscuss Ions,
and moral support; Sylvie Bordet for glving me the interest
ta wori{ with one a f the mutant andr ùgen r eceptor si and
Carlos Alvarado for technical help ln transfections, .:Jnd
western blotting, and for his friendship.
vi
TABLE OF CONTENTS
Abstract ............ . . ..•..•.••• l i • •••••••• l l i Rés u mé . . . . . . . . . . .... .
Ack nowlegements ..... . . .......... v Abbrevlat Ions ....... . • ...•••• V 11 l
List of figurE'5 .... . •...••....• x i List nE tables ..... . · ........ xv i
1. 1 NTRODUCTI ON 1. Sterold hormones and their precursoIs .•......•..... 1 2. Superfaml1y of steroid receptors ................... 2
2 .1 A common ancestor gene ....•....•......•..... 3 3. structure-Eunction properties oE steroid receptors.5
3.1 The N-te]~mina1 domain ....................... 5 3.2 The DNA-binding domë.in ...................... 6
3.2.1 Dimerization subdomaln ...•........ 10 3.2.2 The hinge reglon .................. 11 3.2.3 Subcellular SR localization ....... 12
3 . 3 The ho r mon e - b l n d l n 9 d 0 ma ln. . . . . . . . . . . . . . ... 1 2 3.3.1 Hsp90-blnding and transcrlptional
repression ........................ 13 4. Androgen insensitlvity ...........•....•......•.... 14
4.1 Androgen hormone act ion ...•.....•.....•.... 14 4.2 Androge:n insensitivity syndromes ........... 16
4.2.1 Complete androgen insen:=;itivity ... 16 4.2.2 Partial androgen insensitivlty .... 17
4.1 Biochemical characterization of the hAR .... 18 4.4 Structure-functlon properties of the hAR ... 18 ~ . 5 Mut a t l 0 n sin the h AR . . . . . . . . . . . . . . . . . . • . . . . 2 4
5. ObjectIves ....•.......................•......•.... 29
II. MATERIALS AND METHODS 1. Ma ter i aIs ..................•.....••.•.••.....•.... 30
1.1 Families ..................•....•.....••.... 30 1.2 Primer synthesis ..........••.••••.....••... 30 1.3 Pr imary and secondary PCR .....•.......•.... 31 1.4 PurificatIon of DNA ........................ 31 1.5 Subcloning .....................••.......... 32 1.6 Sequencing ...............•••...••.....•.... 32 1.7 Exon 1 ampilfication and sequencing ........ 32 1.8 Tissue culture ...........••....••...•••••.. 32 1.9 Transfection ....................•.....•.... 33 1.10 Androgen--binding assays .•.•...••....••.... 33 1. l1 Growth hormone assay ...........•.......... 34 1.12 l3-galactosidase assays .................... 34 1.13 Western b10tting ...............•....••.... 34
1.13.1 Cel1 lysis and protein assay ..... 34 1.13.2 Gel electrophoresis .............. 35 1.1?3 Prote in transfer ................. 35
2 . He th od 5 • • • • • • • • • . • • • • . . . . • • . . . • • • • • • • • • • • • • • • •••• 3 5 2.1 Identification of mutatlons ..........••.... 36 2.2 Exon 1 ampllficatlon and sequencing ........ 36 2.3 Family studies •...........•....•••..•...... 36
VIi
2.4 Expresslon vectors....... ............ lG 2.4.1 pSVhl\Ro/BHEX ..................... lb
2.4.2 pMMTV-GH .......................... 37 2.5 Stte-directed mutagenesls .................. 17
2 . 5 . 1 P r 1 me r s . . . . . . . . . . . . . . . . . . .. . ..... J 9 2.5.2 Prlmary PCR •......•••..••..•••.•.. 3'1 2."'.3 Secondary PCR ............... '" .. 39
2.6 Purification of DNA fragments .............. 40 2.7 Subc1oning ................................. 40
2.7.1 RestrictIon endonuclf'élSe cllgest-Ion'IO 2.7.2 LlgatIon .......................... 42 2.7.3 Com~etent cells ................... 47 2.7.4 Transformatton and screenlng of
colonies .......................... 42 2 . 8 La r 9 e - s c a 1 e D N A a mp Il fic a t I on . . . . .......... 4 3 2.9 SequencIng ................................. 43 2.10 Tissue culture ............................ '13 2.11 Transfection .............................. 44 2.12 Cotransfectlon ............................ 44
2.12.1 Transactlvation dnd growth hormone assay .................... 45
2 . 1 3 An d r 0 9 e n - b i n d i n 9 as s a ys. . . . . . . . . . . . . . . . . . 4 6 2.13.1 Nonequi1ibrium dissociatlon r~te
cons tants ........................ 46 2.13.2 Thermol~bility ot complexes ...... 47 2.13.3 Apparent equillbrium dissociatIon
rate constants ................... 47 2.14 r3-ga1actosidase assay .................... 47 2.15 Western blotting ......................... 48
2.15.1 Cell lySlS and protein determination .................... 48
2.15.2 Discontlnuous SDS-PAGE ........... 49 2.15.3 Proteln transfer ................. 49
III. RESULTS 1. Identification of mutations ....................... 51 2. Fami1y studies .................................... 51
2.116588 (Leu820Va1) .......................... 51 2.2 1609/6003 (Pro903Ser) ...................... 57 2 . 3 6 0 5 (1 1 e 6 6 JAs n ) . . . . . . . . . . . . . . . . . . . . . . . . . . . . 57
3. Site-directed mutagenesis ......................... 61 4. Androgen-binding assays ........................... b2
4.1 Genital skin fibroblasts ................... 62 4.2 Transfected COS-1 celIs .................... 61
4.2.1 Thermolab11ity .................... 64 4.2.2 Nonequilibrium dissociatlon rates.65 4.2.3 Apparent equi1ibrium dlssoclation
rate constants .................... 72 5. Transacrivation assays ............................ 76 6. Western blottlng .................................. 82 7. Exon 1 amplification and sequencing ............... 82
IV. DISCUSSION ....•..............•...................... 85 V. CONCLUS 1 ON .......•..•.••••....•...•......•.......... 95 VI. REFERENCES ..............................•........... 97
~----------------------- ------
vili
LIST OF ABBREVIATIONS
AI Androgen insensitivity
AIS Androgen insensitlvity syndrome
AMH Anti-Mullerian hormone
AR Androgen receptor
ARE Androgen response element
Asn As~aragine
Bmax Maximal binding capacity
CAlS Complete androgen insensitivity
CAT Chlorarnphenicol acetyl transferase
cDNA Complernentary deoxyribonucleic acid
COUP-TF Chicken ovalburnin upstream prornoter transcription
factor
DBD DNA-binding domain
DHT 5a-dihydrotestosterone
ER Estrogen receptor
ERE Estrogen response element
ERRl and ERR2 Estrogen related receptors 1 and 2
GAL4 Yeast transcription factor
GH Growth hormone
GR Glucocorticoid receptor
GRE Glucocorticoid response element
hAR Human androgen receptor
HBD Hormone-binding dornainhGR
hGR Human glucocorticoid receptor
hER Human estrogen receptor
lX
hHR Human mineralocortlcold receptor
hPR Human progesterone receptor
HRE Hormone response element
HSP Heat shock protein
Ile Isoleucine
Leu Leucine
HAIS Hild androgen insensitivity
MB Mibolerone
MHTV-LTR Mouse mammary tumour virus-long terminal repeat
MR Mineralocorticoid receptor
MT Methyltrienolone
NLl and NL2 Nuelear loealization signal 1 and 2
PAIS Partial androgen insensitivity
PB Probasin gene
PR Progesterone reeeptor
PSA Prostate specifie antigen
RAR Retinoic acid reeeptor
rAR Rat androgen reeeptor
SBMA Spinal bulbar muscular atrophy
Ser Serine
Slp Mouse sex limited protein
SR Steroid receptor
SVP Sevenup gene produet
T Testosterone
TR Thyroid hormone receptor
TK Thymidine kinase
TRE Thyroid hormone response element
x
Val Valine
VP16 Herpes virus protein
LIST OF FIGURES
Fig. 1: Biosynthetic pathway of steroid hormones from
cholesterol.
Fig. 2: structure-function organization of the nuc!ear
receptor superfamily (Wahli and Martinez 1991).
xi
Fig. 3: Proposed phylogenetic tree for the nuclear receptor
gene superfamily (Laudet et al., 1992),
Fig. 4: structure of the DNA-binding domain of the rat
glucocorticoid receptor and a variety of consensus
sequences of hormone response elements (Freedman
and Luisi 1993).
Fig. 5: 1 Formation of the internal genital tract in male and
female embryos (Wilson et al., 1981).
Fig. 6: Conversion of testosterone to 5Œ-dihydrotestosterone
by the enzyme 5Œ-reductase (Wilson et al., 1981).
Fig. 7: Formation of the external genital tract in male and
female embryos (Wilson et al., 1981).
Fig. 8: cDNA sequence and deduced amino acid sequences of
the rat and human androgen receptor (Chang et al.,
1988).
xii
Fig. 9: Exonic and modular structure-function organlzation
of the human androgen receptor (Pinsky et al.,
1992).
Fig. 10: Amino acid sequence homology among various steroid
receptors (Chang et al., 1988).
Fig. Il: Human androgen receptor expression vector (pSVhAR o )
(Brinkmann et al., 1989).
Fig. 12: Modified human androgen receptor expression vector
(pSVhARo/BHEX) .
Fig. 13: Human ~~owth hormone reporter cunstruct (pMMTV-GH)
(Prior et al., 1992).
Fig. 14: Steps for PCR mutagenesis (Higuchi 1990).
Fig. 15: Sequencing d~ta of the 11e663Asn mutation.
Fig. 16: Sequencing datd of the Leu820Val mutation.
Fig. 17: Sequencing data of the Pro903Ser mutation.
Fig. 18: Chemica1 structure of the amino acids involved in
the three mutations.
xiii
Fig. 19: Nucleotide sequence of exon 7 and locatIon of the
primers and HphI digestion sites in Leu820Val.
Fig. 20: Family study of 16588 (Leu820Val).
Fig. 21: Nucleotide sequence of exon 8 and location of the
primers and the abolished Bsp12861 site in
Pro903~er.
Fig. 22: Family study of 1609/6003 (Pro903Ser).
Fig. 23: Thermolabi1ity of complexes in COS-1 celis
transfected with the three mutat;ons separately.
Fig. 24: Thermolability of the three mutant and control
unliganded receptors expressed in CûS-1 cells.
Fig. 25: Dissociation assay of Pro903Ser and control in
transfected COS-l cells with mibolerone and methyl
trienolone.
Fig. 26: Dissociation assay of control, Leu820Val, and
Ile663Asn in COS-l cells with mibolerone and methyl
trienolone.
Fig. 27: Scatchard analysis of the three mutations in COS-l
cells with mibolerone.
xiv
Fig. 28: Scatchard analysis of the three mutatIons in COS-l
cells with methyltrienolone.
Fig. 29: Transactivation of pMMTV-GH in a cotransfection
assay in COS-1 cells with a control and the three
mutations (values corrected for transfection
efficiency) .
Fig. 30: Androgen-binding activity in COS-l cells cotrans
fected with control and the th~ee mutati0ns with
pMMTV-GH in the 48-50 h group, 48 h group, and the
94-96 h group (values corrected for transfection
efficiency) .
Fig. 31: Transactivation of human growth hormone per unit
MB-binding activity of control and the three mutant
receptors.
Fig. 32: Western blot of proteins extracted from GSF of 605,
16588, and 6003.
Fig. 33: Mode1 for interactions of the progesterone receptor
with hormone and antihormone (Baniahmad and Tsai
1993).
Fig. 34: Amino acid sequence of the hinge region of the ruman
androgen, glucocorticoid, progesterone, and minera-
1ocorticoid receptors.
xv
LIST Ol? TABLES
Table 1: Various putative androgen response elements and the
consensus glucocorticoid response elements (Roche
et al., 1992; and Rennie et al., 1993).
Table 2: Summary of base and codon substitutions of the
three mutations with the biochemical phenotype of
the mutant androgen receptors and the clinical
phenotype of the patients.
Table 3: Mean nonequilibrium dissociation rate constants ~or
mibolerone, methyltrienolone, 5«- dihydrotesto~te
rone, and testosterone in GSF ar.d ln COS-l r~lls
transfected with the control or mutant AR.
Table 4: Mean apparent equilibrium dissociation rate cons
tants of the three mutant AR in COS-l cells with
mibolerone and methyltrienolone.
1
1. INTRODUCTION:
1. Steroid hormones and their precursors:
The biochemical beginning of the twentieth century was
marked by the discovery, isolation and synthesis of steroid
hormones. The field of steroid chemistry developed rapidly
from 1929 to the mid 1950s: this period has been called the
"golden age" of steroid research. Estrone, the first sex
hormone to be recognized, was isolated in 1929. By the end
of the fourth decade, the rest of the sex hormones were
discovered and synthesized. The major medical discoveries
in that period included: the us~ of cortisone in treatment
of rheumatoid arthritis, and the contraceptive quality of
progesterone (Gortler and Sturchiù 1992).
Cholesterol, the main biosynthetic precursor of steroid
hormones, i s a ub i qu i tous substance in eukaryotes, but is
absent in prokaryote~. Its basic structure is an isoprene
un i t (i sopentyl pyrophospha te), a 5-car bon cha in that is • formed from acetate. Condensation of four isoprene units
forms a substance called a terpene (squalene C30 ), then
cyclization and further modification of the latter produce
cho lestero 1 (C:a 7) • Crucial hydroxylation of cholesterol
produces the sterold hormones (Stryer 1988a), including: the
progestagens (progesterone), which prepare the lining of the
uterus for implantation of the ovumi mineralocorticoids
(aldosterone), which promote reabsorption of sodium and
chloride ions by the kidney to maintain blood volume and
blood pressure; glucocorticoids (cortisol), which promote
gluconeogenesis and degradation of fat and protein;
FUNCTION
DNA-binding
Ligand-binding
Dimerization
Nuc1ear localization
Transactivation
HSP90-binding
CI l'II
A/B
N __ ~~
-•••••••••• •••••••••
1 ••••••••• • •••••••• 1
F
E}-C ? .
Fig. 2: structure-function organization of the nuç1ear
receptor superfamily. A/B indicates the N-terminal
domain; C represents the D~A-binding domain anJ i8
subdivlded into the CI (first zinc-flnger) and the
Clr (second zinc-finger); D is the hinge reglon; E
represents the hormone-b1nding damain, F 15 present
in the ER, the RAR and others, but its functlon (if
any) 1s not known (Wahli and Martinez 1991).
androgens <testosterone), which
development of primary and
characteristics; and estrogens
2
are responsible for the
secondary male sexual
(estradiol), which are
responsible for the development of female secondary sex
characterlstics (Fig. 1).
2. Superfamily of steroid receptors:
In contrast to peptide hormone receptors that reside in
the cell membrane, steroid receptors (SRs) are found inside
the cell. Sorne SRs are predominantly cytoplasmic and others
are nuclear. They are distinct in their ability to act as
llgand-induced transcr iption regulators. SRs mediate the
action of steroid hormones by binding to their cognate
ligand, and translocating into the nucleus where they bind,
as dimers, to specifie DNA sequences called hormone response
elements (HREs), usually located ln the promoter region,
upstream of target genes. This process activates or
represses the genes in question.
The genes encoding the SRs are members of a large
nuclear receptor superfamily that comprises the receptors
for steroid hormones, thyroid hormones, retinoic acid and
vitamin 0 (Evans et al., 1992). Other protelns with similar
structural and functional characteristics are called "orphan
receptors" because their ligands are unknown (Laudet et al.,
1992). The chicken ovalbumin upstrea~ promoter
transcription factor (COUP-TF) is one such "orphan
receptor". It recognizes a promot~r sequence important in
the efficient transcription of the ovalbumin gene (O'Halley
et al., 1990), and structurally i t i5 related to three
Glucocorticoids (C21 )
Cholesterol (Cv)
l Pregnenolone (C11)
l Progestagens (C 21 )
Mineralocorticoids (C21)
Androgens (C I9)
l Estrogens
(Cu)
Fig. 1: A simplif:ed biosynthetic pathway of steroid hormones
from cholesterol. C=carbon molecule and the subscr ipt
numbers refer to the numbers of carbon molecules in
each substance (stryer 1988a).
3
or phan receptors found in two different species: the hurnan
estrogen-related receptors 1 and 2 (ERR1 and ERR2), and the
5evenup gene product (SVP) that i5 involved in phatoreceptor
cell formation during eye developrnent in Drosophila,
2.1 A common ancestor gene:
AlI the members of the superfamily have three
5 t r u ct ur a l do ma i n s : 1) an N - ter rn i na Ida ma in, var i ab lei n
length, that has been shown ta madulate transcr iptional
regulation in sorne cases; 2) a central hydrophilic domain
involved in DNA-bindingi and 3) a hydrophobie C-terminal
domain involved in ligand-binding (Fig. 2). Because of the
tr anser Ipt i onal regulatory property of these nuclear
reeeptars, sc i ent i s ts have been i nterested in the ir
evolutionary origin. Two hypotheses have been proposed: the
first assumes that the different domains have distinct
origins, and that the transcription factors arose from their
fusion; the second suggests a single precursor that acquired
complex functions with time (Amero et al., 1992). Studies
on sequence conservat i on in the DNA and ligand -bind i ng
domains led Laudet et al., (1992) to divide the members of
the superfarnily into three groups: 1) the retinoie acid
receptors (RARs) and the thyroid hormone receptors (TRs)i 2)
the "orphan receptors"; and 3) the SRs. Th 1 s was done by
constructing and comparing phylogenetic trees of the DNA
binding, and the hormone-binding domains of 32 genes that
belong to the superfamlly, using the "Fitch least square"
method (Laudet et al., 1992) (Fig. 3).
<1
Fig. 3: Proposed phylogenetic tree for the nuclear receptor
genes superfamily based on the sequences encoding
the DNA-binding domain. The groups and the
subfaml1ies are lndlcated by brackets. The bar
represents a branch length of 10 units. The arrows
point ta human and Drosophila genes which cluster
together. AR, human androgen receptor; COUP,
chlcken ovalbumln upstream promoter; E75, Drosophi la
or phan receptori EARl, orphan receptori ECR, Droso
phila ecdysone receptor; EGON, Drosophila orphan
receptor, ER, human estrogen receptor; ERR1, human
orphan receptori ERR2, human orphan receptori FTZ
Fl, Drosophila orphan receptor; GR, human glucocor
tlcoid receptori H2RIIBP, mouse orphan receptor;
HNF4, r.at or phan receptor; KNI, (knirps) Droso-
phila or phan receptori KNRL, Drosophlla knirps
related or phan receptor i MR, human mlneralocortlcoid
'receptor i NGFIB, orphan receptor; PPAR, mouse or phan
receptori PR, human progesterone receptori RARA,
human retinolc acid receptor alpha; RARB, human
retinolc acid receptor beta; RARG, mouse retinoic
acid gamma; RXR, human orphan receptor; SVP, Droso
phila orphan receptori TLL, tailless Drosophila
orphan receptori TR2, human orphan receptori THRA,
human thyroid hormone receptor alpha; THRAXA,
Xenopus thyroid hormone receptor alpha; THRB, human
thyroid hormone receptor betai USP, Drosophlla
ultrasplracle orphan receptori VDR, human vitamin D
receptor (Laudet et al., 1992).
Group Subramily
rC. THR-\ ! THR THR\X.-\ 1 THRB
"RARA [ t:RARB RAR 1 } RARG
EARl
! t E75~ EARl -1 PPAR
COLl»
cot"P
EAlU
TR1
IL-i r=RXR ) n ~K~ RU
t:SP }
L 'GF1B
IDiH t H>T<= ....-'lU
ER
1ER ERRl
ERlU
GR
l PR GR
...- AR m FI'Z.F]
IQIl
KSlU.
~ EGON K.'"1IVDR
VDR ~
ECR
5
3. structure-function properties of sterold receptors:
Based on the percentage of amino acid conservation, the
SR group i s further di vided into two subfami lies: the
glucoeortico id receptor
receptor (ER) sub family.
(GR) sUbfamily, and the estrogen
The GR 5ubfamily comprises the GR,
the androgen receptor (AR), the mlneralocorticoid receptor
(MR), and the progester one reee ptor (PR) (Green and Chambon
1988) •
The cDNA of the GR was the f irst SR to be cloned
(Hollenberg et al., 1985). Much effort was spent on
ident i fying the di f ferent funet ional doma i ns of the GR, and
this was attained by using mutational analyses (Giguère et
al. 1 1986) as descr ibed below.
3.1 The H-terminal domain:
The N-terminal domain of aIl SRs i5 encoded entirely by
exon 1. Its length varies from 25 amine acid! (vitamln D)
to 600 amino acids (MR) (Janne et al., 1993), and accounts
for most of the difference in the!r rnolecular weights. The
N-terrninal domain i5 aiso irnrnunogenic; several monoclonal
antibodies have been raised against portions of it. This
region of the SRs is cailed the transactivating domain since
it contains els-acting elements important in activating
transcription of reporter genes (Krozowski et aL, 1989).
In sorne SRs , this domain is rich in aeidic amino acids
(Br inkrnann et al., 1989). Ac id l c doma ins have been found ln
the yeast transcr iption factor GAL4 and the herpes v iIUS
protein VP16, where they functlon as "transcription
act i va tors" (Ptashne and Gann 1990) 1 presurnably by vi rt ue of
interaction with other proteins.
6
These regions have been
shawn to be lnvo) ved in prote i n-pr oteln i nteract ions.
In vi t:ro mutagenesis in the N-terminal domain of the
rAR revealed sequences that seemed necessary for
transcriptional activation. When coexpressed with wild-type
rARs, sorne delet ion mutants behaved as dominant-negative
regulators most probably by heterodimer formation (Pa1vimo
et a 1 . 1 1993).
3.2 The DHA-blndlng doma.ln:
The ONA-binding domain (DBO) of SRs and thyrold
receptors is made of 66 to 68 amino acids, and it possesses
the highest degree of amino acid conservation (Chang et al.,
1988). It is rich in cysteine residues and contains basic
amine acids. These features made the central part of the
receptors a good candidate for a DNA-bind Ing domain. Site
directed mutagenesis in that area affected DNA-binding but
not hormone -bind! ng ab! l i ty (Ho llenberg et al. 1 1987). When
this region of 66 amino acids of the human ER (hER) was
replaced by that of the human GR (hGR), the chimaeric
receptor activated GR-respons ive genes upon stimulation by
estradiol (Green and Chambon 1987). This proved that the
spec 1 f ici ty for target genes was conferred by the ON A
bind l nq domain. In the rat AR (rAR), the human AP (hAR),
the human PR (hPR), and the hGR, ten cystelne re~idues are
conserved and in the ER nine of ten cysteines are conserved
(Chang et aL, 1988). Eight cysteines appear to fold into
two "z inc- f Inger" str uctures wi th one zinc atom being
tetrahedra11y coordi:1ated ta four cysteines at the base of
each fi nger • This motif was f irst found
7
ln the
transcription factor TFIIIA from Xenopus, which 1s Involved
in the transcription of the 5S ribosornal RNA by binding to
DNA. TF! IIA -=:ontai ns nine consecutive "zinc-fingers": they
differ from those in SRs by the replacement of two cysteines
wi th two hist idin~s in each finger. 1 n the nuclear receptor
superfamily, the two "zinc-fingers" are encoded by d1fferent
exons, they are di fferent structurally and they fOIm a
single unit. The "z1nc-fingers" of TFIIIA contact the DNA
strand and function independently. Three dirnens10nal
informa t ion was obtained from nuclear magnetic resonance
(NHR) spectroscopy (Hard et al., 1990), and crystallographic
analysis (Luisi et a1., 1991) of the rat GR (rGR) (Fig. 4A)
and the ER (Rhodes and Klug 1993). Bath "zinc-f!ngers" are
characterized byan irregular loop (zinc atom at the base),
followed by an alpha helix, and an extended region. The two
alpha helices cross at the midpoint. Each "z1nc-flnger" has
a d1st i nct f unct1on; the N-termi nal "zinc- f inger" contacts
the ONA strand in the maj or groove through two amine ac ids
1 n the loop, and one in the alpha he 1 ix. 'l'he lat ter thr ee
amino acids form the P box (Carson-Jurica et al., 1990).
