short title: intra-cluster and mutual regulation of ap2/erfs · 54 nicotine2 (nic2) erf cluster....
Post on 19-Jan-2020
5 Views
Preview:
TRANSCRIPT
1
Short title: Intra-cluster and mutual regulation of AP2/ERFs 1
Corresponding authors: Ling Yuan and Sitakanta Pattanaik, Department of Plant and Soil 2
Sciences and Kentucky Tobacco Research and Development Center, University of Kentucky, 3
Lexington, KY, USA. 4
Email: lyuan3@uky.edu and spatt2@uky.edu 5
Phone: 859-257-4806; 859-257-1976 6
Fax: 859-323-1077 7 8
Title: 9
Mutually Regulated AP2/ERF Gene Clusters Modulate Biosynthesis of Specialized Metabolites in 10
Plants 11
Mutually regulated APETALA2/ETHYLENE RESPONSE FACTOR clusters modulate specialized 12
metabolite biosynthesis 13
14
Author names and affiliations: 15
aPriyanka Paul†,
aSanjay Kumar Singh†,
aBarunava Patra, *Xiaoyu Liu,
aSitakanta Pattanaik, and 16
a,bLing Yuan 17
aDepartment of Plant and Soil Sciences and the Kentucky Tobacco Research and Development 18
Center, University of Kentucky, 1401 University Drive, Lexington, KY 40546 USA 19
bKey Laboratory of South China Agricultural Plant Molecular Analysis and Genetic 20
Improvement, South China Botanical Garden, Chinese Academy of Sciences, Guangzhou, China 21
510650 22
23
*College of Life Sciences, Shanxi Agricultural University, Shanxi, China 030801 24
25
† These authors contributed equally to this work. 26
27
One-sentence summary: 28
Intra-cluster and mutual regulation of jasmonate-responsive transcription factor gene clusters is 29
evident in the biosynthesis of many plant specialized metabolites. 30
31
Plant Physiology Preview. Published on November 14, 2019, as DOI:10.1104/pp.19.00772
Copyright 2019 by the American Society of Plant Biologists
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
2
Author contributions: 32
L.Y. and S.P. designed the research; P.P., S.K.S., B.P., X.L. and S.P. performed experiments; 33
P.P., S.K.S. and S.P. analyzed data; and P.P., S.K.S., S.P. and L.Y. wrote the paper. 34
35
Funding information: 36
This work is supported partially by the Harold R. Burton Endowed Professorship to L.Y. and by 37
the National Science Foundation under Cooperative Agreement no. 1355438 to L.Y. 38
39
ABSTRACT 40 41
APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) gene clusters regulate the 42
biosynthesis of diverse specialized metabolites, including steroidal glycoalkaloids in tomato 43
(Solanum lycopersicum) and potato (S. tuberosum), nicotine in tobacco (Nicotiana tabacum), and 44
pharmaceutically valuable terpenoid indole alkaloids (TIAs) in Madagascar periwinkle 45
(Catharanthus roseus). However, the regulatory relationships between individual AP2/ERF 46
genes within the cluster remain unexplored. We uncovered intra-cluster regulation of the C. 47
roseus AP2/ERF regulatory circuit, which consists of ORCA3, ORCA4, and ORCA5. ORCA3 48
and ORCA5 activate ORCA4 by directly binding to a GC-rich motif in the ORCA4 promoter. 49
ORCA5 regulates its own expression through a positive auto-regulatory loop, and indirectly 50
activates ORCA3. In determining the functional conservation of AP2/ERF clusters in other plant 51
species, we found that GC-rich motifs are present in the promoters of analogous AP2/ERF 52
clusters in tobacco, tomato, and potato. Intra-cluster regulation is evident within the tobacco 53
NICOTINE2 (NIC2) ERF cluster. Moreover, overexpression of ORCA5 in tobacco and of NIC2 54
ERF189 in C. roseus hairy roots activates nicotine and TIA pathway genes, respectively, 55
suggesting that the AP2/ERFs are functionally equivalent and are likely to be interchangeable. 56
Elucidation of the intra-cluster and mutual regulation of transcription factor gene clusters 57
advances our understanding of the underlying molecular mechanism governing regulatory gene 58
clusters in plants. 59
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
3
Keywords: AP2/ERF gene cluster, intra-cluster and mutual regulation of transcription factor 60
cluster, terpenoid indole alkaloids, nicotine, transcriptional regulation, Catharanthus roseus 61
(Madagascar periwinkle) 62
63
INTRODUCTION 64
Plants produce a vast array of bioactive specialized metabolites in response to various biotic and 65
abiotic stresses. Many specialized metabolites with nutritional and medicinal values are 66
beneficial to animals and humans. While significant progress has been made in discovering the 67
genes encoding key enzymes in biosynthesis of specialized metabolites, molecular regulatory 68
mechanisms controlling the metabolic pathways are insufficiently understood. Biosynthesis of 69
specialized metabolites is primarily regulated at the transcriptional level (Colinas and Goossens, 70
2018). The APETALA2/ETHYLENE RESPONSE FACTOR (AP2/ERF) family transcription 71
factors (TFs) have emerged as key regulators of specialized metabolite biosynthesis, including 72
nicotine in tobacco (Nicotiana tabacum) (Shoji et al., 2010; De Boer et al., 2011), terpenoid 73
indole alkaloids (TIAs) in Madagascar periwinkle (Catharanthus roseus) (van der Fits and 74
Memelink, 2000; Paul et al., 2017) and Ophiorrhiza pumila (Udomsom et al., 2016), artemisinin 75
in Artemisia annua (Yu et al., 2012; Lu et al., 2013), and steroidal glycoalkaloids (SGA) in 76
tomato (Solanum lycopersicum) and potato (S. tuberosum) (Cardenas et al., 2016; Thagun et al., 77
2016; Nakayasu et al., 2018). AP2/ERFs are subdivided into 12 phylogenetic groups (Nakano et 78
al., 2006). Several group IX AP2/ERFs form physically linked gene clusters that regulate 79
biosynthesis of specialized metabolites. TF gene clusters have been characterized in a limited 80
number of plant species, including tobacco (Shoji et al., 2010; Kajikawa et al., 2017), tomato 81
(Cardenas et al., 2016; Thagun et al., 2016; Nakayasu et al., 2018), potato (Cardenas et al., 82
2016), and C. roseus (Paul et al., 2017). The tobacco NICOTINE2 (NIC2) locus comprises at 83
least 10 AP2/ERFs that are homologous to the C. roseus ORCAs. Not all NIC2 ERFs are equally 84
effective in regulating nicotine biosynthesis; ERF189 and ERF221/ORC1 play major roles in 85
nicotine biosynthesis (Shoji et al., 2010; De Boer et al., 2011). The AP2/ERF-gene cluster in 86
tomato and potato comprise five and eight ERFs, respectively. GLYCOALKALOID 87
METABOLISM 9 (GAME9)/JASMONATE-RESPONSIVE ERF4 (JRE4), a member of the 88
AP2/ERF gene clusters in tomato and potato, is key to biosynthesis of SGAs and the upstream 89
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
4
isoprenoids. Knockdown, knockout, or overexpression of the GAME9 genes in tomato and potato 90
affect the SGA pathway gene expression and SGA production (Cardenas et al., 2016; Thagun et 91
al., 2016; Nakayasu et al., 2018). In C. roseus, the ORCA cluster consists of at least three 92
AP2/ERFs, ORCA3, ORCA4, and ORCA5, and of which ORCA3 and ORCA4 are known to 93
regulate the biosynthesis of the pharmaceutically valuable TIAs (Figure 1A) (van der Fits and 94
Memelink, 2000; Paul et al., 2017). 95
In addition to the group IX AP2/ERFs, TF gene clusters have been identified in the group III 96
AP2/ERFs, C-repeat Binding Factors (CBFs) (Gilmour et al., 1998; Zhang et al., 2004), Auxin 97
Response Factors (ARFs) (Hagen and Guilfoyle, 2002), R2R3 MYBs (Zhang et al., 2000; Zhang 98
et al., 2019) and basic helix-loop-helix (bHLH) factors (Sanchez-Perez et al., 2019). TF gene 99
clusters are likely originated from tandem gene duplication events (Shoji et al., 2010; Kellner et 100
al., 2015). Unlike the operon-like, non-homologous metabolic gene clusters (Boycheva et al., 101
2014; Nützmann and Osbourn, 2014; Nützmann et al., 2016), TF gene clusters encode 102
homologous TFs with overlapping or unique functions. It has been suggested that gene 103
duplication offers the opportunity for mutual regulation among the duplicated genes (Shoji et al., 104
2010); however, mutual regulatory relationships among the members of any TF cluster remained 105
unconfirmed. Furthermore, the ORCA, NIC2, and GAME9/JRE locus ERFs are phylogenetically 106
related and commonly respond to the phytohormone, jasmonic acid (JA), suggesting the 107
evolution of similar regulatory mechanism in diverse metabolic pathways (Shoji et al., 2010; 108
Thagun et al., 2016). Question thus arose as to whether AP2/ERFs from different clusters are 109
functionally equivalent and interchangeable. Elucidation of the mutual regulatory relationship 110
among the ERF gene clusters implies an evolutionarily conserved molecular mechanism that 111
controls the biosynthesis of functionally and structurally diverse specialized metabolites. 112
In this study, we discovered a regulatory relationship among the members of the ORCA cluster. 113
The direct activation of ORCA4 by ORCA3 and ORCA5, as well as self-regulation of ORCA5, 114
highlight the presence of feed-forward and auto-regulatory loops in the ORCA cluster. We also 115
demonstrated the intra-cluster regulation among the tobacco NIC2 ERFs. Moreover, ORCA5 116
overexpression in tobacco hairy roots upregulated nicotine biosynthetic genes and nicotine 117
accumulation, and reciprocal overexpression of NIC2 ERF189 in C. roseus hairy roots induced 118
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
5
the TIA biosynthetic genes, suggesting that the ORCAs and NIC2 ERFs are functionally 119
equivalent and are likely interchangeable. 120
RESULTS 121
Phylogenetic analysis positions ORCAs, GAME9, and NIC2 ERFs in the same clade 122
AP2/ERFs are divided into 12 groups based on domain structure and other conserved motifs. The 123
group IX AP2/ERFs are involved in phytohormone signaling and defense response (Nakano et 124
al., 2006). Phylogenetic analysis of group IX ERFs from tomato, tobacco, potato and C. roseus 125
showed that ORCAs are grouped together with NIC2 and GAME9 ERFs, which are involved in 126
nicotine and SGA biosynthesis in tobacco and tomato, respectively (Shoji et al., 2010; Cardenas 127
et al., 2016) (Supplemental Figure S1). Interestingly, this clade does not include ERFs from 128
Arabidopsis thaliana, suggesting that the ERFs in this clade are possibly evolved for the 129
biosynthesis of structurally complex specialized metabolites. 130
ORCA gene cluster is differentially induced by MeJA and ethylene 131
MeJA is a key elicitor of biosynthesis of a number of specialized metabolites, including nicotine 132
(Shoji et al., 2000), beta-thujaplicin (Zhao et al., 2004), artemisinin (Shen et al., 2016), taxol 133
(Mirjalili and Linden, 1996) and SGAs (Thagun et al., 2016; Nakayasu et al., 2018). Ethylene 134
(ET) acts synergistically with MeJA to promote biosynthesis of taxol in Taxus cuspidate 135
(Mirjalili and Linden, 1996), beta-thujaplicin in Cupressus lusitanica (Zhao et al., 2004), and 136
hydroxycinnamic acid amides (HCAAs) in Arabidopsis thaliana (Li et al., 2018), while ET 137
attenuates the effects of MeJA on nicotine and SGA biosynthetic pathway gene expression in 138
Nicotiana species (N. tabacum and N. attenuata) and tomato, respectively (Shoji et al., 2000; 139
Winz and Baldwin, 2001; Shoji et al., 2010; Nakayasu et al., 2018). In C. roseus, MeJA induces 140
expression of ORCA3, ORCA4, and ORCA5 as well as their targets (van der Fits and Memelink, 141
2000; Paul et al., 2017). To determine the effects of ET alone or in combination with MeJA on 142
ORCA gene expression, C. roseus seedlings were treated with MeJA, ACC, or both for 2h, and 143
transcript accumulation were measured by reverse-transcription quantitative PCR (RT-qPCR). 144
Expression of ORCA5 was induced 9.5-fold by MeJA but remained unaffected by ACC; 145
however, MeJA-induced expression of ORCA5 was attenuated in the presence of ACC, reduced 146
to 7.5-fold. Expression of ORCA4 and ORCA3 was induced 7 and 12 fold, respectively, by MeJA 147
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
6
and reduced to 0.2-0.3 fold by ACC (Figure 1B). Similar to ORCA5, MeJA-responsive 148
expression of ORCA4 and ORCA3 was reduced to 2.5 and 7-fold, respectively, in the presence of 149
ACC. Expression of STR and TDC, two key targets of ORCAs, and CrMYC2a, were induced 4, 150
12 and 5.7 fold, respectively, by MeJA treatment. The MeJA-induced expression was reduced to 151
2-4 fold in the presence of ACC (Fig 1B). In addition, we measured the TIA contents in 152
seedlings treated with MeJA and ACC either alone or in combination. MeJA induced, whereas 153
ACC repressed the accumulation of tabersonine and ajmalicine. Moreover, MeJA-induced 154
accumulation of tabersonine, but not that of ajmalicine, was attenuated by ACC. Accumulation 155
of catharanthine was reduced in MeJA or ACC-treated seedlings (Figure 1C). 156
ORCA5 is a nucleus-localized transcriptional activator 157
To determine the transactivation activity, ORCA3, ORCA4, or ORCA5, fused to the GAL4-158
DNA-binding domain (GAL4-DBD), were co-electroporated into tobacco protoplasts with a 159
luciferase reporter driven by a minimal CaMV 35S promoter with GAL4-responsive elements as 160
described previously (Paul et al., 2017). Transactivation activities of ORCA3, ORCA4, and 161
ORCA5 were 6.5, 6.6, and 12-fold, respectively, higher than the reporter-only control 162
(Supplemental Figure S2A). The significant inductions of reporter activity in plant cells suggest 163
