sodium benzoate, a common preservative, inhibits growth
Post on 25-Jun-2022
14 Views
Preview:
TRANSCRIPT
Research Paper
Sodium benzoate, a common preservative, inhibits growth, shortens
lifespan, induces premature aging, and accelerates neurodegeneration
Jason Cui
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
1
ABSTRACT
Sodium benzoate is one of the most commonly used preservatives in the food industry. Although
the compound is recognized as safe by the FDA, the effects of sodium benzoate on human health
have been of interest to both the public and the scientific community. The nematode
Caenorhabditis elegans (C. elegans) is an ideal model organism to study the health effects of
sodium benzoate because of its simplicity and its well established genetic toolkit. In this study, I
found that sodium benzoate restricts C. elegans growth, shortens its lifespan, induces premature
aging, and accelerates neurodegeneration. Sodium benzoate functions in parallel with the
insulin/IGF-1 pathway to decrease lifespan. Using an Alzheimer’s disease model that expresses
human beta amyloid peptides, sodium benzoate was revealed to also significantly accelerate
neurodegeneration. Sodium benzoate induced age-pigments in young worms through
accumulating age-pigments in lysosome-related organelles (LROs), contributing to premature
aging and neurodegeneration. Using GFP marker strains and quantitative RT-PCR assays, I
uncovered the role of sodium benzoate in suppressing the irg-1 innate immunity gene expression.
The compromised innate immunity response is another underlying mechanism for the
phenotypes described above. Overall, these results reveal the long term detrimental effects of
sodium benzoate on animal health and it may have similar consequences on human health.
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
2
INTRODUCTION
Sodium benzoate is a commonly used preservative all over the world. It is present in
almost all preserved foods and ingredients such as chips, ramen, etc. and even in carbonated
drinks like Pepsi and Coca-Cola. The FDA maintains that sodium benzoate has no harmful
effects to health and regulates the use of sodium benzoate such that it does not exceed the
concentration 0.1% of the total weight of the substance (CFR FDA et al. 2019). However, at the
time that sodium benzoate was approved by the FDA in 1977, there was no substantial evidence
showing there were no adverse effects of sodium benzoate (McCulloch et al. 2017). After its
approval, there has been no extensive, in-depth research into the overall effect of sodium
benzoate on health. Some studies on sodium benzoate have revealed unreliable results because of
the correlated outcome that play into the health of complex organisms. Khoshnoud et al. (2018)
showed that sodium benzoate severely impaired motor function in mice. In lymphocyte cells,
there were signs of mutations and toxicity after sodium benzoate treatment (Pongsavee et al.
2015). Conversely, Lin et al. (2014) showed that in a 24-week human trial, sodium benzoate
improved cognitive function of patients with early-phase Alzheimer’s disease, but they failed to
see the same positive effects in a 6-week human trial conducted five years later (Lin et al. 2019).
An in-vivo model organism that was both simple and had well-established genetic tools
was ideal to investigate the role and mechanisms of sodium benzoate in animal health. The
small, free living nematode, Caenorhabditis elegans (C. elegans) offers such a model system.
Many of its molecular functions and genes in development and aging are similar to more
complex organism, like humans. Researchers have also established several transgenic C. elegans
models with Aβ/tau toxicity, including CL2355 (Link et al. 2006, Hassan et al. 2015), allowing
the investigation of sodium benzoate on age-related diseases. Finally, growing and maintaining
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
3
C. elegans is simple, efficient, and inexpensive. It readily consumes the bacteria provided in its
environment, allowing studies on the link between diet and aging in C. elegans to be studied in-
depth (Hunt et al., 2017). Because of our high consumption of sodium benzoate, it is important to
investigate its role in early animal development, as well as the long-term impact on lifespan and
aging. The diet of an organism is often linked to development, aging and lifespan (Fontanta et al.
2015).
In this study, I used C. elegans and discovered that sodium benzoate delayed animal
developmental growth, reduced lifespan, induced premature aging, and accelerated
neurodegeneration.
MATERIALS AND METHODS
Maintaining C. elegans
C. elegans is relatively easy to maintain and do not require constant care. In this research project,
I used the wild type N2 strain, glo-1(zu391), a temperature-sensitive beta-amyloid induced C.
elegans strain (CL2355), and multiple transgenic GFP (green fluorescent protein) strains.
CL2355 worms were maintained at 15°C while the wild type N2 worms (and the transgenic GFP
worms) were kept at 20°C. Using chunking methods, crowded plates were maintained with a
small portion of it moved to fresh NGM plates every three to four days.
Escherichia coli (E. coli) Preparation
In this study, the non-pathogenic E. coli OP50, was used as the food source for C. elegans. The
bacteria were cultured in Lysogeny broth (LB) for at least 16 hours (and no more than 24 hours).
250 uL of E. coli culture were then spotted onto 6-cm petri dishes with NGM agar (Nematode
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
4
Growth Medium). After being dried at room temperature for 3 days, the plates were moved to a
4°C cold room for storage.
Preparation of sodium benzoate supplemented plates
Sodium benzoate with the chemical formula C7H5NaO2 was obtained from Sigma-Aldrich. The
concentration of the stock solution of sodium benzoate was 300mg/mL, dissolved in water.