These amino ac1ds are involved in recognition of the
specifie HREs of each receptor. In the rat GR (rGR) they
are: glycine 458, serine 459, and valine 462. These amino
acids are conserved among the members of the GR subfamlly.
The C-termina l "z1nc-finger" 15 i nvol ved 1 n dimer i zation of
t wo reeeptor sand stab l1izat i on 0 f the structure. A
dimerlzation region was discovered in this "zlnc-finqer" and
was named the 0 box. This reglan 15 respons1ble for
8
li' 19. 4: (A) DNA -bind i ng domain 0 f the rat glucocortico id
receptor. Indicated residues and regions are based
on the crystal structure of the protein bound to a
GRE (Luisi et al., 1991). One module (indicated by
a brack et) consists of one loop and one u-helix
(region enclased by a sol id Une). Solid rectangles
r epresent res idues making speci f lc contacts wi th the
phosphates, whereas the open rectangles represent the
residues making nonspecific contacts. Solid and open
arrows indicate res idues that contact the bases at
specifie and nonspecific sites, respectively. The
asterisk indicates that the contact between Val 462
and the base is not at a nonspecific site. Solid
dots mark the res1dues Involved in dimer interface
interactions. The ami no acids that confer the
specificity ta HREs are shown in solid boxes; those
l nvol ved in half-s i te spac ing r equil ement are shown
in sol id circ les. The number 1 ne; scheme is based on
the full-length receptor. The smaU letters on the
N-terminus of the DNA-binding domain derive from
flanking sequences derivinq from the expression
plasmid used. The C-terminus end contains amino
acids represented by dashes (reviewd by Freedman and
Luisi 1993). (B) Idealized pal indromic response
elements of the GR, ER, TR and VDR. The n urnber i ng
convent ion used cons iders the dyad as or ig1n. Arrows
indicate the direction of the half-sites (Freedman
and Lui s i 19 9 3 ) .
(A)
MC~l.:le 1
(B)
1.""\':
Mcèl.:l' :
----.-.---.----- •• ---- L ~1rC:::Aï..\aQIG KIKKKïl<RA E • -~1;r· - _. - -=:~- -- - -~f5- - - - 510
~GG ïCA:lïG ACC~ "'ZC C AGi:). C ïC:G y
~ G Q 'j" C Air:.-:.yfc G j" CAl ""Z C CAC:::: ïlr.nn 'Z. C C A G ï 1
G l
N
9
determlning the spacing between the two recognition helices
in th~ N-terminal f1nger which 1s important to allow proper
proteln-protein contacts for optimal DNA-binding (Luisi et
a1., 1991).
The HREs are short imper fect pal indromic sequences,
they are c ls -act i ng and are class i fied as enhancers s ince
they function in different orientations and positions
(Carson-Jurica et a1., 1990). The GR shares similar HREs
w1th the PR and the AR: they are called GREs. They are
dlfferelit from the HREs of ER (EREs) and the TR (TREs). The
GREs and the EREs consensus sequences are made of two half
sites that are separated by three nucleotides, whereas the
TREs' half-sites lack the separating nucleotides (Fig. 48).
A GRE was fi rst ident if ied ln the long terminal repeat 0 f
the mouse mammary tumour virus (HMTV-LTRi -201 to -69),
whlch also contains binding sites for NF1 (a transcription
factor). PR was capable of transactivating a
chloramphenicol acetyl transferase (CAT) gene from a
thymidine kinase (TK) gene promoter containing the 15 base
pair GRE consensus sequence (Strâhle et al., 1987).
HREs are usually located at various positions relative
te the transcription start site of target genes, near other
transcription factor-binding sites (Strâhle et al., 1988).
A synerglstic action was found between GREs and the
transcription factor-binding sites. When one GRE or ERE was
placed near the TATA box of a reporter gene~ distal prometer
elements being deleted, there was hc.rmone-dependent
transactivation with the respective hormone. However, when
one GRE was placed farther upstream of the TATA box, there
10
was no transactivation. The latter was restored by the
addition of another GRE or a CCAAT box, or NFl and SPl
binding sites.
The Involvement of nonrecept~,.,.. factors with HREs was
also demonstrated by Pearce and Yamamoto (1993). A
composite GRE has been discovered upstream of the prollferln
gene (member of the mouse prolactin-qrowth hormone family)
(Mordacq and Linzer, 1989). 1 t conferred repress ion by
glucocortico Ids, and was shown to be occupied by GR in
footprinting experiments. This region was named "plfg" by
Diamond et a1., (1990), and the "composite speciflcity
domain" by Pearce and Yamamoto (1993). The latter group
formed chimeric constructs: 1) The GR N-termlndl domain was
linked ta the DBD and HBD of MRi 2) The N-termlnal of the MR
was Ilnked ta the DBD and HBD of the GR. The first
construct repressed expression of a reporter gene in vitro
in the presence of heterodimers of cJun-cFos (subunlts of
the transcription factor APl), enhanced transactivation with
cJun homodime1:s, and lacked activity ~dth the absence of
APl. The second construct failed te repress transactivatlon
given the same conditions for GR-induced repression. They
concluded that the N-terminal domain distlngulshes GR from
MR wlth respect to represslon of cFos-cJun activlty at
"plfg" •
Speclflclty of androgen action will be discussed in
section 4.4.
3.2.1 Dlaerizatlon subdomalns:
The dyad symmetry of the HREs predicted potential dimer
11
formation by the SRs. Use of gel retardat ion assays and
monoclonal antibodies to GR and p~ showed that both
receptors bind the consensus GRE specifically, and that the
receptors first bind the 3' half-site and then the 5· half
site. The binding of the first thus faeilitates the binding
of the second receptor. This led to the postulate that the
SR's DNA-binding proeess is cooperative and that the
receptors are in a dimer form (Tsai et al., 1988; Luisi et
al., 1991). The existence of two sedimentation coefficients
of the activated (DNA-binding state) ER, indicated the
existence of a monomer and a dimer form of the receptor
respectively (Notides et al., 197 A). A dimerization
subdomain in the mouse ER was found within a region in Its
hormone-binding domain (Fawell et al., 1990). The amine
acids ln that region are eonserved among the nuelear
reeeptor superfamily; they form a hydrophobie cluster that
resembles the "Leucine zipper" motif. This motif 1s a
heptameric repeat of leucine (or equivalent amina aeids sueh
as valine, methionine, and isoleucine), farming an
amphipathie alpha helix (Fawell et al., 1990).
3.2.2 The hlnge region:
The ONA-binding domain and the hormone-binding damain
are separated by a short sequence of amino aeids that
cantains turns and coi l'S. It is called the hinge region
beeause It is thought that it facilitates the folding of the
two domains onto each other (Krazowski et al., 1989). The
amine acid sequence in thls region is not conserved among
the members of the superfamily. Recently, a mutation has
12
been found in this region of the c-erbA-f3 TR gene in a
family with a generalized thyroid hormone resistance (Behr
et al., 1992).
3.2.3 Subcellular SR localization:
Most un11ganded SRs are thought to be located ln the
cytoplasm. Upon hormone administration the hormone-receptor
complexes move to the nucleus where they bind HREs. Picard
and Yamamoto (1987) found two nuclear locallzation signaIs
in the rGR: NLI and NL2. This group fused different deleted
rGRs to tt"te E. col i B-galactos idase gene, and used them to
transfect COS 7 and CV-l cells (two afr1can green monkey
kidney cells). The fusion proteins were detected by
immunofluorescence us1ng antibodies d1rected against B
ga1actosidase or the N-terminal domain of the rGR. NL1 was
loca1ized in the C-termina1 end of the DNA-binding domain
(hinge region). 1 t 15 lys ine-r ich and has 50\ homology w1 th
the SV40 large T-ant1gen nuclear localization signal
(Ka1deron et al., 1984). In hAR this sequence 1s located
between codon 629 and 634 (Lys-Leu-Lys-Lys-Leu-Gly)
(revi~wed by Jenster et a1., 1991). NL2 was loca11zed in
the HBD, but its sequence has not been identified.
4.2 7he hor.ane-bindlng domaln:
The hormone-binding domain (HBD) 1s located in the C
terminal portion of the SRs. It is re1atively rich in
hydrophobie amine ac1ds that are presumably invo1ved ln
forming a steroid-binding pocket. Comparative stud1es of
the members of the GR subfamily revealed 50 ta 54% overall
13
s imilar: i ty in th 1 s reg i on, and four conserved subreg ions
containing 65 to 100% homology (Chang et al., 1988).
Methionine res idues are present dense1y in this domain, a
characteristic of aIl SRs.
Besides its ligand-binding activity, the HBD plays an
important role in: dimerization (3.2.1), nuclear
locallzation (3.2.3), the binding of heat shock protelns
(3.3.1), and transactivation (3.3.1).
3.3.1 Hsp90-binding and transcriptional repression:
GRs is01ated from cytos01 preparations of hypotonie
cell 1ysates sediment as large complexes of 8S-95 on a
sucrose gradient. The receptors seem ta be associated wlth
a 90 kilodalton (kDa) heat shock protein (hsp90). When this
receptor preparation was heated or treated wi th salt, i t
sedimented as a 4S molecule thé1t had high DNA-bindlng
activlty (Pratt et al., 1988). The same 4S receptor form
was found upon hormone add i t ion (Hollenberg et al., 1989).
C-terminal and N-terminal deletions created in the HBD of
the hGR revea1ed the presence of transer ipt ion inhibi tory
regions. Gene constructs were made with normal and deleted
HBDs of the hGR to measure transcription of a luciferase
reporter gene (Denis and Gustafsson 1989). Two
transcr 1 pt 10n Inh 1 bi tory repress i on reg l ons were found, one
between amino acids 530 to 582, and another between residues
697 and 777. Two models have bèen proposed for the
mechanism of repression. The first proposes that the
inh1bitory sequences mask the DNA-binding sites, and the
second suggests that the inhibi tory sequences might be
ovary ___ A Fallopian .J7fJ tube . ,
INDIFFERENT STAGE
mesonephros
ullerian duet
If tian duet
epididymis testis
as deferens
seminal vesiele
........... / :" :i .~ prostate ..... ~ " '..,
...... ::,-/ ',t.
MALE
Fig. 5: Formation of the internaI geni tal tract in male and
female embryos (Wilson et al., 1981),
14
occupied by a non-receptor protein (one being the hsp90).
A "dock Ing complex" has been propos ed by Pratt (1992). In
this model the GR is attached to a cytoplasmic "docking"
structure made of two hsp90 molecules, and one each of
hsp56, p50, p23, and p14. It i5 also postulated that the
bind lng of the receptor to hsp90 confers on the receptor a
conformation that promotes steroid-binding and a cytoplasmic
location, but inhibits DNA-binding, and that the function of
the complex 1s mainly trafficklng and folding of the
receptoI. Upon l igand-binding, the GR dissociates from the
hsp90. This was not found for the PR and the ER, as these
receptors b Ind ligand in hsp90 fr ee state (pr att et al.,
1992) .
4. Androgen insensitivity:
4.1 Androgen hormone action:
In humans, androgen hormones are responsible for the
normal development of the male genitalia prenatally, and for
virilization at puberty. Defects of androgen action at any
stage of the deve lopment of the human embryo cause androgen
resistance or androgen insensitivity syndromes (AIS).
Under~tanding the normal process of male sexuai
differentiation explains the di fferent cl inical phenotypes
observed in subjects wlth AI.
A mammalian zygote carrylng a 46, XX karyotype will
develop into a female, whereas a 46, XY zygote develops into
a male. Ir. humans, at 5 to 6 weeks of gestation,
indifferent gonads form. At this stage the internaI
genitalia are made of two duct systems: the Wolfian (male),
IN DI FFERENT STAGE
ovary ___ ~
FalioPian=:tfJ tube ~ ,
uterus--:....L
vagina , , 'oM.'
FE MALE
mesonephros
ullerian duct
pididymis --testis
s deferens
. ..-....... .' .' .;.... prostate .: ~
··:l!:~j MALE
Fig- 5: Formation of the internal genital tract in male and
female embryos (Wilson et al., 1981).
15
and the Mullerian (female) (Fig. 5). A "switch mechanism"
15 necessary to decide whlch pathway wlll be chosen (male or
female). The short arm of the Y chromosome contains a gene,
called SR Y, that ls responslble for the development of
testes in male f""nbryos (Sinclair et al., 1990). When
formed, the testes produce testosterone via the Leydig
cells, and the anti-Mullerian hormone (AMH) via the Sertoli
ce 115. The AMH i s a g lycoprotei n that acts i ps i lateral1y
and causes regresslon of the Mu11erian ducts. These
structures lose responsiveness to this hormone after a
critical period of fetal development (Hughes et al., 1989).
Testosterone causes the differentiation of the Wolffian
ducts into the epididymes, vasa deferentia, and seminal
veslcles. Simultaneously, the prostate gland is formed from
endodermal buds in the pr imi t i ve urethra (Wilson et al.,
1981). In a female fetus, the Mu1lerian ducts differentiate
into the fallopian tubes, uterus, upper vagina, and the
Wolfflag ducts regress.
In target cells, testosterone ls metabolized to 5Œ
dihydrotestosterone (DHT) by the action of the 5Œ- reductase
enzyme (Fig. 6). In male embryos, DHT is responsible for
the development of the male external geni tal ia. By i ts
action, the urogenital sinus (or genital fold), the genital
tubercule, and the genita1 swe11lngs de~elop, respectively,
Into the penis, the penile urethra, and the scrotum (Hughes
and Plnsky, 1989). In the female embryo, the genital
tubercule becomes the clitoris, the genital swellings become
the 1abla majora, and the genita1 folds become the labla
minora (Wilson et al., 1981) (Fig. 7). Deficient or
OH OH
5a- Reductase
o o
TESTOSTERONE DI HYDROTESTOSTERONE
Fig. 6: Conversion of testosterone to 5tt-dihydrotestosterone
by the enzyme 5tt-reductase (Wilson et al., 1981).
genital~~ : •• 0 ". • ... , .:: fald :: .. :;'O·~' :::.
genital--+' \; ::}:.=I swelling \'. ",-" :'1~:.)'
"l' ",'~ ... . .... .' "-.... ~ ..... . genital INDIFFERENT tubercle /' STAGES
f////,Cff\---Q 1 ans
It-;.:f~-urethral graave
~ /' .. ,!.-:-; .. ; ':':. " l' t . . f:·' ". .... C Ions ;t . .::~." ;",: ::/0:. f. .. :.' ":. -~ urethral orifice ~: •••. ' .1°:; ~:.: 1'. "! .-..: hymen ','.' : '7-1' .• ~f': ":0.. )?::.,,:o ':",~ .'. II" ~::.'
~ rJ!.:·' l·:.!~!
Fig. 7: Formation of the externa1 qenita1 tract in male and
fema1e embryos (Wilson et al., 1981).
16
defect ive 5et-reductase act i vi ty resul ts in an autosomal
recessive disorder in males because of decreased con\eIsion
of t!stostelone to DHT. The gene encoding this enzyme has
been cloned Iecently (Andersson et al., 1991). The affected
ind1viduals have a 46,XY kalyotype, are born wlth
predominant1y female external gen;talia and are often Ieared
as females. At puberty most subjects experience appreciable
virilizat1on.
4.2 Androgen insensltivity syndromes (AIS):
A deficient or defective response to androgens during
embryogenesis and puberty results in AIS. The affected
Individuals have a 46,XY karyotype but their clinical
phenotype varies from a female with complete AIS (CAlS) to
a mildly undervirilized male with mild AIS (HAIS). An array
of intermediate variations (partial AIS or PAIS) occurs
between the two extremes. 1 t 1s an X-l inked d lsorder,
mainly caused by mutations in the androgen receptor. The
gene encod ing the hAR is present in a 5 ingle copy in the
human genome, and has been localized on the long arm of the
X chromosome in the Xqll-l2 reqion (Brown et al., 1989).
Two-thirds of the mutations are passed on from one
generatlon to the next by fema1e carriers, s1nce affected
males are generally i nfert i le. The other one-thi rd of
affected males represent new mutations.
4.2.1 Complete androgen insensltlvlty:
The CAlS 15 the most severe form of AIS. The subjects
are born and reared as females and present in infancy w1th
17
inguinal hernia (testes) or at puberty with primary
amenorrhea. The external genitalia are feminine, but the
blind vagina may be short, the testes are present in the
abdomen or in the inguinal canal, and there are no fernale
internal genitalia or Wolfian duct derivatives. After
puberty, they aiso have I1ttle or n~ pubic and axillary hair
with normal or e1evated male testosterone levels in the
blood (Kovacs et al., 1986).
4.2.2 Partial androgen insensltlvlty:
PAIS is char acter ized by phenotypic heterogene i ty.
Individuals with PAIS a,·e born with more-or-less ambiguous
external genitalia: at one externe, they are masculinized,
but with abnormalitles (micropenis and hypospadias); at the
other extreme, they are those of a female with sorne degree
of virillzation (clitoromegaly and labial fusion) (Hughes
and Pinsky, 1989). Sorne of the eommon features among the
affected subjects are: hlgh-pi tched voiee, ske letal
undermuseulature, gynecomastia, hypospadias, and sparse
facial and pubic halr. Affected individuals may have one or
more of these features, but near ly aIl share absence of
spermatogenesls (Pinsky 1988). Corrective surgery can be
used to restore female or male external genitalia depending
on the severlty of the clinlcal phenotype (more femlnized or
masculinized) .
The milder cases ot PAIS are classified as havlng HAIS.
These are male Indivlduals who are infertile and possibly
show gynecomastia. The "undervir il ized ferti le male
syndrome" encompasses indivlduals who are fertile but
18
possess sorne clinical features of MAIS. This group is the
least freguent.
4.3 Blochemical characterization of the hAR:
~he development and use of androgens in binding assays
fac i 1 i tated the understand ing of androgen-receptor (A-R)
binding properties. Serially subcultured genital skin
f ibroblasts (GSFs) were used pr imar ily because they have
three times more specifie binding activity than nongenital
skin fibroblasts (Pinsky et al., 1992). Androgen-binding
assays in GSFs yielded the first evidence for androgen
receptor defects in AIS, and allowed classification of
mutant receptor~ into three quantitative categories:
receptor-negative (undetectable specifie androgen-binding
activity), receptor-deficient (lower than normal blndlng
activity) and receptor-positive (normal range of binding
activity) •
A-R complexes are also characterized qualitatively in • order ta identify and classify patients with different types
of AIS. For that purpose, various biochemical markers have
been developed: increased thermolabill ty; increased
equilibrium and nonequilibrium rate constants of
dissociation; and defective upregulation upon prolonged
exposure to synthetic, nonmetabolizab1e ligand (Kaufman et
al., 1984).
4.4 structure-function of the hAR:
The hAR was c10ned in severa1 different laboratorles at
approximately the same time (Lubahn et al., 1988; Tilley et
19
al., 1989; Trapman et al., 1988; and Chang et al., 1988)
(Fig. 8). The cDNA clones had different sizes depending on
the laborator ies where they were discovered. The size
differences were due to the polymorphie nature of the the N-
terminal domain, where homopolymeric sequences vary in
length in healthy individuals (Janne et al., 1993). One of
the original hAR cONA clones had an open reading frame of
2.7 kb that corresponded to a protein of 918 1 amine acids
(Chang et al, 1988) (Fig. 9). The calculated molecular
weight was 98.8 kOa and the deduced size of the gene
encoding the hAR spanned a region of approximate1y 90 kb
long (Brinkmann et al., 1989). The hAR runs as a 110 kDa
protein (Brinkmann et al., 1992) on SOS-PAGE (sodium dodecy1
sulfate-polyacrylamide gel electrophoresis).
The promoter of the hAR gene lacks TATA and CCAAT
boxes. The mechanism of transcription of the hAR gene is
not weIl understood. Two transcription initiation sites
have been located, AR-TI S 1 (+1/2/3), and AR-TIS II
(+12/13), in a pyrimidine-rich, 13 base-pair-region. Faber
et al., ( 1993) used mutat i ona1 analyses to ident i fy the
minimal promoter of the hAR. They found two potential
regulatory regions: a Ge box (-59/-32), and a long
homopurine stretch (-117/-60). SpI (transcription factor)
was found to bind a sequence from -46 to -37 (GC box), and
was involved in transcription initiation from AR-TIS 1. The
sequences involved in transcription "initiation from AR-TIS
1. 1 have used the same number ing system as Chang et al, (1988) throughout the thesis. The amine acid numbers vary in the literature due to the variation of the length of the homopolymeric sequences in the N-terminal domain.
20
Fig. 8: The cDNA sequence and deduced amine acid sequences
of the rat AR (rAR) and the hAR. Identical amino
acids are represented by hyphens. Dots replace gaps
that have been created to reach the best alignment.
AlI ATG/methionine residues are boxed. Homopoly
merle or oligomeric reglons are indlcated by bold
face brackets. Identical regions between the rAR
and hAR are boxed (amino acids 556-623 and 666-918
in hAR) (Chang et al., 1988).
"MI :.v.--c-:~~ ~ 1\ ~~~-r-..a::--~""--=--~JIC-ro-....::.-a::~""'~A-~-:--"""-/laX~····C···C""",··'t·"X'::.u.a.·~T.\A".uc-~"~~
~u.~o:r~ AXJ.·~"-:--...v.~~"""""-"'-~.to:AC~~NX~~~~~.Jo:.X"""':---'CA
,... .:.u.--::z;T-x..u..x-~.u......x
-.J4 la, ~~Q"'"""'I;-:::-..c~~~~Af;L""'"XNZ:"".JC"".\.C'CX ... - .... '""!.N:~~·x"c",·..-rrc ~....a:-.~" ..•. _4--':-C .. -....:::-
,l1li 1 -=; " 'A' ;J/' .... :: ., .... :a., ....,. v •• -" ,,.. .... " ,,.. ". 1., .. , ...... , ..." u~ .. , ~ ,"'- :.~ ..... .-, ... :1 .. 1 .. , " •• "'0' : ... ' .. 1.1 \e:: /1 A,,,, ,,,. :1., ,,. -V1 lu ,,.. , ... ,) 1 .~ .JJ: ;-0,: JI'. -" .::a: ::-.; ~ ,IGI;:""'C ".. CLl :0: ""'X 'X'C ""'="= ....".. lICt' .",,, :z:A %.A x:; --= ~ _r :;"""1; -ç ~ -.x ~ ;:xx: ~ xc .'"'e ~ UiC ::0: ::CI: = aa; ~ ::c-JI'" Il' J _ 1-" - -- - - -. -- _ .. - .. _. -1 -- -.; _ .. - -- -- - --c - - _. - _. - - - -- - - - - 1- - - - - - - _. --li ., ..... 1 .. .... .. ..