that three ORCAs are transcriptional activators. To determine the sub-cellular localization, 164
ORCA5 coding sequence was fused in-frame to the enhanced green fluorescent protein (eGFP) 165
and expressed in tobacco protoplasts. Compared to the protoplasts expressing the eGFP-control, 166
in which GFP was detected throughout the cell, the ORCA5-eGFP fusion protein was localized 167
to the nucleus (Supplemental Figure S2B), consistent with its putative function as a TF. 168
ORCA4 and ORCA5 bind to the JRE in the STR promoter 169
We have shown that ORCA4 and ORCA5 activate the promoters of key TIA pathway genes, 170
including STR, TDC, and CPR in tobacco cells (Paul et al., 2017). A previous study has shown 171
that ORCA3 binds to the JRE in the STR promoter (Van Der Fits and Memelink, 2001). To 172
determine whether ORCA4 and ORCA5 also bind the same JRE in the STR promoter, we 173
performed electrophoretic mobility shift assay (EMSA). We purified the recombinant, 174
glutathione S-transferase (GST)-tagged ORCA3, ORCA4, ORCA5, (GST-ORCA3/4/5) and 175
CrMYC2a (GST-CrMYC2a) proteins from E. coli using GST affinity chromatography as 176
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
7
described previously (Paul et al., 2017; Patra et al., 2018) (Figure 2A; Supplemental Figure 3A). 177
CrMYC2a, which binds T/G-box motif, was used as a negative control. The purified ORCA3, 178
ORCA4, ORCA5 or CrMYC2a protein was incubated with a 5’ biotin-labeled probe covering the 179
JRE of the STR promoter. Similar to ORCA3, ORCA4 and ORCA5 also bind to the JRE, 180
resulting in a mobility shift (Figure 2B). The binding of GST-tagged ORCA5 to the JRE of the 181
STR promoter was further confirmed by competition using 10X, and 100X excess of the 182
unlabeled (cold) probe. The intensity of the signal decreased gradually with the increase of the 183
concentration of cold probe (Supplemental Figure 3B). As shown in Figure 2B, the unlabeled 184
probe, 1000-fold in excess, out-competed the labeled probe and abolished the signal, suggesting 185
the shifted-band was indeed the ORCA5-JRE complex. We thus used 1000X excess of the cold 186
probe for the competition experiments with ORCA3 and ORCA4, and, similar to ORCA5, the 187
cold probe completely abolished the signals on the gel, indicating the shifted-band was indeed 188
the ORCA3/ORCA4-JRE complex (Figure 2B). We did not detect any signal for CrMYC2a, 189
suggesting that CrMYC2a does not bind to JRE in the STR promoter (Supplemental Figure 3B). 190
ORCA TFs differentially activate TIA pathway genes 191
The ORCAs are known to regulate a number of genes of the indole pathway and downstream 192
branches (van der Fits and Memelink, 2000; Paul et al., 2017). In this study, we investigated 193
their roles in regulation of additional genes in the TIA pathway. Biosynthesis of secologanin in 194
C. roseus (Figure 1A) requires nine enzymes, seven of which involved in the conversion of 195
geranyl diphosphate (GPP) to loganic acid are regulated by BIS1 (Van Moerkercke et al., 2015) 196
and BIS2 (Van Moerkercke et al., 2016). Loganic acid is converted to secologanin by loganic 197
acid methyltransferase (LAMT) and secologanin synthase (SLS). We used protoplast-based 198
transactivation assay to determine whether LAMT and SLS are regulated ORCAs. The LAMT 199
(1376 bp) or SLS (980 bp) promoter, fused to a firefly-luciferase reporter gene, was co-200
electroporated into tobacco protoplasts with or without the constructs expressing ORCA3, 201
ORCA4, or ORCA5 (Figure 2C). ORCA3, ORCA4, and ORCA5 significantly activated the 202
LAMT promoter compared to the control. ORCA5, but not ORCA3 and ORCA4, significantly 203
activated the SLS promoter (approximately 2.5-fold) compared to the control (Figure 2C). 204
Derepressed CrMYC2a and ORCA5 have synergistic effects on TIA pathway genes 205
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
8
A recent study has shown that mutation of a conserved aspartic acid to asparagine (D126N) in 206
the JAZ-interaction domain (JID) of CrMYC2a prevents CrMYC2a from interacting with 207
CrJAZ3 and CrJAZ8, thus derepressing CrMYC2a from the inactive complex with the JAZ 208
proteins. In addition, coexpression of the derepressed CrMYC2a (CrMYC2aD126N
) with ORCA3 209
has synergistic effect on expression of several TIA pathway genes (Schweizer et al., 2018). To 210
determine whether the derepressed CrMYC2a acts synergistically with ORCA5, we generated 211
the CrMYC2aD126N
mutant by site-directed mutagenesis and evaluated its effect on four key TIA 212
pathway gene promoters, TDC, STR, LAMT and SLS, which are regulated by ORCA5. As shown 213
in Figure 3, CrMYC2a had no additive effect on the STR promoter activity when co-expressed 214
with ORCA5. The TDC, LAMT and SLS promoter activities were slightly higher when CrMYC2a 215
was co-expressed with ORCA5. However, coexpression of CrMYC2aD126N
with ORCA5 had 216
synergistic effect on activation of all four promoters (Figure 3). 217
ORCA5 overexpression activates TIA pathway genes and boosts TIA accumulation in C. 218
roseus hairy roots 219
To further elucidate the regulatory role of ORCA5 in TIA biosynthesis, we generated transgenic 220
C. roseus hairy roots overexpressing ORCA5 (ORCA5-OE). The transgenic status of hairy roots 221
was confirmed by PCR (Supplemental Figure 4A). Two empty vector (EV) control and two 222
overexpression lines (OE-1 and OE-2) were selected for further analysis. Compared to EV 223
control, expression of ORCA5 was 24-40 fold higher in the transgenic lines (Supplemental 224
Figure 4B). Expression of a number of TIA pathway genes, including ASα, TDC, CPR, G10H, 225
IS, SLS, STR, and SGD, were significantly higher in the ORCA5-overexpression lines compared 226
with the EV control. In addition, expression of the genes encoding C2H2 zinc finger repressors, 227
ZCT1, ZCT2, and ZCT3 were also increased. Interestingly, expression of ORCA3 and ORCA4 228
were increased significantly in ORCA5-overexpressing hairy roots, suggesting that ORCA5 229
possibly regulates other members in the ORCA cluster (Figure 4A). 230
Previous studies have shown that overexpression of ORCA3 in C. roseus hairy roots does not 231
result in increased TIA accumulation (Peebles et al., 2009; Wang et al., 2010; Zhou et al., 2010). 232
In this study, overexpression of ORCA5 significantly increased the transcripts levels of genes in 233
both indole (i.e. AS and TDC) and iridoid branches (i.e. CPR, G10H, IS, and SLS) of the TIA 234
pathway. In addition, expression of the downstream pathway genes, STR and SGD, were also 235
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
9
significantly increased. To determine the metabolic outcomes of ORCA5-overexpression, we 236
measured the alkaloids in the two independent hairy root lines. Accumulation of tabersonine, 237
ajmalicine, and catharanthine increased significantly in ORCA5-OE lines compared to the EV 238
lines (Figure 4B). 239
In C. roseus, tabersonine, ajmalicine, and catharanthine are detected in roots and aerial parts, 240
while vindoline is only accumulated in aerial parts (van der Heijden et al., 2004). Recent studies 241
have shown that four separate hydrolases (HL1 to HL4) are involved in the conversion of the 242
unstable intermediate derived from O-acetylstemmadenine to tabersonine by HL1, to 243
catharanthine by HL2, and to vincadifformine byHL3/4 (Qu et al., 2018; Qu et al., 2019) (Figure 244
1A). In roots, the tabersonine is converted to hörhammericine catalyzed by tabersonine 19-245
hydroxylase (T19H) (Giddings et al., 2011) and minovincinine 19-O-acetyltransferase (MAT) 246
(Laflamme et al., 2001). Recently, a BADH acetyltransferase, tabersonine derivative 19-O-247
acetyltransferase (TAT), has been characterized in C. roseus. TAT is highly expressed in roots, 248
and has been shown to acetylate 19-hydroxytabersonine derivatives from C. roseus roots at a 249
higher efficiency than MAT (Carqueijeiro et al., 2018). In addition, two conserved cytochrome 250
P450s, tabersonine 6,7-epoxidase isoforms 1 and 2 (TEX1 and TEX2), have been identified in C. 251
roseus. TEX1 is preferentially expressed in roots whereas TEX2 transcripts are present in stem, 252
leaf, and flower (Carqueijeiro et al., 2018). TEX1/2 catalyze the stereo-selective epoxidation of 253
tabersonine to lochnericine which is then converted to hörhammericine by T19H and 254
subsequently acetylated by TAT to form 19-O-acetylhörhammericine. In a parallel branch, a 255
root-specific cytochrome P450, vincadifformine 19-hydroxylase (V19H) catalyzes the 256
conversion of vincadifformine to minovincinine, which is then O-acetylated by MAT to form 257
echitovenine (Williams et al., 2019). We found that similar to other TIA pathway genes, 258
expression of HL2, HL4, T19H, TAT, MAT, and TEX2 was induced by 1.5 to 18 fold in MeJA-259
treated C. roseus seedlings (Figure 5A). However, we did not observe significant change in the 260
expression of HL1, HL3, V19H and TEX1 in response to MeJA treatment. Next, we measured the 261
expression of these genes in EV and ORCA5-OE hairy root lines and found that expression of 262
MAT and T19H was induced by 20-500 fold ORCA5-OE compared to EV (Figure 4A). 263
Expression of HL3, V19H, TEX1, TEX2, and TAT was also induced by 2-11 fold in the ORCA5-264
OE lines (Figure 5B), suggesting that these genes are likely regulated by ORCAs. In the ORCA5-265
OE lines, expression of HL1 and HL4 was slightly repressed whereas HL2 expression did not 266
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
10
change significantly. This is similar to a recent study where transient overexpression of ORCA3 267
and/or MYC2a in Catharanthus flower petal had no effect on HL1 and HL2 expression, indicting 268
that additional factors are involved in regulation of TIA pathway (Schweizer et al., 2018). 269
270
ORCA5 activates the ZCT3 promoter 271
ZCTs are negative regulators of TIA pathway (Pauw et al., 2004). In both ORCA4 (Paul et al., 272
2017) and ORCA5 overexpressing hairy root lines (Figure 4A), expression of ZCTs were 273
significantly increased. We analyzed the cis-elements in the ZCT promoters, and found that the 274
ZCT3 promoter contains putative AP2/ERF binding sites (GC-rich motif). The findings suggest 275
that ORCA5 regulates ZCT3 possibly by binding to its promoter, while indirectly regulating 276
ZCT1 and ZCT2. We thus tested the activation of ZCT3 by ORCAs. The ZCT3 promoter (961 bp) 277
was fused to a firefly-luciferase reporter gene and co-electroporated into tobacco protoplasts 278
with or without the constructs expressing ORCA3, ORCA4 or ORCA5 (Figure 5C). Only ORCA5 279
moderately but significantly activated the ZCT3 promoter compared to the control. To test 280
whether ORCA5 is regulated by ZCT3, ORCA5 promoter was fused to a firefly-luciferase 281
reporter gene and co-electroporated into tobacco protoplasts with or without the construct 282
expressing ZCT3. No significant repression of the ORCA5 promoter was observed (Figure 5D). 283
To demonstrate that ORCA5 activates ZCT3 likely by binding to its promoter, we performed 284
yeast one-hybrid (Y1H) assay. Plasmids expressing GAL4-AD-ORCA5 fusion, controlled by the 285
ADH promoter, and the HIS3 nutritional reporter driven by the ZCT3 promoter were co-286
transformed into yeast cells. Transformed yeast cells, harboring the ZCT3-HIS3 reporter and AD-287
ORCA5, grew on selection medium (-leu-trp-his) with 50 mM of 3-AT, indicating activation of 288
the ZCT3 promoter by ORCA5 (Figure 6A). 289
ORCA5 activates the ORCA4 promoter 290
Expression of both ORCA3 and ORCA4 were increased significantly in ORCA5-OE hairy root 291
lines (Figure 4A), indicating that ORCA5 possibly regulates the expression of ORCA3 and 292
ORCA4. To test this possibility, ORCA3 (778 bp), ORCA4 (883 bp), or ORCA5 (890 bp) 293
promoters, fused to a firefly-luciferase reporter, were co-electroporated into tobacco protoplasts 294
with or without the plasmids expressing ORCA3, ORCA4 or ORCA5. None of the ORCAs could 295
activate the ORCA3 promoter, suggesting the ORCAs are unable to bind to the promoter despite 296
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
11
the induction of ORCA3 in ORCA5-OE lines (Figure 6B). ORCA3 and ORCA5, but not ORCA4, 297
significantly activated the ORCA4 promoter (Figure 6C). In addition, ORCA5 activated its own 298
promoter compared to the control (Figure 6D). However, ORCA3 or ORCA4 had no effects on 299
transcriptional activity of the ORCA5 promoter (Figure 6D). The activation of ORCA4 by 300
ORCA3 and ORCA5, activation of ORCA3 and ORCA4 by ORCA5, and self-regulation of 301
ORCA5 allude to the possible presence of auto-regulatory and feed-forward loops in the ORCA 302
cluster. 303
ORCA3 and ORCA5 bind to the ORCA4 promoter 304
We identified a GC-rich motif (AGCCCGCCC) to be a putative AP2/ERF binding site in the 305
ORCA4 promoter and mutated it to AGCAAAACC by site-directed mutagenesis. The mutant 306
promoter, mORCA4-pro was fused to the luciferase reporter to generate a reporter vector. The 307
reporter vectors harboring the wild-type or mutant ORCA4 promoter were co-electroporated into 308
tobacco protoplasts with the plasmid expressing ORCA5. Mutation in the GC-rich motif reduced 309
