supported by a grant from the alfred p. sloan foundation

Supported by a grant from the Alfred P. Sloan Foundation

What is the Urban Barcode Project (UBP)?

• An opportunity for NYC high school students “to do science” and compete for $20,000 in prizes.

• A chance to explore the living environment in NYC.

• A way to take part in a global effort to identify all living organisms.

What is DNA barcoding and why is it important?

?

ACGAGTCGGTAGCTGCCCTCTGACTGCATCGAATTGCTCCCCTACTACGTGCTATATGCGCTTACGATCGTACGAAGATTTATAGAATGCTGCTAGCTGCTCCCTTATTCGATAACTAGCTCGATTATAGCTACGATG

Organism is sampled DNA is extracted “Barcode” amplified

Sequenced DNA is compared with a barcode database

How DNA barcoding works

Issue #1: No one knows how many species there are.

How many species can you name?How many Animals did you name?

How many mammals?How many plants?How many insects?

“Cat”Felis catus

“Dog”Canis lupus familiaris

“Oak Tree”Quercus alba

“Shark”Ginglymostoma cirratum

“Beetle”Popillia

japonica

• Currently between 1.5 and 2 million species are described/known

• This number may represent as little as a third of the true number of species

• Perhaps more than 1/3 of all species are threatened(IUCN Red list version

2010.1)

Vertebrates Species

Mammals 5,490

Birds 9,998

Reptiles 9,084

Amphibians 6,433

Fishes 31,300

Total 62,305

Invertebrates Species

Insects 1,000,000

Mollusks 85,00

Crustaceans 47,000

Corals 2,175

Arachnids 102,248

Total (+others) 1,305,250

Plants Species

Angiosperms 281,821

Gymnosperms 1,021

Ferns and Allies 12,000

Mosses 16,236

Algae 10,134

Total 321,212

Issue #2: There is a lack of agreement of what “species” means.

?

Canis lupus Canis lupus (familiaris)

Anas platyrhynchos

Defining “species” is complex and

depends on many factors:

• Interbreeding capabilities

• Morphological variation

• Ecological context

• Genetic similarities

Issue #3: Traditional taxonomic identification methods may be inadequate/too slowto capture vanishing biodiversity

Classical taxonomy is difficult for non-experts to understand

The body form ranges from hemispherical (e.g., Cleidostethus) to elongate oval (e.g., Clypastraea) to latridiid-like (e.g., Foadia).  Corylophids are typically dull brown, but some species have contrasting yellowish-brown patches on the pronotum or elytra.  The integument is often densely punctured and may be glabrous or bear short, fine recumbent setae.  Most corylophid adults can be diagnosed using the following morphological features: Maxilla with single apical lobe; Mesotrochanter short and strongly oblique; Head usually covered by pronotum; Frontoclypeal suture absent; Antennae elongate with 3-segmented club; Procoxal cavities closed externally; Tarsal formula 4-4-4; Pygidium exposed

Adding to the complexity: immature, damaged or incomplete specimen may make identification impossible.

Classical taxonomy may call one species what it is actually many…

Issue #4: Education lacks opportunities to engage students in their own learning

DNA Barcoding is engaging in and outside of the classroom, and directs curiosity to opportunities for practical inquiry…

Kate Stoeckle

August 23, 2008

How will UBP work?

1. Students will convene in teams and design projects that use DNA barcoding to answer a question

Who can enter the competition?• Competition open to NYC high school students enrolled in grades 9–

12.

• Student teams consist of either 9th/10th graders or 11th/12th graders.

• Team members do not have to be from the same school.

• Teams of 2–4 students must be sponsored by a qualifying teacher who has completed a six-hour training session with the DNALC (see next slide).

• Sponsors do not have to be from the same school as any of the students on their team.

How does a sponsor qualify?

• Only science teachers currently employed by a private or public secondary school in NYC’s five boroughs can sponsor a team.

• A sponsor commits to overseeing her/his student team.