10uL, 25uL, 50uL, and 100uL of the stock solution were mixed with ddH20 (double-distilled
water) to make up to a total volume of 150uL and then applied to the fully grown (3-day old)
bacterial lawns grown through the procedure described above. The final concentration of sodium
benzoate on each plate was 2, 5, 10 and 20 mM (the FDA limit is 9mM).
Synchronization of C. elegans
1) Egg laying synchronization method to obtain less than 100 worms per plate: C. elegans
was grown until the gravid adult stage at their relative growing temperature from the first larval
stage (L1) (3 days for 20°C or 5 days for 15°C). Then, gravid adults were picked and placed onto
the supplemented and control plates and allowed to lay eggs for 2 hours. Then, the gravid adults
were removed from the plates. Worms hatched from these eggs at the same time and grew at a
similar rate.
2) Bleaching method to obtain a large number of worms: Gravid adults grown at their
respective temperatures were collected using M9 buffer and centrifuged at 1400 rpm (rotation
per minute). The supernatant was aspirated and the bleach solution (6.75 mL ddH20, 1.25 mL
4N NaOH, 2 mL NaOCl) was added into the solution. 4-5 minutes were required to break down
the gravid adults and release the eggs. The solution was then centrifuged once again, and the
supernatant aspirated. To relieve the acidity, the eggs were washed a minimum of 2 times with
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
5
M9. The eggs were then left in 5mL of M9 and placed at their relative temperatures for 16-24
hours to fully hatch. All worms’ development was stalled at the L1 stage due to lack of nutrients
in the M9 salt buffer.
Lifespan/Aging Analysis
L4 stage (Larval stage 4) worms were placed onto 2 copies of treatment and control plates and
cultured at either 25°C or 20°C. The worms were fertile for 5-7 days after the L4 stage and to
control progeny presence and to reduce possible starvation factor, the worms were transferred to
new plates with the same concentration of sodium benzoate every day. After their fertility wanes
after 7 days, the worms were then transferred to new plates every three days until no live worms
remained on the plates. The number of live and dead worms were scored every day. Worms were
considered dead if they failed to express a response to external stimuli.
Age-pigment/Lipofuscin assay
Age-pigments, a toxic biomarker of aging, is characterized by auto-fluorescence in the intestinal
region, caused by the accumulation of oxidized macromolecules (Terman et al. 1998). N2 wild
type worms were synchronized and raised from L1 to L4 stage on regular E. coli OP50 plates.
Then, L4 worms were transferred onto petri dishes with various concentrations of sodium
benzoate. They were then incubated for 24 hours at 20°C. 20 worms were then selected
randomly from the treated and untreated groups and mounted onto 3% agarose pads. 1 mM
levamisole was then used to anesthetize the worms. Images were captured using a Nomarski
fluorescence microscope under a DAPI filter (with an excitation of 340–380 nm and emission of
435–485 nm) or a GFP filter (with an excitation of 488 nm and an emission of 510 nm). The
fluorescence intensity was quantified by using Image-J software (NIH).
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
6
Quantitative RT-PCR assays
N2 wild type worms were synchronized and raised from L1 to L4 stage on regular E. coli OP50
plates. L4 stage worms were then grown on sodium benzoate treatment plates for 24 hours at
20°C. Afterwards, 1000-2000 worms of each condition were collected and washed in M9 buffer.
Then the total RNAs were collected through a Trizol based method (Burdine and Stern 1996).
The mRNAs were reverse-transcribed into first strand cDNA with the SuperScript III First-
Strand Synthesis SuperMix (Invitrogen). The expression of selected genes was measured using
the AriaMX real-time PCR instrument (Agilent). The cycle threshold (Ct) value for each
transcript was normalized to the house-keeping gene, act-1. The list of genes that were tested is
shown in Appendix II.
Green fluorescent protein visualization and quantification
A green fluorescent protein (GFP) visualization and expression analysis was also conducted to
investigate sodium benzoate’s role in stress response. The C. elegans transgenic strains stably
expressing DAF-16::GFP (TJ356), SOD-3:: GFP (CF1553), HSP-60::GFP (SJ4058), HSP-
4::GFP (SJ4005), and IRG-1::GFP (AU133) as reporter genes were used to investigate various
stress responses. L4 stage worms were placed on NGM plates supplemented with or without
sodium benzoate and incubated for 24 h at 20 °C. The worms were then mounted on a 3%
agarose pad, with a 1 mM levamisole to anesthetize the worms, and sealed with a coverslip. The
worms were imaged under a GFP filter (with an excitation of 488 nm and an emission of
510 nm) using a fluorescence nomarski microscope. The levels of expression were then
quantified using ImageJ software (NIH).
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
7
Chemotaxis assay
To study the effect of sodium benzoate on neurodegeneration (an age-related disease), a
chemotaxis assay of an Alzheimer’s disease C. elegans model (Luo et al. 2009) was employed.
Synchronized transgenic C. elegans CL2355 were first grown to L3 (Larval 3) stage on E. coli
OP50 plates at 16°C for 36 hours. Then, they were transferred onto plates treated with or without
sodium benzoate and shifted to 23°C for another 36 hours. The worms were then collected and
assayed on 100 mm plates containing NGM agar. The plates were divided into four quadrants (2
for the attractant and 2 for the control). 1 μl of 1 M sodium azide along with 1 μl of odorant
(0.1% benzaldehyde in 100% ethanol) were added to the attractant quadrant. 1 μl of 100%
ethanol and 1 μl drop of sodium azide were added to the control quadrant. Immediately after, 2
μl of the worms (about 60-100 worms) were pipetted to the center of the plate. The assay plates
were then incubated at 23°C for 90 minutes. Afterwards, the number of worms in each quadrant
was scored. The chemotaxis index (CI), using the equation: CI = (number of worms in both
attractant quadrants – number of worms in both control quadrants)/total number of scored
worms, was then calculated (Margie et al. 2013).
Statistical Analysis
Quantitative data are expressed as the mean ± Standard Error of the Mean (SEM). Data were
analyzed by an unpaired two-tailed student’s t-test using Excel 2016. Survival comparisons and
statistical analysis were performed using the Mantel-Cox log-rank test within an online tool (Han
et al. 2016) (https://sbi.postech.ac.kr/oasis2/). Biological replicates reflect different sources of
material and/or experiments performed on different days. Statistical details for experiments are
indicated in the figure legends.
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
8
RESULTS
Sodium benzoate restricts the developmental process of C. elegans
To investigate whether sodium benzoate treatment affects the growth of C. elegans, wild type N2
animals were grown at 20°C under various doses of sodium benzoate starting from L1 stage.
After 48 hrs, the body lengths were assayed using the WormLab video tracking system. In this
assay, I found that the average worm body length decreased in a dose-dependent manner when
compared to the control (2mM of sodium benzoate: 11% decrease (p-value 0.0017), 5mM: 9%
decrease (p-value 0.0036), 10mM: 18% decrease (p-value 5.22474E-08), 20mM: 38% decrease
(p-value 1.11727E-21)) (Figure 1). The two lower concentrations (2mM and 5mM) used in this
study are well below the FDA limit and yet still negatively affected C. elegans’ development.
Sodium benzoate shortens C. elegans lifespan
To investigate the impact of sodium benzoate in animal aging, I conducted a lifespan assay. Wild
type C. elegans were cultured on different doses of sodium benzoate starting from the L4 stage
to circumvent the developmental effect of sodium benzoate. N2 worms grown at 20°C had a
mean lifespan of 20 days on the control medium with solvent only (H2O). The mean lifespan
was shortened to 86.7%, 79.7%, 63.7%, and 53.9% of the untreated control at the doses of 2, 5,
Figure 1. Sodium
benzoate treatment
resulted in growth
reduction. Data were
expressed as means ±
standard errors (SEM).
The differences
between control (H2O
only) and different
doses of sodium
benzoate were
analyzed using the
student’s t-test. **P-
value < 0.01.
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
9
10 and 20 mM of sodium benzoate, respectively (Figure 2A) (p value < 0.05 by log-rank test).
N2 worms grown at 25°C had a shorter mean lifespan of 11.56 days compared to worms grown
at 20°C. The mean lifespan was shortened to 93.6%, 84.5%, 79.8%, and 78.5% of the untreated
control at the doses of 2, 5, 10 and 20 mM of sodium benzoate, respectively (Figure 2B) (p value
< 0.05 by log-rank test). The detailed statistical analyses of the lifespan assays are included in
Appendix I. In summary, these lifespan assay results indicate that sodium benzoate accelerates
the aging process and shortens lifespan.
Sodium benzoate decreases lifespan parallel to the insulin/IGF-1 signaling pathway
To investigate the mechanism behind the lifespan shortening caused by sodium benzoate, the
insulin/IGF-1 signaling pathway was studied. This pathway is one of the main lifespan regulators
in C. elegans and includes critical components, AGE-1/PI3K and DAF-16/FOXO (Murphy et al.
2018). Insulin/IGF-1 signaling inhibits the transcriptional activity of DAF-16/FOXO (Salih and
Figure 2. Sodium benzoate reduces the lifespan of C. elegans wild type N2, daf-16(-) and age-1(-) mutants.
Survival curve of N2 worms incubated at 20°C (A) and at 25°C (B). Survival curve of daf-16 worms (C) and age-1
worms (D) at 25°C. All tests had a minimum of 60 animals and the differences are statistically significant with a
*P-value < 0.05 obtained by the log rank test. (E) A model depicting the relationship between the insulin IGF-1
pathway and sodium benzoate in regulating longevity.