activation of the ORCA4 promoter by ORCA5 (Figure 6C), suggesting that ORCA5 activates 310
ORCA4 likely by binding to the GC-rich motif in its promoter. 311
To further verify that ORCA3 and ORCA5 bind the GC-rich element in the ORCA4 promoter, we 312
performed Y1H assay. ORCA3 or ORCA5 fused to the GAL4-AD was co-transformed into yeast 313
cells with the HIS3 reporter driven by the ORCA4 promoter. Yeast cells, harboring the ORCA4-314
HIS3 reporter and AD-ORCA3 or AD-ORCA5, grew on selection medium (-leu-trp-his) with 50 315
mM of 3-AT, suggesting that ORCA3 and ORCA5 can activate the ORCA4 promoter (Figure 316
6A). 317
We also carried out EMSA to validate the binding of ORCA3 and ORCA5 to the GC-rich motif 318
in the ORCA4 promoter. Recombinant, GST-tagged ORCA3 or ORCA5 protein was purified and 319
incubated with 5’ biotin-labeled probes covering the GC-rich motif of the ORCA4 promoter. 320
Figure 6E shows that ORCA3 and ORCA5 proteins individually interacted with the GC-rich 321
motif, resulting in a mobility shift. The binding of ORCA3 and ORCA5 to the labeled probe was 322
confirmed by a competition experiment using unlabeled (cold) probes. The binding signals of the 323
biotin-labeled probes could be eliminated by excess concentrations (1000x) of cold probe (Figure 324
6E), suggesting that ORCA3 or ORCA5 binds to the GC-rich motif in the ORCA4 promoter. 325
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
12
GC-rich motifs are present in the promoters of AP2/ERF gene clusters in other plants 326
AP2/ERFs are known to bind the GC-rich motifs in target gene promoters (Fujimoto et al., 2000; 327
Shoji et al., 2013). Group IX ERFs bind differentially to three GC-rich motifs, P-box 328
(CCGCCCTCCA), CS1-box (TAGACCGCCT) and GCC-box (AGCCGCC) (Shoji et al., 2013). 329
A recent study has identified consensus sequence for GC-rich motifs 330
([A/C]GC[A/C]C[T/C][C/T]C) present in the promoters of nicotine biosynthetic genes in 331
tobacco (Kajikawa et al., 2017). In addition, ORCA3 and ORCA5 bind to a GC-rich motif 332
(AGCCCGCC; this study) in the ORCA4 promoter. The question thus arose whether GC-rich 333
elements are also present in the promoters of AP2/ERF gene clusters identified in other plant 334
species. To address this question, we manually searched for similar GC-rich motifs 335
approximately 1kb 5’ of the protein coding regions of NIC2 and GAME9 genes in tobacco, 336
tomato, and potato. Of the ten NIC2 promoters, two GC-rich sequences were found each of 337
ERF168, ERF115 and ERF179. Both tomato GAME9-like 1 (Solyc01g090300) and 2 338
(Solyc01g090310) contain a single GC-rich sequence, while potato GAME9-like 2, 3, 4, and 7 339
(Cardenas et al., 2016) contain several in their promoters (Supplemental Figure S5). 340
Intra-cluster and mutual regulation in AP2/ERF gene clusters 341
The conserved nature of the GC-rich elements in promoters of the AP2/ERF clusters alludes to 342
the possible intra-cluster regulatory mechanisms that are mutually shared among different plant 343
species. To test this possibility, the C. roseus ORCA4-promoter-luciferase reporter construct was 344
co-electroporated into tobacco protoplasts with or without the plasmids expressing tobacco 345
ERF189 or ERF221. Both tobacco ERF189 and ERF221 significantly activated the ORCA4 346
promoter compared to the control (Figure 7A). Similarly, tobacco ERF115 (1056 bp) or ERF179 347
(1070 bp) promoter-luciferase reporter construct was co-electroporated into tobacco protoplasts 348
with or without the construct expressing ERF189 or ORCA5. The activation of the ERF115 and 349
ERF179 promoters by ERF189 or ORCA5 were moderate, but statistically significant (Figure 350
7B). In addition, we found two potential ERF binding motifs (GGCACCT and GGCCAAGC) in 351
the ERF115 promoter. Mutation of either individual motif did not significantly affect the 352
activation of ERF115-LUC by ERF189; however, mutation of both motifs reduced the activity of 353
ERF115-LUC reporter by 70% compared with the wild-type promoter (Figure 7C). Collectively, 354
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
13
these findings suggest the presence of intra-cluster and mutual regulation in both NIC2 and 355
ORCA clusters. . 356
C. roseus ORCA ERFs and tobacco NIC2-locus ERFs are likely interchangeable 357
C. roseus ORCA3/4/5 are homologous to tobacco NIC2 locus AP2/ERFs, ERF189 and ERF221 358
(a.k.a. ORC1) (Shoji et al., 2010; De Boer et al., 2011). In addition, both ORCAs and NIC2 359
ERFs are induced by MeJA and recognize GC-rich motifs in target gene promoters in two 360
diverse metabolic pathways (Shoji et al., 2010; De Boer et al., 2011). It is thus intriguing to 361
speculate that C. roseus ORCAs and tobacco NIC2-locus ERFs are functionally equivalent and 362
interchangeable. We tested this assumption by co-electroporation of the putrescine N-363
methyltransferase (PMT; 1500 bp) or quinolinate phosphoribosyltransferase (QPT; 1579 bp) 364
promoter-luciferase reporter vector into tobacco protoplasts with or without the plasmids 365
expressing ERF221, ORCA3, ORCA4 or ORCA5. As expected, ERF221 significantly activated 366
the PMT and QPT promoters compared to the control. ORCA3 and ORCA5 also activated the 367
PMT and QPT promoters although to lower levels compared to the activation by ERF221 (Figure 368
8A). The STR promoter (587 bp) fused to the luciferase reporter was co-electroporated into 369
tobacco protoplasts with or without the construct expressing ORCA3, ERF189, or ERF221. 370
Similar to ORCA3, a known STR-activator, both ERF189 and ERF221 significantly activated the 371
STR promoter (Figure 8A), suggesting that the tobacco ERF189 and ERF221 are functional 372
equivalents of C. roseus ORCAs. To determine the activation specificity of PMT and QPT by 373
NIC2 ERFs or ORCAs, we cloned a tobacco bZIP TF which is not involved in the regulation of 374
nicotine biosynthesis (Yang et al., 2001) and used it as a negative control. As shown in 375
Supplemental Figure S6, the bZIP TF was unable to activate the PMT or QPT promoter in 376
tobacco cells. Similarly, CrMYC1, a C. roseus bHLH TF not known to regulate the TIA pathway 377
(Chatel et al., 2003), was unable to activate the STR promoter in tobacco cells. 378
To functionally verify the conserved regulatory roles of AP2/ERFs of different clusters, we 379
generated tobacco hairy roots overexpressing ORCA5. Transgenic status of the hairy roots was 380
confirmed by PCR (Supplemental Figure S7), and two hairy root lines were used for further 381
analysis. Expression of PMT and QPT were 2.5-3.0 fold higher in ORCA5-expressing hairy roots 382
compared to the empty vector control (Figure 8B). Moreover, nicotine contents in the two 383
ORCA5-overexpressing lines were 3-4 fold higher compared to the control lines (Figure 8C), a 384
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
14
result that is consistent with a previous study showing that overexpression of ERF189 in tobacco 385
hairy roots resulted in 2-3 fold increase in PMT and QPT expression and alkaloid accumulation 386
(Shoji et al., 2010). We also generated C. roseus hairy roots overexpressing ERF189, and two 387
transgenic lines were used for further analysis (Supplemental Figure S8). STR expression was 388
approximately 2-fold higher in ERF189-expressing hairy roots compared to the empty vector 389
control (Figure 8D). In addition, the two ERF189-overexpressing lines accumulated 2-7 fold 390
higher ajamalicine, catharanthine and tabersonine compared to the controls (Figure 8E). 391
Discussion 392
Physically linked clusters of non-homologous, structural genes have been identified in numerous 393
plant species, including Arabidopsis, rice, maize, oat, tomato, potato, and opium poppy 394
(Boycheva et al., 2014; Nützmann and Osbourn, 2014; Nützmann et al., 2016). These gene 395
clusters generally encode enzymes that are involved in the biosynthesis of specialized 396
metabolites (Boycheva et al., 2014; Nützmann and Osbourn, 2014; Nützmann et al., 2016). 397
Unlike the structural gene clusters, TF gene clusters comprise homologous genes that likely 398
arose as the results of duplication events. It is unclear whether the duplicated TF genes are 399
functionally redundant and co-regulated by the same transcriptional circuit, or if they have 400
evolved through gene divergence to possess unique functions, including differential responses to 401
hormonal signals and regulation of one another. 402
We showed that ORCAs and key TIA pathway genes exhibit two distinct expression patterns in 403
response to ET alone, or the combined treatment of ET and MeJA (Figure 1B). CrMYC2a, 404
ORCA5, and TDC were upregulated by MeJA, but not affected by ET. On the other hand, 405
expression of ORCA3, ORCA4, and STR was significantly induced by MeJA and repressed by 406
ET. Moreover, when treated simultaneously, ET antagonizes the MeJA-induced expression of 407
ORCA3, ORCA4, ORCA5, TDC, and STR (Figure 1B). Expression divergence has been observed 408
among the tobacco NIC2 ERFs (Shoji et al., 2010) and tomato JREs (Nakayasu et al., 2018) in 409
response to MeJA and ET. MeJA-induced expression of ERF189/199 is antagonized by ET, 410
whereas expression of other NIC2 ERFs are insensitive to ET treatment (Shoji et al., 2010). 411
Other duplicated regulatory genes in Arabidopsis also exhibit expression divergence (Ganko et 412
al., 2007). The plant genomes sequenced to date have shown whole-genome, tandem, and/or 413
segmental duplications that result in neo-, sub-, or pseudo-functionalization of duplicated genes 414
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
15
(Rensing et al., 2008; Chae et al., 2014). These findings suggest that duplicated regulatory genes, 415
including ORCA and NIC2 ERFs, experience sub-functionalization (Shoji et al., 2010). 416
We demonstrated that ORCA5 has a broader transactivation specificity than ORCA3 and 417
ORCA4 (Figure 2C). Overexpression of ORCA5 in C. roseus hairy roots significantly induced 418
expression of genes in the indole branch and downstream of the iridoid branch, such as SLS, 419
resulting in increased TIA accumulation (Figure 4A). In addition, expression of CrMYC2a was 420
also upregulated in ORCA5-overexpressing hairy roots. In tobacco, not all NIC2 ERFs are 421
equally effective in activating nicotine pathway genes. This functional divergence among the 422
ERFs may be attributed to the sequence differences in the AP2 DNA binding domain and/or the 423
region outside of the AP2 domain (Shoji et al., 2010). MYC2 is known to regulate plant 424
specialized metabolites, including nicotine, TIAs, and SGA. Previously, we have demonstrated 425
that CrMYC2a expression strongly correlates with those of TIA structural and regulatory genes. 426
Similar to MYC2 regulation of nicotine biosynthesis in tobacco (Shoji and Hashimoto, 2011), 427
CrMYC2a co-regulates TIA pathway genes with ORCA3 (Paul et al., 2017). In addition, 428
CrMYC2a expression is induced in response to JA (Figure 1B) and increased in ORCA5-429
overexpressing hairy roots (Figure 4A). A recent study has shown that transient co-430
overexpression of a derepressed CrMYC2a (CrMYC2aD126N
) with ORCA3 synergistically affects 431
several TIA pathway gene expression (Schweizer et al., 2018). Similar to the previous study, we 432
found that CrMYC2aD126N
, when coexpressed with ORCA5, has additive effects on activation of 433
TIA pathway genes. Collectively, these findings suggest that CrMYC2a and ORCAs are part of a 434
regulatory network that modulate TIA biosynthesis in C. roseus. Transient overexpression of 435
CrMYC2a or CrMYC2aD126N
alone or in combination with ORCA3 activate a limited number of 436
TIA pathway genes, suggesting that additional but unidentified TFs are likely involved in the 437
TIA gene regulatory network. 438
Positive and negative regulatory loops are the hallmarks of metabolic pathways in plants. In 439
Arabidopsis JA signaling pathway, MYC2 activates the expression of JAZ repressors, which, in 440
turn, interact with MYC2 to attenuate the intensity of JA signal (Chini et al., 2007; Kazan and 441
Manners, 2013). AtMYBL2, a repressor of anthocyanin biosynthesis in Arabidopsis, is regulated 442
by the bHLH activator, TRANSPARENT TESTA8 (TT8). AtMYBL2 competes with the R2R3 443
MYBs, PAP1 and PAP2, to form a complex with TT8 that represses anthocyanin accumulation 444
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
16
(Matsui et al., 2008). Recently, we demonstrated that in C. roseus, CrMYC2a and BIS1 activate 445
the expression of the bHLH TF, RMT1, which acts as a repressor of CrMYC2a targets (Patra et 446
al., 2018). Similarly, in tomato MYC2 regulates expression of a small group of JA-responsive 447
bHLH TFs, MYC2-targeted bHLH 1 (MTB1), MTB2 and MTB3. MTB proteins inhibit the 448
formation of MYC2-MED25 complex and compete with MYC2 to bind to its targets (Liu et al., 449
2019). Here, we showed that, similar to ORCA4 (Paul et al., 2017), overexpression of ORCA5 450
significantly activates ZCTs in C. roseus hairy roots (Figure 4A). Moreover, we demonstrated 451
that ORCA5 activates ZCT3 possibly by binding to the GC-rich element in the promoter (Figure 452
5C, 6A). In C. roseus cells, ZCTs repress STR and TDC, the direct targets of ORCAs, by binding 453