, .. "1 ................... , 1" ....... r,. ,,, ;a, fI.., -.,. __ ~\n -:" ..,~ ~"'" .:\ .. ·"tu •• , , .... t ..... q .... ., 4.1;1 ~ • ..."t; .. r" ,. :.oMO ôTX Z- .a: ...... x..-. 'X"T x:e Qt;1' :xc -.::'" -.. ::M: ':,Jill: cg; ~ ~ IC"" .-gr: :c::: :::œ :::;c :cc ::;c o:;c ~ ",.. Ill, __ ~ _ œ= _ __ - -< --... _ -..:-c. -:-e C""'I: - - .-.. - :.w: ":M; :.a.: :.tI' :.AC. ~ ::..III::: ~ c...: :.rc: c:N: o:N: =.M ___ -- .\- .a.- .a.- .. A- -a- -.. /III UI .. .... .. .. hr, ..... .-. _'I .. -:1 .... ::, ... :: .. :: .. :: fi :J> :1 .. :: .. :1'1 :1 .. :1" :1 .. : .... :1", .. .. ,:1 .. ~ .. :' .. <:. .. -
.~ ".;JI CI. ,,... ~" • ...,. :1' ..... ,,... -:,,. A.U l'.' ...... ., -:1, ~f ~f:' "'Yt..-. AJ,. -.,.'; ... : .... : .. ':~ .... 1'" ,,.. Ie":u\ :;1 .. :,"'ler AJ. ... , :1 .. Qlt .. ~.,,.. :1 ...... :' c-,. f~ JI', C.IIG -:AC :c- :IiIG :.Ar ~ ~ 'X'T I:M xx: ~ A"'C "'" ~ ACt. /ItL.I. xx: !.IriC :-'1: X1: :-: =--.: :.IIiC :.u. c:...c ':JIG ~ -cA.:AC:..III: c:.w:: ~ 2:%: '"'IX ::.tIC QIX' -:..IrC :::- ~ .ItGI: :xc ~ "lU '1', _ CIl:.- _ - -T _ --<! ___ -t :c't _ - -:: - - - - - .... - _. - - --- --1. - - - -c. - ~ - C""Ç - ... - - --c __ -II. -t -....... " ~ 'u, - - N'1 - .... .1. - """ - - , .... - - t..... - e-r. - - ..... -II4#. 1. ~ .,... ; .. ,,... : , ....... a.J. '!"lU ..... 're :., _" :1, ~ 're : .. -:,. t,.. ,,... ..... 're ,., ut :LI\ .. , ...... , t.l.t &.L. , .... 1., ~r ........... .- ~ =~, ,_ ... , ,,.. p,.. :1, ,NI "', --e x:c :.t.a a:1 3;,A -x- :zx ara; QC'1' a:- :n: J,N: 'XI: C""'C = !:NO '!,IIIC. :x.a. :t:.A 2:'" :r-- :::::..t :;.t.. :...-: ::.At -;.te"-I:A XT 2X o::A owo:: ac:::. ~ --c: ~. ::-OC::IX ax: IC"" 1'-.: :x.a .z:c ... JiII 101 l-- _ ... __ ... __ --c _ ::or_ --c ~ • ________ -____ -- '"Ç - __ A - -= -< .:-- -- -- - - - - -- -- - - --C - -- - - - -< -,,, .. l' , .. 1 - v.l _ "'11 1., _ .. t..oro. - .. :'... -
,A,II \)} -.. k' I.r :-rI t ....... UJI , • _,. -"0 • ..-.. ••• '; .. '-1. : ., .... '~c:1" ....... ~r:i:"".:-,-:-"-:,"".:-:-,-:"-:,:-"::-:-:-:-"-:,:-":-:-:""::-::""~:-:-,.-:"-:,:-~:-::-:""",:-:-.-::,-::'""":::-."'"-::,-:.,-:-:-:-.-:,:-~::-:-:-:-.-:,:-~::-:-:":'. r'" ",, -A loX' ...x -a:: "'f"t: :c..A ;.AC At"" ...... -'< ....... :-0: an:: ,.N:;. xe 2X ..c: ,~ ~ :- .- :A; :JrG ~ ':..oIrr:: :.u. ::..; c:AA ~ <:JW: .:.AoC ~ .:...: :AI; ::.tIC :.aG !!AC; ::.,t,.;. :AI; :AA ::.AI: ::.104 "1 .... Jl,. ___ - -- -- -. -- c:- _ -_ -_______ --- ... - - -,- --C --- - - ... --- - ~
" .... " - t...I - ••• r - L.....:-J - ., - , .... U, -;-::;" :a .. "" l' M' .... : ,~ v&l ...... ., ""' ...... .., :1 .. AJ.. '"IV :1., ........... ~l, ...... '.r -.,., _ =1, :~r Ae" ,., "'"U' 1 •• &et ...." ..... AJ.... _,. :1 ... .- e-r. ,U "1, ~ ;.!roI;l ;;-.... r. -rc ......... ~ JIIm: -.; AIIiII: ~ ..... 'JC.Jt .u:. .....:;; ;,;:;'C ..:-- ~ ~ :-0::: ""C"'" ~ -0:: ......: ~- IICT -/IItC C'T'" QQG:IZ: """1' '"'CI: -.c: ..... A ""'I:'T ~ olCT z:::: .I0oIII: ':oIIG _ ""C:T
~... 1. -fi C ... ~ - - _ - - __ ~ __ ç; __ - - "-e - -- - ,- - - - --<: •• - -- - - -c - - -- - -_ le - - -- - ->lAII If ....... v., -. ~:, _. - _ •• , - - - ~ - - - - ... '" - - -~, _ - . - - A.I ..... - -
.1-' "r. ",.. ou ..... 1 'e, V.1 "'êJ-' Ct, - ':::II, v. ::1 .......... ..- =1 .. "1 ........ ,., .... :: • ., :1 .. ;0.11 .... A.I~ Cl., "'Il e-,.r;;;;"!...,., u.. hl' 1-. ~ Cl., :1.,. ..... 'ro-. .u..a val Ar, .,.. ~
.... '4', u.Jj. 2:A;""'C '""C'T .-.:; -WCC'Al"!O ace 'M'Q X"" ~:.AA ::c.A =-.:: GAA ~ .. c-c: lItCT :z:.a. ::a: :AC ..a.. :-- o::z: ::.::;c ~ -0:1 ~!"JC QtC ""C: C"""I: ~ x.t. Z't IX.A IX'C' ::cc ;""'C :='T ::c: ltC""
::: :::: -: -:- - ~ - -:- -:- ~ c-:= -:- - --<: --:= T:- -:- -:- -:- -:- -:- --: -:A -:- -=- -:- --C -:' -:-0- -::;~ -:T T:- -:- ~~ -:-- :- -:T -:- :- -:- -:-,AlI " •• , .. ('., ...... ,,.. 1-. •. 1. QI .. e-r. 1.,. QI, '- •• , _ .... :1 .. Çl., ". Çl, .,.. =1, ...... , :1 .. ; .. """', A"h :1,.. 1"'rr 19' h' , .... J'I ~1,. :1, ?yy ~ L,. 01., ~ :.l .. =1., = ..... , .AII '.'1 cr"" --cT x:::o :rT C"'""1 .z:r; ~ t'IX .u.A 'X'T .:- ""0: ~ ~ :.u. œc co: ::0: ...... ZI: JC"T ~ :.AoC IICT x-- ~ -"T '"'CI: ~ t--c:: A.JiIG QCA :a:T -/ItC .z:z: AN/. ':taC ----= a\ Z"T Q"lC ,..-
"''''IJ'', _ - -< --a T- - - - - - ""C C""'C _ .. __ -< A·_ Q.. ... - -4 .. - - - -- - - - - - c-- - - - - - A- -- - e·1I - -< - -< "'1&.11 J ", _ .. "'r 1...000... _ ....... a., Al. • - le, - - ...... - - .r. .. . ~ .. _ .M UI _ Cl.,.....,. le, ::', ... , Se, Ga .. M. ca, •• , •• , ::1, ""',.- Cl .. 1.'''' •• , ,., "- .. , _....,,, ., .... ~1,.I.l.. V.l ..... ' =1 .. f..l.J.e.l.l.. AJ..i ...,., ca .............. T)'r....,., .... . • AA "1, ~ :0:: ""'IX ~ zr M% lrC'T c.u. :z:.a '2:T .II!X ~ :r..c ..c..A :"'f' ~ ATC =:%: ""C: '"'I:..A ;-:: ~ .:-.: ':AT .ur..: ~ ;r.a QCA ~" ~ c:.tIC XA 2:A XA "UC ~ .u.T ca: ::..c "'ac -Je AN: .... ' •• 6, _ .. ~ __ - _ x~ -< -- -.ç - ~< ___ - _ ... :::...; - -T .-< - - -= --C - --C - -- c:..c: -- - - -T -4 - .- ~ ___ - - -...... JII. - .. ~ - .. - tMw - - ~I - .. t.." • .. L..:.......:.-: - - •• ~ .. , .... 141, , ..... ,... _ AJ.. t.u ,., ;1, ,,.. ,,. .. u J1I,. ,,.. 'r. , .. i~, IIIU ,,... lU ....... """ • _, ...... : • .., ",-", " ........... ..." ;1, .......... ,..'1U.e AJ. • .u. oU ........ 1 :, ... e-,. "" ~ ,J.tl. " --r ::c:: ~ r'"' ::-c ""c: :n:: ::c::x:r: :...t.C ::o:.:c: =cr: -:t:"" ace: c:...T 'XA.:.AC x:: :::x "-0: .a.tw: ::""'::..N;. .u.c: :a: -: .:..c ~ ;IX ag: z:::: ~ Z""' ;z:::;r;c; tXA ZI: :.u. ""'IX c:::x ':A-tI",,'.I!, __ A --c: _ - ;- -.10 - -..e _, __ -<: _ C'-- __ -c - _ .. _ - - _w. - __ t;- - - -- - _ - --4 -T - --<; _ -< - - -.. """ UI, _ - AJ.. -, - .. Pro .. - 'r., _ . 1 • _ , _
....... 'U, :1, .... ..- AJ. ...... __ .1. :.,:; .. h, ," .u =1., ,,.. '.or -", 1: ., I.e" .... ". "-" -U- A.h i ,., , ... ,.,'.". !tu ""'lu ....., ,1Ie;~ .. a.... 1: ... 0; ... :It ;1", _ -n 1:1,. ,,..t;:;
..... ,., ;;.a:;:.-= --:; ~ .IIŒ' -:- ... :AZ :x:.... oo:c ~ -;;-.0\ ';IC"': ::.;.A::C-:: .trQC I>C"" X.A ~ = :A x-:: ..c::: zc "'C""" --co- '"'C1: -= CA,. AC- ~ --C ....... ::é"" :.AA ':.AA:;ar: ~ -...JI, "10.- 2:1; :I:A "Z/I.
"""" 1', -~ - 1:;- -. -- --c - -< oC ;.-... -oC ...: _- -:""T ""- ......:: - ... - ... ..- - ::.-- -T --C -" - -- -< - -- - - .. ...e - - - -<: -01; - -A.....o; --T - .I..1.:,A...J. - Ql,l.r - •• ,.~~. - Cy.
rU ",, :lp ,: ... " :., :_1 ~ ..... '.r .....,. L. ct, 'r.. V.l .1..1.1 .,. ..." :::11 .... r -a.- ..... 2',.. ',..:0.11 I~"'t. 2lC ~ :u:. .zE IIOX tC" aa: :-:..a. aa: :.JI, CX'T:IZ =- ;-" x:: ::::0: ....... "" '"'AC J.I.'!* =c; :a::: =r:.wo 'Uotl"" _T -T -T -Ç :t"" :t"" :r::""" :0: QDC' 2X .xc :cc 2X :IX QIOC .:0: :rc XI; 2X :a: xr: ..: ::.-- ;..< ....... :a: Q- .< ~ _.u. ~ __ - -C "'_ - - - - - -
"AlI "", - ç ., :; ,. ::1, 1;1" C\" ':,,, : , : r :.r -:t" Cil, e " : ., ::.r r: • ::lf :.'" : r ; , .. r ::1, : ,:1.,,:.1. ... = ........ -~~'::J: ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~:::;.:! ~;;! ;..: ;!! ~ :: ~;=.: ~ ~ ~ ~ ~ ~ ~ ~ :!.: ~ ~I~I~ ~ :::~,~ ~ ~::: :::, -:- - ~ ;;; ~:- ~& :~ - -:- ~~ - ... ;;: ;:; ~- ~ -~ -.- -: -:c :...~ -:- ~ -:- ~ -:- -=- -=- -: -:- ~: -:- -:= -: -: -:8-:c -: -:l:j~: :; , .... 'l' ..,... s..:, " • ...,r::, ..... ÇlA.t ............. , h, t"'I .. .." ...... U "., _ '·a ....... ...".." ..... 'n'!"'e:: ... I .. , ..... r::-y. ___ -:Y' ::., ........ 1.", AJ.. 1.' :,:y. -Ill' --,.1 r ..... "'., -II: ""'C:: :r..A ~ ·Ar :ocr: ::.N:l A-9 cr:"" ~::.AC ~- Jo&:: .w:z; CJIC ':.JI(: ':"""T -A = ... n::..c """.N: --= -::::::...::ZX ca.cIMC te: -a:::---.; .. -: -:- ZA:,l-:.a.. r- '--e- 2:"" --=- ~~' ~:a:,:' -:- -=- -:- -:- --:= -:- -:-0 -:- ~ ~ ~, ~: -:- -:- -:T -- -: -:- -:1' - -=- -:- -:T -:- -=- -=-1-:- -:- -:- -:- -:- .:- -:- ":- -:- -:- -:- -:: -=- -:- -:TI ,AlI ,t, 1 :.., ................ 'If =.,. :: , ... :..,. L,. "'.l ,.,. ''14 _, ..... ., 'li AJ.. :1 .. -:" .,. :." _, • ...,., _ ::r' ... 11 1., AI, .......... :y. ~ 1 ... , .,. , .... AIt, AI'I ., ..... " c:"f. ;p,.. ... ,! , ..... , .. " 1 ~ X- ~ loC"" ~ .xx: ...x "U Vtt; :"'"'C" -: -eMA/lI:.AX-.x:::::...AX;C ....... :.aI; ~ .... ~. ~ Z'l:: M% lo:A -...- .... - -X -== ... - ::.r. • .u.A - o::;c aac .......... T ~ ::.a. '"'= ~~:~: -:- --:- - -:11 -: -.0\ -:- --- -:- -:- - - -- -:- ~ -:: -:- -:- - -=- -:- -:- -: ~ ~ -:- _ -:- -: _ :- -:' :- -:- -:- -: -: .. -:- -:- -:- -:- -:- -:·1 , .... "":'y' .u, _ .. "'1 .,. :"y. ,..,r :1. ... Al. ::1.,. "t /-" .- : . .,,, ....... , .. ,. _ .. , •. , ..... : , ............. _ri .- : ... -: ... : ... :. , -: ...... " l.er ... r ........ l, 1 •• 'ro-. '"'!l, :1 ......... ',. ''''''11 , ~ ;;:::- =-= :;g;j; """'" -.;- -Jo,- ....... ZA :.Jt; ... '"'t;!"--- -;-;;; :;x;.A .;rr =- ~ ;-""';0 .-....;; IAA =-- .......... 1' =-= ......... =-A ~ ........ :.tr.A ;o('...t. :.Mo .u.;: --c; .IIC1' ;;r:- a:T .....: = JoC'" ~ ~ XAo
I\MJJ" , -- - _ .. - -- - - - - - - -- -- - < -~ .- - - -- -- -- - --<; - -- - ......c - - --c X- - --C A-< a.c: - - - -- -.; ...... '\"""l .. - - .. -. - - .... - .. - -.. .. - - - - .. - . - - """'""" ... _ .. : .. ~ 1 •• "_"" r' _li -" ~ •• 1er "1. r • :: ... .-.f ...,. : .. ':7' ~ ... 'tG • 'Ile __ " JI -..:......... _:. 'r. ~ ,1. " •. :-y ...... : 1 "'l' ................ =~ ... 're ....... 10er ,~
tIA •• , ........-::.AI: ......... -;j ~ ::Jo. ~ :Je. ... - ;.A,A :00: -", .. :..u. -:"' ':.M ::r-- ..... ""C - =- ...... ~ ::-- ::..u. 'XI:' A.- :.w: ::::... Z.A ~ .:-: ~ x:: %;,A :,t.- :.AC UC /rJJIC ~ =-- :.I.T ~ -
:::::' ~ = ~:~: ~~ ::::. = :: ~::::;. : ~~ .:.:::: ::.:: = : :. :=:: ~:: ~:::. := :~: : :: ~: ::: : ~ ::.:: ~::i ' ~ ~ :: ~~ ~ 1. ~ ~ ~ ~ ~ ~ ~ ~:; ~~ ::: =? ~ ~ -; ~ ~ ~ ::: ~ ~ =:: ~ ~ ~ ; =? ~ ~ ~8~ ::= ~ ~ ~I , .... "li ! •• r -.",~ :1,. ...... , ..... t v.l , ... U., l'til : , .". "'" la, ,~ ~, ..... '" v.~ ...... a.t "'1''''-l _ ...,,, , .... a.... 're ..., .- ~ •• , ....... " : ... ..,r N., .... t Il ... .,. .... ",., "'t '""rY , .... J " , """1:"': ~ .. '"'=' Xoo\ --=, A .... tCO-A - XCI "--::, %"" -.z: c:c "'C:' -oc ac- M" :""C .uc '"":" .I!C: ..... -: C""'C! "AC - XA :::T :AI: ~ ::- --= A,A" ::,a,,: ." .. ::X8~ eJrC .t.M: ---=- :::.t. A..-:l"lC! ,,~-(&,,- _j-J._ .... --<\-\--4 - -'--1--<= --- -. - --- --c- __ - - ~ - - -- - --< --< -- _. - _ - - - --c: - - - - --e...c: --r--" .... ·"11· . ~. -~ - - . U ~ . - - - - - .. - - - '-..:.... - - - . - - - , - . .. - - - ... - . -~ -.. AIl tU, ... , .. JI :y • .".1 Alfj __ t)âf. "u t.u ..... :..11; .. ,he = , .,. .-. •• " 1 • ...., '" ::1.1 :.101 , ....... :-,.~",. aJ.a.' ...... ..- .-'n .... r n •.•• ,.. V.i. ..... .:" ...... _,. .... ", ,. ..... Jl1'11Ci!::.AC -Z:""l:: .IoaC:::::!III:JDCJC:-t ~ ~::.a.: - z:.tt."-a: =--e:=.....: ...... .ac: =ce-:a.:::.u. -.: =-= -ar: .L--:,LU. XA~~""=-"'!:: ~ ~.:- ..... -'ecA.:""!: ~ ZI::-' #IAA.u!1
:~~.: : -:- -:- -:' ~ ; -"L:;:J -:- -:- ~ -=- -:- -:- -:- :- -:- -:- __ A -:: -:- -: .. -:- -:- -:- -:- -:"") -: 1-:- -:., -:- -:- -:-, -:- -:- :- -:- -:- -:- -=- -:- -:- -:- -=-[ , ..... ' 1 : ..... r' ,~ 'PI ......... Il ... :- "'1~"" ...." ..... ,. ':::.4 ...... "'1' -"'1 ,_. _e """. :y. _,., ... , _,. ",-,,-;;::'""1" •• , e,. MI 0\1" ""1 'fi_ ....,or :1.tI .- "" ... , ............. ,... h', ,A-'J"I ,=» ....... -.: - :.u !;AA =-- ':z:.A"""'I:IAM:. wN:; .~ ~ :..t.A. =--:.At:=c "'''''C'''-:cA -..x MA.-.c.A JtN,...t..A! ==.cA "t:C ""X' -c:A Aœ::X .......:: "'IC :AI::""'C IC: A.otC: :--t::-;; ~ '""::"""
~:~ :"7 -=- -:- -~ -=- -:- -:- -=-L! -:- -:- - - -:- -~ -:- "':T -:- -:- :-~ -:- -:- -:- -=- "':- "':-- -:- -:- -:- -:A -:- -:-- -:- -: .. -:- -:- :- -=- -:- .-:= -:c; ...... , ... 1 : .. 'N Il ...... , ". - .u ,~ , ............ '- - .. >, ....... -." ..... , .... , .. ,~ :'.'i!' .... ". ,. , .... -01 "ft ~, ,~ ,JO h' -' ,AAUH .:r"'1:M:r""' Ar!1C4 /ItGA.:.tIC:"'Iô:AT ':M -e 1C" - -;JIC c-.:;:-A ..... ...:; AN; -c:: .:.a'"' ... ""'4 .-: u ::-; :..AC -:0::- ~,1w4OC Il''': XA:.Ie.""'.~ ""C""':;"'!';o::M:""!: = ~ A-C: =-1
~l~!:" -=- -:- -:- -:- ~:- -:- - - -:- -:- :- -:- -:- -- -:- -:- -:- -:A --;:='-:- -=- -:- -:- -:-:- ~ .. :-!-:- ~-:- -:- -:- -:- -:'" -:- -:- -:-- -:- -:- -:- -:-1 tU! "1 , I.r 21p .r' "'.L .,. Ire • ...,. ,.,. Ill. ,""", :.", ,"'1-" ""':"" lOI: ..... :--e -"'::C:",""C --U r--c;:AC fOC.A:..IGI~ ~~""'''A~:.AOI!_ • • x ~-:-::-'t"'"X::--;-....... ~~~-:c"""":""'ac-" '1""J'!' ) _ -- _. - _ .. -- - -- -- - -..: -, _ ........:0\- _____ •• r~_.:-__:._-~~ c::--~~ .. ~e .. _e_-c-_·A.:A .. ~x.ac-~--~--A.A__:::_·-t._·~~ ......... ' _1
, ..... :." _ .........:-c-:-c:.a"""!:.uc.r.-c--~~.u C......... ce C c: C" .... Je;;.. =x::::-:::--....... ~---,;.ufl:":~X'"'CC""'CI:~~A~ ... '\Mla~. ..10&.:"'C ~"'QI:,A-T""'C ..... -"'O-~-T·----c--:--C--""C~-c:-:----c--<- C<""O: -. I!" "";'·_~·_""".;-<:M.-·<~-~-C-c:.a-....co-::--U-----"....IJC.---~·-T-A--·
' ..... 1'1. - .... _ •• xx:c::AC""~ .... ~~c-x::.uc~~~~ ....... -r"' ..... -OZ:u..-N;~A .. II,ItC'-A~·'<··ItI:··""·etC C:'~~~~ '\AAJ,'\ --.... -& ... - .. -- .... ---.:,..."'C"-at--c--.~~ .. -...:c.I.C<A --e: .. _-It&* .... _ .. - ... -X---=-A·Ç""-~aa:"~-A.-:-:c_A·_""C ... ....ç ... ·A<-Cc:::::;---""C
' .... 1 '\ a.c-"" , ... x: ......... NT". '---C
Exon 1 ::r-_ .......... 1_2-->1'--3-1......1 _4_-1--5 --1--6--L-_
7 ---1-
8---.1
• Amino Acid • _ ~""'~ (Gln),7_2t (Pro). (G/Y),f-27 556 623
.... ONA-
~ff#/00WM 666 918 _.1--_ Androgen --~._
Binding Domains
Fig. 9: The exonic and modular structure-function organi
zation of the hAR using the amine acld coordinates
of Chang et al., (1988). The recent normal range of
glutamines in the homopolymeric region 15 now known
to extend from Il to 31 (Pinsky et al., 1992).
21
II were located between position -5 and +57 (Faber et al.,
1993).
The N-terminal domain of the hAR contains sever al
homopolymeric amino acid segments. The major ones include:
Il to 31 consecutive glutamine residues, 8 prolines, or 16
to 27 glyc i ne res ldues . Glutarnine-rich regions have been
found in many established or suspected transcription factors
: the mammalian transcription factors SpI, OCT-I and OCT-2i
the Drosophila Antennapedia and Ultrabithorax proteinsi and
the yeast HAPI and HAP2, among others (reviewed by Mitchell
and Tjian 1989). In the hAR, expansion of the glutamine
tract to 40 or more glutamines causes an adult-onset motor
neuronodegenerative disorder, callp.d Spinal Bulbar Muscular
Atrophy (SBMA) (La Spada et al., 1991).
In vitro mutagenesh~ in the N-terminal domain of the
rAR has revealed sequences that seem necessary for
transcriptional activation. When coexpressed with wild type
rARs, t;he deletion mutants behaved as dominant-negative
regulators most probably by heterodimer formation (Palvimo
et al., 1993).
The HBD of the hAR contains 250 amine acids, and is
encoded by exons 4 to 8 of the gene. Deletions of amine
acid 651 to 712 in the C-terminal part of the HBD abolished
the hormone-binding capacity (Jenster et al., 1991). A
mutant AR lack ing 12 amine acids from the C-terminus was
unable to bind hormone, whereas deletions in the N-terminal
domain or the DNA-binding domain did not affect hormone-
binding. Complete deletion of the HBD resulted in a
constitutively active receptor (Jenster et al., 1991).
22
Fig. 10: Amino acid sequence homology among various members
of the nuclear receptor superfamily is shown in the
left panel. The right panel shows four conserved
amine acid regions in the putative hormone-blnding
domain of steroid receptors represented by roman
letters. Dashes replace identical amino acids.
Gaps have been created to reach the best allgnment
and are shown in dots (Chang et al., 1988).