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
10
Brunet, 2008). When insulin/IGF-1 signaling is reduced, lifespan is doubled (such as the age-
1/PI3K mutant), and this life span extension requires daf-16. Conversely, when daf-16 is deleted
in otherwise normal animals, the rate of tissue aging is accelerated and life span is shortened by
∼20% (Lin et al., 2001). Lifespan analysis were performed at 25°C using the wild type N2, daf-
16(-), and age-1(-) mutants. The three possible outcomes of this genetic epistasis analysis were
the following: 1) if sodium benzoate shortened the lifespan of both daf-16 and age-1 mutants, it
worked in parallel with the insulin/IGF-1 signaling pathway, 2) if sodium benzoate shortens only
the lifespan of age-1(-), sodium benzoate works upstream of DAF-16/FOXO and downstream of
AGE-1/PI3K, or 3) sodium benzoate works upstream of both DAF-16/FOXO and AGE-1/PI3K
by not affecting any of the mutant’s lifespan. The lifespan assay data showed that sodium
benzoate reduced the lifespan of the age-1 mutant by 9.7%, 13.5%, 37.4%, and 48.9% at the
doses of 2, 5, 10 and 20 mM of sodium benzoate, respectively, compared to the untreated control
(p value < 0.05 by log-rank test) (Figure 2D). The lifespan assay at 25°C also showed that
sodium benzoate significantly reduced lifespan in the daf-16 mutants by 9.6%, 17.6%, 26.3%,
and 25.3% at the doses of 2, 5, 10 and 20 mM of sodium benzoate, respectively, compared to the
untreated control (p value < 0.05 by log-rank test) (Figure 2C). The detailed statistical analyses
of the lifespan assays are included in Appendix I. The lifespan of both age-1(-) and daf-16(-)
decreased when exposed to sodium benzoate and therefore, it acts in parallel with the
insulin/IGF-1 signaling pathway to regulate C. elegans lifespan.
Sodium benzoate does not induce cytoplasmic, ER, or mitochondrial stress
To study the underlying mechanism in the shortening of lifespan caused by sodium benzoate, I
assayed stress response changes using several strains carrying stress response genes fused with
GFP. A group of stress response genes including heat-shock-proteins (HSP) encoding genes are
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
11
upregulated when animals are facing environmental assaults. The C. elegans hsp-16.2 encodes a
16-kD HSP that plays pivotal roles in cytoplasmic stress resistance (Park et al., 2009). The C.
elegans hsp-4 encodes an ER chaperone protein that plays important roles in endoplasmic
reticulum (ER) stress response (Shen et al., 2001). The C. elegans hsp-60 encodes a
mitochondria-specific chaperon (Kim et al., 2010). The stress-response genes sod-3, which codes
for a mitochondrial MnSOD involving oxidative stress response. The worms carrying these
HSP::GFP (hsp-4::GFP, hsp-60::GFP, hsp-16.2::GFP, sod-3:GFP) were fed with different
doses of sodium benzoate and assayed. I found that there was no GFP increase detected in
animals treated with sodium benzoate versus control (H2O) (50 worms were scored for each
condition in two sets of independent experiments). Quantitative RT-PCR results also confirmed
there were no changes at the mRNA level (Figure 4A). Therefore, these data suggest that sodium
benzoate at the current dosage do not cause cytoplasmic, ER, mitochondria, or oxidative stress.
Figure 4. Sodium benzoate downregulates the irg-1 gene expression in C. elegans wild type N2 worms. (A)
Real-time quantitative PCR result of target gene expression. The house keeping gene, act-1, serves as an
internal control. (B) Representation of irg-1::GFP expression (scale bar, 0.2 mm). (C) Sodium benzoate
suppresses irg-1::GFP expression. Atleast 50 worms were scored for each condition in two sets of independent
experiments. *P < 0.05 and **P < 0.01 compared with the untreated control obtained by student’s t-test.
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
12
Sodium benzoate suppresses the expression of the irg-1 gene, encoding a pathogen infection
response factor
In the above assay, I did find that sodium benzoate caused significant gene expression changes in
the innate immunity stress response. The innate immunity gene irg-1 expression was assayed
through both irg-1::GFP marker strain analysis and quantitative RT-PCR. Under control
conditions, irg-1::GFP is expressed in the intestine (Figure 4B). However, I found that the
percentage of animals with irg-1::GFP expression was decreased upon sodium benzoate
treatment in a dose dependent manner (Figure 4C). Moreover, at 20mM of sodium benzoate, 0%
of the 50 worms assayed showed irg-1::GFP expression (Figure 4C). Consistently, a quantitative
RT-PCR assay showed a decreased expression of the irg-1 gene at the mRNA level (Figure 4A).
Higher doses of sodium benzoate were correlated with a lower expression level of the irg-1 gene
(Figure 4A). irg-1 has deaminase activity and is known for its critical innate immune defense
role (Dunbar et al. 2012). It also plays an important role in pathogen response and prevention of
accelerated aging (Dunbar et al. 2012). These results suggest that sodium benzoate compromised
innate immunity response, affecting lifespan and aging.