to their promoters (Pauw et al., 2004). The up-regulation of ZCTs by ORCA4- or ORCA5-454
overexpression suggests the existence of a negative regulatory loop that is probably involved in 455
the fine-tuning of TIA biosynthesis (Figure 6F). 456
Individual genes in the tobacco and C. roseus ERF gene clusters play overlapping and unique 457
roles in controlling the structural genes in nicotine and TIA biosynthetic pathways, respectively 458
(Shoji et al., 2010; Paul et al., 2017). However, the regulatory relationship among the members 459
within an ERF cluster, or any known plant TF clusters, has not been elucidated prior to this 460
study. Here we demonstrated that an intra-cluster regulatory mechanism exists in both C. roseus 461
ORCA cluster and tobacco NIC2 cluster. The self-regulated ORCA5 activates ORCA4 by 462
binding to its promoter and ORCA3, likely through an uncharacterized TF. ORCA3 also activates 463
ORCA4 by binding to the GC-rich motif in its promoter (Figure 6). In tobacco, ERF189 activates 464
both the ERF115 and ERF179 promoters (Figure 7B). GC-rich sequences are not found within 465
the 1kb promoter regions of ERF189 and GAME9. The fact that GC-rich motifs are present only 466
in the promoters of some ERFs indicates that certain key regulators, such as ERF189, likely play 467
important role in controlling amplification loop in the ERF cluster. The intra-cluster regulation of 468
ERF clusters implies that the individual components within a cluster are not simply redundant 469
duplication of one another. The positive amplification loops help plants to make sufficient 470
precursors required for the spatial-temporal biosynthesis of specialized metabolites. The 471
mechanism is likely conserved in other ERF clusters in plants. It is also reasonable to predict that 472
similar self-regulation mechanisms exist in other TF clusters, such as those formed by group III 473
AP2/ERFs, CBFs (Zhang et al., 2004), and ARFs (Hagen and Guilfoyle, 2002). 474
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
17
The conserved nature of the intra-ERF-cluster regulation prompted us to speculate that ERFs 475
from gene clusters of different plant species are functionally equivalent and interchangeable, 476
despite low sequence similarity (35-41%). In this study, we showed that C. roseus ORCA5 can 477
activate both tobacco ERF115 and ERF179, and tobacco ERF189 and ERF221 can activate the 478
C. roseus ORCA4 promoter (Figure 7A and B). Furthermore, ORCA3 and ORCA5 can activate 479
the PMT and QPT promoters (Figure 8A). Similarly, the STR promoter in the TIA pathway can 480
be activated by tobacco ERF189 and ERF221 (Figure 8A). Moreover, ORCA5 overexpression in 481
tobacco hairy roots induced expression of PMT and QPT, resulting in increased nicotine 482
accumulation (Figure 8B and C). Similarly, ERF189 overexpression in C. roseus hairy roots 483
activated the expression of STR and induced TIA accumulation (Figure 8D and E). The mutual 484
activations of two distinct metabolic pathways by the ORCA and NIC2 clusters support our 485
hypothesis that the AP2/ERFs are functionally equivalent and are likely interchangeable (Figure 486
8F). Other ERF gene clusters, such as GAME9 ERFs of tomato and potato (Supplemental Figure 487
S5) also contain the GC-rich elements in their promoters and respond to JA-induction similar to 488
the ORCA and NIC2 clusters. We thus propose that the intra-cluster and mutual regulatory 489
functions are widely conserved among the ERF gene clusters of diverse plant species, although 490
additional experimental verifications are required. 491
TF gene clusters have been identified in non-plant organisms, including nematodes, Drosophila, 492
mouse, and human. The non-plant, homeodomain HOX TF clusters, which play critical roles in 493
invertebrates and vertebrates development, have been characterized (Lappin et al., 2006; 494
Montavon and Duboule, 2013). By comparison, the plant TF clusters are poorly investigated. As 495
more and more TF clusters are being identified, the unique functions and mutual regulatory 496
relationships of the clustered TFs require in-depth examination. Central to the knowledge gaps is 497
the regulatory relationship within a cluster and among different species. Understanding of such 498
relationships will shed light on TF evolution, as well as the functional equivalence and 499
divergence of TFs involved in specialized metabolism. This study demonstrates intra-cluster and 500
mutual regulation of AP2/ERF gene clusters, suggesting that a conserved regulatory mechanism 501
modulates biosynthesis of diverse groups of plant specialized metabolites. 502
MATERIALS AND METHODS 503
Plant materials 504
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
18
Catharanthus roseus (L.) G. Don var. ‘Little Bright Eye’ (NE Seed, USA) was used for cloning, 505
gene expression, and generation of transgenic hairy roots. Nicotiana tabacum var. Xanthi cell 506
line was used for protoplast-based transient expression assays. N. tabacum var. SamsunNN was 507
used for generation of hairy roots. 508
RNA isolation and cDNA synthesis 509
C. roseus (L.) G. Don var. ‘Little Bright Eye’ seeds were surface-sterilized using 30% (v/v) 510
commercial bleach for 15 min, washed five times with sterile water and inoculated on half-511
strength Murashige and Skoog (MS) medium (Caisson Labs, USA). The plates were kept at 512
28°C in dark for two days and then transferred to a growth room at 28°C, with constant light 513
(Patra et al., 2018). Ten-day-old seedlings were immersed in half-strength MS medium with 100 514
M methyl jasmonate (MeJA) and/or 50 M of ethylene precursor, 1-aminocyclopropane-1-515
carboxylic acid (ACC) for 2h. Mock-treated seedlings were used as control. Total RNA isolated 516
from the seedlings were used for cDNA synthesis as described previously (Suttipanta et al., 517
2007). 518
Reverse-transcription quantitative PCR 519
Reverse-transcription quantitative PCR (RT-qPCR) was performed as described previously 520
(Suttipanta et al., 2011). The primers used in RT-qPCR are listed in Supplemental Table S1. In 521
addition to the C. roseus Elongation Factor 1∞ (EF1∞), 40S Ribosomal Protein S9 (RPS9) gene, 522
was used as a second internal control (Liscombe et al., 2010). All PCRs were performed in 523
triplicate and repeated at least twice. 524
Total RNA isolated from empty-vector control and ORCA5-overexpressing hairy roots were used 525
for cDNA synthesis and RT-qPCR as previously described (Suttipanta et al., 2011). The 526
comparative cycle threshold (Ct) method (Applied Biosystems, 527
http://www.appliedbiosystems.com) was used to measure transcript levels. In addition to tobacco 528
elongation factor-1œ (Shoji et al., 2010) (GenBank accession number D63396), œ-tubulin 529
(GenBank accession number AJ421411) was also used as a reference gene. 530
Sub-cellular localization 531
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
19
For sub-cellular localization, the full-length cDNA of ORCA5 was fused to the N-terminus of the 532
enhanced GFP (eGFP) driven by the CaMV3S promoter and rbcS terminator in a pBS plasmid to 533
generate pORCA5-eGFP. A pBS plasmid containing only eGFP was used as a control. The 534
plasmids containing either eGFP or ORCA5-eGFP were individually electroporated into tobacco 535
protoplasts as described previously (Pattanaik et al., 2010) and visualized after 20h incubation in 536
dark under a fluorescent microscope (Eclipse TE200, Nikon, Japan) . 537
Tobacco protoplast isolation and electroporation 538
The 5' flanking regions of LAMT (-1375 to -1; relative to the ATG), SLS (-979 to -1), STR (-586 539
to -1), ZCT3 (-960 to -1), ORCA3 (-777 to -1), ORCA4 (-882 to -1) and ORCA5 (-889 to -1) 540
promoters were PCR-amplified from C. roseus genomic DNA. The PMT (-1499 to -1), QPT (-541
1578 to -1), ERF115 (-1055 to -3) and ERF179 (-1069 to -3) promoters were amplified from 542
tobacco genomic DNA using gene specific primers. The two GC-rich motifs, TGGCACCT and 543
GGCCAAGC, in ERF115 promoter were mutated to aaaACCT and GaaaAAGC using site-544
directed mutagenesis. The reporter plasmids for transient protoplast assays were generated by 545
cloning LAMT, SLS, STR ZCT3, ORCA3/4/5, PMT, ERF115 and ERF179 promoters in a 546
modified pUC vector containing a fire-fly luciferase (LUC) and rbcS terminator. The effector 547
plasmids were constructed by cloning ORCA3/4/5, ERF189/221, and ZCT3 into a modified pBS 548
vector under the control of the CaMV35S promoter and rbcS terminator. The ß-glucuronidase 549
(GUS) driven by the CaMV35S promoter and rbcS terminator was used as an internal control in 550
protoplast assay. For transactivation assay, ORCA3, ORCA4 and ORCA5 were fused to the 551
GAL4 DNA binding domain (GAL-DBD) in a pBS plasmid containing mirabilis mosaic virus 552
(MMV) promoter and rbcS terminator. The reporter plasmid used in the assay contains firefly 553
luciferase driven by minimal CaMV 35S promoter with five tandem repeats of GAL4 Response 554
Elements (5X GALRE), and rbcS terminator fused. Protoplast isolation from tobacco cell 555
suspension cultures and electroporation with supercoiled plasmid DNA were performed using 556
previously described protocols (Pattanaik et al., 2010). The reporter, effector, and internal 557
control plasmids were electroporated into tobacco protoplasts in different combinations; 558
luciferase and GUS activities in transfected protoplasts were measured as described previously 559
(Suttipanta et al., 2007). Each experiment was repeated three times. 560
561
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
20
Construction of plant expression vector and generation of hairy roots 562
For plant transformation, ORCA5 and ERF189 were PCR-amplified from C. roseus and tobacco 563
seedlings cDNA, respectively and cloned in pCAMBIA2301 vector containing the CaMV35S 564
promoter and the rbcS terminator (Pattanaik et al., 2010). The pCAMBIA2301 vector alone was 565
used as an empty vector (EV) control. The plasmids were mobilized into Agrobacterium 566
rhizogenes R1000 by freeze-thaw. Transformation of C. roseus seedlings and generation of hairy 567
roots were performed using the protocol described previously (Suttipanta et al., 2011; Paul et al., 568
2017). Transgenic status of the hairy root lines was verified by PCR amplification of rolB, rolC, 569
virC, nptII and GUS genes. Primers used in this study are listed in Supplemental Table S1. Two 570
independent hairy root lines were selected for further analysis. 571
572
Alkaloid extraction and analysis 573
For extraction of alkaloids, ten day-old seedlings were immersed in half-strength MS medium 574
with 100 M MeJA and/or 50M of ACC for 24h. MeJA and/or ACC-treated seedlings, and 575
transgenic hairy roots were frozen in liquid nitrogen and ground to powder. Samples were 576
extracted in methanol (1:100 w/v) twice for 24 h on a shaker. Pooled extracts were then dried via 577
a rotary evaporator and diluted in methanol 10 μL/mg of the initial sample. The samples were 578
then analyzed using high performance liquid chromatography (HPLC), followed by electrospray-579
injection (ESI) in a tandem mass spectrometry (MS/MS), as previously described (Suttipanta et 580
al., 2011; Paul et al., 2017). The known alkaloid standards were run to identify elution times and 581
mass fragments. 582
583
Yeast one-hybrid assay 584
The ORCA4 (883 bp)/ZCT3 (961 bp) promoter was cloned in the pHIS2 vector (Clontech), 585
containing the HIS3 reporter gene to generate the reporter plasmid (pORCA4/ZCT3-HIS3). The 586
full-length ORCA3 and ORCA5 cDNAs were cloned into the yeast expression plasmid, pAD-587
GAL4-2.1 (Stratagene), to generate the effector plasmids (pORCA3/ORCA5-AD). The reporter 588
and effector plasmids were transformed into yeast strain Y187, and transformants were selected 589
on synthetic dropout (SD) medium lacking Leu and Trp (-Leu-Trp). Transformed colonies were 590
then streaked on SD medium lacking His-Leu-Trp (-Leu-Trp-His) with 50 mM 3-AT to check 591
promoter activation. 592
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
21
Recombinant Protein Production and EMSA 593
The ORCA3, ORCA4 and ORCA5 genes were cloned into the pGEX 4T-1 vector (GE Healthcare 594
Biosciences, Pittsburgh, PA, USA) to generate GST-fusion proteins. The constructs were 595
verified by DNA sequencing and transformed into E. coli BL21 cells containing pRIL (Agilent, 596
Santa Clara, CA, USA). Protein expression was induced by adding isopropyl ß-D-597
thiogalactopyranoside (IPTG) to a final concentration of 0.1mM to the cell cultures at A600 ~ 598
0.8 and induced for 2 h at 37°C. The cells were harvested by centrifugation and lysed using 599
CelLytic B (Sigma, USA) according to the manufacturer’s instructions. The GST fusion proteins 600
were bound to Glutathione Sepharose 4B columns (Amersham) and eluted by using 10mM 601
reduced glutathione in 50mM Tris–HCl (pH 8.0) buffer. Bacterial expression and purification of 602
recombinant CrMYC2a protein were performed as previously described (Patra et al., 2018). For 603
EMSA experiments, biotin-labeled DNA probes were synthesized by Integrated DNA 604
Technologies (IDT) and annealed to produce double-stranded probes. Complementary DNA 605