• Sponsors can work with up to five (5) student teams.

• Each team can have a maximum of four (4) students.

• Prospective sponsors must participate in a six-hour training workshop A $150 stipend is available for teachers participating in the training.

• Training events will be held at the Harlem DNA Lab on either

- Saturday, April 2, 2011 9:00am-3:00pm, or- Saturday, April 30 , 2011 9:00am-3:00pm, or- Saturday, May 14 , 2011 9:00am-3:00pm, or- Saturday, June 4 , 2011 9:00am-3:00pm.

• Prospective sponsors must r.s.v.p. on the UBP website for a training session.

What will sponsor training entail?1. Background information on DNA barcoding.

2. Project and lab safety training.

3. Training in all lab and bioinformatics procedures required to conduct DNA barcoding, including:1. DNA extraction from plant and animal tissues and food

sources;2. PCR amplification of DNA barcodes;3. Agarose gel electrophoresis;4. Submitting DNA barcodes to sequencing facilities;5. Analyzing DNA barcode sequences.

4. Assistance with proposal ideas and outlines

2. Student teams must submit a research/project proposal

Proposals will be accepted duringone of two submission periods

June 1-15, 2011 (Round I)

October 1-15, 2011 (Round II)

Proposals must be submitted onlineat the UBP website

www.urbanbarcodeproject.org

A research question can be about any living thing in NYC or about non-living things (foods or other products) that have

DNA.

• Are there invasive or non-native plants in my local park?

• What are the most popular types of flowers in NYC?

• Do the teas I buy at my supermarket really contain the ingredients on the package?

• How many different living organisms can I find in an office building?

• How many species of butterfly migrate through NYC?

What kind of research questions are acceptable?

Examples for research questions:

1. An introduction to the question, describing why your question is original, creative, and relevant. You should also have references to previous research, such as examples of DNA barcoding used to answer a similar question or examples relating to research on the specific organisms.

2. Explain the goal of your project, and what you plan to achieve.

3. Methods, including how samples will be collected and processed.

4. Safety and legality concerns, such as how any necessary permission will be secured.

5. Brief biographies of each team member.

Proposals will include, amongst other things:

3. If a proposal is accepted, the team becomes part of the UBP

and the research can begin

Collect Samples(Leaves, Insects,

Foods, etc. )

Do DNA Barcoding

Experiment

Get Results and Make

Conclusions

Project Workflow

Teams whose proposal is accepted will have access tothe materials needed for the DNA barcoding

component of their project:

• DNA extraction Kit

• PCR machine and reagents

• DNA sequencing

• Bioinformatic tools (analysis of DNA sequence)

The DNA barcoding equipment is safe and easy to use, and the experiments can be done in a few

hours

Materials and equipment are provided to participating teams…

• either by attending “Open Lab” days held in NYCat sites including:

- Harlem DNA Lab- New York Academy of Sciences

- American Museum of Natural History- The Rockefeller University

- Others (TBA)

• Or: by borrowing it from the UBP

Teams will have access to online tools to analyze their results

***Demo Blue Line***at

www.dnasubway.org

Every participating team will also be assigned ascientific mentor

Mentors will be drawn from NYC research institutionsand will help with technical issues

4. Finish your research, and present itat the UBP symposium in Spring 2012

Summary Details

1. Form a team of 2-4 NYC high school students and a qualifying science teacher (sponsor).

2. Develop a project proposal.

3. Go to www.urbanbarcodeproject.org and submit your proposal online by one of two deadlines.

4. Proposals will be judged for originality, creativity, relevance, plausibility, and scientific merit. The top teams from each round of submissions will be invited to compete in the Urban Barcode Project.

5. Invited competitors must complete their projects by Spring 2012 and present their work at a project symposium.

Follow us Online

www.facebook.com/urbanbarcodeproject

twitter.com/urbanbarcode

www.urbanbarcodeproject.org

Latest news and announcements posted first to: