speciation discussion how does a new species arise?

Speciation

Discussion How does a new species arise?

First…what is a species? Biological species concept

population whose members can interbreed & produce viable, fertile offspring

reproductively compatible

Western MeadowlarkEastern Meadowlark

Distinct species:songs & behaviors are different enough to prevent interbreeding

But that doesn’t capture every situation

Consider Ensatina salamanders. How many species? Which ones are different species?

Species Definitions Other definitions include:

Morphological or typological - They conform to the same body plan.

Phylogenetic or evolutionary - Share a common ancestor and a unique evolutionary history.

Ecological - Share a specific niche, unique to them and them alone.

“Species” is a human language box. Never forget that nature exists on a continuum!

Discussion Which definitions work or don’t work to

determine whether or not you’re examining different species if you’re studying… Bacteria in a lab petri dish? Hooved mammals in the modern-day

arctic? Dinosaurs? Ancient algae?

How and why do new species originate? Species are created by a series of evolutionary

processes populations become isolated - no gene flow between

them geographically isolated and/or reproductively isolated

isolated populations evolve independently

Isolation allopatric

geographic separation sympatric

still live in same area

An obstacle to mating or fertilization

PRE-zygotic barriers

behavioral isolation

geographic isolation ecological isolation temporal isolation

mechanical isolation gametic isolation

Geographic isolation Species occur in different areas

physical barrier allopatric speciation

“other country”

Harris’s antelope squirrel inhabits the canyon’s south rim (L). Just a few miles away on the north rim (R) lives the closely related white-tailed antelope squirrel

Ammospermophilus spp

Ecological isolation Species occur in same region, but occupy different habitats so rarely

encounter each other reproductively isolated

2 species of garter snake, Thamnophis, occur in same area, but one lives in water & other is terrestrial

lions & tigers could hybridize, but they live in different habitats: lions in grasslands tigers in rainforest

Temporal isolation Species that breed during different times of day, different

seasons, or different years cannot mix gametes reproductive isolation sympatric speciation

“same country”

Eastern spotted skunk (L) & western spotted skunk (R) overlap in range but eastern mates in late winter & western mates in late summer

Behavioral isolation Unique behavioral patterns & rituals isolate species

identifies members of species attract mates of same species �

courtship rituals, mating calls reproductive isolation

Blue footed boobies mate only after a courtship display unique to their species

sympatric speciation?

firefly courtship displaysfirefly courtship displays

courtship display of Gray-Crowned Cranes, Kenya

courtship songs of sympatricspecies of lacewings

Recognizing your own species

Mechanical isolation Morphological differences can prevent successful

mating reproductive isolation

Even in closely related species of plants, the flowers often have distinct appearances that attract different pollinators. These 2 species of monkey flower differ greatly in shape & color, therefore cross-pollination does not happen.

Plants

Mechanical isolation For many insects, male &

female sex organs of closely related species do not fit together, preventing sperm transfer

lack of “fit” between sexual organs: hard to imagine for us… but a big issue for insects with different shaped genitals!

Damsel fly penises

Animals

Gametic isolation Sperm of one species may not be able to fertilize eggs of

another species mechanisms

biochemical barrier so sperm cannot penetrate egg receptor recognition: lock & key between egg & sperm

chemical incompatibility sperm cannot survive in female reproductive tract

Sea urchins release sperm & eggs into surrounding waters where they fuse & form zygotes. Gametes of different species— red & purple —are unable to fuse.

POST-zygotic barriers Prevent hybrid offspring from

developing into a viable, fertile adult reduced hybrid viability reduced hybrid fertility hybrid breakdown

zebroid

Reduced hybrid viability Genes of different parent species may

interact & impair the hybrid’s development

Species of salamander genus, Ensatina, may interbreed, but most hybrids do not complete development & those that do are frail.

Mules are vigorous, but sterile

Reduced hybrid fertility Even if hybrids are vigorous

they may be sterile chromosomes of parents may differ in number

or structure & meiosis in hybrids may fail to produce normal gametes

Donkeys have 62 chromosomes(31 pairs)

Horses have 64 chromosomes(32 pairs) Mules have 63 chromosomes!

Hybrid breakdown Hybrids may be fertile & viable in first

generation, but when they mate offspring are feeble or sterile

In strains of cultivated rice, hybrids are vigorous but plants in next generation are small & sterile.On path to separate species.