probes were designed to include the jasmonate-responsive elements (JRE) of STR promoter (-
606
100ACATCACTCTTAGACCGCCTTCTTTGAAA GTGATTTCCCTTGGACCTT
-58 relative to 607
transcription start site; TSS) (Van Der Fits and Memelink, 2001) and putative GC rich element of 608
the ORCA4 promoter (-106
CCTTCATAGCCCGCCCAATTGGTAAACGTGCACCAACCTCC-
609
66 relative to the translation start, ATG). EMSA experiment was carried out using light shift 610
chemiluminescent EMSA kit (ThermoFisher Scientific). For the binding reactions 40 fmole of 611
DS DNA was incubated with purified protein (500 ng of each protein) for 60 min at room 612
temperature. The protein-DNA binding for ORCA5 was further confirmed by performing 613
competition experiment, where 10X-, 100X- and 1000X-fold excess amount of cold probe 614
(without biotin-label) was added to the binding reactions. For ORCA3 and ORCA4, 1000X-fold 615
excess amount of cold probe was added to the binding reactions. Recombinant CrMYC2a protein 616
was used as a negative control on biotin-label STR probe. The DNA-protein complexes were 617
resolved by electrophoresis on 6% non-denaturing polyacrylamide gels and then transferred to 618
BiodyneB modified membrane (0.45 mm; Pierce). The band shifts were detected by a 619
chemiluminescent nucleic acid detection module (Pierce) and exposed to X-ray films. 620
621
Phylogenetic analysis of group IX AP2/ERFs 622
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
22
Protein sequences for tobacco, tomato, and potato were downloaded from Sol Genomics 623
Network database (Fernandez-Pozo et al., 2015), and protein sequences for C. roseus were 624
obtained from the medicinal plant genomics resource database 625
(http://medicinalplantgenomics.msu.edu/). The Arabidopsis AP2/ERFs sequences were obtained 626
from a previously published report (Nakano et al., 2006). The group IX AP2/ERFs protein 627
sequences from Arabidopsis were used as queries using Basic Local Alignment Search Tool 628
(BLAST) (Camacho et al., 2009) to identify the AP2/ERFs from tobacco, tomato, potato, and C. 629
roseus. Putative AP2/ERFs sequences were screened using the Pfam database for the AP2/ERFs 630
domain (Finn et al., 2016). The group IX AP2/ERFs protein sequences were aligned using 631
ClustalW with the default settings, and MEGA6.0 was used to construct the phylogenetic tree 632
using Neighbor Joining (NJ) method with bootstrap values set as 1000 replicates. The tree image 633
was generated with the Evolview v2 (He et al., 2016). 634
Generation of tobacco hairy roots and measurement of nicotine 635
Leaf discs of in vitro grown N. tabacum var. SamsunNN plantlets were infected with A. 636
rhizogenes strain (R1000) harboring the pCAMBIA2301-ORCA5 overexpression construct. 637
After 2 days of co-cultivation, leaf discs were transferred to MS medium supplemented with 638
400 mg/L cefotaxime and kept at 25°C in the dark. Hairy roots developed from the leaf discs 639
were transferred to MS medium with 400 mg/L cefotaxime and 100 mg/L kanamycin for 640
further proliferation. 641
Freeze-dried empty-vector control and ORCA5-overexpressing hairy roots were exhaustively 642
extracted for pyridine alkaloids by methyl tert-butyl alcohol (MTBE) and aqueous sodium 643
hydroxide. Alkaloid contents were determined using Gas Chromatograph with Flame Ionization 644
Detectors (GC-FID, PerkinElmer, USA) (Lewis et al., 2008). Nicotine content was reported as 645
percentages on a dry-tobacco-weight basis. 646
Statistical analyses 647
The data presented here were statistically analyzed by Student’s t-test or one-way analysis of 648
variance (ANOVA), and Tukey’s Honestly Significant Difference (HSD) for multiple 649
comparisons. The significance level (P value) was described in legends to each figure. 650
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
23
Accession numbers: ORCA3 (AJ251249), ORCA4 (KR703577), ORCA5 (KR703578), 651
ERF189 (AB827951) and ERF221 (XM_016622819) 652
. 653
Supplemental Data 654
Supplemental Figure S1. Phylogenetic analysis of group IX AP2/ERFs in tobacco, tomato, 655
potato and C. roseus. 656
Supplemental Figure S2. Sub-cellular localization of ORCA5 and transactivation assay of 657
ORCAs in tobacco cells. 658
Supplemental Figure S3. ORCA5 and CrMYC2a binding to the GC-rich motif in the STR 659
promoter. 660
Supplemental Figure S4. Molecular analysis of ORCA5-overexpressing C. roseus hairy roots. 661
Supplemental Figure S5. Positions and sequences of GC-rich motifs in the AP2/ERF promoters 662
of C. roseus, tobacco, tomato, and potato. 663
Supplemental Figure S6. Activation assays of the QPT, PMT, and STR promoters using tobacco 664
bZIP and CrMYC1. 665
Supplemental Figure S7. Molecular analysis of ORCA5-overexpressing tobacco hairy roots. 666
Supplemental Figure S8. Molecular analysis of ERF189-overexpressing C. roseus hairy roots. 667
Supplemental Table S1. Oligonucleotides used in this study. 668
Acknowledgements 669 670
This work is supported partially by the Harold R. Burton Endowed Professorship to L.Y. and by 671
the National Science Foundation under Cooperative Agreement no. 1355438, to L.Y. We thank 672
Mr. J. May (Department of Civil Engineering and Environmental Research Training 673
Laboratories, University of Kentucky) for assistance on LC-MS and Huihua Ji (KTRDC, 674
University of Kentucky) for assistance on nicotine measurement. 675
676
Figure legends 677 678
Figure 1. Expression of ORCA3, ORCA4, and ORCA5 in response to JA and ACC. (A) A 679
simplified diagram of the TIA biosynthetic pathway in Catharanthus roseus. TIA pathway genes 680
studied in this work are highlighted in blue, and genes regulated by ORCAs and CrMYC2a (this 681
study; Schweizer et al. 2018; Paul et al. 2017; van der Fits and Memelink, 2000) are indicated by 682
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
24
circle and green triangle, respectively. (B) Ten-day-old C. roseus seedlings were treated with 100 683
µM MeJA (JA) and/or 50 M ACC for 2h, and gene expression in whole seedling was measured 684
by RT-qPCR. Mock-treated seedlings were used as controls (CN). (C) Measurement of 685
ajmalicine, catharanthine, and tabersonine in JA-, ACC- and JA+ACC-treated C. roseus 686
seedlings. Alkaloids were extracted and analyzed using LC-MS/MS. The levels of alkaloids were 687
estimated based on peak areas compared to standards. Data represent means ± SDs of three 688
biological samples each with 15-17 seedlings. Different letters denote statistical differences as 689
assessed by one-way ANOVA and Tukey HSD test, p < 0.05. ASα, anthranilate synthase; CPR, 690
cytochrome P450 reductase; G10H, geraniol 10-hydroxylase; HL1/2/3/4, hydrolase 1/2/3/4; IS, 691
iridoid synthase; LAMT, loganic acid methyltransferase; MAT, minovincine 19-O-692
acetyltransferase; SGD, strictosidine β-glucosidase; SLS, secologanin synthase; STR, 693
strictosidine synthase T19H, tabersonine 19-hydroxylase; TAT, tabersonine derivative 19-O-694
acetyltransferase; TEX1/TEX2, tabersonine 6,7-epoxidase isoforms 1 and 2; V19H, 695
vincadifformine 19-hydroxylase. ACC, 1-aminocyclopropane-1-carboxylic acid; MeJA, methyl 696
jasmonate; TIA, terpenoid indole alkaloid. 697
Figure 2. ORCA binding to the GC-rich motif in the STR promoter and differential 698
activation of TIA pathway gene promoters. (A) ORCA3, ORCA4, and ORCA5 were expressed 699
in E. coli and the recombinant proteins were purified to homogeneity as demonstrated by SDS-700
PAGE. (B) Binding of ORCA3, ORCA4, and ORCA5 to the GC-rich motif in the STR promoter. 701
Nucleotide sequence of GC-rich motif and position of JRE (-100 to -58) relative to the 702
transcription start site (TSS) is shown on the top panel. Autoradiograph shows the DNA-protein 703
complex of biotin-labeled GC-rich motif probe with ORCA3, ORCA4, or ORCA5. The labeled 704
probe was outcompeted by 1000X unlabeled probe (+). (C) Transactivation of the LAMT and 705
SLS promoters, fused to the firefly luciferase (LUC) reporter, by ORCA3, ORCA4, and ORCA5 706
in tobacco cells. Control (CN) represents reporter plasmid alone. A plasmid containing the ß-707
glucuronidase (GUS) reporter, driven by the CaMV 35S promoter and rbcS terminator, was used 708
as an internal control. LUC and GUS activities were measured 20 h after electroporation. LUC 709
activity was normalized against GUS activity. Data presented here are the means ± SDs of three 710
biological replicates. Statistical significance was calculated using the Student’s t-test, * p <0.05, 711
** p <0.01. JRE, jasmonate responsive element. 712
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
25
Figure 3. Derepressed CrMYC2a and ORCA5 synergistically effect TIA pathway genes. 713
Activation of the TDC, STR, LAMT, and SLS promoters, fused to the firefly luciferase (LUC) 714
reporter, by ORCA5, CrMYC2a, and CrMYC2aD126N
in tobacco cells. A reporter plasmid 715
containing the promoter-LUC cassette was co-electroporated into tobacco protoplasts with 716
effector plasmids harboring TF genes. Control (CN) represents reporter plasmid alone. A plasmid 717
containing the ß-glucuronidase (GUS) reporter, driven by the CaMV 35S promoter and rbcS 718
terminator, was used as internal control. LUC and GUS activities were measured 20 h after 719
electroporation. The LUC activity was normalized against the GUS activity. Data presented here 720
are the means ± SDs of three biological replicates. Different letters denote statistical differences 721
as assessed by one-way ANOVA and Tukey HSD test, p < 0.05 722
Figure 4. Relative expression of key TIA pathway genes and alkaloid accumulation in 723
ORCA5-overexpressing C. roseus hairy roots. (A) Relative expression of the TIA pathway 724
genes and TF genes in two empty vector (EV) controls and two ORCA5-overexpression (OE-1 725
and OE-2) hairy root lines as measured by RT-qPCR. (B) Measurement of tabersonine, 726
ajmalicine, and catharanthine in EV controls, OE-1, and OE-2. Alkaloids were extracted and 727
analyzed using LC-MS/MS, and the levels of alkaloids were estimated based on peak areas 728
compared to standards. Data presented here are the means ± SDs of three biological replicates. 729
Statistical significance was calculated using the Student’s t-test, * p <0.05, ** p <0.01, *** p 730
<0.001 731
Figure 5. Relative expression of TIA pathway genes in response to MeJA and in ORCA5-732
overexpressing hairy roots. (A) Ten-day-old C. roseus seedlings (15-17 seedlings in each 733
replicate) were treated with 100 M MeJA (JA) for 2h, and expression of HL1 to HL4, V19H, 734
TEX1, TEX2, T19H, TAT, and MAT in seedling was measured by RT-qPCR. Mock-treated 735
seedlings were used as controls (CN). (B) Relative expression of HL1 to HL4, V19H, TAT, TEX1, 736
and TEX2 in empty vector (EV) controls and two ORCA5-overexpression hairy root lines (OE-1 737
and OE-2) were measured by RT-qPCR. (C) Activation of the ZCT3 promoter, fused to the LUC 738
reporter, by ORCA3, ORCA4, or ORCA5 in tobacco cells. (D) Transactivation of the ORCA5 739
promoter, fused to the LUC reporter, in tobacco cells. Control (CN) represents reporter plasmid 740
alone. In both C and D, a plasmid containing the GUS reporter, driven by the CaMV 35S 741
promoter and rbcS terminator, was used as an internal control. LUC and GUS activities were 742
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
26
measured 20 h after electroporation. The LUC activity was normalized against the GUS activity. 743
Data presented here are the means ± SDs of three biological replicates each with 4-5 samples. 744
Statistical significance was calculated using the Student’s t-test, * p <0.05, ** p <0.01 745
Figure 6. Intra-cluster regulatory relationship among the members of ORCA cluster. (A) 746
Yeast one-hybrid assay demonstrating activation of the ORCA4 promoter by ORCA3 or ORCA5, 747
and the ZCT3 promoter by ORCA5. ORCA3 or ORCA5, fused to the GAL4 activation domain 748
(pAD-ORCA3/ORCA5), was co-transformed into yeast cells with the pORCA4-HIS3 or pZCT3-749
HIS3 reporter plasmid. The transformants were grown in either the double selection medium 750
(SD-Leu-Trp) or triple selection medium (SD-Leu-Trp-His) with 50 mM 3-amino-1,2,4-triazole 751
(3-AT). Transactivation of the promoters of (B) ORCA3, (C) ORCA4 and mutant-ORCA4 (m-752
ORCA4), and (D) ORCA5 by ORCA3, ORCA4, or ORCA5 in tobacco cells. Data presented here 753
are the means ± SDs of three biological replicates each with 4-5 samples. Statistical significance 754
was calculated using the Student’s t-test, * p <0.05, ** p <0.01 (E) Binding of ORCA3 and 755
ORCA5 to the GC-rich motif in the ORCA4 promoter. Nucleotide sequence and position of the 756
GC-rich motif relative to the translation start site (TSS) is shown on the top panel. 757
Autoradiograph shows the DNA-protein complex of the biotin-labeled probe covering the GC-758
rich motif with ORCA3 or ORCA5. The binding of the labeled probe was outcompeted by 759
1000X unlabeled probe (+). (F) A model summarizing the intra-cluster regulation among the 760
ORCAs and co-regulation of ORCAs and ZCTs of the TIA pathway. The ORCA genes are 761
activated by JA but repressed by ET. ORCA3 and ORCA5 regulate ORCA4. ORCA5 regulates 762
its own expression. ORCA5 activate ZCT3 whereas ORCAs indirectly regulate ZCT1 and ZCT2. 763