Dinding Oomoin
ONA Hormone
556 623666 918
hAR --------------[Q]}-I8 100 '!II: hl 540 607 650 902
rAR -------------~[Q]}-li!IOO xM' 565 632 601 933
hPR ---------------IŒ2}-ItHi'.?:, S-t ~ !~,11 1 60' 668 732 904
hMR ŒQ}--I·\.~·a SI '!II: F$li'll1"
419 406 525 795 hfiR ŒJ--If~I':"3 sow; f·~;:1
103 250 30? 595
hER ------ffi}--l.'I~ ~"1' 5 ...-; !"ft"!~ 1 1 56 123 164 432
hRAR --@]-t "'a ( 1 5 '!II: E!l 1 100 167 232 456
hc-erbA ~(IS'J;SJ
III 170231 403
TR2 - __ lliJ--I:"fJJ (15 .,; f~,:1
e
rllR 650 hllR 666 hPR 681 hGR 525 hMR 737 hEIl 309
YECOP 1 • FLNVL(,:A 1 EPGVVCAGIIDNNOPDSFIIIILLSSI.NELGEROLVIIVVI<WAKIILPGFrull.IIVDD
10LI-P Li-L-MS---D-IY-----TK--TSSS--T---O------L~----S-S--------1--1.1'01.1 PTI.vSL--V-- -E-LY--Y-S'iV- - -TWRIMTT--H--G--VIIIII- - - - - - 1- - - - - - -1.-RIII.T-~ .PVM- --N---E 1 -Y--Y -SSK- -TI\EN- - -T--R-I\GK-HIQ- - - - - -V- - - -K- -PI.!:SI.TIIIIO HVSII-I.IJII--P J LYSEY-PTR- F-E-SMMGI.-TN-I\I) -E- --M 1 N - - -RV- - -VO-TLII-
-1-------1 1---11---1 rllR 716 OMIIVIOYSWHGI.HVFIIMGWRSFTtMISRMLYFIIPOLVnIEYRMIIKSRHYSQCVRMRIII.SOFFGW. 1.0
hllR 1]2 ---------------------------------------------------------------- --hPR 14 7 -ITI.- - - - - -$- -- -GL----YKII-SGO- - - - - - - -1I.--0--KE-SF- -I.-I.T-WOI P- -- VI<.--hGR 592 --TLI.-----F--A--L----YROSSIINL-C-----II--O--TLPC--O--KII-LYV-S-LIIR.-hMIl 1"8 -ITI.-- - - - -C-SS- -1.5- --YI<IIT- -OF- - - -- - -- - - -EK- -O-II--FI.-QG-llor -I.O-VR. -hFR )15 -VIII.I.~CI\-I.EILHIGI.v---HEIIPVK 1.-. ---N-I.LDRNQGKCVFGHVEI FO-I.I.IITSSRFRHHN
1 III 1- IV ----i rllR ïR2 ITPOFFI.CMKI\I.LLFSI 1 PVOGLKNOI<FFOELPHNY II<F.LORIIIICK/U(NPT';CSRRFYOLTKLLOS
hllR 799 -------------------------------------------------------------------hPR n 13 VSOF - - - - - -V---LNT--I.E-- RS-TO-E-H-SS --R--I KJ\-GI.RO-GVV- <;-0- - - - - - - - --II hGIl 650 VSYE- y - - - -T-- -L-SV-K- - - -S-EI.- - -1- -T-- -- -Gl<I\-VKRFC;- SSQNWO- - - - - - -- - -hMR 964 L-fr-YTI--V---L-T--I<----S-I\II-E-H-T------RKHVTKCPN-Sr.O<;WQ----------hER 440 LOGE- V-LoS Il-LNSGVYTF-SSTLKSL-EKDII IIIRV--K-TOTLIIILHIlKIIGI.TI.O-OIIOR-I\O
rl\R 849 VOl' IIIREI.1I0FTFOLI.1 KSIIHVSVOFpEMHIIE II SVOVPI< 1 LSGIIYl<PIYFIiTO
hllR 965 ------------------------------------------------------hPR B no J,II!JI.VKQ- -I.YCLNTF-O-RIIL- -F- --- -S-V-III1-I.- -- -II-H-- -1.1.- -KK hGII ns Mllrvv~ 1I-I.NYC-OTFI.IlKT-. -1 E- ---1.-- - -TN-I - -YSN-N 1 - KI.I.- -OK hMIl 9 J 1 HlIIlI.v';!J-I.r -C- YTFRE- -lU.K-E- -I\-I.V- - --0-1.- -VF- -111\- -1.- - -RI< hER 507 1.1.1.-1.:;11 1 RIIMSNKGMEIlLYSHKCKNV'!PI,Y!JI.I.I.r::M!.OIIIIRI.1Jl\pTS RGGII';V
e
23
The DNA-binding damain of the hAR cantains 68 amine
acids. They share 76\ homalogy wi th hGR and hMR, and 79\
with hPR (Chang et al., 1988) (section 3.2) (Fig. 10).
Al though andr ogen-r eceptor compl exes ar e capabl e 0 f
binding the GRE consensus sequences and activating reporter
genes in vitro, there has been mueh Interest in finding HREs
specifie to androgens (AREs). Potential AREs were found in
androgen-regulated genes such as: the sex-limited proteln
(Slp), which 15 expressed in adult male mice (Adler et al.,
1991); the C3 gene, which encodes the C3 subunit of
prostatein, a prostatic protein secreted by the ventral
prostate (Tan et al., 1992); the prostate specifie antigen
(PSA) (Roche et al., 1992); and the rat probasin gene (ra)
which codes for a nuc1ear protein seereted by the
dors01ateral prostate (Rennie et a1., 1993). The 5'
flanking region of the PB gene was isolated by screening the
rat genomic DNA with the complete coding region of the PB
gene. Band shi ft assays were carr i ed out to determl ne l f
the AR binds the isolatt!d sequences. Cotransfection of
androgen independent PC-3 (human prostatic carcinoma) cells,
with the PB 5' -flanking region (-426 to +28), linked to the
bacterial chloramphenicol acety1 transferase (CAT) gene with
AR, GR or PR expression vectors, showed a hlgher CAT
expression by AR than GR or PR (Rennie et al., 1993) (Table
1).
Since androgen-receptor complexes ace capable of
binding the GRE consensus sequences and activating reporter
genes in vitro, how do they accomplish specificity of
express ion? The answer may res ide in the context 0 f the
24
upstream region of tarqet genes. Recently, specificity of
AR action was demonstrated in in vitro mutagenesis using the
120 bp enhancer from the upstream region of the Slp gene (C'
69) (Adler et al., 1993). In this system the GR binds the
HRE in the enhancer but 1s not capable of transactivation in
that context. C'~9 contains several sequences similar to
HREs. On ly one 3' -HRE (HRE-J) is identical to the GRE
consensus. It binds androgen and confers hormonal-response
on a reporter gene. However, this HRE aione does not
account for the specificity of androgen action. This was
confirmed by testing the effect of sequence alterations of
C'~9 on specificity. CV-l cells were cotransfected with the
AR expression vector and different C'A9 mutants (formed by
site-directed mutagenesis). AlI mutants, mostly HRE-3,
affected androqen response on the thymidine kinase-driven
reporter gene (CAT), and did not change glucocorticoid
action. Therefore these mutants did not alter specificity.
However, when HRE-3 was placed 10 bp downstream of i ts
natural site, androgen-response was restored. GR was aiso
capable of transactivating this plasmid. Thus, distancing
the HRE from the enhancer allowed glucocorticoid
responsiveness. This showed the differences between GR and
AR wlth respect to interactions with other factors on the
enhancer. It was also suggested that the N-termlnal portion
of the receptor contributes to the spec1ficity (Adler et
al., 1993).
4.5 Mutations ln the hAR:
Sequencing the genomic ONA from GSFs or per Ipheral
Genes ARBs
PB ARB-l
ARE-2
Cl
PSA
Consensus GRB
Sequence
-241 to -223
atagcATCTTGTTCTTAGT
-140 to -117
GTAAAGTACTCCAAGAACCTATTT
AGTACGtgaTGTTCT
AGMCAgcaAGTGCT
GGTACAnnnTGTTCT or
GGTACAnnnTGTCCT
Table 1: The sequences of the consensus GRE (Roche et al.,
1992), and the putative AREs in the C3 gene, the
PSA gene (Roche et al., 1992), and the PB gene
(Rennie et al., 1993) a~e shawn in capital lette~s.
(n) designate any nucleotide in the spacing reglon.
For the PB gene, the small lette~s Indicate
sequences flanking the AREs, and for the C3 and PSA
they indicate the spaclng between the two half
sites.
25
lymphocytes of many subjects wi th AI S has revealed several
categor ies of AR mutations. Mutations were found throughout
the cod ing region of the hAR gene, but the maj or i ty was
present in the HBD and seemed to cluster in two regions: 1)
between amino acids 727 and 773; and 2) I..'etween amine ae Ids
827 and 865 (HcPhaul et al., 1992).
Host CAlS patients have 1ess than 5 fmol/mg protein
androgen-binding activity ln the GSFs. This ls due to:
partial or complete deletions of the AR coding region;
single-base substi tutions resul ting in splicing err ors
leading to a shorter prote in; nonsense mutat ions where base
substi tutions resul t in the introduction of a premature
termination codon; or the most common one, base
substi tut ions that cause replacement of an amine acid by
another (Pinskyet al., 1992).
A large deletion was found ln a patient with CAlS and
mental retardation. The deletion was revealed by a Southern
blot us i ng part of the cDNA as a probe. The hAR had minimal
specifie llgand-binding activity in GSF (Trifiro et al.,
1991).
Recently a base substitution at nucleotide 337 was
found by Zoppi et a1., (1993) in an individual with CAlS.
It resulted in a replacement of a glutamine at position 59
to a stop codon, in the N-terminal domain. No protein was
detected in an immunoblot using anti-N-terminal antibodies,
thls suggested an abnormal amino terminus. Androgen-bind ing
assays showed a deereased bind ing affini ty and increased
dissociation rates. This group raised the hypothesls that
translation of the mutant hAR was re-initiated downstream of
26
the mutat 10n, at lower levels than norma l, and wl th
funct ional impai rments •
Different exon deletions of the hAR gene have been
found in members of one fami l y (HacLean etaI., 1993). Two
sibllngs and the ir maternaI aunt, all a f fected wi th CAlS,
had exon 5 deletion, and exons " e and 7 deletlon,
respective1y. Both deletions resulted in an hAR lackinq
androgen-binding activity. Southern blot analysis on DNA
from the mother, grandmother, the two affected siblings and
the aunt, reveal ed: a 5-kb delet i on of exon 5 in the two
5ibl1ng5 and in one allele of the mother and grandmother
(both are obl igate heterozygotes); and the same size
delet ion 0 f exons 6 and 7 in the af f ected aunt. The
deletion of exon 5 extends into intron 4 and has one
breakpoint in lntron 5. The delet i on found in the aunt, has
the same breakpoint (5' of a Sac1. site ln intron 5) but
extends in the opposi te direct ion in intr on 7. The de letion
in the aunt is a de novo mutation sinee it has not been
found in the grandmother. The authors postulated two
possibilities. The first is nonhomologous crossing-over in
intron 5 occuring at different times and resulting in the
two delet ions. And the second supposes the presence of a
transposon-like sequence in intron 5 causing the two
deletions in two cell lineages in the grandmother.
The AR in CAlS familles can have normal binding
activity with qualitative defects, such as thermolabll1ty,
or increased dissociation rate constants. Two mutations at
the same codon: arginine 773 histidine and arginine 773
cysteine occuring in two unrelated families result from base
27
substitutions in the HBD of the hAR causing CAlS. In the
first family (arginine 773 histidine) there was normal
androqen-binding activity in GSF, whereas in the second
family (arginine 773 histidine) the binding activity was
unmeasurab1e (Pr ior et al., 1992).
A small proportion of CAlS patients have deficient
androgen-binding activity. In one case, described by Ris
Sta1pers et al., (1991), a guanine-to-cytosine substitution
in exon 4 resulted in a replacement of aspartate by
histidine at codon 694 in the HBD. The AR in the GSF had
deflcient androgen-binding. In transiently transfected COS
l cells, this mutant AR had an 8-fold increase in A-R
dissociation rates and abnormal transactivation of a
reporter gene. When the same codon was replaced by
asparaq i ne in another pat i ent due to a guan i ne-to-adeni ne
substitution, the patient had CAlS with positive androgen
binding activity.
Hutat ions in the DNA-binding domain were found in
patients with CAlS. Two different in-frame deletions of
three nucleotides, found in two families, resulted in
biochemically different mutant ARs: de1etion of arginine 614
yie1ded a normal ligand-binding AR; and deletion of
phenylalanine 581 yielded GSF wlth unmeasurable or
deficient androgen-binding activity (Trifiro et al., 1991).
Rec:ently, two di f ferent base s ubst i tutlons in ex on 3 0 f
the DNA-binding domain have been found to cause arginine 606
to be replaced by glutamine, and arginlne 607 by lysine.
They were found in three ind i vidua1s wi th PAIS that aiso had
breast cancer (Lobaccaro et al., 1993).
28
A single base substitution in exon 5 that converts
tyrosine to cysteine at position 762 in the hAR, was
assoclated wi th a shortening of the glutamine tract (12
glutamines), in a fami ly wi th PAl S. The mutat ions were
reproduced and used to act ivate a reporter gene. Together,
the two mutations were less active than either one alone,
and the A-R complexes had increased d issoeiation rates. It
was postulated that the two mutations interact to impair
normal AR function (McPhaul et a1., 1991).
A base substitution in exon 6 changes codon 813 from
serine to asparagine in a family with PAIS. The AR in GSF
had l igand-speci f le misbehaviour: i t had normal levels of
binding with all ligands, but the complexes dissociated
norma11y wi th the synthet ic androgen, MT and abnormally wl th
DHT and the synthetic androgen, MB. The AR seemed ta be
sensitive to DHT, for a reason not yet understood. This
unusual behaviour of the AR added a new quall tat ive
classification: ligand-dependent or sensitive AR. Affeeted
i ndi v idua1s resemble those wi th PAl S, wh ile others have
unambiguous male external geni talla. At puberty they have
a def icient ske1etal musculature, gynecomastia, and female
body contour lPlnskyet al., 1985).
29
5. Objectives:
One of the objectives of this study was to prave the
pathogenicity of three widely dispersed point mutations in
the HBD of the AR, in three individuals wlth AIS: a
transverslon in exon 4 that changes an isoleucine to an
asparagine at codon 663, in a patient with PAISi a
transversion in exon 7 that replaces a leucine by a valine
at codon 820, in a patient with PAIS; and a transition in
exon 8 that changes a proline ta a serine at codon 903, in
a patient with CAlS.
We WE're also interested in correlating bioc:he'mical
phenotype wi th mtolecular genotype in the mutant AR.
And finally, we were hoping to delimit the N-terminal
border of the AR's HBD by proving the pathogenicity of this
domain's most N-terminal mutation (Ile663Asn).
------------~ ~ ---- ~
II KATIRIALS AIID HETHODS
1. Mater:1als:
1.1 Fa.111es:
30
The patient coded 16588 was born with ambiguous
genitaIia, and was diagnosed with PAIS. His maternaI uncie
is affected, and his mother and grandmother are obligate
carriers.
Two siblings, coded 1609 and 6003, were born with
unambiguous female externai genitalla, and bilateral
inguinal gonads. Gonadal biopsies on 6003 revealed testes
bilaterally. Their karyotypes from peripheral lymphocytes
was 46,XY, and they were diagnosed with CAlS.
An individual coded 605 was born wlth amblguous
genitalia, was diagnosed with PAIS and had corrective
surgery dur i ng the newborn per lod . No other af fected
individuals were found in the family.
1.2 Pri.er synthesls:
AlI the pr imels wele synthes i zed us i ng the Gene
Assembler (Pharmacia/LKB Biotechnologies, Bale D'Urfé, PO.).
The sequences of the intronic pr imers were klndly donated by
C. Chang (Chicago) and J. Trapman (Rotterdam). The
sequences for exon 1 pr imers were from Rotterdam and our
Iabolatory.
Mutant pr iaers: nucleotlde no.
605-A S* 5'- GACAGTGTCACACAATGAAGGCTATG -3' 2505 to 2530
605-8 AS* 5'- CATAGCCTTCA~TGTGTGACACTGTC -3' 2530 to 2505
16588-A S 5'- ATTCCAGTGGATGGGqTG~TC -3' 2974 to 2998
31
16588-B AS 5'- GATTTTTCAÇ.CCCATCCACTGGAAT -3' 2998 to 2974
1609 -A S 5' - TGCAAGTGtCCAAGATCCTT -3' 3230 to 3249
1609 -B AS 5' - AGAAAGGATCTTGGlCACTTGCAC -3' 3252 to 3239
F lank 1 ne) pr Imers :
P3' AS 5' - CACCAACCTTCTCGATAGGCAGC -3' 62 bp 3' of BamH!
(P3' 15 located in the O-globln po1y-A taU ln pSVhARo in
Fig. 11).
88271 8 -A S 5' - AACCAGCCCAACTCCTTTG - 3 ' 2599 to 2611
DNA-B
Bac-B
AS 5' - GACTTCACCGCACCTGATGT -3' 2512 to 2526
S 5' - GGCTAGCCTCACTGGGTGTGGAAATAGA -3' 3286 to 3279
1. J Pr imary and secondary PCR:
The PCR reactions were carried out in a DNA Thermal
cycler (Perkin Elmer Cetus, Montreal, PQ.). The Vent
polymerase was purchased from New Eng1and Bi\llabs
(Mississauga, Ont.), and the deoxynucleotides from
Pharmacia/LKB Biotechnologies (Baie D'Urfé, pa.).
1. 4 Pur:ification of DRA:
Low me1 t agarose was purchased from IeN Biomed icals
Canada (Miss issauqa, Ont.). The buf fer used was TBE.
Hexadecylpyr idini um chlor ide was suppl1ed by Sigma (st.
Louis, MO.), and 1-Butanol was purchased fram Fisher
Scient1fic (Nepean, Ont.).
* S = sense, and AS = antisense
32
1. 5 Subcloning:
Restr lction endonueleases were purchased from Promega
(Madlsson, W.) exeept for 8stBl that was obtained from New
England Bi olabs (Miss issauga, Ont.). T4 DNA L igase was
purchased from Gibeo/BRL (Bethesda, MA.). XLl Blue E. coli
eells were purchased from Stratagene (San Diego, CA.).
Calcium chloride was purehased from Fisher Seientific
(Nepean, Ont.). Yeast extract and Baeto-Tryptone were
supplled dy Difco (Detroit, MI.). Agar was purchased from
BDH (st. Laurent, PO.), and Ampiclllin was obtained from
Boehringer Mannheim (Laval, PO.).
1.6 Sequencing:
Dideoxynueleotides were purehased from Boehr inger
Mannheim (Laval, PO.). Aerylamide was obtained from ICN
Biomedieals Canada (Hlssissauga, Ont.). Sequenase enzyme
was purehased from United states Bioehemicals (Cleveland,
Ohio). Sequeneing plates and the Base Runner were obtained
from Terochem (Harkham, Ont.). X-Ray film Cronex 7 was
purchased from E. 1. Dupont de Nemour 5 (N . D. G. photo ,
Montreal, PQ.).
1.7 Bxon 1 a.pllflcation and sequenclng=
Taq DNA polymerase was purehased form Blo/Can Se lent 1 f ic
Ine. (Mlssissauga, Ont.). 7-Deaza-2' -Deoxyguanoslne 5'
Triphosphate was purchased from Pharmacia/LKB
Biotechnologies (Baie D'Urfé, PQ.).
1.8 Tissue culture:
33
GSFs were derived from biopsies of patients and controis
obtained wi th informed consent according to approved
protocols. COS -1 ce Ils were purchased from the Amer ican
Type Culture Collection (ATCC) (Rockville, MD.). AlI the
cells were incubated in a 37°C humidified incubator supplied
with 5\ CO:z and 95\ air. The culture medium used for the
blnding assays was Opti-HEH supplied by Gibco/BRL Life
Technologies (Burlington, Ont.). The culture medium used in
the growth hormone assays was HEH with Hank's salt buffered
with Hepes purchas~d from ICN Biomedicals Canada
(Hississauga, Ont.). AlI the culture media were
supplemented wi th Gentamycin sulfate that was purchased from
Schering Canada (Pointe claire, PO.)i Penicillin that was
obtained from Ayerst (st. Laurent, PO.); streptomycin
Sul fate that was purchased. from ICN 8 iomed icals Canada
(Hississauga, Ont.); and Sodium Bicarbonate that was
obtained from Fisher Sclentific (Nepean, Ont.). Fetal Calf
Serum was purchased from ICN Biomedicals Canada
(Hlssissauga, Ont.).
1.9 Transfection:
COS-l cells were electroporated in a Gene Pulser using
0.4 mm cuvettes suppl ied by Bio Rad Laborator ies Canada
(Hlsslssauga, Ont.).
1.10 Androgen-blndlng assays:
The androgen-binding assays were performed using two
synthetlc androgens, (17«-methyl-»Hlmibolerone (HS; 7«, 17
«-dimethyl-19-nortestosterone) with a specifie actlvity of
J4
80.6 Ci/mmoll, and [l7<x-methy1-:JHJmethyltrieno1one (MT; 17
B-hydroxyl-17Œ-methy1-4,9,11-estriene-3-one, 83 Ci/mmol),
and two natural androgens [l,2,4,5,6,7-:JHJ5Œ
dihydrotestosterone (DHT; 120 Ci/mmol) and testosterone
[1,2,6,7-:JH (Nli (Ti with a specifie activity of 92.5
Ci/mmo1l. Radiolabe1led synthetie androgens were purchased
from Dupont Canada (Mississauga, Ont.). The radioinert
androgens were purehased from Amersham (Oakville, Ont.).
Samples were added ta liquid scintillation vials containing
biodegradable scintillation fluid: Beta Max ES, purchased
from ICN Blomedicals Canada (Mississauga, Ont.), and counted
in a TriCarb 1500 liquid scintillation counter (Hewlett
Canberra-Packard
cupr ic sul fates
(Nepean, Ont.).
Canada). Ciocalteu's Folin reagent and
were purchased from Fisher Scientifle
1. LI Growth hormone assays:
Growth hormone levels were measured using an Allegro
human growth hormone assay kit, purchased from Nichois
Institute (Los Angeles, CA).
1.12 8-C)alactosidase assay:
2-Nltrophenyl B-D-galactopyranoside (ONPG) was obtalned
from Boehr i nger Hannhe i m (Lava l, PO.}.
1.13 Western blottinC):
1.13.1 Ce11 lysis and protein assay:
The protease inhibi tors were purchased from Boehr Inger
Mannheim (Laval, PO. l. The sodium dodecyl sulfate (SOS) and
the DC pro t e i n assay were purchased
Laboratorles Canada (Mississauga, Ont.).
1.13.2 Gel electrophoresls:
35
from Bio Rad
Coomassie brilliant blue was purchased from Bio Rad
Laboratories Canada (Mississauga, Ont.). The discontinuous
SOS-gel ran on an electrophoresis apparatus purchased from
Glbco/BRL Life Technologies (Burlington, Ont.).
1.13.3 Protein transfer:
Nitrocellulose filters were purchased from Xymotec
B iosystems (Hontrea l, PO.). The monoc l anal ant ibody F39 .4.1
was kindly donated by A.O. Brinkmann (Zegers et al., 1991).
Horseradish peroxidase was obtained from Professional
Diagnostic Inc. (Edmonton, AB.). Tween 20 was purchased
from BOH (Ville St-Laurent, PO.). ECL detection reagents
were purchased from Amersham (Oakville, Ont.). The X-ray
film used was X-OHAT-AR and was obtained from Eastman Kodak
(Rochester, NY).
2. Hethods:
2.1 Identification of mutations:
The ONA was extractp.d previously in the laboratory from
GSFs or periphera1 blood lymphocytes accordlng ta the method
descr i bed by Greenberg et al., (1987). AlI the exons were
amplified tJy using intronic primers, and the PCR products
were gel purified and used for sequenclng. The mutat ions
were identtfleè and confirmed for each family.
36
2.2 Bxon 1 amplification and sequencing:
Deoxyguanosine 5'-Triphosphate (dGTP) was replaced by 7-
Deaza-2'-Deoxyguanosine 5'-Triphosphate to Eacllitate
amplification of the GC-rich areas. It was aiso used in the
sequencing reactions. Exon 1 was amplified from genomic DNA
using Taq DNA polymerase as follows: 98°C denaturation for
1 min., 55°C annealing temperature for 1 min., and 72°C
extens i on for 1 min. and 30 sec. The PCR pr oducts were
tesolved on a 1\ low meit agarose gel. The right size bands
wer e exc ised and sequenced us i ng Sequenase, a mod i f Led T7
DNA polymerase, according to the manufacturer's protocol.
2.3 Family studies:
In the case of the 16588 family, the DNA was extracted
from blood samples obtained from the gr.:andmother,
grandfather, unc1e, aunt, the mother of the subject 16588,
and the proband 16588. Exon 7 was amplified by PCR and the
PCR products were gel purified and digested wlth the
restriction enzyme HphI.