Niles EldredgeCurator

American Museum of Natural History

Rate of Speciation When considering speciation events over

geological time: Does speciation happen gradually or rapidly, uniformly or unevenly? Gradualism

Charles Darwin Charles Lyell

Punctuated equilibrium Stephen Jay Gould Niles Eldredge

Gradualism Gradual, constant

divergence over long spans of time

big changes occur as the accumulation of many small ones

events can increase or decrease speciations worldwide, but overall speciation proceeds fairly regularly

Punctuated Equilibrium Rate of speciation is not

constant Organisms are in

“stasis” for much of their history, with little or no change

When speciation occurs, it tends to be in a rapid burst

Species undergo rapid change when they 1st bud from parent population

Discussion Based upon what you know of

evolutionary history, where do you fall: gradualism or punctuated equilibrium supporter?

Speciation Rates Regardless of whether punctuated

equilibrium or gradualism holds, speciation rates vary by species and circumstance Speciation can occur over a scale of

millions of years, or much more rapidly! Polyploidy in plants increases

speciation rate to, in some cases, only a few years

Polyploidy and Hybrid Speciation Unlike in animals, in plants, duplicating

the genome (polyploidy) isn’t fatal. Plants hybridize more often and more

readily than animals on average

Sometimes in plants, a diploid hybrid is sterile, but a triploid or tetraploid hybrid isn’t due to the

mechanisms of chromosome alignment in their haploid life

phase.

Polyploidy and Hybrid Speciation Polyploid offspring may reproduce with other

polyploids, or re-reproduce with a parental type, or may self-fertilize (oh plants, you so crazy)

But by any of the three mechanisms, polyploids wind up reproductively isolated from the parental population, but produce non-sterile offspring = they’re a new population that evolution will be acting upon! A new species, in as little as a generation!

Polyploidy and Hybrid Speciation This has been observed in species like

the Evening Primrose, Raphanobrassica, Hemp Nettle, and the Maidenhair Fern.

Speciation Rates In all species, when a new habitat or

new niche becomes available, speciation rates tend to increase

Adaptive radiation - ecological & phenotypic diversity in a rapidly multiplying lineage

Discussion Scientists generally break it down into

two main reasons why this causes a burst in speciation events. What do you think they could be?

Speciation Rates Ex: Darwin’s finches

Ex: An explosion in bivalve species diversity after the loss of brachiopods in the “Great Dying,” or Permian extinction 250 mya

Extinction But, of course, extinction rates also

fluctuate Higher in times of environmental stress

Million years ago

% of familiesextinct

Discussion A population’s ability to respond to

environmental changes is dictated, in part, by its level of genetic diversity.

Which do you think is most resistant to extinction and why: high-genetic-diversity or low-genetic-diversity?

Lines of EvidenceMorphological,

Molecular, and Other

Lines of Evidence Modes of investigation into evolutionary history

include Morphological Molecular Developmental (which is part Morphology, part

Molecular Biology) Geographical* Geological* Active change

* - Not addressed in notes - read up on basic definition of biogeography, fossil record at home

Discussion What is the relationship between:

Recency of two populations’ last common ancestor

Amount of similarity between populations

Degree of relatedness between populations

…and WHY?

Morphological Evidence Morphology = body form

Shared deep body structures are evidence of shared ancestry, but appearances and functions aren’t necessarily… why not?

Anatomical record Homologous structures

similarities in characteristics resulting from common ancestry

Homologous structures Similar structure Similar development Different functions Evidence of evolutionary

relationship

spines

tendrilssucculent leaves

colored leaves

Homologous structures

leaves

needles

Homologous Structures Produced by divergent evolution

Your typical “population divided, evolves in two separate directions” scenario

Structure present in ancestor passed down to descendents

Analogous structures

Separate evolution of structures similar functions similar external form different internal structure &

development different origin no evolutionary relationship

Solving a similar problem with a similar solutionSolving a similar problem with a similar solution

Analogous Structures Flight evolved in 3 separate animal groups

evolved similar “solution” to similar “problems”

Analogous Structures Fish: aquatic vertebrates Dolphins: aquatic mammals

similar adaptations to life in the sea

not closely related

Those fins & tails & sleek bodies are

analogous structures!