Solid blue arrows indicate activation by JA; solid yellow T-bars represent repression by ET. 764
Solid black arrows represent direct activation, whereas broken arrows represent indirect or 765
undetermined activation. ORCA5 activates whereas ZCT represses several genes in the indole 766
and iridoid branches of the TIA pathway. 767
Figure 7. Mutual regulatory relationship among C. roseus ORCA and tobacco NIC2 768
AP2/ERFs. (A) Transactivation of the ORCA4 promoter by NIC2 ERF, ERF189 or ERF221, and 769
(B) the tobacco ERF115 and ERF179 promoters by ERF189 or ORCA5. Data represent means ± 770
SDs of three biological samples. Different letters denote statistical differences as assessed by 771
one-way ANOVA and Tukey HSD test, p < 0.05. (C) Transactivation of the mutant ERF115 772
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
27
promoter by ERF189 in tobacco protoplast-based transactivation assay. A plasmid containing the 773
GUS reporter, driven by the CaMV 35S promoter and rbcS terminator, was used as an internal 774
control. Control represents reporter plasmid alone. The LUC and GUS activities were measured 775
20 h after electroporation. The LUC activity was normalized against the GUS activity. Data 776
presented here are the means ± SDs of three biological replicates each with 4-5 samples. 777
Statistical significance was calculated using the Student’s t-test, * p <0.05. 778
779 Figure 8. C. roseus ORCAs and tobacco NIC2 ERFs are likely interchangeable (A) 780
Transactivation of C. roseus STR promoter by ORCA3, ERF189, or ERF221 and tobacco PMT 781
and QPT promoters by ERF221, ORCA3, ORCA4, or ORCA5 in the tobacco protoplast assay. A 782
plasmid containing the GUS reporter, driven by the CaMV 35S promoter and rbcS terminator, 783
was used as internal control. Control (CN) represents reporter plasmid alone. The LUC and GUS 784
activities were measured 20 h after electroporation. The LUC activity was normalized against the 785
GUS activity. Data represent mean ± SDs of three biological replicates each with 4-5 samples. 786
Different letters denote statistical differences as assessed by one-way ANOVA and Tukey HSD 787
test, p < 0.05 (B) Relative expression of PMT and QPT in two empty vector (EV1 and EV2) 788
control and two ORCA5-overexpressing (OE-1, OE-2) tobacco hairy root lines, as measured by 789
RT-qPCR. The tobacco elongation factor 1 œ (EF1œ) was used as an internal control. (C) 790
Nicotine contents in two empty vector-control (EV1 and EV2) and two ORCA5-overexpression 791
(OE-1 and OE-2) tobacco hairy root lines. Nicotine concentrations are presented as percentage 792
dry weight (%DW). (D) Relative expression of STR in EV1 and EV2 (control) and two ERF189-793
overexpressing (189OE-1, 189OE-2) Catharanthus hairy root lines, as measured by RT-qPCR. 794
The Catharanthus EF1œ was used as an internal control. (E) Measurement of ajmalicine, 795
catharanthine, and tabersonine in EV1 and EV2 controls, and OE-1, and OE-2. Alkaloids were 796
extracted and analyzed using LC-MS/MS, and the levels of alkaloids were estimated based on 797
peak areas compared to standards. Data presented here are the means ± SDs of three biological 798
replicates. Statistical significance was calculated using the Student’s t-test, * p <0.05, ** p <0.01, 799
*** p <0.001. (F) A model depicting the mutual regulatory relationship among and between the 800
ORCA and NIC2 locus AP2/ERFs. The thin solid arrows represent direct activation and broken 801
arrows represent indirect activation within a cluster. The thick arrows indicate the inter-species 802
mutual regulation of the ERFs. 803
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
28
804
Literature Cited 805
Boycheva S, Daviet L, Wolfender JL, Fitzpatrick TB (2014) The rise of operon-like gene 806
clusters in plants. Trends Plant Sci 19: 447-459 807
Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL 808 (2009) BLAST+: architecture and applications. BMC Bioinformatics 10: 421 809
Cardenas PD, Sonawane PD, Pollier J, Vanden Bossche R, Dewangan V, Weithorn E, Tal 810
L, Meir S, Rogachev I, Malitsky S, Giri AP, Goossens A, Burdman S, Aharoni A 811 (2016) GAME9 regulates the biosynthesis of steroidal alkaloids and upstream isoprenoids 812
in the plant mevalonate pathway. Nat Commun 7: 10654 813
Carqueijeiro I, Brown S, Chung K, Dang TT, Walia M, Besseau S, Duge de Bernonville T, 814
Oudin A, Lanoue A, Billet K, Munsch T, Koudounas K, Melin C, Godon C, 815
Razafimandimby B, de Craene JO, Glevarec G, Marc J, Giglioli-Guivarc'h N, 816 Clastre M, St-Pierre B, Papon N, Andrade RB, O'Connor SE, Courdavault V (2018) 817
Two Tabersonine 6,7-Epoxidases Initiate Lochnericine-Derived Alkaloid Biosynthesis in 818
Catharanthus roseus. Plant Physiol 177: 1473-1486 819
Carqueijeiro I, Duge de Bernonville T, Lanoue A, Dang TT, Teijaro CN, Paetz C, Billet K, 820
Mosquera A, Oudin A, Besseau S, Papon N, Glevarec G, Atehortua L, Clastre M, 821
Giglioli-Guivarc'h N, Schneider B, St-Pierre B, Andrade RB, O'Connor SE, 822 Courdavault V (2018) A BAHD acyltransferase catalyzing 19-O-acetylation of 823
tabersonine derivatives in roots of Catharanthus roseus enables combinatorial synthesis of 824
monoterpene indole alkaloids. Plant J 94: 469-484 825
Chae L, Kim T, Nilo-Poyanco R, Rhee SY (2014) Genomic signatures of specialized 826
metabolism in plants. Science 344: 510-513 827
Chatel G, Montiel G, Pre M, Memelink J, Thiersault M, Saint-Pierre B, Doireau P, Gantet 828 P (2003) CrMYC1, a Catharanthus roseus elicitor- and jasmonate-responsive bHLH 829
transcription factor that binds the G-box element of the strictosidine synthase gene 830
promoter. J Exp Bot 54: 2587-2588 831
Chini A, Fonseca S, Fernandez G, Adie B, Chico JM, Lorenzo O, Garcia-Casado G, Lopez-832 Vidriero I, Lozano FM, Ponce MR, Micol JL, Solano R (2007) The JAZ family of 833
repressors is the missing link in jasmonate signalling. Nature 448: 666-671 834
Colinas M, Goossens A (2018) Combinatorial Transcriptional Control of Plant Specialized 835
Metabolism. Trends Plant Sci 23: 324-336 836
De Boer K, Tilleman S, Pauwels L, Vanden Bossche R, De Sutter V, Vanderhaeghen R, 837 Hilson P, Hamill JD, Goossens A (2011) APETALA2/ETHYLENE RESPONSE 838
FACTOR and basic helix–loop–helix tobacco transcription factors cooperatively mediate 839
jasmonate‐elicited nicotine biosynthesis. Plant J 66: 1053-1065 840
Fernandez-Pozo N, Menda N, Edwards JD, Saha S, Tecle IY, Strickler SR, Bombarely A, 841 Fisher-York T, Pujar A, Foerster H, Yan A, Mueller LA (2015) The Sol Genomics 842
Network (SGN)--from genotype to phenotype to breeding. Nucleic Acids Res 43: D1036-843
1041 844
Finn RD, Coggill P, Eberhardt RY, Eddy SR, Mistry J, Mitchell AL, Potter SC, Punta M, 845 Qureshi M, Sangrador-Vegas A, Salazar GA, Tate J, Bateman A (2016) The Pfam 846
protein families database: towards a more sustainable future. Nucleic Acids Res 44: 847
D279-285 848
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
29
Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M (2000) Arabidopsis ethylene-849
responsive element binding factors act as transcriptional activators or repressors of GCC 850
box–mediated gene expression. Plant Cell 12: 393-404 851
Ganko EW, Meyers BC, Vision TJ (2007) Divergence in Expression between Duplicated 852
Genes in Arabidopsis. Mol Biol and Evol 24: 2298-2309 853
Giddings L-A, Liscombe DK, Hamilton JP, Childs KL, DellaPenna D, Buell CR, O'Connor 854 SE (2011) A stereoselective hydroxylation step of alkaloid biosynthesis by a unique 855
cytochrome P450 in Catharanthus roseus. J Biol Chem 286: 16751-16757 856
Gilmour SJ, Zarka DG, Stockinger EJ, Salazar MP, Houghton JM, Thomashow MF (1998) 857
Low temperature regulation of the Arabidopsis CBF family of AP2 transcriptional 858
activators as an early step in cold-induced COR gene expression. Plant J 16: 433-442 859
Hagen G, Guilfoyle T (2002) Auxin-responsive gene expression: genes, promoters and 860
regulatory factors. Plant Mol Biol 49: 373-385 861
He Z, Zhang H, Gao S, Lercher MJ, Chen WH, Hu S (2016) Evolview v2: an online 862
visualization and management tool for customized and annotated phylogenetic trees. 863
Nucleic Acids Res 44: W236-241 864
Kajikawa M, Sierro N, Kawaguchi H, Bakaher N, Ivanov NV, Hashimoto T, Shoji T (2017) 865
Genomic Insights into the Evolution of the Nicotine Biosynthesis Pathway in Tobacco. 866
Plant Physiol 174: 999-1011 867
Kazan K, Manners JM (2013) MYC2: The Master in Action. Molecular Plant 6: 686-703 868
Kellner F, Kim J, Clavijo BJ, Hamilton JP, Childs KL, Vaillancourt B, Cepela J, 869 Habermann M, Steuernagel B, Clissold L, McLay K, Buell CR, O'Connor SE (2015) 870
Genome‐guided investigation of plant natural product biosynthesis. Plant J 82: 680-692 871
Laflamme P, St-Pierre B, De Luca V (2001) Molecular and biochemical analysis of a 872
Madagascar periwinkle root-specific minovincinine-19-hydroxy-O-acetyltransferase. 873
Plant Physiol 125: 189-198 874
Lappin TR, Grier DG, Thompson A, Halliday HL (2006) HOX genes: seductive science, 875
mysterious mechanisms. Ulster Med J 75: 23-31 876
Lewis RS, Jack AM, Morris JW, Robert VJ, Gavilano LB, Siminszky B, Bush LP, Hayes 877 AJ, Dewey RE (2008) RNA interference (RNAi)-induced suppression of nicotine 878
demethylase activity reduces levels of a key carcinogen in cured tobacco leaves. Plant 879
Biotechnol J 6: 346-354 880
Li J, Zhang K, Meng Y, Hu J, Ding M, Bian J, Yan M, Han J, Zhou M (2018) Jasmonic 881
acid/Ethylene signaling coordinates hydroxycinnamic acid amides biosynthesis through 882
ORA59 transcription factor. Plant J 95:444-457 883
Liscombe DK, Usera AR, O'Connor SE (2010) Homolog of tocopherol C methyltransferases 884
catalyzes N methylation in anticancer alkaloid biosynthesis. Proc Natl Acad Sci USA 885
107: 18793-18798 886
Liu Y, Du M, Deng L, Shen J, Fang M, Chen Q, Lu Y, Wang Q, Li C, Zhai Q (2019) MYC2 887
Regulates the Termination of Jasmonate Signaling via an Autoregulatory Negative 888
Feedback Loop. Plant Cell 31:106-127 889
Lu X, Zhang L, Zhang F, Jiang W, Shen Q, Zhang L, Lv Z, Wang G, Tang K (2013) 890
AaORA, a trichome-specific AP2/ERF transcription factor of Artemisia annua, is a 891
positive regulator in the artemisinin biosynthetic pathway and in disease resistance to 892
Botrytis cinerea. New Phytol 198: 1191-1202 893
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
30
Matsui K, Umemura Y, Ohme‐Takagi M (2008) AtMYBL2, a protein with a single MYB 894
domain, acts as a negative regulator of anthocyanin biosynthesis in Arabidopsis. Plant J 895
55: 954-967 896
Mirjalili N, Linden JC (1996) Methyl jasmonate induced production of taxol in suspension 897
cultures of Taxus cuspidata: ethylene interaction and induction models. Biotech Progress 898
12: 110-118 899
Montavon T, Duboule D (2013) Chromatin organization and global regulation of Hox gene 900
clusters. Philos Trans R Soc Lond B Biol Sci 368: 20120367 901
Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysis of the ERF gene 902
family in Arabidopsis and rice. Plant Physiol 140: 411-432 903
Nakayasu M, Shioya N, Shikata M, Thagun C, Abdelkareem A, Okabe Y, Ariizumi T, 904 Arimura GI, Mizutani M, Ezura H, Hashimoto T, Shoji T (2018) JRE4 is a master 905
transcriptional regulator of defense-related steroidal glycoalkaloids in tomato. Plant J 906
94:975-990 907
Nützmann H-W, Osbourn A (2014) Gene clustering in plant specialized metabolism. Curr 908
Opin Biotech 26: 91-99 909
Nützmann HW, Huang A, Osbourn A (2016) Plant metabolic clusters–from genetics to 910
genomics. New Phytol 211: 771-789 911
Patra B, Pattanaik S, Schluttenhofer C, Yuan L (2018) A network of jasmonate‐responsive 912
bHLH factors modulate monoterpenoid indole alkaloid biosynthesis in Catharanthus 913
roseus. New Phytol 217: 1566-1581 914
Pattanaik S, Kong Q, Zaitlin D, Werkman J, Xie C, Patra B, Yuan L (2010) Isolation and 915
functional characterization of a floral tissue-specific R2R3 MYB regulator from tobacco. 916
Planta 231: 1061-1076 917
Pattanaik S, Werkman JR, Kong Q, Yuan L (2010) Site-Directed Mutagenesis and Saturation 918
Mutagenesis for the Functional Study of Transcription Factors Involved in Plant 919
Secondary Metabolite Biosynthesis. In AG Fett-Neto, ed, Plant Secondary Metabolism 920
Engineering: Methods and Applications. Humana Press, Totowa, NJ, pp 47-57 921
Paul P, Singh SK, Patra B, Sui X, Pattanaik S, Yuan L (2017) A differentially regulated 922
AP2/ERF transcription factor gene cluster acts downstream of a MAP kinase cascade to 923
modulate terpenoid indole alkaloid biosynthesis in Catharanthus roseus. New Phytol 213: 924
1107-1123 925
Pauw B, Hilliou FAO, Martin VS, Chatel G, de Wolf CJF, Champion A, Pré M, van Duijn 926 B, Kijne JW, van der Fits L, Memelink J (2004) Zinc Finger Proteins Act as 927
Transcriptional Repressors of Alkaloid Biosynthesis Genes in Catharanthus roseus. J Biol 928
Chem 279: 52940-52948 929
Peebles CA, Hughes EH, Shanks JV, San KY (2009) Transcriptional response of the terpenoid 930
indole alkaloid pathway to the overexpression of ORCA3 along with jasmonic acid 931
elicitation of Catharanthus roseus hairy roots over time. Metab Eng 11: 76-86 932
Qu Y, Easson M, Simionescu R, Hajicek J, Thamm AMK, Salim V, De Luca V (2018) 933
Solution of the multistep pathway for assembly of corynanthean, strychnos, iboga, and 934