For the 1609/6003 family, exon 8 was amplified from GSFs
of the two siblings and digested with Bsp1286I. In both
cases the fragments were resolved on a 10\ polyacrylamide
gel at 150 volts for 5 h. The gel was then stained wlth
ethidium bromide and photographed.
2.4 Expression vectors:
2.4.1 pSVhARa/BHEX:
The express ion vector used was pSVhARo (Br inkmann et
37
aL, 1989) (E"ig. Il). It was modified in our 1aboratory by
creating or abo1ishing restriction endonuc1ease sites, to
facilitate cloning. The modlfied vector was renamed
pSVhARo/BHEX (Fig. 12). It 1s 7219 base pairs long and
conta i ns the comp lete cod i ng sequence 0 f the hAF (cDNA)
cloned as a SalI-Pst! fragment in pBR328, the SV40 early
promoter, the rabbit O-globin po1yadeny1ation signal, and
the ampicillin resistance gene for selection in bacteria.
2 • 4 • 2 pHMTV-GH:
A growth hormone gene dr i ven by i ts own promoter was
placed next to the mouse mammary tumour virus long terminal
repeat (LTR) (Prior et al., 1992) (Fig. 13). This plasmid
was used in cotransfectlon assays to measure AR-lnduced
t r ansact i vat i or ..
2.5 Site-dlrected mutagenesls:
The mutations were reproduced by the overlap-extension
method of site-directed mutagenesls using the recombinant
polymerase chain reaction method (peR) described by Higuchi
(1990) and pSVhARo/BHEX as template. First, in two primary
peR reactions, two overlapping pieces of DNA containing the
desired base substitutions are formed by using: 1) one
mutant primer (ie. sense) with a 3' flanking primer, and 2)
the antisense mutant primer with the 5' flanking primer.
Second, a secondary peR reaction amplifies the full length
DNA fragment containing the desired mutation by using the
two overlapping primary peR products and the flanking
38
Fig. Il: hAR eDNA expression veetor (pSVhAR o ) (Brinkmann et
al., 1989). It eontains: the complete eOdlnq
sequence of the hAR cDNA (2751 bp) in a 3037 bp
SalI-PstI fragment; the SV40 early promoter; the
rabbit B-globin poly-adenylation signal; and the
ampleillin resistance gene from pBR 328. Hatched
boxes represent the 5' and the 3' noncoding regions
of the eDNA.
Amp'
p8R 328
ORI
?vu Il
pSVAAo
(7219 bpI
BgI" Bam HI Smal Sali EcoAI
Pslf
Sac 1
pSVhARoIBHEX (7219 bp)
n-globin
1-4--Xhol
Fig. 12: pSVhARo/BHEX, a modified hAR cDNA expression vector
(refer to Fig.ll). Some restriction enzyme sites
have been abolished and others created.
MMTV·LTR 1.45 kb
pMMTV-GH (6264 bp)
Fig. 13: Human grùwth hormone reporter construct pMMTV-GH.
The mouse mammary tumour virus long terminal repeat
(MMTV-LTR, HindIII-NheI fragment) was inserted into
the human growth hormone cD~A (hGH) construct (ptGH)
(Prior et al., 19~2).
39
primers.
2.5.1 Primers:
The pr imers were synthes i zed wi th the spec l f le base
change at the site of the mutation. The sense and the anti
sense primers were used in conjunction with flanking primers
that were chosen to anneal with the template (pSVhARo/BHEX)
5' or 3' of a unique restriction site (section 1.2).
2.5.2 Primary PCR:
The mutant and the flanking primers were used to amplify
the two overlapping pieces of DNA separately using 2 ug of
the pSVhARo/BHEX. The denaturation reaction was carried out
at 95°C for 45 sec, the annealing reaction (45 sec) was at
57°C for Leu820Val and at 63°C for Pro903Ser, and the
extension reaction was at 75°C for 1 min and 45 sec. The
Vent Po1ymerase enzyme was used because of its 3'
exonuclease activity in proofreading the extended fragment
of DNA.
2.5.3 Secondary PCR:
Equimolar aliquots of the two primary PCR products (gel
purified) were mixed in one FeR reaction. AlI the essential
ingredients were added except for the upstream and
downstream pr Imers (the paramaters were the same as in
sect i on 2.2.2). The r eact i on was allowed to proceed for
f ive cycles when the DNA fragments were denatured and
reannealed as heteroduplexes and 3' extension was carried
out by the enzyme. The flanking primera were then added and
40
the PCR reaction proceeded for 20 more cycles (Fig. 14).
2.6 Purification of DNA fragments:
The pr imary and the secondary PCR products were resolved
by 1\ low melt agarose gel electrophoresis with ethidium
bromide staining. 'rhe DNA fragments were excised over cl
short wave ul traviol et lamp, then extracted from agarosE~
according to Landridge et al. (1980). This method is basecl
on separating DNA fragments by treating the melted agarose
wi th a quaternary ammonium compound, Hexadecylpyr idinium
chloride (ON). The ON+ ammonium cation binds to DNA in lo~,
salt concentration but not to agarose. By the addition of
water equilibrated 1-Butanol, the DNA-QN+ complexes transfer
to the alcohol layer. By increasing the salt concentration
the DNA complexes dissociate and transfer to the aqueous
layer. The DNA ls then pur i f i ed and extracted by a
chloroform and ethanol precipitation respectively.
2.7 Subcloninq:
2.7.1 Restriction endonuclease digestion:
pSVhARo/BHEX and the Insert (secondary PCR product) were
digested with a pair of unique restriction endonucleases 5'
and 3' of the mutations to create identical sites for
ligation. The eut vector and inserts were resolved on a 1\
low melt gel and purified by the ON-butanol method (sec~ion
2. 5) •
41
Fig. 14: steps for PCR mutagenesis (Higuchi 1990). The
arrows indicate the location of the prim~rs and th~
direction of amplification exc~pt for 2) where the
arrows indicate the direction on1y. The mutation
is represented by the symbol (0).
1) Primary PCR 5' 5' __________________ ~ _____ 3'
3'-----------------------------5' 5' A e ~ ..
~ Q B 5' 5'------------------------- 3' 3' 5'
5' ..
2) Secondary PCR a. remove primers, denaturation and renaturation
3' 5'-a= S'
+ 5' i=3' ...
-- 3'
b. 3' extension of the 5' overhanging fragments
~:
c. amplification
~: ---.. -------~s~----------------
3'
5'
3' 5'
3' 5'
42
2.7.2 Llgation:
1: 3 mo lar rat i 0 of the cut vector and the i nsert,
respectively, were added to the ligation mixture according
to the method described by Sambrook et al. (1989b). 100 ng
of the cu t vecto r was added to the llga t ion mi xtu re and
treated as a negative control. The reaction was carrled out
at 1GoC for 18 h.
2.7.3 Competent cells:
E. coli XLI Blue cells were made competent accordlng to
the method descr i bed by Davis et al. (1986). 40 ml of
sterile Luria Broth (LB) medium was inoculated with a sample
of XLI Blue cells (original agar stock). The culture was
grown logarithmica11y at 37°C, pelleted at room temperature
and resuspended ip 20 ml of 50 mM CaC12. The cel1s were
kept on ice for 30 min, then were centrifuged at 4°C and the
pellet was resuspended in one-tenth of the original volume
and kept at 4°C for 1G h to increase the competence of the
cells.
2.7.4 Transforaation and screening of colonies:
The competent bacterial cells were transformed using the
method described by Davis et al. (198Gb). 200 ul of
competent cells were added to: the llgated vector/lnsert
mixture; the negative control (section 2.2.2); and to 1 ng
of the intact vector (positive control). The mixture was
incubated on ice for 30 min, and heat shocked at 42°C for 2
mln. 1 ml of LB was then added and the celis were incubated
at 37°C on a rotor for 45 min. 100 ul of each mixture were
43
added to LB/agar-containing petri dishes, supplemented with
50ug/ml ampicillin, that were incubated at 37°C for 18 h.
The ampt·~illin-resistant colonies were picked aseptically
and grown in 5 ml of LB containing ampicillin at 37°C for 18
h. 1 ml was used to extract DNA using an alkaline-Iysis
procedure described by Sambrook et al. (1989a). Positive
colonies were chosen for a large-scale DNA amplification.
2.8 Large-scale DKA amplification:
The DNA extracted from the positive subclones was
amplified in E coli following the protocol described by
Sambrook et al. (1989c). 500 ml of LB were inoculated with
4 ml of the bacterial culture and incubated at 37°C for 18
h on a shaker. The DNA was extracted using the resin
separation columns (Qiagen) following the manufacturer's
protocol.
2.9 Sequencing:
The plasmids containing the mutations were sequenced
using Sequenase enzyme. The sense and the anti-sense
strands were sequenced according to the manufacturer's
protocol. The sequencing reactions were run on a 5\
denaturing polyacrylamide gel dt 64 watts, and the gel was
exposed to an X-ray film.
2.10 Tissue culture:
COS-l cells and GSFs were grown in Opti-MEH culture
medium, supplemented with 5\ fetal calf serum (FCS). The
cells were harvested with 0.1\ trypsin and centrifuged at
44
200xg for 3 min, and the pellet was resuspended in the same
medium.
2.11 Transfection:
COS-1 cells were harvested and resuspended in the
culture medium at a concentration of 20 million cells Iml.
la million cells were aliquoted in the electroporation
cuvettes (0.5 ml). The control and the mutant plasmids were
added ta different cuvettes in triplicates. 4 ug of the
pCHV-O-Gal plasmid carrying the O-Galactosidase gene driven
by the Cytomeqalovirus promoter, were added ta the cells ta
measure transfection efficiency. The cuvettes were placed
on ice for 5 min prior to electroporation. The cells were
shocked at 250 volts and 960 uF and were placed on ice for
10 minutes. Frp.sh medium was added, the cells were pooled
and plated either in 24 weIl plates (500,000 cells per weIl)
or in 35 mm plates (1 million cells per plate), 24 h later,
the medium was replaced by a fresh one.
2.12 Cotransfection:
COS-1 ce11s were cotransfected with la uq pSVhARo/BHEX,
or the mutant plasmid, 10 uq of pMMTV-GH, and 4 ug of the
pCMV-B-Gal as described in section 2.11. The pulsed cells
were pooled and resuspended in Opt i --HEM wi th 10\ FCS,
500,000 cells were added to each weIl of a 24 weIl plate.
48 hours post-transfection, 10 nH ta 0.03 nH 3H-HB was added
in a 300 ul volume in MEM supplemented with Hank's salts,
Hepes buffer and 10\ FCS. This medium was used because it
lacks biotin which can Interfere wi th the growth hormone
45
assays. The cells were assayed for androgen-binding
activity 48 h after transfection, for 2 h and 48 h after
addition of androgen.
2.12.1 Transactivation and growth hormone assay:
The cotransfected COS-l cells (section 2.9) were assayed
for androgen-induced transactivation of the growth hormone
gene by measuring the amount of GH in the medium 48 hours
after the addition of androgens. The transactivation
activity by the A-R complexes was studied using a growth
hormone immunoassay kit (Nichols Institute Diagnostics)
according to the manufacturer's protocol. This kit
incorporates two monoclonal antibodies with high affinity
and specificity for the human growth hormone. Both
antibodies bind specifically to a different epitope and form
a "sandwich" complex with the hGH. One of the antibodies
was radiolabelled for detection while the other was coupled
to biotin. The complexes thus formed bind to avidin-coated
beads (subsequently added to the reaction mixture) via the
high-affinity binding of biotin to avidin. The media from
cotransfected COS·l cells (incubated with androgen for 48 h
or 72 h) were collected and assayed for growth hormone
activity. 50 or 100 J.l.l of the reaction mixture (12!SI_
Antibody solution or the "sandwich" complex) were added to
an equal volume of the media with one avidin-coated bead in
round-bottom tubes. The tubes were placed on a shaker for
1 h and 30 min at room temperature. The beads were washed
twice with a wash solution (provided in the kit), and the
tubes were placed in a gamma counter in order to measure the
46
hGH activity.
2.13 Androgen-b\nding assays:
GSFs and transfected COS-1 ce1ls were incubated with a
tritiated androgen for 2 h or more at 37°C in tripllcate.
The androgen-binding activity was measured according to the
method described by Kaufman and Pinsky (1989). At the end
of the incubation, the cells were placed on tce, and washed
twice with a Tris/saline buffer (0.2 M Tris/Hel pH 7.4 and
l 5 0 mM Na Cl) . The cells were Incubated with 0.1% Trypsin
for 5 min at room temperature, and were scraped with a
rubber policeman and centrifuged at 200xg at 4°C for 3 min.
The pell et was washed twice wi th the same but ter and the
cells were lysed by the addition of 0.5 N sodium hydroxide.
The lysate was mi xed vigor ous ly, al iquots wer e taken for
protein determination using the Lowry assay (Lowry 1951),
and for counting the radioactivity. The nonspecific binding
was measured by incubating the cells (dupl icates plates) 1
with the tritiated hormone and 200-fold excess of the same
radioinert androgen. The specifie actlvity was measured by
subtracting the nonspecific binding from the total binding
actlvlty.
2.13.1 Monequllibrium dissociation rate constants:
COS-l cells were transfected with 0.05 ug ta 2 ug of the
control and mutant plasmid. 48 h later quadruplicate plates
were incubated with 3 nM of the tritiated androgen for 2 h
at 3?OC, and duplicates received the tritlated hormone with
41
200 fold excess radioinert hormone. After the incubation,
one 8P.t 0 f ce Ils was placed on i ce and processed as in
section 2.10. The lest of the plates received fresh medium
containing 200-fold excess of unlabelled hormone, and then
were placed at 37°C for different periods of time (30 min ta
2 h). At intervals, the cells were processed as in section
2.10.
2.13.2 Thermolability of complexes:
Triplicate plates of GSF or transfected COS-l cells were
incubated at 37°C with 3 nM of 3H-MB or 3H-MT for 2 h with
100 uM cycloheximlde, and duplicate plates were incubated
wi th the same medium plus 200-fold excess of unlabelled
hormone. The basa 1 b i nd i ng act i vi ty was meas ur ed and the
rest of the plates were shi fted to a higher temperature
(42°C) and were processed at different time intervals (1 ta
6 h).
2.13.3 Apparent equilibrium dissociation rate constants:
GSF or transfected COS-l cells were labelled with
di f f erent concentrai ons of tr i t i ated androgens (0.03 to 3
nH) for 2 or 3 h in the presence of 100 uH cycloheximide at
37°C, then the cells were processed 35 described above
(section 2.10).
2.14 8-galactosidase assay:
COS-l cells transfected with pCMV-O-gal were washed and
scraped in a 0.2 M Tris/HCI solution pH 7.4 and centrifuged.
The pellet was resuspended in 100 ul of a 0.25 M Tris pH 8.
48
The cells were then lysed according to the method described
by Sambrook et al., (1989d) by three cycles of freezing and
thawing in a dry ice/ethanol bath and 37°C bath,
respectively, for approximately one minute each cycle. The
tubes were centrifuged at 4°C and 30 ul of the supernatant
were assayed for protein determination and for Beta
galactosidase activity.
The l3-galactos idase assay uses o-n i trophenyl G-D
ga lactopyr anos ide (ONPG) as s ubstrate . Th i 5 compound 1.5
hydrolysed by l3-galactosidase to yield a chromogenlc
compound o-nitrophenyl (ONP). ONPG was added to 30 ul of
the supernatant pl us 0.1 M sod i um phosphate, 0.1 M magnes i um
ch lor ide and 4.5 M IJ-mercaptoethano 1. The ml xture was
incubated at 37°C until the solution turned yellow, the
reaction was stopped by the addition of 1 M calcium
phosphate. The optical density (OD) of the solution was
measured at 420 nm and the units of O-galactasiddse activity
were calculated according to the following equation:
A 4 4Z0/0. 00 45 units/ml=
t ime x volume
(time, is the reaction time in minutes; volume, 1s th.,.
volume of cell extract in ml; and 0.0045 15 a constant).
The linear range was an 00 from 0.2 ta 0.8.
2.15 Western blotting:
2.15.1 Cell lysis and protein determination:
GSFs were grown to confluence in T 175 cm2 flasKs. The
media was aspirated and the cells were incubated with
49
versene (NaCl, 137 mM; potassium phosphate monobasic, 37 mM;
KCl, 67 mM; sodium phosphate dibasic, 107 mM; and EDTA, 13
mM) at 37°C for 10 min. The cells were harvested by
vigourous tapping and washed twice in a Tris/saline solution
pH 7.4. The pellet was resuspended in an SDS-lysis buf.fer,
then lysed by passing the mixture through a 25 gauge needle
5 times in the presence of a variety of protease inhibitors:
APHSF, Aprotonin, Bestatin, E-64, Leupeptin, and Pepstatin.
The lysate was boiled for 10 min. and a sample was used for
protein determlnation. This was done using a colorimetrie
assay for protein concentration following detergent
solubilization. It is similar ta the Lowry assay (Lowry et
al., 1951).
2.15.2 Discontinuons SDS-PAGE:
The gels were prepared according ta Sarnbrook et al.,
(198ge) . After boiling the lysate and determining the
concentration of the protein, 200-400 Jlg were loaded on the
gel. The gels ran overnight at 100-110 volts in duplicates.
One set was stai"ed with Coomassie brilliant blue, and the
other was transferred anto a nitrocellulose fnter.
2.15.3 Protein transfer:
Protein transfer was done by electroblotting, fallowing
the methad of Sambrook et al., (1989f). The current used
was 325 mAmp. for 3 h and 30 min. Following the transfer,
the blot was incubated for 1 heur at room temperature (or
overnight at 4°C) in a blocking solution containing Tris-
50
buffered saline (TBS) pH 7.4 and 0.5\ Tween 20 (detergent).
It was then incubated with the monoclonal antlbody
(F39.4.1), 1:10000 dilution, for 1 hour at room temperature.
This antibody recognizes a peptide sequence corresponding to
amino acids 301-320 in the N-terminal domain of the hAR
(Zegers et al., 1991). The blot was t hen washed s everal
times wi th TBS and 0.5% Tween 20 at room temperatur e and
incubated with the secondary antibody. The latter was a
horseradish peroxidase (HRP) goat anti-mouse immunoglobin G
(1: 10000 di lut ion) . The blot was washed and s ubjected to
the chemi 1 uminescence detect ion method accord lng to the
suppl ier' s protocol (ECL protocol from Amersham). It was
immersed in a mixture of detection reagents for 1 minute,
and exposed to an X-ray film for maximum 1 hour.
51
1 Il RESULTS:
1. Identlf ication of mutations:
By sequenc i ng exons 2 to 8 of the hAR from genomic DNA
of GSF the mutat i on in the pat ient C oded 605 was found to be
a thymidine-to-adenlne transversion at nucleotide 2519 in
exon 4. It changes an isoleucine ta an asparagine at codon
663 (Fig. 15), a nonconserved amino acid in the GR
subf amily.
A cytosine to guanine transversion was found in the
genomic DNA of patient 16588 at nucleot ide 2989 in exon 7.
It changes codon 820 in the HBD from a leucine to a valine
(Fig. 16), a conserved residue in the GR subfamily.
The mutat i on found in 1609 and 6003 was a cytos i ne-to
thym i d in e t r ans i t ion a t nue le 0 t ide 3 2 3 8 i n e x 0 n 8. l t
rep1 aces a prol i ne by a ser i ne near the c-terminal end 0 f
the HBD at codon 903 (F ig. 17) which is conserved in the GR
subf amitly.
wi th the
Table 2 displays base
clinical phenotype of
and codon substitutions
the patients and the
biochemical phenotype of the mutant hAR. The structure of
the amine acids invo1ved in each mutation 1s shawn in figure
18.
2. Family studies:
2.1 16588 (Leu820Val):
Normally exon 7 (262 bp) of the hAR cantains one HphI
restriction endonuclease site. The mutation Leu820Val
creates an extra site for this enzyme (Fig. 19). Exon 7 was
ampli f ied f rom DNA extr acted from per ipheral lymphocytes of
52
Fig. 15: T ta A substi tut ion in codon 663 found by sequen
cing exon 4 of 605. The mutant nucleotide and
amina acid sequences are compared ta control.
Aste r lsks and bo Id let ters i ndica te the base
susbsti tut ion.
Normal
C-terminus
Î
665 Gly
Glu
Ile Asn
HIS
Ser 661
J, N·terminus
53
Fig. 16: C to G substitution in codon 820 found by sequen
cing exon 7 of 16588. The mutant nucleotide and
amino acid sequences are compared ta control.
Asterisks and bold letters indicate the mutatlon.
C-terminus
Î
n 822 [1\ Asn
[1 ~ GATC. GATC
~J Lys
~~ ~J Leu 820 va{ ~
*C G*
n Gly D Normal
n Asp [~ 818
t N-terminus
54
Fig. 17: C ta T substitution at codon 903 found by sequen
cinq exon 8 of 1609 and 6003. The mutant nucleo
tide and amino acid sequences are compared ta
contra 1 . Aster isks and bo ld let ters i nd icate the
mutation.
C-terminus
Î
n 905 U Ile
GATe n Lys [; GATe
•• -. a-~}ro 903 s{~ -. 41ft
• • . ~- *C T* ,: • . -'- n u " ~ --Normal Val 1609/6003
n Gin [~ 901
J, N-terminus
Phenotype Code Exon Codon Base Residue Receptor Cllnical
605 4 663 T to A Ile ta Asn deflcient PAIS
16588 7 820 C to G Leu ta Val pos iti ve PAIS
1609/ 8 903 C to T Pro to SeT. positive CAlS 6003
Table 2: Base and codon substitutions in the three families,
their exonic locations, the andragen-binding pheno-
type of the corresponding mutant AR and the clini-
cal phenotype observed.
55
Fig. 18: Chemical structure of the amino acids involved in
the three mutations: (a) praline and serine in the
Pro903Ser mutation; (h) leucine and valine in the
Leu8 2 OVal mu tat i on; and (c) iso l euc i ne and aspara
gine in the Ile663Asn mutation. The arrows point
to the amino acid created by the mutation in each
case.
proline (Pro, or P)
+ H2N
,00-C-H
1 1 BzC CB2 ""/ Clh
leucine (Leu, or L)
COO + 1
H3N -C--H
1 Clh
1 CH
/, }bC 013
isoleucine (Ile, or 1)
COO + 1 HJN-C-H
1 H-C-C}13
1 C:-12
1 Cr13
... +
serine (Ser, or S)
COO
1 HJN-C- H
1 }1-C- (C)!FJ
1 lB
valine (Val, or V)
coo + 1
---... ~ HJN - C - H
1 œ
/" }hC CH)
asparagine (Asn, or N)
(a)
(b)
(C)
Fig. 19: Leu820Val nueleotlde and amino acid sequence alte
ration in exon 7 and HphI sites. 7Aand 78 are the
sense and ant i -sens e nue 1 eot ide sequences us ed as
intronie primers for exon 7 amplification. Arrows
point to the substitutions and the digestIon sites.
Intronie sequences are shawn in smaller Slze
letters.
G
~ GCTCCTICGTGGGCATGCTICCCCTCCCCATICTGTCTICATCCCACATCAG TI CCA GTG GAT GGG .eTG
7 A le Pro Val Asp G1y ~u ~ ,
Hph 1 Val
AAA AAT CAAfAAA TIC ITT GAT GAA CIT CGA ATG AAC TAC ATC AAG GAA Lys Asn Gin Lys Phe Phe Asp Glu Leu Arg Mel Asn Tyr Ile Lys Glu
crc GAT CGT ATC AIT GCA TGC AAA AGA AAA AAT CCC ACA Tec TGC TCA Leu Asp Arg Ile Ile Ala Cys Lys Arg Lys Asn Pro Thr SeT Cys SeT
Hph 1 , AGA CGC TTC TAC CAG CTC ACC AAG crc crG GAC TCC GTG CAG CCTGTAAG Arg Arg Phe Tyr Gin Leu Thr Lys Leu Leu Asp SeT Val Gin Pro
CAAACGATGGAGGGTGCTTTATCAGGGAGA~CAGCçrGATAGAGCCAATG
..2!! --
e -
51
16588 and his grandmother, grandfather, mother, 2 maternal
aunts and an af fected unele. The PCR pr oducts were di gested
wi th Hp.'7.I, and the fragments were r esolved on a 10'\
polyacryl amide gel. Figure 2 a shows the r estr i ct i on patter n
of the family. The unele and the proband (lanes 4 and 6,
respectively) had identieal 3-band pattern of 96, 88, and 18
bp. The mother and the grand mothe r (lanes 3 and S,
respecti ve ly) had identieal 4-band heterozygote patter ns
( l 7 4, 9 6 , 8 8 , and 7 8 b p) e 0 m p ris i n g the no r ma l a II e 1 e (1 1 4
and 88 bp fragments), and the mutant allele (96, 88, and 78
bp fragments).