Analogous Structures Analogous structures produced by

convergent evolution or parallel evolution Convergent evolution: Two

separate, asynchronous (different times, different ecospaces) evolutionary lineages develop a similar trait/solution Example: pillbugs and pillmillipedes

both develop similar defenses, but didn’t inherit them from a so-defended shared ancestor

Parallel Evolution Like convergent evolution, but the two species evolve at

the same time and/or in the same ecospace filling similar ecological roles in similar environments, so

similar adaptations were selected

marsupial mammalsmarsupial mammals

placental mammalsplacental mammals

Vestigial structures Modern structures that have reduced or no

function remnants of structures that were functional in

ancestral species deleterious mutations accumulate in genes for

non-critical structures without reducing fitness eyes on blind cave fish

are a kind of homology

Vestigial organs Hind leg bones on whale fossils and

modern whales

Why would whaleshave pelvis & leg bonesif they were always

sea creatures?

Vestigial structures Spurs or tiny leg bones in snakes

Vestigial structures Arrector pili, post-caudal tail, appendix

in humans

Molecular Evidence Evidence from genes & proteins The most powerful and commonly-used

these days, in part because the data set is so vast and in part because it’s easily quantifiable

“Conservation” What does it mean to say a

homologous sequence or structure is “highly conserved?” Means it’s extremely similar or identical

amongst the organisms that inherited it Conserved sequences = useful

evidence in uncovering ancestry

Conserved Structures Example, metabolic pathways = highly

conserved across all domains of life (archaea, bacteria, eukarya)

A remnant of life’s common ancestry

Bacterial metabolic enzymes - notice, more of them are common to all 3 domains than are at all unique

Conserved Structures Example: Structural evidence supports

the relatedness of all eukaryotes More than just the nucleus is

conserved… linear chromosomes, membrane-bound organelles, and endomembrane systems are as well

Molecular record Molecular evidence elegantly demonstrates the

relatedness of all life universal genetic code! The ultimate “conserved

sequence” - the whole darned thing! DNA, RNA, proteins - genome, transcriptome, proteome

Closely related species have sequences that are more similar than distantly related species DNA & proteins are a molecular

record of evolutionary relationships

Closely related species have sequences that are more similar than distantly related species DNA & proteins are a molecular

record of evolutionary relationships

Discussion “The more similar genetic loci two

populations share, the more related they are”

WHY would this be??

Conserved Sequences Think of a conserved sequence (which

can be as little as a single base pair) as being a genetic homologous structure

Conserved Sequences Suppose an ancestral population has

the sequence

AAGTCTTTAGCTAGCTGGCTGT

at a particular locus.

Over time, it accumulates mutations. Demo!

AAGTCTTTAGCTAGCTGGCTGT

AAGTCTTTATCTAGCTGGCTGT AAATCTTTAGCTAGCTGGCTGT

AAATATTTAGCTAGCTGGCTGT

AAATCTTTAGCTAGCTGTCTGTAGGTCTTTATCTAGCTGGCTGT

AAGTCTTTATCTAGCTGGCTGG

CAGTCTTTATCTAGCTGGCTGG

AAGTCTTTATCTAGCTGGGTGG

AAATATTTCGCTAGCTGGCTGT

AAATATTTAGCCAGCTGGCTGT

AAATCTCTAGCTAGCTGTCTGT

AAATCCTTAGCTAGCTGTCTGT

What % of DNA do these two share?Are they closely related?

Can you spot any conserved sequences among the modern (F3) species?

Discussion Suppose you have this information for locus

ß135 in three similar species.

Species A: AGCTTCGATTGCTAGCTA

Species B: AGCTACGATTGGTAGCTA

Species C: AGCTACGACCTTGGTAGCTA

Who’s most related? Who shares the most recent LCA?

It works for proteins, too!

Number of amino acid differences betweenhemoglobin (146 aa) of vertebrate species and that of humans

100 20 30 40 50 60 70 80 90 100 110 120

LampreyFrogBirdDogMacaqueHuman

328 45 67 125

Why does comparingamino acid sequencemeasure evolutionary

relationships?

Molecular Evidence An organism’s evolutionary history is

documented in its genome! How many similarities are shared between

populations? DNA hybridization experiments

Track SNPs (single nucleotide polymorphisms), conserved sequences, common loci, duplicated genes

Analyze pseudogenes (“vestigial genes”) Even analyze whole genomes…

Genome sequencing What can data from whole

genome sequencing tell us about evolution of humans?