Sodium benzoate increases aging pigments
When studying the stress-response genes’ GFP expression, I discovered that age-pigments (also
known as (auto-fluorescence or lipofuscin) were increased in intestinal cells when L4 worms
were treated with sodium benzoate for 24 hours. The intestinal cells of aging C. elegans
accumulate an auto-fluorescent aging pigment similar to the auto-fluorescence present in post
mitotic mammalian cells (Soukas et al., 2013). The amount of age-pigments gradually increases
throughout C. elegans adulthood and auto-fluorescent granules can be detected in older adult
nematodes by fluorescence microscopy (Clokey et al. 1986). Therefore, auto-fluorescent
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
13
pigments have been used as a biomarker of aging. As shown in Figure 3A, auto-fluorescence was
significantly increased in the day 1 adult worms treated with 20mM of sodium benzoate
compared to the worms on the control, which shows only very low-level of background
fluorescence. Quantification of fluorescent intensity showed that sodium benzoate increased the
auto-fluorescent aging pigment over 40% relative to untreated control (67.9%, 42.4%, 58.1%,
and 122.9% increase for 2, 5, 10, 20 mM of sodium benzoate, respectively) (Figure 3B). These
results strongly suggest that sodium benzoate accelerates the aging process by increasing the
accumulation of toxic oxidized macromolecules in young adult worms.
Sodium benzoate increases aging pigments in the lysosome-related organelles (LROs)
Lysosome-related organelles (LROs) are the sites of the decomposition of toxic substances such
as oxidized lipids and proteins, the components of age-pigments. The glo-1 mutant is defective in
developing LROs and have mislocalized age-pigments from the gut granule to the intestinal
lumen (Herman et al. 2005). Therefore, to investigate whether sodium benzoate increases age-
pigments through LROs, I utilized the glo-1(-). Both wild type N2 and glo-1(-) worms were
Figure 3. Sodium benzoate increases intestinal lipofuscin, a biomarker of aging. (A) Representative intestinal
fluorescence accumulation in Day 1 Adult N2 worms under control and 20mM sodium benzoate treatment.
Intestinal auto-fluorescence was recorded using a GFP filter with an exposure time of 4,000 ms (scale bar, 0.2
mm). (B) Quantification of the intestinal auto-fluorescence intensity in wild-type N2 animals treated for 24 hours
under different doses of sodium benzoate using a GFP filter and ImageJ software. **P < 0.01 obtained by t-test.
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
14
exposed to sodium benzoate for 16 hours and then the percentage of worms showing auto-
fluorescence were scored. Wild type N2 worms showed an age-pigment increase as reported in
the result shown above in Figure 3B. However, none of the glo-1(-) worms at any concentration
of sodium benzoate showed an increase of age-pigments under the same treatments (Figure 4A).
Under a GFP filter, the glo-1(-) showed only background auto-fluorescence while the N2 showed
significantly increased auto-fluorescence (Figure 4B). Under the DAPI filter, which is an
alternate way to detect auto-fluorescence, similar results were found (Figure 4C). These data
confirm that the sodium benzoate causes accumulation of age pigments (auto-fluorescence) in
LROs.
Sodium benzoate reduces chemotactic abilities and accelerates neurodegeneration
To measure the effect of sodium benzoate on neuronal degeneration, a transgenic Alzheimer’s C.
elegans model was analyzed. CL2355 transgenic worms have a pan-neuronal expression of
human beta-amyloid (Aβ) peptide (the main cause of Alzheimer’s) and when suffering increased
Figure 4. Sodium benzoate increases auto-fluorescence in lysosomal related organelles (LRO) (A) Percentage of
worms showing auto-fluorescence between N2 and glo-1 day 1 adult worms. Comparison of auto-fluorescence
between N2 and glo-1 worms under GFP filter (4,000ms exp.) (B) and DAPI filter (1,000ms exp.) (C). 30 worms
were scored for each condition. Scale bar, 0.2 mm.
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
15
neuron degeneration, their chemotaxis towards an attractant is negatively affected (Luo et al.
2009). L3 worms placed onto plates treated with sodium benzoate for 36 hours showed a
significant decrease in chemotactic abilities. The chemotaxis index (CI) was calculated through
the equation shown in Figure 5A. The lower the CI value is, the higher the indication of
neurodegeneration. The results shown in Figure 5B depict the clear reduction of chemotactic
abilities correlating with the higher concentration of sodium benzoate. The difference between
the control and the 20mM of sodium benzoate treatment is the largest with a statistically
significant 0.4955 unit decrease in chemotaxis index units (p-value of 0.004797) (Figure 5B).
These results strongly suggest that sodium benzoate plays a role in accelerating Aβ induced
neurodegeneration.
Figure 5. Sodium benzoate increases
neurodegeneration in neuronal A𝛃-
expressing transgenic C. elegans strain
CL2355. (A) Schematic diagram of the
chemotaxis assay and how to calculate
the Chemotaxis Index (CI) (Dostal et al.
2015). (B) The CI of CL2355 fed with
the control (H2O) and different doses of
sodium benzoate. Error bars indicate
SEM. **P < 0.01 by the student’s t-test.
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
16
DISCUSSION
This is the first known study conducted to date that identifies the harmful role sodium
benzoate plays in an animal's lifespan and aging. The new results obtained in this study reveal
that sodium benzoate is a harmful substance to animal health in general. Indeed, in C. elegans,
sodium benzoate clearly reduces lifespan, increases neurodegeneration, accelerates aging,
suppresses innate immunity response, and restricts development.