2.2 1609/6003 (Pro903Ser):
Exon 8 was ampl if ied and digested with Bsp1286I. The
fragments were resol ved or, a 10'\ polyacrylamide ge 1 . The
mutation Pro903Ser abolishes the site for asp1286I in exon
8 (F i g . 2 1 ) . Fig ure 2 2 s h 0 ws the 16 0 9 / b 003 f ami lys t u d y .
A digested control sample (lane 5) yie1ded 2 Lt"agments: 152
and 143 bp. The PCR products frui',1 the 1609 and 6003 were
resistant to digestion (lanes 6 and 7, respectively).
2.3 605 (Ile663Asn):
There was no fami ly study conducted on the 1 l e663Asn
mutation for three reasons: 1) 605 was the only fam! ly
member affer::ted; 2) the mother's DNA was not available; and
3) the mutation dld not ereate or abo1ish a known
res t r let i on enzyme.
58
Fig. 20: Family study of 16588 (Leu820Val mutation). Exon
7 PCR produets were digested Wit:1 HphI. The frag
ments were resolved on a 10% polyacrylamide gel.
Lanes 1 and 9 eontain PhiX174 cut with HaeIII (DNA
moleeular we ight marker). Lane 2 carr ies an uncut
control PCR produet of exon 7 (262 bp). The mother
and the grandmother (lanes 3 and 5 respect i vely)
show the heterozygote pattern of digest. The
mutant allele, having an additional site for diges
tion, was eut in three fragments (96, 88 and 78
bp), and the normal allele in two (174 and 88 bp).
The uncle and the proband (lanes 4 and 6 respec
tively) show the homozygote mutant pattern of
digestion. Lanes 7 and 8 show the normal pattern
of HphI digestion of exon 7 of an unaffected aunt
and gr andfather re.=; pect i vely.
262 234 194
118
72
123456789
174
~3 78
59
Fig. 21: Pro903Ser nucleotide and amino acid sequence alte
rdtlon and Bsp12861 site. 8A and 8B are the sense
and anti-sense nucleotlde sequences used as
intronic primers for ~xon 8 amplification. Arrows
point to the substitutions and the Bsp12861 site in
control. 'Lntronic sequences are shown in smaJ 1er
size lettets.
e
ACCKCTIQICACCçrGTITITCTCCCTCTIATIGTICCCTACAG AIT GCG AGA GAG CTG CAl' CAG 8A Ile AJa Arg Glu Leu His GIn
TIC ACf TIT GAC erG CfA ATC AAG TCA CAC ATG GTG AGC GTG GAC nT Phe 111r Phe A"p Leu Leu Ile Lys Ser His Met Val Ser Val Asp Phe
Bsp 12861
1 \ X
CCG GAA ATG ATG GCA GAG ATC ATC TCT GTG CAA G";G tct AAG ATC CIT Pro Glu Met Mel Ala Glu Ile He Ser Val GIn Val Pro Lys Ile Leu
-rCT GGG AAA OTC A 7
")ct Gly Lys V"i
::CCCA<iCTCATt .J\..
r t
1er :rc TAY TIC CAC ACC CAG TGAAGCATIGGAAACCCTA
{, ,e Tyr Phe His Thr GIn
T-Lr ,-, rCTTCIGCCIGTTAIAACTCIGCACTAÇTÇCJÇJGÇAGIGCCTnGGGG
88
e
60
1"'lg. 22: Family stuc1y of 1609/6003 (Pro903Ser mutation).
Amplified exon 8 was digested with Bsp1286I. Lanes
1, 2 and 3 show amplified exon 8 of a control, 1609
and 6003 respect ively (295 bp). Lane 4 shows the
molecular weight ffi~~ker PhiX174 cut with HaeIII.
Lane 5 shows amplifled exon 8 of a control, cut
with Bsp1286I. Two fragments were generated: 152
and 143 bp. Lanes 6 and 7 (exon 8 from 1609 and
6003 respectively) show resistance to digest.
MW 1 2 3 4 5 6 ., MW bp bp
310
234
194 52
118
61
1. Si te-d i rected mutagenes 15 :
AIl three rnutatlons were reproduced by a recombinant
PCR technique (Higuchi 1990). For the Ile663Asn 1 mutation,
the two primary PCR reactions were perfGrmed by I.Ising: the
f lank ing sense pr imer DNA-B wi th the mutan tant isense pr imer
605-B [section II (1.2») to give a 504 bp fragment; and the
Elanking antlsense primer Bac-B with the mutant sense primer
605-A to give a 768 bp fragment. The secondary PCR produced
the full-length DNA fragment. It was double-digested with
HindIII and XhoI. Thus, a 330 bp DNA fragment, harboring
the mutation, was released. It replaced the normal seqüé:nce
in pSVhARo/BHEX.
For 16588, the two prlmary PCR reactions were performed
by using: the flanking sense primer 605-A with the mutant
antisense primer 16588-B [section II (1.2)] to produce a 492
bp fragment; and the f1anking antisense primer P3' [section
II (1.2)] with the mutant sense primer 16588-A (section II
( 1 .2) 1 to produce a 472 bp fragment. The secondary PCR
synthesized the full-length fragm2nt that was digested with
EcaRI and BamHI and re1eased a 462 bp-DNA fragment
containing the mutation.
For 1609/6003, the two primary PCR reactions produced
a 651 bp fragment and a 222 bp fragment by using: the
flanking sense primer 882718-A [;ection II (1.2)] with the
mutant antisense primer 1609-8; and the flanking antisense
1 The site-directed mutagenesis and the subcloning of Ile663Asn were done by Sylvie Bordet, a former graduate 5 tudent.
62
primer P3' with the mutant 1609-A [sectlon II (1.2)} sen:.,'t'
prImer respectively. The full-length DNA fraqment was
synthesized in the secondary PCR reaction. It was dlqested
with EstEr and BamHI and yielded a 394 bp long fragment.
The three mutant hAR cDNA sequences g~nerated by PCR ln
the hAR expreSSlon vector, were verlfied by DNA sequencing
prior to functional studies. This was done ta exclude
unwanted mutatio~s.
4. Androgt'n-binding assays:
4.1 Genital skin fibroblasts:
Androgen-binding assays on GSF from 1609 and 6003 were
published by Gottlieb et al., (1987). The A-R complexes
formed in GSF from 6003 had an incr~ased apparent
equilibrium dissociatlon rate constant (K4=0.5 to 0.7 nMi,
but a normal maximal bindlng capacity (Bu.) with MB and MT.
The complexes fa i 1 ed to augment (0 r upr egu la1:e) the i r 1
androgen-binding activity upon prolonged incubation with
synthet i c nonmetabo 1 i zable andr ogen. The unliganded A.Rs
were thermostable. In th i sassay, the GSFs wer e i ncubated
at 42°C, in the presence of 100 ~M cycloheximlde, for
different lengths of time, then the tritiated MB was ddded
and the cells were incubated at 37°C. The complexes formed
at various tirnes after the addition of :JH-MB 37"C were cl
measure of the rernaini'1g receptors capable of hormone-
binding. However, when the complexes (already labelled at
37°C) were placed at 42°C, they were thermolablle. The A-R
complexes had increased nonequilibrium dissoci.'ition rate
constants at 37°C (t 11Z =40 min, normal t 1l2 =230 mln. with MB).
63
A-R complexes in GSF from 16588 had normal androgen
bInding activity (>20 fmol/mg protein with MB) and were able
to augment with prolonged incubation wlth dndrogen. The
nonequllibrium dissOcIatIon rates were increased with MB,
MT, and DHT. The complexes were thermolabIle at 42°C. The
apparent equilibnumdlssociation rates observed (K.=0.l6 nM)
f e Il l n t he n 0 r ma 1 r ange (O. 0 1 - 0 . 3 n M) .
Initlally, A-R complexes formed in GSFs from 605 had
deficient levels of androgen-binding activity (between 10
and 20 fmol/mg protein). Due to the low level ot activity,
the qualitative assays were not possible. The GSF cultures
grew poorly. Once we were successfùl in g::owinq a new
culture of 605, the number of A-R complexes with MB was
~loser to the normal range. The dissociatiùn rates 0f the
complexes were normal. The complexes were able to augment
with prolonged incubation with androgens. The specifie
androgen-binding activity increased from 25 to 58 fmol/mg
protein in 24 hours.
4.2 Transfected COS-l cells:
In order to prove the pathogenicity of the mutations,
we transfected COS-l cells with the hAR expression vector
pSVhARo/BHEX harbor ing each of the appropr iate base
substitutions. Base substitutions were introduced by site
directed mutagenesis. Transiently transfected COS-l cells
were then subjected to a serles ot" kinetic assays. They
were: thermolabilitYi nonequilibrium dissociation rates;
apparent equilibrium dissociation rates; and transactivation
assays.
64
4.2.1 Thermolability:
COS-l cells transfected with 2 )1g of the Prû903Ser
mutant plasmid had very thermolablle A-R complexes at 42°C
as seen in GSF. The cells were labelled wlth ~H-MB or 3H-MT
at 37°C for two hours in the presence of 100 pM
cycloheximide (the latter was used to prevent protein
synthesis during the IncubatIon). The cells were then
shifted ta a higher temperature (42°C) and were incubated
for different lengths of rime (0 to 6 h). They were then
assayed for the remaining androgen-binding actlvIty. This
was pl8tted semi-logarirhmlcally, as percent activlty,
against time. 50% of the mutant complexes were lost in 60
minutes exposure to 42°C with MB (Fig. 23c). In COS-1 cells
transfected with the control plasmid, the same amount of
complexes was lost in 900 mInutes. Therefore, the Pro903Ser
mutant plasmids were 15 times more thermolabile or unstable
than control with MB. These mutant A-R complexes were ~lso
thermolabile with MT and the complexes were lost at a faster
rate than MB. Thus, thlS mutatIon causes thermo1abi1ity of
the complexes in GSF and COS-l cells.
When COS-l cells were transfected wlth the Leu820Val
mutant plasmid, the complexes formed were thermolabi le at
42°C, as seen also ln the GSFs of the patIent 16588. The
mutant complexes lost 50% of their activity in 150 minutes,
whereas the control complexes lost 50% of the activity ln
900 minutes (Fig. 23b). Therefore, the Leu820Val mutant
complexes were 6 times more thermolabIle than control. The
loss of activlty was slower than that seen in the Pr0903Ser
mu ta t ion under the same cond i t ions. The abnorma 1 therma 1
65
behavlour of the complexes seen in GSF was repeated ln the
transfected COS-l cells. This proved the pathogenicity of
this mutation.
When COS-l cells were transfected with the Ile663Asn
mutant AR, the complexes were as thermostable as the control
AR at 42°C with 3H-MB (Fig. 23a).
When the unliganded receptors were exposed to 42°C for
30 min or l h then labe1led with 3H-MB at 37°C in the
presence of 100 ~M cycloheximide, the complexes formed were
as thermostable as control (Fig. 24). Therefore, the
unligdnded receptors were not thermolabile but the liganded
ones were. This phenomenon has been reported by Gottlieb et
al., (1987) in GSFs from 1609 as mentioned above. Thus the
receptors appeared to be in two different states depending
on presence or absence of hormone.
4.2.2 Nonequilibrium dissociation rates:
The nonequilibrium dissociation rate constant (k,
min- 1 ) is a measure of how fast A-R complexes dissociate
inside the cells. Table 3 displays the mean k values
obtained in GSFs and COS-l cel1s transfected with the three
mutant hARs. For 1609/6003 (Pro903Ser) it was clear that
the A-R complexes had higher (2-to-4 fo1d) dissociation
rates than control, with aIl ligands. The k values in COS-l
ce1ls were not identical ta the ones from GSF (control or
mutant) probably because the internal milieu of the two cell
types is different. However, as in GSF, the COS-l system
revealed mutant rates of dissociation higher than control.
Figure 25 is a representative dissociation assay in
66
Fig. 23: Thermolability of complexes in transfected COS-l
cells. 1 ~g of control, Ile663Asn (a), Leu820Val,
(b), and Pro903Ser (c) plasmids were used. 48 h
after transfection, the cells were labelled at 37°C
with 3 nM 3H MB for 2 h in the presence of 100 ~M
cycloheximide. Then, they were shifted ta 42°C for
a to 6 h. The ce11s were assayed for the remaining
MB-binding activity at 0, l, 2, 4, ana 6h. The
remaining binding activity was plotted semi-loga
rithmlcal1y agalnst time (min.).
(a)
c conU'OI
• I1c663Asn
10 0 100 200 300 400
0.() C .-C
100 .-C': e QJ ... >. -.-~ .-- (b) ~ C': 0.() C ~ C
iii control .-.J:J. • • Leu820Val
== ~ 10
0 100 200 300 400
~
100
(c)
• control • Pro903Scr
o 100 200 300 400
Time (min)
67
Fig. 24: Thermolability of unliganded receptors in trans
fected COS-1 cells. 1 ~g of control, Leu820Val,
Pro903Ser, and Ile663Asn plasmids were used. 48 h
later, the cells were incubated at 42°C for 0 to 2
h in the presence of 100 ~M cycloheximide. Every
30 min., a group of cells was labelled at 37°C with
3H-MB for 30 min. The MB-binding activity was
plotted semi-logarithmlcally against time (min.).
100
el) c .-c .-œ S ~ s.. >. -.-.. . --tj œ el)
I!& control .5 "C • Leu820Val c :E • Pro903Ser 1
== :; • Ile663Asn ~
10 0 50 100 150
Time (min)
68
Fig. 25: Dissociation assays in COS-l cells transfected with
2 ~g of the Pro903Ser plasmid with MB and MT at
37°C. The binding activity was calculated as per
cent activity remaining and was plotted semiloga
rithmically against time (min.). The k values
(min"l) were: MB, 0.002 for control and 0.005 for
the mutant; and MT, 0.007 for control and 0.030 for
the mutant.
.... -
o 30
• control MB
• Pro903Scr MB
• control MT A Pro903Scr MT
60 90 120 150
Time (min.)
6<)
transfected COS-l cells. The cells were transfected with 2
~g of the Pr0903Ser mutant hAR, then labelled with MB or MT
at 37°C for 2 h. The medium was then replaced wlth
unlabelled androgen for different lengths of time. The
percent androgen-binding activity remaining WdS plotted
semi-Iogarithmically agalnst ~ime (min.). The specifie
basal activity after two hours of labelling was considered
100 percent. The log percent binding activity remaining at
different time intervals were used in a linear regression
analysis. The dissociation rate constants (k) were
determined directly from the slopes generated. In GSF the
control mean k values at 37°C for DHT and MT are: 0.006 ±
0.0012 ~n=15) for DHT, and 0.012 ± 0.03 for MT (n=26)
(Pinsky et al., 1985). The normal k value for testosterone
has been defined using 5<x-reductase deficlent cell-lines
( k = 0 . 0 2 4 min - 1) ( Ka u f ma n and Pin s k y 1 9 8 3 ) .
When the Leu820Val mutation was expressed in COS-l
cells, • the A-R complexes had 1.5-to-2 fold increase of
nonequ il i bd um d issoc i at i on rates over contr 0 1 (Table 3).
Figure 26 shows the dissociation profile of Leu820Val and
Ile663Asn complexes expressed in COS-1 cells with (a) MB at
42°C and (b) MT at 37°C. The abnor~al biochemical phenotype
of Leu820Val mutant hAR has been reproduced ln transfected
COS-l cells. This proved that the sequence alteration is
responsible for the abnormal behaviour of the complexes and
the clinical phenotype of the patient. The Ile663Asn
mutation showed normal dissociation rates with MB and MT as
seen in GSFs. The dissociation rates of Ile663Asn with DHT
were slightly higher than normal in COS-l cells and GSF
70
Table J: Mean nonequilibrium dissociation rate constants (k
in xlO- 3 min-1 ) were calculated along with the
standard deviations in dissociation assays. GSF
(from 605, 16588 and 1609/6003) and COS-l cells
(transfected with each of the 3 mutant hARs) were
labelled with MB, MT, DHT or T at 37°C and "chased"
either at 37°C or 42°C. n represents the number of
experiments. Dashes were used where the experiment
was not performed.
GSF
Mutant (n)
DUT 605 37°C 9 i3 ( 3 )
16588 11t4 ( 4 )
1609/6003 24±6 ( 2 )
MD 605 37°C 3±0.7 (2)
MT 37°C
T 37°C
1609/6003 1 4 ( 1 )
16588 12±0 (2)
1609/6003 30tO (2)
605 I2tO ( 2 )
16588 19 t7 ( 3 )
1609/6003 48t4 ( 2 )
16588 21±4 ( 2 )
(xlO- 3
Control (n)
6:t1.2 ( 15)
3±0.1 (15)
6±0.1 (15)
I2±2 (26)
23
COS-l min-l. )
Mutant (n) control (n)
Ile663Asn 6±1 ( 3 ) 5t! ( 3 )
Leu820Val 9±0.6 ( 3 ) 5t! ( 3 )
Pro903Ser 23±8 ( 3 ) 6 i3 ( 3 )
Ile663Asn 3 (1) 3 ( l )
Pro903Ser 7±2 (3) 3tO.6 (3)
11e663Asn 6 ±O . 8 ( 3 )
Leu820Val
7±0.7 (2)
11±0.2 (4) 7tO.5 (4)
Pro903Ser
11e663Asn 8.2 ( 1 ) 8.5 ( 1 )
Leu820Val 12.5±2 ( 2 ) 9 ±1 ( 2 )
Pro903Ser 31±4 ( 3 ) 7tO.6 (3)
Leu820Val 37 ( 1 ) 18 ( l )
71
Fig. 26: Dissociation assays in COS-l cells transfected with
2 ~g of the Leu820Val or Ile663Asn plasmids. The
cells were assayed at 42°C with MB and 37°C with
MT. k values (min-l.) were: (a) MB, 0.007 for
control, 0.007 for Ile663Asn, and 0.010 for
Leu820Vali (b) MT, 0.009 for control, 0.009 for
Ile663Asn, and 0.011 for Leu820Val.
100
>. ... .• , .• ... ~~ ~ C
o.c 'c (a) C'-.• ~
"0 e .S Q,I &J 1..
1
== a control ~ • Ilc663A~n ~ • Leu820Val
10 0 30 60 90 120 150
Time (min.)
100 >. -.;:; .--~~ '" C ~'c c·· .• ~ (h) ~S .:: Q,I .cl.. • li control E-~ • lIe663Asn ~ • Leu820VaI
10 0 30 60 90 120 150
Time (min.)
72
(Table 3).
4.2.3 Apparent equilibrium dissociation rate constants:
The apparent equilibrium dissOciation rate constants
(K.) (from Scatchard anal' .s) were used in order to
determine che affinity of the rèceptors ta androgens. GSF
or trans f ected COS-I ce Ils wer e labe lIed wi th di f ferent
concentrations of ligand at 37°C for 2 h in the presence of
100 ~M cyc l ohex imide. The ce Ils wer e then ass ayed for
binding activity. Table 4 displays the different mean K.
values with MB or MT in GSF and COS-l cells. GSF from 1609
and 6003 show increased K. values, a proof for lower affinity
or instabi li ty of complexes. These results have been
reproduced in COS-l cells transfected with 1 J.lg of the
Pro903Ser plasmide Figure 27a shows the Scatchard plots of
Pro903Ser with MB, and figure 28a with MT in COS-l cells.
The binding activities h~ve been corrected for transfection
eff icumcy. The K •• were computed from the slope of the
Scatchard plots, and the Bm.x (maximum binding capacity in
fmol/mg protein) was extrapolated from the intercept of the
line on the abscissa. The Brrax vdlues in COS-I cells
transfected with 1 J.lg of the Pro903Ser plasmid were normal
with MB, but apparently abnormal with MT. The normal K.
values in GSF (exposed ta hormone for 2 h) have been defined
by Pinsky et al., (1985): DHT, 0.22 ± 0.09 nM (26
experiments); and MT, 0.16 ± 0.08 nM (8 experiments). The
8m _ Je •• values were for DHT, 28 ± 8 fmol/mg protein (26
experiments); and for MT, 31 ± 12 fmol/mg protein (8
exper i ments ) .
13
Table 4: Mean apparent equilibrium dissociation rate
constants in GSF and transfected COS-l cells (K,)
expressed in nM. With COS-l cells, 1 ~g of
plasmids were used except where it is speclfled
(0.05 ~g). The experiments were conducted at 37°C
for 2h.
GSF COS-l nH
Mutant (n) Control (n) Mutant (n) Control (n)
MB 605 Jle663asn .01 to .30 (0.05~g) .49t6 ( 2 ) .19:t0.007 ( 2 )
16588 Leu820Val .16:t:4 ( 3 ) (0.05~g) .48t3 ( 2 ) .19±0.007 ( 2 )
(l~9 ) .60±l ( 3 ) .sO±.lO ( 3 )
1609 Pro903Ser .50 (1) .05 ( 1 ) (l~g) l.O±.30 (3) .30±.20 ( 3 )
6003 .70 (1) .10 ( 1 )
MT 605 Ile663Asn (O.Os~g) .50 ( 1 ) .30 (1)
16588 Leu820Val (O.OS~9) .60 ( 1 ) .30 ( 1 )
(l~g) .78±.l2 (3) .SO±.20 ( 3 )
1609 Pro903Ser (1~g) 1. S±. 50 ( 4 ) .70±.30 ( 4 )
74
Fig. 27: Scat chard analysis with 3H-MB (0.03-3 nM) at 37°C
in the presence of 100 J,lM cycloheximide for 2 h and
30 min. (a) l /lg of control (K.= 0.59 nM) and Pro
903Ser (K.=1.59 nH) plasmids were used. (b) 0.05
J.l.g of control (K.=.l9 nH), and Leu820Val (K.=0.51
nM) were used. In (c) 0.05 J.l.g of control (K.=0.18
nM), and Ile663Asn (K.=0.46 nM) were used. The
range of control K. values changed wi th the amount
of p lasmid used. The range 0 f contr a l K. va lues in
transfected COS-l cells was 0.4-0.7 nM with 1 J,lg
plasmid, and 0.18-0.34 nH with 0.05 j.lg.
MB 500
El control
400 • Pro903Ser
300
(3)
100
0 0 50 100 150 200 250 300
300 III control -.
\CI • Leu820Val '= .... il< 200 --~ ~ (b) '-'-- 100 ~ c: = Q
== 0
0 10 20 30 40 50 60
300 ....... --------------III control
• Ile663Asn
200
(c)
100
o+-~~~-~-,-~~~~~~ o 20 40 60 80
Bound (fmol/mg protein)
75
Fig. 28: Scatchard analysis us ing 3H MT (0.03-3 nH) at 37°C
for 2 h and 30 min. in the presence of 100 ~H
cyclohex imide. In (a) 1 )J.g of control (K.=O. 7 nH)
and Pro903Ser (K.=1. 6 nH) were used. In (b) 0.05
~g of control (K.=0.34 nH), Leu820Val (Kd:0.59 nM),
and Ile663Asn (K.=O. 52 nH) were used.
MT 500
iii control
400 • Pro903Ser
300
(a) 200 --"b 100 ....c
~ --~ 0 ~ 0 SO 100 ISO 200 250 300 L.
'-~ = = Q
100 = m m control
80 • Leu820Vai
, Ile663Asn
60 (b)
40
20
0 0 10 20 30 40 50 60
Round (fmol/mg protein)
----------------------
76
When GSF from 16588 were assayed in a Scatchard
analys is, the mean K. value was in the normal range w i th ME
(K.=0.16 nM) (Table 4). When COS-1 cells were transfected
with 0.05 J.lg or l).1g of the Leu820Val plasmid, the Kd values
were higher than normal. Figure 27b shows a Scatchard plot
with MS and figure 28b with MT. There was a difEerence in
the K. values when di ff er ent amounts of p lasmids wer e
transfected. With 0.05 ).Ig, the d ifference between control
and mutant K .. was larger than the difference seen with 1 ).lg
( in each exper i ment) .
Figure 27 c shows a Scatchard plot using 0.05 J.lg of the
Ile663Asn hAR with MB. The K. values were higher than
normal. The values wer e cor rected for tran.:; fect i on
efficiency and the Bm .... was h1.gher than control. The K.
values were aiso higher with MT (Table 4) (Fig. 28b).