Primate Common AncestryChromosome Number in

the Great Apes (Hominidae)

orangutan (Pogo) 48gorilla (Gorilla) 48chimpanzee (Pan) 48human (Homo) 4646

Chromosome Number in the Great Apes

(Hominidae)

Hypothesis:Hypothesis:Change in chromosome number?Change in chromosome number? If these organisms share a common ancestor, then is there evidence in the genome for this change in chromosome number

Could we have just lost a pair of

chromosomes?

Chromosomal fusionTestable prediction:Testable prediction: If common ancestor had 48 chromosomes (24 pairs),then humans carry a fused chromosome (23 pairs).

Testable prediction:Testable prediction: If common ancestor had 48 chromosomes (24 pairs),then humans carry a fused chromosome (23 pairs).

Centromere

Telomere

Ancestral Chromosomes Fusion Homo sapiens

Inactivated centromere

Telomere sequences

(Hominidae)

Test of the Human Genome“Chromosome 2 is unique to the human lineage of evolution, having emerged as a result of head-to-head fusion of two chromosomes that remained separate in other primates. The precise fusion site has been located in 2q13–2q14.1, where our analysis confirmed the presence of multiple subtelomeric duplications to chromosomes 1, 5, 8, 9, 10, 12, 19, 21 and 22. During the formation of human chromosome 2, one of the two centromeres became inactivated (2q21, which corresponds to the centromere from chimp chromosome 13) and the centromeric structure quickly deterioriated.”

“Chromosome 2 is unique to the human lineage of evolution, having emerged as a result of head-to-head fusion of two chromosomes that remained separate in other primates. The precise fusion site has been located in 2q13–2q14.1, where our analysis confirmed the presence of multiple subtelomeric duplications to chromosomes 1, 5, 8, 9, 10, 12, 19, 21 and 22. During the formation of human chromosome 2, one of the two centromeres became inactivated (2q21, which corresponds to the centromere from chimp chromosome 13) and the centromeric structure quickly deterioriated.”

Hillier et al (2005) “Generation and Annotation of the DNA sequences of human chromosomes 2 and 4,” Nature 434: 724 – 731.

Ancestral Chromosomes Fusion Homo sapiens

Inactivated centromere

Telomere sequences

Human Chromosome #2 shows the exact point at which this fusion took place

Discussion If you want to analyze the evolutionary

history of an order, a phylum, a kingdom, etc., what kinds of genes do you think would be most productive to study?

Molecular Clocks Some genes show a constant rate of

mutation/evolution They can be used as molecular clocks and

used to calculate the time since divergence, calibrated against branches whose dates are known from the fossil record

Divergence time (millions of years)Nu

30 60 900

Molecular Clocks Example: Use of molecular clocks

demonstrates that HIV leapt from simians to humans in the 1930s

Adjusted best-fit line(accounts for uncertaindates of HIV sequences)

01900 1920 1940 1960 1980 2000

Evo-Devo: Morpho+DNA Evidence Comparative embryology reveals anatomical

similarity not visible in adults Ex: all vertebrate embryos have similar

structures at similar stages of development gill pouch in fish, frog, snake, birds, human, etc.

Pharyngealpouches

Post-analtail

Human embryoChick embryo (LM)

Evo-Devo Major changes in body form can

result from changes in the sequences and regulation of developmental genes Genes that program development

control the rate, timing, and spatial pattern of changes in an organism’s form as it develops

Ex: A change in the rate of gene expression produces very different skulls from the same genes

Chimpanzee fetus -> adult

Human fetus -> adult

Evo-Devo Ex: A change in spatial expression of

the Hox gene produces body parts in a new location, without a change in coding genes

Hox gene 6 Hox gene 7 Hox gene 8

About 400 mya

DrosophilaArtemia

Repeated Hox expression extends body

Evo-Devo Among MANY other evolutionary

applications, these means that modern organisms have many ancient genes still in place that can be used to study the ancestral form Those genes are just producing

different phenotypes now because of changes to regulatory sequences

Active Change Examples of ongoing change

Artificial selection Antibiotic resistance Industrial melanism

Artificial selection Artificial breeding can use variations in

populations to create vastly different “breeds” & “varieties”

“descendants” of the wolf

“descendants” of wild mustard

Selective breeding

the raw genetic material (variation) is hidden there

Selective breedingHidden variation can be exposed through selection!