aspidosperma monoterpenoid indole alkaloids from 19E-geissoschizine. Proc Natl Acad 935
Sci U S A 115: 3180-3185 936
Qu Y, Safonova O, De Luca V (2019) Completion of the canonical pathway for assembly of 937
anticancer drugs vincristine/vinblastine in Catharanthus roseus. Plant J 97: 257-266 938
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
31
Rensing SA, Lang D, Zimmer AD, Terry A, Salamov A, Shapiro H, Nishiyama T, Perroud 939 P-F, Lindquist EA, Kamisugi Y (2008) The Physcomitrella genome reveals 940
evolutionary insights into the conquest of land by plants. Science 319: 64-69 941
Sanchez-Perez R, Pavan S, Mazzeo R, Moldovan C, Aiese Cigliano R, Del Cueto J, 942 Ricciardi F, Lotti C, Ricciardi L, Dicenta F, Lopez-Marques RL, Moller BL (2019) 943
Mutation of a bHLH transcription factor allowed almond domestication. Science 364: 944
1095-1098 945
Schweizer F, Colinas M, Pollier J, Van Moerkercke A, Vanden Bossche R, de Clercq R, 946 Goossens A (2018) An engineered combinatorial module of transcription factors boosts 947
production of monoterpenoid indole alkaloids in Catharanthus roseus. Metab Eng 48: 948
150-162 949
Shen Q, Lu X, Yan T, Fu X, Lv Z, Zhang F, Pan Q, Wang G, Sun X, Tang K (2016) The 950
jasmonate‐responsive AaMYC2 transcription factor positively regulates artemisinin 951
biosynthesis in Artemisia annua. New Phytol 210: 1269-1281 952
Shoji T, Hashimoto T (2011) Tobacco MYC2 regulates jasmonate-inducible nicotine 953
biosynthesis genes directly and by way of the NIC2-locus ERF genes. Plant Cell Physiol 954
52: 1117-1130 955
Shoji T, Kajikawa M, Hashimoto T (2010) Clustered transcription factor genes regulate 956
nicotine biosynthesis in tobacco. Plant Cell 22: 3390-3409 957
Shoji T, Mishima M, Hashimoto T (2013) Divergent DNA-binding specificities of a group of 958
ETHYLENE RESPONSE FACTOR transcription factors involved in plant defense. Plant 959
Physiol 162: 977-990 960
Shoji T, Nakajima K, Hashimoto T (2000) Ethylene Suppresses Jasmonate-Induced Gene 961
Expression in Nicotine Biosynthesis. Plant and Cell Physiology 41: 1072-1076 962
Suttipanta N, Pattanaik S, Gunjan S, Xie CH, Littleton J, Yuan L (2007) Promoter analysis 963
of the Catharanthus roseus geraniol 10-hydroxylase gene involved in terpenoid indole 964
alkaloid biosynthesis. Biochim Biophys Acta 1769: 139-148 965
Suttipanta N, Pattanaik S, Kulshrestha M, Patra B, Singh SK, Yuan L (2011) The 966
Transcription Factor CrWRKY1 Positively Regulates the Terpenoid Indole Alkaloid 967
Biosynthesis in Catharanthus roseus. Plant Physiol 157: 2081-2093 968
Thagun C, Imanishi S, Kudo T, Nakabayashi R, Ohyama K, Mori T, Kawamoto K, 969
Nakamura Y, Katayama M, Nonaka S, Matsukura C, Yano K, Ezura H, Saito K, 970 Hashimoto T, Shoji T (2016) Jasmonate-Responsive ERF Transcription Factors 971
Regulate Steroidal Glycoalkaloid Biosynthesis in Tomato. Plant Cell Physiol 57: 961-975 972
Udomsom N, Rai A, Suzuki H, Okuyama J, Imai R, Mori T, Nakabayashi R, Saito K, 973 Yamazaki M (2016) Function of AP2/ERF Transcription Factors Involved in the 974
Regulation of Specialized Metabolism in Ophiorrhiza pumila Revealed by 975
Transcriptomics and Metabolomics. Front Plant Sci 7: 1861 976
van der Fits L, Memelink J (2000) ORCA3, a Jasmonate-Responsive Transcriptional Regulator 977
of Plant Primary and Secondary Metabolism. Science 289: 295-297 978
Van Der Fits L, Memelink J (2001) The jasmonate‐inducible AP2/ERF‐domain transcription 979
factor ORCA3 activates gene expression via interaction with a jasmonate‐responsive 980
promoter element. Plant J 25: 43-53 981
van der Heijden R, Schripsema J, Verpoorte R (2004) The Catharanthus alkaloids: 982
pharmacognosy and biotechnology. Curr Med Chem 11: 607-628 983
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
32
Van Moerkercke A, Steensma P, Gariboldi I, Espoz J, Purnama PC, Schweizer F, 984 Miettinen K, Vanden Bossche R, De Clercq R, Memelink J, Goossens A (2016) The 985
basic helix-loop-helix transcription factor BIS2 is essential for monoterpenoid indole 986
alkaloid production in the medicinal plant Catharanthus roseus. Plant J 88: 3-12 987
Van Moerkercke A, Steensma P, Schweizer F, Pollier J, Gariboldi I, Payne R, Vanden 988
Bossche R, Miettinen K, Espoz J, Purnama PC, Kellner F, Seppanen-Laakso T, 989 O'Connor SE, Rischer H, Memelink J, Goossens A (2015) The bHLH transcription 990
factor BIS1 controls the iridoid branch of the monoterpenoid indole alkaloid pathway in 991
Catharanthus roseus. Proc Natl Acad Sci U S A 112: 8130-8135 992
Wang C-T, Liu H, Gao X-S, Zhang H-X (2010) Overexpression of G10H and ORCA3 in the 993
hairy roots of Catharanthus roseus improves catharanthine production. Plant Cell Rep 29: 994
887-894 995
Williams D, Qu Y, Simionescu R, De Luca V (2019) The assembly of (+)-vincadifformine- 996
and (-)-tabersonine-derived monoterpenoid indole alkaloids in Catharanthus roseus 997
involves separate branch pathways. Plant J 99: 626-636 998
Winz RA, Baldwin IT (2001) Molecular Interactions between the Specialist Herbivore 999
Manduca sexta (Lepidoptera, Sphingidae) and Its Natural Host Nicotiana attenuata. IV. 1000
Insect-Induced Ethylene Reduces Jasmonate-Induced Nicotine Accumulation by 1001
Regulating Putrescine N-Methyltransferase Transcripts. Plant Physiol 125: 2189-2202 1002
Yang SH, Berberich T, Sano H, Kusano T (2001) Specific association of transcripts of tbzF 1003
and tbz17, tobacco genes encoding basic region leucine zipper-type transcriptional 1004
activators, with guard cells of senescing leaves and/or flowers. Plant Physiol 127: 23-32 1005
Yu Z-X, Li J-X, Yang C-Q, Hu W-L, Wang L-J, Chen X-Y (2012) The jasmonate-responsive 1006
AP2/ERF transcription factors AaERF1 and AaERF2 positively regulate artemisinin 1007
biosynthesis in Artemisia annua L. Mol Plant 5: 353-365 1008
Zhang H, Koes R, Shang H, Fu Z, Wang L, Dong X, Zhang J, Passeri V, Li Y, Jiang H, 1009 Gao J, Li Y, Wang H, Quattrocchio FM (2019) Identification and functional analysis 1010
of three new anthocyanin R2R3-MYB genes in Petunia. Plant Direct 3: e00114 1011
Zhang P, Chopra S, Peterson T (2000) A segmental gene duplication generated differentially 1012
expressed myb-homologous genes in maize. Plant Cell 12: 2311-2322 1013
Zhang X, Fowler SG, Cheng H, Lou Y, Rhee SY, Stockinger EJ, Thomashow MF (2004) 1014
Freezing-sensitive tomato has a functional CBF cold response pathway, but a CBF 1015
regulon that differs from that of freezing-tolerant Arabidopsis. Plant J 39: 905-919 1016
Zhao J, Zheng SH, Fujita K, Sakai K (2004) Jasmonate and ethylene signalling and their 1017
interaction are integral parts of the elicitor signalling pathway leading to β‐thujaplicin 1018
biosynthesis in Cupressus lusitanica cell cultures. J Exp Bot 55: 1003-1012 1019
Zhou M-L, Zhu X-M, Shao J-R, Wu Y-M, Tang Y-X (2010) Transcriptional response of the 1020
catharanthine biosynthesis pathway to methyl jasmonate/nitric oxide elicitation in 1021
Catharanthus roseus hairy root culture. Appl Microbiol Biotechnol 88: 737-750 1022
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
Parsed CitationsBoycheva S, Daviet L, Wolfender JL, Fitzpatrick TB (2014) The rise of operon-like gene clusters in plants. Trends Plant Sci 19: 447-459
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL (2009) BLAST+: architecture and applications. BMCBioinformatics 10: 421
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Cardenas PD, Sonawane PD, Pollier J, Vanden Bossche R, Dewangan V, Weithorn E, Tal L, Meir S, Rogachev I, Malitsky S, Giri AP,Goossens A, Burdman S, Aharoni A (2016) GAME9 regulates the biosynthesis of steroidal alkaloids and upstream isoprenoids in theplant mevalonate pathway. Nat Commun 7: 10654
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Carqueijeiro I, Brown S, Chung K, Dang TT, Walia M, Besseau S, Duge de Bernonville T, Oudin A, Lanoue A, Billet K, Munsch T,Koudounas K, Melin C, Godon C, Razafimandimby B, de Craene JO, Glevarec G, Marc J, Giglioli-Guivarc'h N, Clastre M, St-Pierre B,Papon N, Andrade RB, O'Connor SE, Courdavault V (2018) Two Tabersonine 6,7-Epoxidases Initiate Lochnericine-Derived AlkaloidBiosynthesis in Catharanthus roseus. Plant Physiol 177: 1473-1486
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Carqueijeiro I, Duge de Bernonville T, Lanoue A, Dang TT, Teijaro CN, Paetz C, Billet K, Mosquera A, Oudin A, Besseau S, Papon N,Glevarec G, Atehortua L, Clastre M, Giglioli-Guivarc'h N, Schneider B, St-Pierre B, Andrade RB, O'Connor SE, Courdavault V (2018) ABAHD acyltransferase catalyzing 19-O-acetylation of tabersonine derivatives in roots of Catharanthus roseus enables combinatorialsynthesis of monoterpene indole alkaloids. Plant J 94: 469-484
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Chae L, Kim T, Nilo-Poyanco R, Rhee SY (2014) Genomic signatures of specialized metabolism in plants. Science 344: 510-513Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Chatel G, Montiel G, Pre M, Memelink J, Thiersault M, Saint-Pierre B, Doireau P, Gantet P (2003) CrMYC1, a Catharanthus roseuselicitor- and jasmonate-responsive bHLH transcription factor that binds the G-box element of the strictosidine synthase genepromoter. J Exp Bot 54: 2587-2588
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Chini A, Fonseca S, Fernandez G, Adie B, Chico JM, Lorenzo O, Garcia-Casado G, Lopez-Vidriero I, Lozano FM, Ponce MR, Micol JL,Solano R (2007) The JAZ family of repressors is the missing link in jasmonate signalling. Nature 448: 666-671
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Colinas M, Goossens A (2018) Combinatorial Transcriptional Control of Plant Specialized Metabolism. Trends Plant Sci 23: 324-336Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
De Boer K, Tilleman S, Pauwels L, Vanden Bossche R, De Sutter V, Vanderhaeghen R, Hilson P, Hamill JD, Goossens A (2011)APETALA2/ETHYLENE RESPONSE FACTOR and basic helix–loop–helix tobacco transcription factors cooperatively mediatejasmonate‐elicited nicotine biosynthesis. Plant J 66: 1053-1065
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Fernandez-Pozo N, Menda N, Edwards JD, Saha S, Tecle IY, Strickler SR, Bombarely A, Fisher-York T, Pujar A, Foerster H, Yan A,Mueller LA (2015) The Sol Genomics Network (SGN)--from genotype to phenotype to breeding. Nucleic Acids Res 43: D1036-1041
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Finn RD, Coggill P, Eberhardt RY, Eddy SR, Mistry J, Mitchell AL, Potter SC, Punta M, Qureshi M, Sangrador-Vegas A, Salazar GA, TateJ, Bateman A (2016) The Pfam protein families database: towards a more sustainable future. Nucleic Acids Res 44: D279-285
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Fujimoto SY, Ohta M, Usui A, Shinshi H, Ohme-Takagi M (2000) Arabidopsis ethylene-responsive element binding factors act astranscriptional activators or repressors of GCC box–mediated gene expression. Plant Cell 12: 393-404
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Ganko EW, Meyers BC, Vision TJ (2007) Divergence in Expression between Duplicated Genes in Arabidopsis. Mol Biol and Evol 24:2298-2309
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Giddings L-A, Liscombe DK, Hamilton JP, Childs KL, DellaPenna D, Buell CR, O'Connor SE (2011) A stereoselective hydroxylation stepof alkaloid biosynthesis by a unique cytochrome P450 in Catharanthus roseus. J Biol Chem 286: 16751-16757
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Gilmour SJ, Zarka DG, Stockinger EJ, Salazar MP, Houghton JM, Thomashow MF (1998) Low temperature regulation of the ArabidopsisCBF family of AP2 transcriptional activators as an early step in cold-induced COR gene expression. Plant J 16: 433-442
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Hagen G, Guilfoyle T (2002) Auxin-responsive gene expression: genes, promoters and regulatory factors. Plant Mol Biol 49: 373-385Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
He Z, Zhang H, Gao S, Lercher MJ, Chen WH, Hu S (2016) Evolview v2: an online visualization and management tool for customizedand annotated phylogenetic trees. Nucleic Acids Res 44: W236-241
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kajikawa M, Sierro N, Kawaguchi H, Bakaher N, Ivanov NV, Hashimoto T, Shoji T (2017) Genomic Insights into the Evolution of theNicotine Biosynthesis Pathway in Tobacco. Plant Physiol 174: 999-1011
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kazan K, Manners JM (2013) MYC2: The Master in Action. Molecular Plant 6: 686-703Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Kellner F, Kim J, Clavijo BJ, Hamilton JP, Childs KL, Vaillancourt B, Cepela J, Habermann M, Steuernagel B, Clissold L, McLay K, BuellCR, O'Connor SE (2015) Genome‐guided investigation of plant natural product biosynthesis. Plant J 82: 680-692
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Laflamme P, St-Pierre B, De Luca V (2001) Molecular and biochemical analysis of a Madagascar periwinkle root-specific minovincinine-19-hydroxy-O-acetyltransferase. Plant Physiol 125: 189-198
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lappin TR, Grier DG, Thompson A, Halliday HL (2006) HOX genes: seductive science, mysterious mechanisms. Ulster Med J 75: 23-31Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lewis RS, Jack AM, Morris JW, Robert VJ, Gavilano LB, Siminszky B, Bush LP, Hayes AJ, Dewey RE (2008) RNA interference (RNAi)-induced suppression of nicotine demethylase activity reduces levels of a key carcinogen in cured tobacco leaves. Plant Biotechnol J6: 346-354