5. Transacti vat ion assays:
COS-I celis were cotransfected with 5 to 10 ).Ig of
mutant or control plasmids, 5 to 10 J.lg of the reporter
pl asmid pMMTV-GH, and 3 to 4 ).Ig 0 f the pCHV- Ogal. plasmi d .
48 hours later, different concentrations of HB (0.03 to 10
nM) were added. GH activity was measured 48 hours after
addition of ligand. Figure 29 shows the profile of
transcriptional activation of GH by the three mutant A-R
complexes. GH acti vi ty (cpm//lg pr ote in) was pl otted aga i ns t
MB concentration (0.12 to 3.34 nM). They were both
cor rected for trans fect ion ef f i ciency. The P r 090 39 er
mutation shows a decreased leve 1 of GH express ion. The
complexes were unstable upon prolonged exposure to ligand.
77
Fig. 29: Cotransfection assay measuring the transactivation
profile of the three mutants compared to control.
COS-l cells were cotransfected with 7 ~g of con
trol, an~ mutant (Leu820Val, Pro903Ser, and Ile663
Asn) hAR expression p1asmids, and 7 ~g of the
pHHTV-GH reporter plas mid . 48 h later the ce 115
were labelled with 0.12 to 3.34 nH 3H HB for 2 h
and 48 h. Another group of cells was labelled for
2 h (between the 94th and 96th hour after transfec
tion) (see diagram, page 78). The media from
the 48 h group was assayed for GH activity. This
was corrected for transfection efficiency and
plotted as cprn/~g prote in against concentrations of
MB (nM).
78
The samples for GH activlty were taken 48 hours after
addition of ligand; by that time, the complexes lost 75~ of
the activity seen at 2 h incubatlon wlth Ho (48-50 h group)
(Fig. 30b). Figure 30 shows the androg~n-binding activity
in three different intervals: 2 h (48-50 h), 48 h, and 2 h
(94-96 h). The following diagram shows the dlfferent groups
of cells assayed in figure 30 considering cotransfection as
o t ime.
Cotransfection 48h
2h 2h
o 48-S0h 94·96h
The binding activity in Pro903Ser was restored to the
initial 2-h binding activity levels when the cells were
incubated for 96 h (post transfection) without hormone,
followed by 2 h incubation with MB. This group was used ta
show that the drop in activity at 48 h was not due to 1055
of plasmid but rather to the instabi lit y of the complexes
when exposed to hormone for 48 h or more. 1 n f igur e 31, the
Pro903Ser mutation shows normal transactivation per unit
complexes.
In figure 29 the GH activity with Pr0903Ser increased
wi th the HB concentrat ions at a s lower rate than normal, and
d id not reach satur at ion. In higher concentrations of MB
the instability problem was alleviated ta a certain point
probably because of the avallibil1ty of a large
concentration of hormone.
In figure 29, the Leu820Val mutation had lower GH
activity than control at all concentrations of MB and the
100
>. - 80 Il ,-;. ._-tic ('Q'Qj - 60 :c= ca Il control "C~ ~::l 40 • Leu820Val ~Ê ('QQ.
• Pro903Ser S~ ... 20 0 Z • Ile663Asn
0 a 1 2 3 4
[MB] nM
79
Fig. 30: Androgen-binding activity in cotransfected COS-l
cells (F:g. 29) during three intervals: 2-h
interval (48-50 h post transfection); 48-h interval
(48 h post transfection); and a 2-h interval (94-96
h post transfection) (refer to diagram, page 78).
(a) Ile663Asn, (b) Pro903Ser, and (c) leu820Val.
The MB-binding activity (fmol/mg protein) was
plotted against different concentrations of MB (nH)
and corrected for transfection efficiency.
2000 • control 2h (48·50h)
• control48h
• control 2h (94-96h)
1500
1000 (a)
500 ~ Ile663Asn 2h (48-50) ~
0 IIe663Asn 48h .... . -> m IIe663Asn 2h (94-96h) .- 0 ..... C.J ~ 3.34 1.72 0.85 0.45 0.22 0.12
01) C ._- 2000 ':Oc C·-.- ~ ~ ....
1 ~ 1500 ~ '-Cc. ~OI)
~ e 1000 (b) ---~-~~ .- e S~
500 -- f:?l Pro903Ser 2h (48-50h) "'C ~ 0 Pro903Ser 48h N .-- C3 Pro903Ser 2h (94-96h) ~ 0 e 3.34 172 0.85 0.45 0.22 0.12 '-~ Z
2000
1500
1000 (c)
500 ~ Leu820Val 2h (48-50h)
0 Leu820Val 48h
0 ~ Leu820Vai 2h (94-96h)
3.34 1 72 085 0.45 0.22 012
[MB] nM
curve was slightly shifted to the right.
was seen in 5 exper iments out of 8.
performed, the tLansactivation seen
80
Thls type of curve
In aIl the assays
by the Leu820Vai
complexes was always higher than the one seen with
Pro903Ser. In figure 30c thE:: complexes weLe stable wlth
prolonged incubation with hormone (48 hl. The proof for
this was by comparing the binding actlvity between the 48-h
group and the 94 to 96-h group. At one concentration (3
nH), the binding activity at 48 h was higher than the one dt
94-96 h thus showing sorne instability at this concentration.
When the OH activity was plotted against HB-bindlng dctivity
(Fig. 31), the transactivation per unit complex was
intermed iate between that of control and Pro903Ser (3 out of
8 experiments). In one assay, the cells were incubated with
HS for 96 h (fresh media added after 48 h) then medlum
samples were assayed for GH. The GH activity measured was
lower than control and the OH versus MB-binding activity
curve was shifted to the right. The complexes, however,
showed normal transactlvation when GH activity was plotted
against MB-binding activity (Fig. 31).
In figure 29, the Ile663Asn
transactivation in 5 out of 7
stability of the complexes (Fig.
muta t ion showed norma l
exper imen ts and norma l
30 a) • l n t wo cas es, the
transactivation was abnormal. This happened when the cells
were subjected to longer incubation with MB (as mentioned
ab ove for Leu820Val). The transactivation of GH was normal
per unit HB-binding ativity in aIl the experiments (FIg.
31) .
61
Fig. 31: GH activity plotted against MB-binding activity in
cotransfect ion assays from the 48 h group (see Fig.
29). This figure shows the transactivation profile
of control and mutant hARs (Ile663Asn, Leu820Val,
and Pr0903Ser) per unit complex.
~ .... .-~ .-.... (,J -~c: .-:C~ Co -'QQ.,
~~ .- :::l --~5 CQ., -eJ o-
;Z
- -----------------
, 00
80
60
40
m control 20 • Lcu820Vai • Pro903Scr ... IIc663Asn
0 a 500 1000 1500 2000 2500 3000
Normalized specifie MB-binding activity (fmol/mg protein)
82
6. Western blottinq:
Fresh lysates were prepared from GSF of 605, 16588, and
6003. The protein concentrations were measured. 325 ~g of
605, and 400 ~g of 16588 and 6003 were loaded on a
discontinuous SDS-po1yacrylamide gel. The amount of protein
in the 605 lane was less than 400 ~g because the sample was
more dilute than the other two. The gel was electroblotted
onto a nitrocellulose filter. The blot was blocked with TBS
and Tween 20 (0.5\) and incubated with the monoclonal
antibody F39.4.1 directed against a portion of the N
terminal domain of the hAR. After a series of washes, the
blot was incubated with the HRP goat anti-mouse immunoglobin
G. The blot was washed and incubated in the
chemiluminescence detection reagents and exposed to an X-ray
film for 1 h. Figure 32 shows one prominent band of
approximately 110 kDa in aIl the mutants: 605, 6003, and
16588 in lanes 2, 3, and 4 respectively. The protein marker
was also visible and the bands were 116 and 68 kD. The
background was high probably because: firstly, overexposure
(1 hl; secondly, there was sorne degradation of the hAR; and
thirdly, nonspecific binding to the antibody.
5. Bxon 1 amplification and sequencinq:
Parts of exon 1 from 605 and 1609 were amplified using
exonic primers. The PCR products were resolved on a 1\ low
me 1 t agarose. The fragments were exc ised and used for
sequencing. Polyg1utamine and polyglycine tracts in exon 1
were sequenced. In 605, the number of glutamines and
glycine5 fell in the normal range (22 for both). In 1609,
83
Fig. 32: Western blot using a monoclonal antibody directed
agalnst a portion of the N-terminus of the hAR.
Proteins were detected using a HRP goat anti-mouse
irnrnunoglobin G with a chemiluminescence detection
kit. GSFs from 605 (2), 6003 (3), and 16588 (3)
were lysed. Lane 2 contains 325 ~q protein, and
lanes 3 and 4 contain 400 ~g each. Lane 1 shows
the high molecular weight protein marker. A
prominent band was present at approximately 100 kO
in ail mutant lysates.
kD 1 2 3 4 kD
116-- - 1: a:--=U 68- ..... .:::.
84
the number of glutamines in the glutamlne tract was also in
the normal r~nge (27 glutamines).
85
IV DISCUSSION
Thr ee po i nt mutat i ons have been d iscovered in our
laboratory in three families affected with AIS. Sequencing
exons 2 to 8 of the hAR gene revealed: a T to A transversion
in exon 4 changing isoleucine to asparagine at position 663
in a patient coded 605; a C to G transversion in exon 7
replacing leucine by valine at position 820 in a patient
coàed ]6588; and a C to T transition in exon 8 replacing
proline by serine at position 903 in two siblings coded 1609
and 6U03.
1 was interested in proving the pathogenicity of the
mutations. To accomplish this goal, the mutations have been
reproduced by site-directed mutagenesis in an hAR expression
vector, which was then transfected into COS-l cells. The
resulting androgen-binding activities were measured in
k inet ic assays and compared to control. The COS-l cells
were used in these assays because they have negl igible
amounts of specifie endogenous androgen-binding activity (5
to 6 fmol/mg protein). Transfecting marnrnalian cells with
the mutant AR express ion vectors has been considered the
main approach to prove the causative Iole of mutations in
the development of AIS (French et al., 1990).
ln order to understand the impact of amino acid
substitutions on proteins we need to know the function of
each residue involved in the suL~titution. The following is
a short description of the different existing side chains in
the twenty amine acids. They vary in size, shape, charge,
hydrogen-bonding capacity, and chemical reactivity. They
86
can be grouped as follows: a) nonpolar (alanine, valine,
leucine, isoleucine, proline, phenylalanine, methionine and
tryptophan); b) uncharged polar (glycine, asparagine,
glutamine, cysteine, serine, threonine, and tyrosine) i c)
acidic (aspartic acid and glutamic acid)i and d) basic
(lysine, arginine, and histidine) (Alberts et al., 1983).
The three-dimensional structure of a protein is specified by
its amine acid sequence and the steric relationship among
non-ad j acent ami no ac ids in the sequence. In order f or a
protein to function properly, its conformation must be
intact (Stryer 1988b). In the Pr0103Ser mutation, proline
is replaced by a serine at position 903 in the hAR. This 1s
a major change since proline has a nonpolar, cyclic side
chain and sel' ine has an uncharged polar, hydroxyl one.
Thus, the two amino acids have different chemical
propert i es. The unexpected pl' esence of a ser i ne in that
position might have created a site for phosphorylation. It
has been observed that GR was phosphorylated in human breast
epithelial cells (Rao and Fox 1987). Thf~ phosphorylated
amine acids were phosphoserine (89%) and phosphotyrosine
(11\). However, 90\ of phosphorylation sites of the AR
were located in its N-terminal domain (Kuiper et al., 1993).
This has been also observed for the GR (Hoeck and Groner
1990) and PR (Chauchereau et al., 1991).
The Pro903Ser mutation in COS-l cells produced A-P
complexes with a high degree of instabilitYi an increased
nonequilibrium rate of dissociation; an increased apparent
equilibrium dissociation rate constant (lower affinitY)i
increased thermolability; and defective transactivation
87
mainly because of the instability of complexes. Reproduclng
an abnormal behaviour of complexes in COS-1 ce11s proved the
pathogenicity of the Pr0903Ser mutation. Moreover, the the
kinetics of this mutant A-R in COS-l cells were comparable
to those seen in GSF. The fact that the unI iganded mutant
receptor was thermostable, whi1e a mutant A-R comp1ex was
unstable shows that the receptor might be in two different
physicai states: liganded or un1iganded. SRs are known to
behave di f ferent 1 y in the pr esence and absence of the i r
ligands (Woos1ey and Muldon 1979).
The Pro903Ser mutation site is at the most C-terminal
position found so far in the HBD of the hAR. Recently,
another mutation at the same codon (903) has been described
by McPhau1 et al., (1992).
in a patient with CArS
androgen-binding activity.
It changes proline ta histidine
and the hAR has unmeasurable
Histidine has a basic side
chain. This replacement seems to be more detrimental to the
receptor since it loses androqen-binding activity. The
praline-serine alteration affects the receptor qualitatively
whereas the proline-histidine change affects it
quantitatively and qualitativeIy.
The Pro903Ser mutation is 15 amine acids away from the
C-terminal end of the recepror. It is important for ligand
binding. Deletion of 12 amino acids from the C-terminal end
of the hAR abolished hormone-binding [(as mentioned earlier
Jenster at al., (1991)]. It probably affects the three
dimensional structure of the receptor making it highly
unstable when bound to hormone.
A study on the PR by Baniahmad and Tsai (1993) proved
88
the importance of the C-terminal tail of the receptor. They
were interested in studying the effect of the PR and GR
antagonist RU486 on the conformation of the PR. The PR was
translated in vi tro and bound to hormone or RU486. The
complexes were then subjected to limited proteolytic
digestion. A 30 kD protease resistant band was produced
from the hormone-bound PRs, whereas a 27 kD band was
produced from the RU486-bound PRs (Allan at al., 1992). It
has been shawn that SR-antihormone complexes bind HREs
(Bagchi et al., 1988; Guichon-Mantel et al., 1988) but are
unable to transact i vate reporter genes. Therefore the
antagonist induces a different conformation on the receptor
than the one imposed by the hormone. They
immunoprecipitated the receptors after limited protease
digestions. The antibody used was raised against the last
14 C-terminal amine acids of the receptor. It recognized
the 30 kD band but not the 27 kD band. Hormone additlon to
the full length receptor prevented the recognition of the
complexes by the antibody, whereas the RU486 induced
recognition. Therefore, it was concluded that the
antagonist confers on the receptor such a conformation that
the C-terminus is accessible to the antibody and the
proteases. When 42 amine acids were deleted from the C
terminus, hormone-binding was abolished, whereas RU486-
binding was possible. From these data, Baniahmad and Tsal
(1993) proposed the following model for SRs. In the absence
of hormone the C-termi na l ta il i nh 1 bi ts i ntr 1 ns lc
transactivation and DNA-binding activities [(also seen ln AR
deletion studies by Jem:;ter et al., (1991»). Hormone-
89
binding induces DNA-binding and transactivation by relieving
the repressian. RU486 allows DNA-binding but blocks
transactivation, because of the conforrnational changes
induced (Fig. 33).
Leucine at position 820 is present in a highly
conserved region among the rnembers of the GR subfamily (Fig.
10, re~ion III). Although leucine and valine belong ta the
same group of nonpolar amino acids, the presence of valine
at position 820 is not tolerated in the hAR. In the highly
conserved regions, a position occupied by leucine in one
member of the GR subfamily can be occupied by valine in
another member. Two examples of this are seen at position
589 in the hGR and the corresponding position (729) in the
hAR, and position 595 in the hGR and 735 in the hAR (Fig.
10) .
The GSFs from 16588 (Leu820Val) had: a normal androgen
binding activitYi normal apparent ~qui1ibrium dissociation
rates; increased nonequilibrium dissociation ratesi and
increased thermolability. AlI the above mentioned
properties of the Leu820Vai receptor are less severe than
those of the Pro903Ser mutant receptor. This correlates
with the degree of severity of their clinical phenotype.
The Pro903Ser mutation was found in two siblings with CArS,
and the Leu820Vai mutation in a family with PAIS. Saunders
et al., (1992) reported a G-to-T substitution causing a
valine-to-leucine alteration in the HBD of the hAR at
position 865. This mutation was found in two unre1ated
individuals with PAIS. It was also reported by Kazemi
Esfarjani et al., (1993). This position is found in a
N _t.l..----..,~NA: t c
1-
H.".o •• (Hl !
Fig. 33: Model for interactions of PR with hormone and anti-
hormone. In the unliganded form, the receptor 1s
repressed from DNA-binding and transactivation due
to the C-terminal taïl. The binding of the hormone
to the HBD changes the conformation of the receptor
thus relieving the repression. Anti-hormone binds
the HBD and induces a different structural change.
In this case DNA-binding is allowed but not the
intr ins ic transact i vat ion ipdicated as "TAF". Black
arrows indicate the putative protease cleavage
sites. Open arrows indlcate addltional putative
protease digestion sites in the unliganded receptor.
---~--~-
90
1
region lmportant for dlmerization, and va11ne is believed to
play a key role. Our mutation is a change of leucine to
valine and aiso occurs in a famiIy with PAIS. The authors
(Saunders et al., 1992) linked the change in charge and size
of amino acids to the c1inical phenotype and noted that a
conservative substitution often occurs in PAIS patients,
whereas a change in charge and size occurs in CAlS patients.
The abnormal biochemical phenotype of the Leu820Vai hAR
was reproduced ln transfected COS-1 cells. In this system,
the mutant hAR had: normal androgen-binding activitYi
increased nonequilibrium dissociation rates; and increased
thermolability. The apparent equilibrium dissociation rate
constants were increased in COS-'. cells, whereas in GSF
(16588) they were normal. This finding was not conclusive
s ince Scatchard analyses are based on saturat ion curves.
The level of hAR in normal GSF i5 lower than the one in
transfected COS-l cells, since these are known to
overex~ress proteins in transfections. Because of the
overexpression, the ratio receptor:hormone is lower in COS-l
cells. This can affect the Scatchard plot and the affinity
of the receptor 1s modified. Saturation of hARs with
hormone in GSFs is weIl documented and the normal K. values
are known.
Transactivation assays with Leu820Val showed lower GH
activityat aIl MB-concentrations (Fig. 29). GH activity
levels reached saturation at a slightly higher MB-
concentration than normal, showing a slight abnormality in
transactivation. However, the intrinsic transactivation per
unit A-R complex was near normal (Fig. 31) (3 out of 8
91
experiments) as lt was for aIL the mutants dlscusseJ ln thlS
study. The fact that the GH activity was slightly abnarmal
in 3 out 0 f 8 exper i ments when plot ted aga l nst andr agen
binding activity, strongly suggests that the intrinsic (pet
unit complex) transactivational activity competence WdS
normal or near norma 1. When i nstab il i ty 0 f camp l e xes was
seen at 48 h in tne binding assays, the CH transactivation
curves (GH versus MB-binding) were abnorma1. Thus,
instability of A-R complexes caused an abnormal
transactivation.
times.
This was triggered by longer incubation
Isoleucine at position 663 in the hAR is not conserved
among the members of the GR subfamily (Fig. 34). Isoleucine
i5 a nonpolar amino
polar one (Fig. 18).
ac id and aspar ag i ne i 5 an uncharged
The Ile663Asn mutant AR did not show
major biochemical abnormalities in COS-l cells. The
nonequilibrium dissociation rates were normal with MB and MT
and they were not significantly high with DHT. The apparent
equilibrium dissociation rate constants were abnormally
h igh. The complexes wer e as thermolab i le as cont r 0 1 and
transactivated CH normally. When the conditions for
indue lng i nstabi 1 i ty were presented, the complexes had a
slightly abnormal transactivatlon (1 experiment). Thus the
only abnormallty seen by Ile663Asn in COS-l cells WdS the K.
values. This alone, was not enough to convince me of its
pat h 0 9 e n ici t Y . As dis eus s e d for Le Ù 8 2 0 Val the K. val u e sin
CSF and COS-1 cells were not the same, probably, because of
the differences between the two cell lines in the nature or
quantity of receptor-associated factors.
92
Fig. 34: Amino acid sequence in the hinge region of hAR,
hGR, hPR, and hMR. hGR and hMR have been aligned
according to Arriza et al., (1987). hAR and hPR
(Misrahi et al., 1987) have been aligned with hMR.
Isoleucine at position 663 in the hAR is represen
ted in boldo Dots flll gaps for best alignment of
the oinge region, and colons for the putative N
terminal end of HBDs (Chang et al., 1988). Dashes
represent the HBD. Arrows point to the DBD and the
HBD. Amino acids were shown in sing1e-letter
format, they were: A (alanine); D (aspartic acid)i
E (glutamic acid); F (phenylalanine); G (glycine);
H (histidine); l (isoleucine); K (lysine); L (leu
cine); N (asparagine); P (proline); Q (glutamine);
R (arginine); S (serine); T (threonine)i V
(valine); y (tyrosine).
DDD ... 1 hAR.24T L G A R K L K K L G N L K L Q E E G ENS S •
hGR4nN L E A R K T K K K 1 K G 1 Q QAT TGV S Q •
hPR .3:JV L G G R K F K K F N K V R V V R A L 0 A V A L PoP
hHR ••• N L G A R K S K K L G K L K G 1 H E E a p a Q Q Q P P
hAR.47. . . . . . . . . . . . . · . T T S P T E E T
hGR510. . . . . · . E T S E N P G N
hPR •• o. . . . . . . · V G V P N E S Q
hHR.,aP P P P P Q S P E E G T T Y 1 A P A K E P S V N T A L
HBD
1 • hAR.55T Q K L T V S H 1 E G Y E C Q p 1 - - - -
hGR 51.K T 1 V P A T L P a L T P - - - -hPR ••• A L S Q R F T F S P G Q D 1 a L 1 P P - - - -
hHR724V P a L S T 1 S R A L T P S - - - -
93
Parts of exon 1 of 605 were sequenced to rule out
additiona1 mutatlons in this region. No mutations were
found and the length of the homopolymeric tracts was in the
normal range.
The po1yg1utamine tract in exon 1 from 1609 was
sequenced to rule out mutations in this region.
Exon 1 from 16588 was not sequenced due to technical
difficulties. Since the pathogenlcity of the two mutations
Leu820Val and Pr0903Ser was proven, 1 did not fee1 the
necess i ty to pursue the sequenc ing of exon 1 in these two
families.
The western blot in figure 32 shows that 605 has as
much hAR as the other two mutants (16588 and 6003) in GSFs.
Therefore, the deficiency in hormone-binding seen in the GSF
was probably due to the quality of the cells during the
assay and not due to the mutation.
Towards the end of this study, a mod i f ied
transactivation assay was developed in the laboratory hoping
to show small differences between control and mutant hARs.
The assay was modified to reduce the number of mutant or
control hAR formed in the transiently transfected COS-l
ce 115, on the assumpt ion that an excess number of mutant
Ile663Asn might conceal an intrinsic transactivational
defect. In these assays, the Ile663Asn mutant A-R complexes
showed normal transactivation (using the same reporter
construct) . These findings proved my results in the
original assays.
One way ta test the transact i vat i anal capac i ty of
l le66 3Asn hAR is to use RNA probes on na tur a Il y OCCU! ing
94
genes that are induced by androgen in GSF. Unfortunately,
these probes do not yet exist.
The three mutations have been reproctucp.d in a
baculovirus expression plasmid. This system offers high
expression of proteins in eukaryotic cells and allows
further characterization of the hAR. For example,
crystallography of the hAR can be achieved which will help
in identifying the amine acids involved in: hormone-binding;
hsp-90-binding; dimerization, and many other important
functions. By studying naturally occuring mutations in the
hAR from AIS individuals, we can have a detailed structure
function map of the of the hAR.