Through a genetic epistasis analysis to reveal the mechanisms behind the lifespan
phenotype, I found that sodium benzoate works in parallel with the insulin/IGF-1 pathway, a
main lifespan regulator. The two mutants of the insulin/IGF-1 pathway, age-1 and daf-16, both
showed a reduction in lifespan after being treated with sodium benzoate. This rules out the
possibility that sodium benzoate works within the insulin/IGF-1 pathway to regulate lifespan.
The lifespan of C. elegans is regulated by multiple conserved genetic pathways in addition to the
insulin/IGF-1 pathway, such as the mTOR pathway, sirtuin, and the AMPK pathway (Pan and
Finkel, 2017). Further study of the interaction of sodium benzoate with these additional
pathways is anticipated to understand how exactly it regulates animal lifespan.
This study also made an effort to investigate sodium benzoate’s role in regulating stress
response and whether it causes critical stress related gene expression changes. Through
analyzing several critical genes in stress response pathways by both GFP marker strains and
qPCR assays, I found that sodium benzoate significantly suppressed the irg-1 gene expression. It
has been previously shown that the irg-1 gene functions in a pmk-1 independent pathway to
regulate innate immunity response (Estes et al. 2010). There are a number of studies that show
the innate immunity pathway’s role in regulating the aging process (Xia et al. 2019). Further
experimentation on how sodium benzoate regulates innate immunity response should be done by
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
17
investigating whether sodium benzoate reduces the pathogen response ability of C. elegans. In
addition, this study has not exhausted all critical stress response pathways in C. elegans and
sodium benzoate may be playing a mechanistic role in other stress response pathways.
When first examining the expression of mitochondrial stress response genes (hsp-60) in
GFP marker strains, I found that the worms treated with sodium benzoate had abnormally high
expression of fluorescence. Under a 100X Nomarski microscope, I discovered that the
fluorescence was actually auto-fluorescence (otherwise known as lipofuscin or age-pigments)
emitted from the intestine and not GFP. To investigate this phenomenon further, a lipofuscin
assay was conducted. This assay revealed that sodium benzoate significantly increased the
presence of auto-fluorescence. Further experimentation with the glo-1(-), which lacks lysosome-
related organelles (LROs), I revealed that sodium benzoate causes an accumulation of age-
pigments in LROs (the site of the decomposition of oxidized macromolecules). These
phenomena have never been reported in any previous sodium benzoate related studies in
literature. This intriguing phenotype further links sodium benzoate with longevity and aging. It
has been found that the accumulation of lipofuscin is age-related (Soukas et al. 2013). In C.
elegans, age-pigments are composed of oxidized and cross-linked lipids and proteins (Gerstbrein
et al. 2005), which is known to be toxic to animals. For example, the accumulation of lipid
peroxide 4-hydroxynonenal is related to premature aging in C. elegans (Ayyadevara et al. 2005).
This study also demonstrated that sodium benzoate accelerated neurodegeneration in a
transgenic beta-amyloid Alzheimer’s disease C. elegans model. Alzheimer’s disease (and other
neurodegenerative diseases) are often related to aging and therefore, this discovery is consistent
with the negative impact of sodium benzoate in the aging process. The accelerating
neurodegeneration by sodium benzoate may be caused by the premature aging of neuronal cells
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
18
or by the upregulation of beta amyloid peptide production (Link et al. 2006). This calls for
further experimentations to reveal the mechanisms of sodium benzoate in neurodegeneration.
In the modern-day health and medicine field, there is strong focus on curing rather than
prevention. However, it is more practicable and impactful to focus on prevention. In this research
study, I revealed the harmful impact of sodium benzoate, one of the most used preservatives, on
animal health. Sodium benzoate is a factor in delaying growth, accelerating aging, decreasing
lifespan, and increasing the risk of developing fatal diseases such as Alzheimer’s. All these
adverse health effects are long term, making sodium benzoate’s role in human health even more
secretive and potent. Its dangers on animal health may prove to be just as consequential to
human health. Reduced consumption of sodium benzoate would contribute to preventing the
health problems. This study has set the base for critical further inquiries into sodium benzoate’s
effect on human health. In the meantime, the FDA should urgently reassess whether sodium
benzoate should be allowed in our diet.
FUTURE DIRECTION
Future research must focus on uncovering the mechanism(s) by which sodium benzoate harms
animal health. As I move forward with this work, I am planning a series of three critical
analyses. First, other age regulating pathways (the mechanistic target of rapamycin (mTOR),
sirtuins, etc) will be investigated. Second, the whole-genome gene expression changes upon
treatment of sodium benzoate will be measured through both transcriptome and proteome
analyses to identify additional mechanisms in regulating development and aging. And third, the
relationship between sodium benzoate and Alzheimer’s disease will be further studied. Finally, I
would also like to use mammalian cell lines and higher organisms like mice or primates to study
sodium benzoate further.
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
19
REFERENCES
Ayyadevara, S., Engle, M. R., Singh, S. P., Dandapat, A., Lichti, C. F., Beneš, H., ... & Zimniak,
P. (2005). Lifespan and stress resistance of Caenorhabditis elegans are increased by
expression of glutathione transferases capable of metabolizing the lipid peroxidation product
4‐hydroxynonenal. Aging cell, 4(5), 257-271.