Antibiotic Resistance

Industrial Melanism Classic Peppered Moth study: Dark vs.

light variants

Year % dark % light1848 5 951895 98 21995 19 81

“Tree Thinking”Phylogenetics,

Cladistics, Systematics

“Tree Thinking” Phylogeny is the evolutionary history of

a species or group of related species Systematics uses fossil, molecular, and

morphological data to infer evolutionary relationships and classify organisms

Depict these relationships in branching cladograms or phylogenetic trees

Order Family

Pantherapardus(leopard)

Genus Species

Canislatrans(coyote)

Taxideataxus(Americanbadger)

Lutra lutra(Europeanotter)

Canislupus(gray wolf)

stelidae

Phylogenetic Trees A phylogenetic tree is a hypothesis

about evolutionary relationships Moves forward in time from the root Each branch point represents a shared

common ancestor (usually not labeled) Sister taxa represented by the tips of

the branches

Branch point:where lineages diverge

ANCESTRALLINEAGE

This branch pointrepresents thecommon ancestor oftaxa A–G.

This branch point formsan unresolvedpattern of divergence, sharedby taxa D, E, and F.

Sistertaxa

Taxon A

Taxon B

Taxon C

Taxon D

Taxon E

Taxon F

Taxon G

Lizards and snakes

Crocodilians

Ornithischiandinosaurs

Saurischiandinosaurs

Commonancestor ofcrocodilians,dinosaurs,and birds

Discussion – Who is most related? Where’s the LCA?

Phylogenetic Trees - Limitations & Rules Show patterns of descent,

not phenotypic similarity. Don’t necessarily indicate how long ago species diverged, or how much it’s changed since then.

Taxa DID NOT evolve from any sister taxa!

Cladistics Trees are constructed based on

homologies, physical or molecular Cladistics groups organisms by

common descent. A clade = a group of species that

includes an ancestral species and its descendents

To be valid, a clade must be monophyletic - include all descendent species, and no non-descendents

(a) Monophyletic group (clade)

Cladistics Invalid clades are

Paraphyletic – Includes the ancestor but not all of its descendents

Polyphyletic - Includes some species that do not share the ancestor in question

(a) Monophyletic group (clade) (b) Paraphyletic group (c) Polyphyletic group

Valid Clades Are reptiles monophyletic, paraphyletic,

or polyphyletic? Should “reptile” be a valid

classification?

Cladistics When comparing it to its ancestor, a

species/clade displays various homologies. Shared ancestral characters - originated

in an ancestor, shared with all members.

Shared derived characters - An inherited novelty unique to that clade.

Cladistics Can use either morphological or

molecular homologies Generally, a chart with + or 1 for “has

it,” 0 or - for “doesn’t”

To construct a tree, examine shared and derived characters, and follow the principle of parsimony, also called Occam’s Razor: the simplest explanation is usually the best.

Vertebralcolumn

(backbone)

Four walkinglegs

Hinged jaws

Amnion

(a) Character table

Discussion – Practice!

Variations Cladograms can be constructed to

show time or distance since divergence, amount of difference…

Trees can take different shapes: angled splits, square splits, circular…

Branch lengths indicate time

Chicken

Zebrafish

Lancelet

Drosophila

Present

CENOZOICMESOZOICPALEOZOIC

Millions of years ago542 251 65.5

Tree Shapes

speciation discussion how does a new species arise?

geographic isolation

ecological isolation

temporal isolation species

species definitions

members of species

new species

species sympatric speciation

speciation slide

Documents

pal chapter 3 species and speciation

24 species and their formation what are species? how do new...

speciation macroevolution. speciation species: groups that...

speciation the evolution of new species. speciation the...

species and speciation d. melanogasterd. simulans

speciation & macroevolution. species what is a species?

chapter 24 the origin of species. what is speciation?...

scienceshot: dad's odor splits a species key words: sexual...

recent developments in meat species...

speciation chapter 2.7, bush. speciation what is a species?...

speciation formation of new species. formation of species...

case study: ring species species and speciation...

the phylogenetic species what is a species? speciation

species and speciation

d2 species and speciation

how do new species arise? -- speciation -- species: group of...

speciation - macroevolution. what is a species?...

speciation - mrs. nicolella's...

lecture iii – species and speciation –...

speciation. what is speciation? how does speciation occur?...