95
V CONCLUSION
The objectives of this study were to prove the
pathogenicity of the three mutations, to correlate phenotype
with genotype, and to delimit the N-terminal end of the HBD
l n h AR • The r e i s s t r 0 n 9 e v ide n cet 0 b e li e ve th a t a t le as t
two of the mutations are pathogenic (Pro903Ser and
Leu820Val). We based our observation on: 1) the fact that
both mutations occur in conserved regions among the members
of the GR subfamilYi and 2) the mutation cosegregates wi th
the AIS in both familles. There is also a correlation
between the more severe biochemical data of the hAR with the
severe cl inical phenotype of the Pro903Ser mutation in the
two CAlS siblings. The Leu820Val mutation present in a
family with a less severe clinical phenotype (PAIS) had an
hAR tha t bound hormone and t ransact i vated in a less severe ly
defective manner than the Pro903Ser hAR. The patient 605
wi th the Ile663Asn mutation was the only affected member of
the fami ly and we have no information about the mother' s
carr 1er state. The codon affected 1s not conserved among
the membp.rs of the GR subfamily. However, assuming that aIl
the cod i ng sequences of the hAR were sequenced, th is
mutation has not been found in any other individual tested,
whether control or patient. Over a hundred mutations in the
hAR associated with AIS have been discovered to date (Sultan
et al., 1993)]. Polyg1utamine and polyglyc ine tracts in
exon 1 were sequenced from 605 ta exclude any mutat ions in
those regions. The nun,ber of glutamines and glycines fell
in the normal range.
l was not successful in delimitting the N-terminal end
96
of the HBD since the pathogenicity of Ile663Asn was not
proven. There is a possibility that this mutation is a
subtle one and the tools that were used were not adequate to
show its abnormality. More specifie AREs, combined with a
different host for transfection would probably be helpful in
showing the abnorrnality of this mutation and prove its
pathogenic i ty.
97
VI REFERENCES
Adler, A.J., Scheller, A., Hoffman, Y. and RObins, D.M. (1991). Multiple components of a complex androgen-dependent enhancer. Mol. Endo. 5,1587-1596.
Adler, A.J., Scheller, A. and Robins, D.M. (1993). The str i ngency and magn i tude of androgen-spec i fic gene activation are combinatorial functions of receptor and nonreceptoI binding site sequences. Hol. Cell. Biol. 13,6326-6335.
Alberts, B., Bray, D., Lewis, J., Raff, M., Rober .... s, K. and Watson, J.O. (1983). Small molecules, eneL'JY, and biosynthesis. In: Holecular biologyof t:he cell. pp. 58-59. Gar land Pub 1 ish i ng l nc. New York and London.
Allan, G.F., Tsai, S.Y., Tsai, M.-J. and O'Malley, B.W. (1992). Ligand-dependent conformational changes in the progesterone receptor are necessary for events that follow DNA binding. PNAS 89,11750-11754.
Amero, S.A., Kretsinger, R.H., Moncrief, N.D., Yamamoto, K.R. and Pearson, W.R. (1992). The origin of nuclear Ieceptor prote i ns: a single precur SOI dis t inct from other transcription factors. Hol. Endo. 6,3-7.
Arriza, J.L., Weinberger, C., Cerelli, G., Glaser, T.M., Handelin, B.L., Housman, D.E. and Evans, R.H. (1987). Cloning of human mineralocort icoid receptoI complementary DNA: structural and functional kinship with the glucocorticoid receptor. Science 237,268-275.
Bagchi, M.K., Elliston, J.F., Tsai, S.Y., Edwards, D.P., Tsai, M.-J. and O'Mal1ey, B.W. (1988). Steroid hormone dependen tinter action 0 f human pr ogester one receptor wi th its target enhancer e1ement. Hol. Endo. 2,1221-1229.
Baniahmad, A. and Tsai, M.J. (1993). Mechanisms of transcriptional activation by steroid hormone receptors. J. Cel1- Biochem. 51,151-156.
Beato, M. (1991). Transcriptiona1 control by nuclear receptors. FASEB J. 5,2044-2951.
Behr, H. and Loos, U. (1992). Thr) in the hinge region hormone receptor gene in thyroid hormone resistance.
A point mutation (J...la 229 to of the c-erbA beta thyroid
a farnily wi th general i zed Hol. Endo. 6,1119-1126.
Brink, M., Humble, B.M., De K1oet, E.R. and van Driel, R. (1992) . The unl iganded glucocort ico id receptor i5 localized in the nucleus, not in the cytoplasm. Endocrinology. 130,3575-3581.
98
Br i n k ma n n , A . 0 ., Fa ber, P. W ., van R 0 0 i j, H. C . J ., K u i p e r , G.G.J.H., Ris, C., Klaassen, P., van der Korput, J.A.G.H., van Laar, J.H., Mulder, E. and Trapman, J. ( 1989) . The human androgen reee pt or : doma in, s tr uc t ur e, genomic organisation and regulation of expression. J. Steroid Biochem. 34,307-310.
Br i n k ma n n , A • 0 ., Je n 5 ter, G., Ku l p e r, G. G • J . M ., Ris, C., van Laar, J.H., van der Korput, J.A.G.M., Degenhart, H.J., Trifiro, H.A., Pinsky, L., Romalo, G., Schweikert, H.U., Veldseholte, J., Mu1der, E. and Trapman, J. (1992). The human androge n reeeptor: st ruct ur e- funet ion r e lati onsh i p in normal and pathological situations. J. Steroid Biochem. Mol. Biol. 41,361-368.
Br 0 wn, C. J ., Go S s, S. J ., Lu bah n,O. B ., J 0 sep h, D. R ., W ils 0 n , E.M., French, F.S. and Wi1lard, H.F. (1989). Androgen reeeptor locus nn the human X chromosome: regional loealization to Xql1-12 and description of a DNA polymorphisme Am. J. Hum. Genet. 44,264-269.
Carson-Jur:ica, M.A., Schrader, W.T. and O'Malley, B.W. ( 1990). Ster 0 id receptor f amily: str ueture and funct ion. Endo. Rev. 11,201-220.
Chang, C., Kokontis, J. and Liao, S. (1988). structural ana1ys i s of complementary ONA and ami no ae id sequences 0 f hurnan and rat androgen receptors. PNAS. 85,7211-7215.
Chauchereau, A., Loosfelt, H. and Hi 19rom, E. (1991). Phosphory1at ion of transfected wild type and mutated progesterone receptor. J. Biol. Chem. 266,18280-18286.
Denis, M. and Gustafsson, J.A. (1989). The Mr = 90000 heat shock protein: an important modulator of ligand and DNAbinding properties of the glucocorticoid reeeptor. Cancer Res. (SuppL): 49,22755-22815.
Diamond, M.L, Miner, J.N., Yoshinaga, S.K. and Yamamoto, K.R. (1990). Transcription factor interactions: selectors of positive or negatie regulatlon from a single DHA element. Science 249,1266-1272.
Evans, R.M. (1988). The steroid and thyroid hormone reeeptor superfarnily. Science 240,889-895.
Fa ber 1 P. W ., van R 0 0 i j, H. C • J ., Sc h i pp e r, H. J ., 8 r i n k ma n n , A.O. a.nd Trapman, J. (1993). Two different, overlapping pathways of transcription initiation are active on the TATA-less hUffian androgen r:eceptor promoter:. The role of Spl. J. Biol.Chem. 268,9296-9301.
Fawell, S.E., Lees, J.A., White, R. and Parker, M.G. (1990). Characterization and coloea1ization of steroid binding and dimerization actlvities in the rnouse estrogen
99
receptor. Cell 60,953-962.
French, F.S, Lubahn, D.B., Brown, T.R., Simenta1, J.A., Quigley, C.A., Yarborough, W.G., Tan, J.A., Sar, M., Joseph, D.R., Evans, B.A., et al. (1990). Molecular basis of androgen insensitivity. Rec. Prog. Horm. Res. 46,1-38.
Giguère, V., Hol1enberg, S.M., Rosenfe1d, M.G., and Evans, R.M. (1986). Functional domains of the human glucocorticoid receptor. Cell 46,645-652.
Gortler, L., and Sturchio, J.L. (1992). Introduction to the International Symposium on the History of Steroid Chemistry, New York, August 27 and 28, 1991. Steroids 57,355-356.
Gottlieb, B., Kaufman, M., Pinsky, L., Leboeuf, G. and Sotos, J.F. (1987). Extracellu1ar correction of the androgen-receptor transformation defect in two families with complete androgen resistance. J. Steroid Biochem. 28,279-284.
Green, S. and Chambon, P. (1987). Oestradiol induction of agI ucocort ico id - respons ive gene by a chimaer ic receptor. Nature 325,75-78.
Greenberg, D., Hamerton, J., Nig1i, M. and Wrogemann, K. (1987). DNA studies in a fami1y with Duchenne muscu1ar dystrophy and a deletion at Xp21. Am. J. Hum. Genet. 41,128-137.
GuiochQn-Mantel, A., Loosfelt, H., Ragot, T., Bailly, A., Atger, M., Misrahi, M., Perricaudet, M. and Milgrom, E. (1988). Receptors bound to antiprogestin form abortive complexes with hormone responsive elements. Nature 336,695-698.
Hard, T., Kellenbach, E., Roelens, R., Ma1p~, B.A., Dahlman, K., Freedman, L.P., Carlstedt-Duck, J., Yamamoto, K.R., Gustaffson, J.A. and Kaptein, R. (1990). Solution structure of the glucocorticoid receptor DNA-binding domaine Science 249,157-159.
Higuchi, R. (1990). Recombinant PCR in: Innis, M.A., Gelfand, D.H., Sninsky, J.J, White, T.J. PCR protoco1s: a guide to methods and applications. Academie press, San Diego, 177-183.
Hoeck, W. and Gr oner, B. ( 1990) . Hormon~-dependent
phosphorylation of the glucocorticoid receptor occurs mainly in the amino -terminal transactivation domaine J. Biol. Chem. 265,5403-5408.
Ho11enberg, S.M., Giguère, V., Segui, P. and Evans, R.M.
100
(1987). Colocallzation of DNA-binding and tr anser i pt i onal act i vat i on funct i on5 in the human g1ucocorticoid receptor. Cell 49,39-46.
Hollenberg, S.M., Giguère, V. and Evans, R.M. (1989). Identification of two regions of the human glucocorticoid :r ecepto:r hormone b i nd i ng domai n that block act i vat ion. Cancer Res. (Suppl): 49,22925-22945.
Hughes, I.A. and Pinsky, L. (1989). Sexual Differentlation. In: Pediatrie Endoeclnology. (eds. R. Co1lu, J.R. Ducharme, and H.J. Guyda). pp. 251-293. Raven press, N.Y.
Jan ne, O. A., Pal v i mo, J. J . , Ka lli 0 , P . and Me h t 0, M. (1 9 9 3 ) . Androgen receptor and mechanism of androgen actIon. Ann. Med. 25,83-89.
Jenster, G., van der Korput, H.A.G.H., van Vroonhoven, Cor, van der Kwast, T.H., Trapman, J. and Brinkmann, A.O. (1991). Domains of the human and:rogen receptor involved in steroid binding, transcriptional activat1on, and subce11ular 1ocalization. Hol. Endo. 5,1396-1404.
Kalderon, D., Richardson, W.D., Markham, A.F. and Smith, A.E. (1984). Sequence requirements for nuclear location of simian virus 40 large-T antigen. Nature 311,33-38.
Kasumi, H., Komori, S., Yamasaki, N., 1 s 0 ji ma , S. (l 9 9 3 ) • Sin 9 1 e nu c 1 e 0 t ide the androgen recepto:r gene in a case positive androgen insensitivity syndrome Acta Endo. 128,355-360.
Shima, H. and substitution of wi th r eceptor
(complete form).
Kaufman, M., Pinsky, L., Bowin, A. and Au, M.W.S. (1984). Familial externa1 genital ambiguity due to a transformation defect of androgen receptor complexes that is expressed with 5a1pha-dihyd:rotestosterone and the synthetic androgen methy1trieno1one. Am. J. Med. Genet. 18,493-507.
Kaufman, M. and Pinsky, L. (1983). The dissociation of testosterone- and 5a-dihydrotestosterone-receptor complexes formed wi thin cul tur ed human geni tal sk in fibrob1asts. J. Stecoid Bioehem. 18,121-125.
Kaufman, M. and Pinsky, L. (1989). A single-site allosteric model of intracellu1ar androgen-receptor interaction. J. Steroid Biochem. 32,113-119. -
Kazemi-Esfarjani, P., Beitel, L.K., Trifiro, M., Kaufman, M., Pinsky, L., Rennie, P., Sheppard, P. and Matusik, R. (1993). Substitution of valine 865 by methlonlne or leucine in the human androgen receptor causes complete or partial androgen insensitlvlty, respectively wlth distinct androgen receptor phenotypes. Mol. Endo. 7,37-
101
46.
Kovacs, W.J, Griffin, J.E. and Wilson, J.O. (1986). Androgen Resistance in Man. In: Steroid Hormone Resistance: Hechanism and Clinica1 Aspects. Adv. Exp. Med. Biol. v.196, leds. G.P. Chrousos, D.L. Loriaux, and M.B. LipsE'tt). p. 258. Plenum press, New York and London.
Krozowski, Z.S., Rund1e, S.E., Wallace, C., CasteIl, M.J., Shen, J.H., Funder, J.W. and Smith, A.!. (1989). Immunolocalization of renal mineralocorticoid receptors wi th an ant i serum aga i nst a pept ide deduced from the complementary deoxyribonucleic acid sequence. Endocrinology. 125,192-198.
Landridge, J., Lanùridge, Extraction of nucleic 8iochem. 103,264-271.
P. and Berguist, P.L. (1979). acids from agarose gels. Anal.
La Spada, A., wilson, E., Lubahn, D., Harding, A. and F ischbeck, K. (1991). Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature 352,77-79.
Laudet, V., Hanni, C., Coll, J., Catzaflis, F. and Stehelin, D. (1992). E:volution of the nuclear receptor gene superfamily. EMBO. J. Il,1003-1013.
Lobaccaro, J.M., Lumbroso, S., Belon, C., Galtier-Dereure, F., Bringer, J., Lesimp1e, T., Heron, J.F., Pujol, H. and Sultan, C. (1993). Male breast cancer and the androgen receptor gene. Nature 5,109-110.
Lowry, O.H., Rosebrough, N., Farr, A., Randall, R. (1951). prote in determination with the fol in phenol reagent. J. 8i~J. Chem. 193,265-275.
Luisi, B.F., Xu, W.X., Otwinowski, Z., Freedman, L.P., Yamamoto, K.R. and Sigler, P.S. (1991). Crystallographic analysis of the interaction of the glucocorticoid receptor with DNA. Nature 352,497-505.
MacLean, H.E., Chu, S., Warne, G.L. and Zajac, J.O. (1993). Related 1 nd i v idua 15 wi th di f ferent androgen receptor gene deletions. J. Clin. Invest. 91,1123-1128.
McPhaul, M.J., Marcelli, M., Tilley, W.D., Griffin, J.E., Isidro-Gutierrez, R.F. and Wilson, J.O. (1991). Molecular basis of androgen resistance in a family with a qualitative abnormality of the androgen receptor and responsive to high-dose androgen therapy. J. Clin. Invest. 87,1413-1421.
McPhaul, M.J., Marcelli, M., Zoppi, S. Wilson, C.M., Griffin, J.E. and Wilson, J.O. (1992). Mutations in the
l1gand-bind ing cluster in two 90,2097-2101.
doma in of the andr ogen regions of the gene. J.
102
receptor gene Clin. Invest.
McPhaul, M.J., Marcelli, M., Zoppi, S., Griffin, J.E. and Wilson, J.O. (1993). Genetie basis of endocrine disease 4 the spectrum of mutations in the androgen receptor gene that causes androgen resistance. J. Clin. Endo. Hetabol. 76,17-23.
Misrahi, M., atger, M., d'Auriol, L., Loosfelt, H., Meriel, C., Frid1ansky, F., Guiochon-Mantel, A., Galibert, F. and Mi1<Jrom, E. (1987). Complete amine acid sequence of the human progesterone receptor deduced from cloned cDNA. Biochem. Biophys. Res. Commun. 143,740-748.
Mitchell, P.J. and THan, R. (1989). Transcriptional regulation in mammalian cells by sequence-speci fic DNA binding proteins. Science 245,371-378.
Notides, A.C. and Nielsen, S. (1974). The molecular mechanism of the in vitro 4S to 6S transformÇltion of the uterine estrogen receptor. J. Biol. Chem. 249,1866-1973.
Palvimo, J.J., Kallio, P.J., Ikonen, T., Mehto, M. and Janne, D.A. (1993). Dominant negative regulation of trans -acti vation by the rat androgen receptor: role of the N-terminal domain and heterodimer formation. Hol. End 0 • 7, 13 9 9 -1 407 .
Pearce, D. and Yamamoto, K.R. (1993). Mineralocorticoid and glucocorticoid receptor activities distinguished by nonreceptor factors at a compos i te response element. Science 259,1161-1165.
Picard, D. and Yamamoto, K.R. (1987). Two signa1s mediate hormone-dependent nuclear local izat ion of the glucocorticoid receptor. EMBO J. 6,3333-3340.
Pinsky, L" Kaufman, M. and Chudley, A.E. (1985). Reduced affinity of the androgen receptor for 5<1-dlhydrotestosterone but not methy1tr ienolone ln a form of partial androgen resistance. J. Clin. Invest. 75,1291-1296.
Pinsky, L., Triflro, M., Kaufman, M., Beitel, A., Kazemi-Esfarjani, P., Sabbaghian, N., Alvarado, C., Vasiliou, M., Gottlieb, Androgen resistance due ta mutation of receptor, Clin. Invest. Med. 15,456-472.
L.K., Mhatre, Lurnbcoso, R.,
B., (1992). the androgen
Pratt, w.e" Jolly, D.J., Pratt, D.V., Hollenbecg, S.M., Giguere, V., Cadepond, F.M., Schweizer-Groyer, G., Catelli, M.G., Evans, R.M. and Baulieu, €.E. (1988). A region in the steroid binding domain determines formation
103
of the non DNA-binding 9S glucocorticoid receptor complexa J. B101. Chem. 263,267-273.
Pratt, W.B., Scherrer, L.C., Hutchison, K.A. and Dalman, F.C. (1992). A mode1 of glucocorticoid receptor unfolding and stabillzation by a heat shock protein complexa J. Steroid Biochem. Hol. Biol. 41,223-229.
Prior, L., Bordet, S., Trifiro, M.A., Mhatre, A., Kaufman, M., Pinsky, L., Wrogemann, K., Be1sham, 0.0, Pereira, F., Greenberg, C., Trapman, J., 8rinkmann, A.O., Chang, C. and Liao, S. (1992). Replacement of arginine 773 by cysteine or histidine in the human androgen receptar causes comp lete androgen i nsens i t i vi ty wi th di Uer ent receptor phenotypes. Am. J. Hum. Genet. 51,143-155.
Ptashne, M. and Gann, A.A.lo'. (1990). targets. Nature 346,329-331.
Activators and
Rao, K. V . S. and Fox, C. F . (1 9 8 7 ). Epi der ma l gr a wt h fa c t 0 r stimulates tyrosine phosphorylation of human glucocorticoid receptor in cultured cells. Biochem. Biophys. Res. Commun. 144,512-519.
Rennie, P.S., Bruchovsky, N., Leco, K.J., Sheppard, P.C., McQueen, S.A., Cheng, H., Snock, R., Hamel, A., Bock, M.E., MacDonald, 8.S., Nickel, B.E., Chang, C., Lia, S., Cattini, P.A. and Hatusik, R.J. (1993). Characterization of twa cis-acting DNA elements involved in the androgen regulation of the prabasin gene. Hol. Endo. 7,23-36.
Rhodes, D. and Klug, A. (1993). Zinc Fingers they play a key part in regulating the activity of genes in many spec i es, fr om yeast ta humans. Fewer than 10 years ago na 0 n e k n e w the y ex i ste d • Sc. Am. 5 6 - 6 5 •
Roche, P.J., Hoare, S.A. and Parker, consensus DNA-b i nd i ng 5 i te for the Hal. Endo. 6,2229-2235.
M.G. (1992). A androgen receptor.
Sambrook, J., Fritsch, E.F., Maniatis, T. (1989a). In: Holeculac Cl oning: a Laboratory Manual. 2nd edi tion (ed. C. No1en) pp. 1.25-1.28, Cold Spring Harbor 1aboratory press. Cold Spr i ng Harbor, USA.
Sambrook, J., Fritsch, E.F., Haniatis, T. (1989b) Ibid. p. 1. 68.
Sambrook, J., Fritsch, E.F., Maniatis, T. (1989c). Ibid. p. 1.82.
Sambraok, J., Fritsch, E.F., Maniatis, T. (1989d). Ibid. p. 16.66.
Sambrook, J., Fritsch, E.F., Maniatis, T. (198ge). Ibid.
104
pp.18.47-18.54.
Sambrook, J., Fritsch, E.F., Maniatis, T. (1989f). rbid. pp.18.60-18.66.
Saunders, P.T.K., Padayachi, T., Tincello, D.g., Shalet, S.H. and Wu, C.W. (1992). Point mutations detected in the androgen receptor gene of thrce men w1th partial androgen insensitivity syndrome. Clin. Endo. 37,214-220.
Sinclair, A., Berta, P., Palmer, M., Hawl<ins, J., Grlffiths, B., Smith, M., Foster, J., Frischauf, A., Lovell-Badge, R. and Goodfello\'1, P. (1990). A gene from the human sexdetermi n ing reg ion encodes a prote i n w i th homo logy to a conserved DNA-binding motif. Nature 346,240-244.
Strah1e, U., Klock, G. and SChutz, G. (1987). A sequence of 15 base pairs 1s sufflcient to mediate glucocorticoid and progesterone lnductlon of expression. Biochem. 84,7871-7875.
DNA both gene
strahle, U., Schmid, W. and Schutz, G. (1988). Synerg1stic act ion 0 f the g lucocort i co id receptor w i th tr anscr 1 pt ion factors. EMBO. J. 7,3389-3395.
Stryer, L. (198 8a). Biosynthes 1s of membrane 1 i pids and steroid hormones. In: Biochemistry 3nd ed1t1on pp. 464-477. W.H. Freeman and company, San Fransisco.
stryer, L. (1988b). Introduction to protein structure and function. ibid pp32-27.
Tan, JI., Marschke, K.B., Ho, K.C., Perry, S.T. (1992). Response elements of the androgen-regulated C3 gene. J. Biol. Chem. 267,4456-4466.
Tilley, W., Marcelli, M., Wilson, J. and McPhaul, M. (1989). Characterization and expression of a cDNA encoding the human androgen receptor. PNAS 86,327-331.
T r a pma n, J., KI a a s sen, P., Ku i p e r, G. G . J . M ., van der K 0 r put, J.A.G.M., Faber, P.W., van Ro01j, H.C.J, van Kessel, A., Voorhorst, M., Mulder, E. and Brinkmann, A.O. (1988). Cloning, structur e and expr ess i on 0 f a cDNA encod i ng the human androgen receptor. Biochem. Biophys. Res. Commun. 153,241.
Trifiro, M., Kaufman, M., Bordet, S., Beitel, L., KazemiEsfarjani, P., Mhatre, A., Sabbaghian, N., Lumbloso, R., Alvarado, C., Gottlieb, B. and Pinsky, L. (1991). Androgen receptor mutat ions that cause male sexual maldevelopment in man. Am. J. Hum. Genet. 49 (Suppl. 4): Abst. N°267, p53.
Tsai, S.Y., Carlstedt-Duke, J., Weigl, N.L., Dahlman, K.,
105
Gustafsson, J.A., TSdl, M.-J. and O'Ma1ley, B.W. (1988). Mo1ecular interactions of steroid hormone receptor with i ts enhancer element: ev idence for receptor d imer formation. Cell 55,361-369.
Wahli, W. and Martinez (1991). Superfamily of steroid nuc1ear receptorsi positive and negative regulators of gene expreSSlon. FASEB J. 5,2243-2249.
Wilson, J.O., Griffin, J.E., George, F.W. and Leshin, M. (1981). The role of gonadal steroids in sexual differentiation. Rec. prug. Horm. Res. 37,1-33.
Woosley, J.t. and Muldon, T.G. (1979). The thermolability of rat uterine cytoso1 estrogen receptors: basis for a novel cytosol exchange-denaturation assay. J. Steroid Biochem. 11,1065-1071.
Zegers, N.D., Claassen, E., Nee1en, C., Mu1der, E., van Laar, J.H., Voorhorst, M.M., Berrevoets, C.A., Brinkmann, A.O., van der Kwast, T.H., Ruizeveld de Winter, J .A. et al. (1991). Epitope prediction and confirmat:on for the human androgen receptor: generation of monoclonal antibodies for multi-assay performance following the s ynthet i c pept ide st rategy. Bi och im. Bi oph. Acta 1073, 23-32.
Zoppi, S., Wilson, C.M., Harbison, M.D., Griffin, J.E., Wilson, J.O., McPhaul, M.j. and Marcelli, M. (1993). Complete testicular feminization caused by an aminoterminal truncation of the androgen receptor with downstream initiation. J. Clin. Invest. 91,1105-1112.
top related