Burdine, R. D., & Stern, M. J. (1996). Easy RNA isolation from C. elegans: a TRIZOL based
method. Worm Breed. Gaz, 14(10).
Clokey, G. V., & Jacobson, L. A. (1986). The autofluorescent “lipofuscin granules” in the
intestinal cells of Caenorhabditis elegans are secondary lysosomes. Mechanisms of ageing
and development, 35(1), 79-94.
Dunbar, T. L., Yan, Z., Balla, K. M., Smelkinson, M. G., & Troemel, E. R. (2012). C. elegans
detects pathogen-induced translational inhibition to activate immune signaling. Cell host &
microbe, 11(4), 375-386.
Estes, K. A., Dunbar, T. L., Powell, J. R., Ausubel, F. M., & Troemel, E. R. (2010). bZIP
transcription factor zip-2 mediates an early response to Pseudomonas aeruginosa infection
in Caenorhabditis elegans. Proceedings of the National Academy of Sciences, 107(5), 2153-
2158.
Gerstbrein, B., Stamatas, G., Kollias, N., & Driscoll, M. (2005). In vivo spectrofluorimetry
reveals endogenous biomarkers that report healthspan and dietary restriction in
Caenorhabditis elegans. Aging cell, 4(3), 127-137.
Hall, M. N. (2008, December). mTOR—what does it do?. In Transplantation proceedings (Vol.
40, No. 10, pp. S5-S8). Elsevier.
Hassan, W. M., Dostal, V., Huemann, B. N., Yerg, J. E., & Link, C. D. (2015). Identifying Aβ-
specific pathogenic mechanisms using a nematode model of Alzheimer's
disease. Neurobiology of aging, 36(2), 857-866.
Han, S. K., Lee, D., Lee, H., Kim, D., Son, H. G., Yang, J. S., ... & Kim, S. (2016). OASIS 2:
online application for survival analysis 2 with features for the analysis of maximal lifespan
and healthspan in aging research. Oncotarget, 7(35), 56147.
Hermann, G. J., Schroeder, L. K., Hieb, C. A., Kershner, A. M., Rabbitts, B. M., Fonarev, P., ...
& Priess, J. R. (2005). Genetic analysis of lysosomal trafficking in Caenorhabditis elegans.
Molecular biology of the cell, 16(7), 3273-3288.
Hunt, P. R. (2017). The C. elegans model in toxicity testing. Journal of Applied Toxicology,
37(1), 50-59.
Khoshnoud, M. J., Siavashpour, A., Bakhshizadeh, M., & Rashedinia, M. (2018). Effects of
sodium benzoate, a commonly used food preservative, kon learning, memory, and oxidative
stress in brain of mice. Journal of biochemical and molecular toxicology, 32(2), e22022.
Lin, C. H., Chen, P. K., Chang, Y. C., Chuo, L. J., Chen, Y. S., Tsai, G. E., & Lane, H. Y.
(2014). Benzoate, a D-amino acid oxidase inhibitor, for the treatment of early-phase
Alzheimer disease: a randomized, double-blind, placebo-controlled trial. Biological
psychiatry, 75(9), 678-685.
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
20
Lin, C. H., Chen, P. K., Wang, S. H., & Lane, H. Y. (2019). Sodium benzoate for the treatment
of behavioral and psychological symptoms of dementia (BPSD): A randomized, double-
blind, placebo-controlled, 6-week trial. Journal of Psychopharmacology, 33(8), 1030-1033.
Lin, K., Hsin, H., Libina, N., & Kenyon, C. (2001). Regulation of the Caenorhabditis elegans
longevity protein DAF-16 by insulin/IGF-1 and germline signaling. Nature genetics, 28(2),
139-145.
Link CD. (2006). C. elegans models of age-associated neurodegenerative diseases: lessons from
transgenic worm models of Alzheimer's disease. Exp Gerontol., 41(10), 1007-13.
Luo, Y., Wu, Y., Brown, M., & Link, C. D. (2009). Caenorhabditis elegans model for initial
screening and mechanistic evaluation of potential new drugs for aging and Alzheimer’s
disease. In Methods of Behavior Analysis in Neuroscience. 2nd edition. CRC Press/Taylor
& Francis.
Marsha McCulloch, MS, RD. (n.d.). Sodium Benzoate: Uses, Dangers, and Safety. Retrieved
from https://www.healthline.com/nutrition/sodium-benzoate
Margie, O., Palmer, C., & Chin-Sang, I. (2013). C. elegans chemotaxis assay. JoVE (Journal of
Visualized Experiments), (74), e50069.
Murphy, C. T., & Hu, P. J. (2018). Insulin/insulin-like growth factor signaling in C. elegans. In
WormBook: The Online Review of C. elegans Biology [Internet]. WormBook.
Pan, H., & Finkel, T. (2017). Key proteins and pathways that regulate lifespan. Journal of
Biological Chemistry, 292(16), 6452-6460.