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Li J, Zhang K, Meng Y, Hu J, Ding M, Bian J, Yan M, Han J, Zhou M (2018) Jasmonic acid/Ethylene signaling coordinateshydroxycinnamic acid amides biosynthesis through ORA59 transcription factor. Plant J 95:444-457
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Liscombe DK, Usera AR, O'Connor SE (2010) Homolog of tocopherol C methyltransferases catalyzes N methylation in anticanceralkaloid biosynthesis. Proc Natl Acad Sci USA 107: 18793-18798
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Liu Y, Du M, Deng L, Shen J, Fang M, Chen Q, Lu Y, Wang Q, Li C, Zhai Q (2019) MYC2 Regulates the Termination of JasmonateSignaling via an Autoregulatory Negative Feedback Loop. Plant Cell 31:106-127
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Lu X, Zhang L, Zhang F, Jiang W, Shen Q, Zhang L, Lv Z, Wang G, Tang K (2013) AaORA, a trichome-specific AP2/ERF transcriptionfactor of Artemisia annua, is a positive regulator in the artemisinin biosynthetic pathway and in disease resistance to Botrytis cinerea.New Phytol 198: 1191-1202
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Matsui K, Umemura Y, Ohme‐Takagi M (2008) AtMYBL2, a protein with a single MYB domain, acts as a negative regulator ofanthocyanin biosynthesis in Arabidopsis. Plant J 55: 954-967
Pubmed: Author and Title www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
Google Scholar: Author Only Title Only Author and Title
Mirjalili N, Linden JC (1996) Methyl jasmonate induced production of taxol in suspension cultures of Taxus cuspidata: ethyleneinteraction and induction models. Biotech Progress 12: 110-118
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Montavon T, Duboule D (2013) Chromatin organization and global regulation of Hox gene clusters. Philos Trans R Soc Lond B Biol Sci368: 20120367
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nakano T, Suzuki K, Fujimura T, Shinshi H (2006) Genome-wide analysis of the ERF gene family in Arabidopsis and rice. Plant Physiol140: 411-432
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nakayasu M, Shioya N, Shikata M, Thagun C, Abdelkareem A, Okabe Y, Ariizumi T, Arimura GI, Mizutani M, Ezura H, Hashimoto T, ShojiT (2018) JRE4 is a master transcriptional regulator of defense-related steroidal glycoalkaloids in tomato. Plant J 94:975-990
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nützmann H-W, Osbourn A (2014) Gene clustering in plant specialized metabolism. Curr Opin Biotech 26: 91-99Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Nützmann HW, Huang A, Osbourn A (2016) Plant metabolic clusters–from genetics to genomics. New Phytol 211: 771-789Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Patra B, Pattanaik S, Schluttenhofer C, Yuan L (2018) A network of jasmonate‐responsive bHLH factors modulate monoterpenoidindole alkaloid biosynthesis in Catharanthus roseus. New Phytol 217: 1566-1581
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Pattanaik S, Kong Q, Zaitlin D, Werkman J, Xie C, Patra B, Yuan L (2010) Isolation and functional characterization of a floral tissue-specific R2R3 MYB regulator from tobacco. Planta 231: 1061-1076
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Pattanaik S, Werkman JR, Kong Q, Yuan L (2010) Site-Directed Mutagenesis and Saturation Mutagenesis for the Functional Study ofTranscription Factors Involved in Plant Secondary Metabolite Biosynthesis. In AG Fett-Neto, ed, Plant Secondary MetabolismEngineering: Methods and Applications. Humana Press, Totowa, NJ, pp 47-57
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Paul P, Singh SK, Patra B, Sui X, Pattanaik S, Yuan L (2017) A differentially regulated AP2/ERF transcription factor gene cluster actsdownstream of a MAP kinase cascade to modulate terpenoid indole alkaloid biosynthesis in Catharanthus roseus. New Phytol 213:1107-1123
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Pauw B, Hilliou FAO, Martin VS, Chatel G, de Wolf CJF, Champion A, Pré M, van Duijn B, Kijne JW, van der Fits L, Memelink J (2004)Zinc Finger Proteins Act as Transcriptional Repressors of Alkaloid Biosynthesis Genes in Catharanthus roseus. J Biol Chem 279:52940-52948
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Peebles CA, Hughes EH, Shanks JV, San KY (2009) Transcriptional response of the terpenoid indole alkaloid pathway to theoverexpression of ORCA3 along with jasmonic acid elicitation of Catharanthus roseus hairy roots over time. Metab Eng 11: 76-86
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Qu Y, Easson M, Simionescu R, Hajicek J, Thamm AMK, Salim V, De Luca V (2018) Solution of the multistep pathway for assembly ofcorynanthean, strychnos, iboga, and aspidosperma monoterpenoid indole alkaloids from 19E-geissoschizine. Proc Natl Acad Sci U S A115: 3180-3185
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Qu Y, Safonova O, De Luca V (2019) Completion of the canonical pathway for assembly of anticancer drugs vincristine/vinblastine inCatharanthus roseus. Plant J 97: 257-266
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Rensing SA, Lang D, Zimmer AD, Terry A, Salamov A, Shapiro H, Nishiyama T, Perroud P-F, Lindquist EA, Kamisugi Y (2008) The www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
Physcomitrella genome reveals evolutionary insights into the conquest of land by plants. Science 319: 64-69Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Sanchez-Perez R, Pavan S, Mazzeo R, Moldovan C, Aiese Cigliano R, Del Cueto J, Ricciardi F, Lotti C, Ricciardi L, Dicenta F, Lopez-Marques RL, Moller BL (2019) Mutation of a bHLH transcription factor allowed almond domestication. Science 364: 1095-1098
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Schweizer F, Colinas M, Pollier J, Van Moerkercke A, Vanden Bossche R, de Clercq R, Goossens A (2018) An engineered combinatorialmodule of transcription factors boosts production of monoterpenoid indole alkaloids in Catharanthus roseus. Metab Eng 48: 150-162
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Shen Q, Lu X, Yan T, Fu X, Lv Z, Zhang F, Pan Q, Wang G, Sun X, Tang K (2016) The jasmonate‐responsive AaMYC2 transcriptionfactor positively regulates artemisinin biosynthesis in Artemisia annua. New Phytol 210: 1269-1281
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Shoji T, Hashimoto T (2011) Tobacco MYC2 regulates jasmonate-inducible nicotine biosynthesis genes directly and by way of the NIC2-locus ERF genes. Plant Cell Physiol 52: 1117-1130
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Shoji T, Kajikawa M, Hashimoto T (2010) Clustered transcription factor genes regulate nicotine biosynthesis in tobacco. Plant Cell 22:3390-3409
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Shoji T, Mishima M, Hashimoto T (2013) Divergent DNA-binding specificities of a group of ETHYLENE RESPONSE FACTORtranscription factors involved in plant defense. Plant Physiol 162: 977-990
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Shoji T, Nakajima K, Hashimoto T (2000) Ethylene Suppresses Jasmonate-Induced Gene Expression in Nicotine Biosynthesis. Plantand Cell Physiology 41: 1072-1076
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Suttipanta N, Pattanaik S, Gunjan S, Xie CH, Littleton J, Yuan L (2007) Promoter analysis of the Catharanthus roseus geraniol 10-hydroxylase gene involved in terpenoid indole alkaloid biosynthesis. Biochim Biophys Acta 1769: 139-148
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Suttipanta N, Pattanaik S, Kulshrestha M, Patra B, Singh SK, Yuan L (2011) The Transcription Factor CrWRKY1 Positively Regulatesthe Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus. Plant Physiol 157: 2081-2093
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Thagun C, Imanishi S, Kudo T, Nakabayashi R, Ohyama K, Mori T, Kawamoto K, Nakamura Y, Katayama M, Nonaka S, Matsukura C,Yano K, Ezura H, Saito K, Hashimoto T, Shoji T (2016) Jasmonate-Responsive ERF Transcription Factors Regulate SteroidalGlycoalkaloid Biosynthesis in Tomato. Plant Cell Physiol 57: 961-975
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Udomsom N, Rai A, Suzuki H, Okuyama J, Imai R, Mori T, Nakabayashi R, Saito K, Yamazaki M (2016) Function of AP2/ERF TranscriptionFactors Involved in the Regulation of Specialized Metabolism in Ophiorrhiza pumila Revealed by Transcriptomics and Metabolomics.Front Plant Sci 7: 1861
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
van der Fits L, Memelink J (2000) ORCA3, a Jasmonate-Responsive Transcriptional Regulator of Plant Primary and SecondaryMetabolism. Science 289: 295-297
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Van Der Fits L, Memelink J (2001) The jasmonate‐inducible AP2/ERF‐domain transcription factor ORCA3 activates gene expression viainteraction with a jasmonate‐responsive promoter element. Plant J 25: 43-53
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
van der Heijden R, Schripsema J, Verpoorte R (2004) The Catharanthus alkaloids: pharmacognosy and biotechnology. Curr Med Chem11: 607-628
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from
Copyright © 2019 American Society of Plant Biologists. All rights reserved.
Google Scholar: Author Only Title Only Author and Title
Van Moerkercke A, Steensma P, Gariboldi I, Espoz J, Purnama PC, Schweizer F, Miettinen K, Vanden Bossche R, De Clercq R,Memelink J, Goossens A (2016) The basic helix-loop-helix transcription factor BIS2 is essential for monoterpenoid indole alkaloidproduction in the medicinal plant Catharanthus roseus. Plant J 88: 3-12
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Van Moerkercke A, Steensma P, Schweizer F, Pollier J, Gariboldi I, Payne R, Vanden Bossche R, Miettinen K, Espoz J, Purnama PC,Kellner F, Seppanen-Laakso T, O'Connor SE, Rischer H, Memelink J, Goossens A (2015) The bHLH transcription factor BIS1 controlsthe iridoid branch of the monoterpenoid indole alkaloid pathway in Catharanthus roseus. Proc Natl Acad Sci U S A 112: 8130-8135
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Wang C-T, Liu H, Gao X-S, Zhang H-X (2010) Overexpression of G10H and ORCA3 in the hairy roots of Catharanthus roseus improvescatharanthine production. Plant Cell Rep 29: 887-894
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Williams D, Qu Y, Simionescu R, De Luca V (2019) The assembly of (+)-vincadifformine- and (-)-tabersonine-derived monoterpenoidindole alkaloids in Catharanthus roseus involves separate branch pathways. Plant J 99: 626-636
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Winz RA, Baldwin IT (2001) Molecular Interactions between the Specialist Herbivore Manduca sexta (Lepidoptera, Sphingidae) and ItsNatural Host Nicotiana attenuata. IV. Insect-Induced Ethylene Reduces Jasmonate-Induced Nicotine Accumulation by RegulatingPutrescine N-Methyltransferase Transcripts. Plant Physiol 125: 2189-2202
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yang SH, Berberich T, Sano H, Kusano T (2001) Specific association of transcripts of tbzF and tbz17, tobacco genes encoding basicregion leucine zipper-type transcriptional activators, with guard cells of senescing leaves and/or flowers. Plant Physiol 127: 23-32
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Yu Z-X, Li J-X, Yang C-Q, Hu W-L, Wang L-J, Chen X-Y (2012) The jasmonate-responsive AP2/ERF transcription factors AaERF1 andAaERF2 positively regulate artemisinin biosynthesis in Artemisia annua L. Mol Plant 5: 353-365
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhang H, Koes R, Shang H, Fu Z, Wang L, Dong X, Zhang J, Passeri V, Li Y, Jiang H, Gao J, Li Y, Wang H, Quattrocchio FM (2019)Identification and functional analysis of three new anthocyanin R2R3-MYB genes in Petunia. Plant Direct 3: e00114
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhang P, Chopra S, Peterson T (2000) A segmental gene duplication generated differentially expressed myb-homologous genes inmaize. Plant Cell 12: 2311-2322
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhang X, Fowler SG, Cheng H, Lou Y, Rhee SY, Stockinger EJ, Thomashow MF (2004) Freezing-sensitive tomato has a functional CBFcold response pathway, but a CBF regulon that differs from that of freezing-tolerant Arabidopsis. Plant J 39: 905-919
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhao J, Zheng SH, Fujita K, Sakai K (2004) Jasmonate and ethylene signalling and their interaction are integral parts of the elicitorsignalling pathway leading to β‐thujaplicin biosynthesis in Cupressus lusitanica cell cultures. J Exp Bot 55: 1003-1012
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
Zhou M-L, Zhu X-M, Shao J-R, Wu Y-M, Tang Y-X (2010) Transcriptional response of the catharanthine biosynthesis pathway to methyljasmonate/nitric oxide elicitation in Catharanthus roseus hairy root culture. Appl Microbiol Biotechnol 88: 737-750
Pubmed: Author and TitleGoogle Scholar: Author Only Title Only Author and Title
www.plantphysiol.orgon February 5, 2020 - Published by Downloaded from Copyright © 2019 American Society of Plant Biologists. All rights reserved.
top related