Park, S. K., Tedesco, P. M., & Johnson, T. E. (2009). Oxidative stress and longevity in
Caenorhabditis elegans as mediated by SKN‐1. Aging cell, 8(3), 258-269.
Pelka, K., & De Nardo, D. (2018). Emerging concepts in innate immunity. In Innate Immune
Activation (pp. 1-18). Humana Press, New York, NY.
Pongsavee, M. (2015). Effect of sodium benzoate preservative on micronucleus induction,
chromosome break, and Ala40Thr superoxide dismutase gene mutation in lymphocytes.
BioMed research international, 2015.
Salih, D. A., & Brunet, A. (2008). FoxO transcription factors in the maintenance of cellular
homeostasis during aging. Current opinion in cell biology, 20(2), 126-136.
Shen, X., Ellis, R. E., Lee, K., Liu, C. Y., Yang, K., Solomon, A., ... & Kaufman, R. J. (2001).
Complementary signaling pathways regulate the unfolded protein response and are required
for C. elegans development. Cell, 107(7), 893-903.
Soukas, A. A., Carr, C. E., & Ruvkun, G. (2013). Genetic regulation of Caenorhabditis elegans
lysosome related organelle function. PLoS genetics, 9(10).
Terman, A., & Brunk, U. T. (1998). Lipofuscin: mechanisms of formation and increase with age.
Apmis, 106, 265-276.
Xia, J., Gravato-Nobre, M., & Ligoxygakis, P. (2019). Convergence of longevity and immunity:
lessons from animal models. Biogerontology, 1-8.
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
21
Appendix I:
Table 1. Lifespan results
age-1
(-)
No.
subjects
Mean lifespan
(days)
Standard
error
95% confidence
interval
Chi# P value# Corrected
p value#
Control
59 23.01 0.93 21.18 ~ 24.84
2mM 62 20.78 0.8 19.21 ~ 22.35 5 0.0253 0.1013
5mM 30 19.9 1.27 17.41 ~ 22.38 7.78 0.0053 0.0211
10mM 59 14.4 0.64 13.13 ~ 15.66 48.42 0 0
20mM 56 11.76 0.46 10.86 ~ 12.65 69.8 0 0
daf-16
(-)
No.
subjects
Mean lifespan
(days)
Standard
error
95% confidence
interval
Chi# P value# Corrected
p value#
Control
54 9.91 0.31 9.29 ~ 10.52
2mM 53 8.96 0.48 8.01 ~ 9.90 0.06 0.803 1
5mM 48 8.17 0.47 7.26 ~ 9.09 4.88 0.0272 0.1087
10mM 54 7.3 0.36 6.60 ~ 8.01 30.64 3.10E-08 1.20E-07
20mM 44 7.4 0.34 6.73 ~ 8.07 30.42 3.50E-08 1.40E-07
N2
(25˚C)
No.
subjects
Mean lifespan
(days)
Standard
error
95% confidence
interval
Chi# P value# Corrected
p value#
Control
57 11.56 0.44 10.70 ~ 12.41
2mM 55 10.82 0.4 10.03 ~ 11.62 3.19 0.0739 0.2957
5mM 57 9.77 0.48 8.83 ~ 10.71 6.14 0.0132 0.0529
10mM 53 9.22 0.41 8.42 ~ 10.01 18.09 0.000021 0.0001
20mM 53 9.08 0.33 8.44 ~ 9.72 24.18 8.80E-07 3.5E-06
N2
(20˚C)
No.
subjects
Mean lifespan
(days)
Standard
error
95% confidence
interval
Chi# P value# Corrected
p value#
Control
28 20 0.65 18.72 ~ 21.28
2mM 40 17.33 0.64 16.07 ~ 18.59 10.72 0.0011 0.0042
5mM 38 15.94 0.55 14.86 ~ 17.01 21.26 0.000004 0.000016
10mM 34 12.74 0.46 11.85 ~ 13.64 43.82 0 0
20mM 21 10.78 0.62 9.56 ~ 12.00 45.03 0 0
#: Statistical analysis by comparing control.
Sodium benzoate, a common preservative, inhibits growth, shortens lifespan, induces premature aging, and
accelerates neurodegeneration
22
Appendix II:
Table 2. Primers used for quantitative RT-PCR
Gene Forward Reverse Group
hsp-60 GGAAGCCCAAAGATCACAAA CAGCCTCCTCATTAGCCTTG Mitochondrial stress
irg-1 AGCCACCGAGCGATTGATTGC GTGGCATTTTGGGCATCTTCTTG Innate immunity
act-1 CTACGAACTTCCTGACGGACAAG CCGGCGGACTCCATACC Housekeeping
hsp-4 TGACTCGTGCCAAGTTTGAG GCTCCTTGCCGTTGAAGTAG ER stress
hsp-16.2 TGCAGAATCTCTCCATCTGAGT TGGTTTAAACTGTGAGACGTTGA Cytoplasmic stress
sod-3 CCAACCAGCGCTGAAATTCAATGG GGAACCGAAGTCGCGCTTAATAGT Oxidative stress
hsf-1 TTGACGACGACAAGCTTCCAGT AAAGCTTGCACCAGAATCATCCC Cytoplasmic stress
top related