types of genetic markers multilocus markers (rapd, aflp, minisatelitte dna fingerprinting)...

Types of genetic markers

• multilocus markers (RAPD, AFLP, minisatelitte DNA fingerprinting)

• single-locus markers (allozymes, microsatelittes, SNPs)

• dominant markers – scored as present or absent (RAPD, AFLP, ...)

• codominant markers – identification of homologous alleles, i.e. scoring of homozygote and heterozygote states (allow estimation of allele frequencies – SNPs, microsatelittes, ...)

Main markers used in molecular ecologySingle locus

Codominant PCR assay Overall variability

Mitochondrial DNA (or sex specific sequences like Y chromosome)

Sequences Yes Haplotypes Yes Low-high

Nuclear multilocus

Minisatellite fingerprints

No No No High

RAPD No No Yes High

AFLP No No Yes High

Nuclear single locus

Allozymes Yes Yes No Low-medium

Microsatellites Yes Yes Yes High

SNPs (sequences) Yes Yes Yes Low-high

Multi-locus genetic markers• screening of many loci distributed

randomly throughout the genome

minisatellite DNA fingerprinting

RAPD (randomly amplified polymorphic DNA)

AFLP (arbitrary or amplified fragment length polymorphism)

• presence vs. absence - codominant

Př.: chromozóm 1

Minisatellite DNA fingerprinting

• randomly distributed repetitions (Alu sekvence, SINE, LINE)

• restriction – sequence specific endonucleases

• electrophoresis

• blotting

• hybridization with probe

• over recent years – shift to PCR-based methods

RAPD (randomly amplified polymorphic DNA)

short random oligonucleotides as primers

PCR at low stringency

detection of PCR fragments by electrophoresis

-

+

low repeatability due to many factors affecting PCR – is not more accepted as method for studies of population structure

AFLP (amplified fragments length polymorphism)

• cheap, easy, fast and reliable method to generate hunderds of informative genetic markers

• simultaneous screening of many different DNA regions distributed randomly throughout the genome

• more reproducible banding pattern than RAPD

Generating AFLP markers

Generating AFLP markers

multi-locus genotype

„capillary version“

PCR with primers on adaptors

Single-locus genetic markers

• allozymes and other transcribed genes

• SNPs (single nucleotide polymorphisms)

• microsatelittes (length polymorphism)

Př.: chromozóm 1

Single nucleotide polymorphisms (SNPs)

SNPs : nuclear genome (consensus)

Example of SNP marker

transiceA ↔ G

transition: PuPu or PyPy transversion: PuPy or PyPu

Use of SNPs markers

• species (or genetical group) identification and analysis of hybridization

• phylogeography• population genetics (genetic variation,

individual identification – parentage, relatedness, population structure, population size, changes in population size)

Advantages

• abundant and widespread in many genomes (in both coding and non-coding regions) – milions of loci

• spaced every 300-1000 bp

• biparentaly inherited (vs. mtDNA)

• evolution is well described by simple mutation models (vs. microsatellites)

• shorter fragments are needed – using in non-invasive methods

Disadvantages

• ascertainment bias – selection of loci from an unrepresentative sample of individuals

• low variability per locus (usually bi-allelic)

• higher number of loci is needed in population genetic applications (4-10 times more loci)

Methods

1. Locus discovery (ascertainment)

2. Genotyping

SNPs discovery

CATS loci = comparative anchor tagged site loci (= cross amplification)

Genomic library = genome restriction + cloning

AFLP = alternative to the genomic library construction (provide PCR fragments, can be transformed to informative SNP)

Sequencing

DNA

PCR product

cloned fragment

sequencing reaction with marked

dideoxynucleotides and specific or universal

primers

GA

GT

GC

C

-+

laser beam

detector

capillary electrophoresis

Sangrova dideoxy metoda

• Sekvence délky 500 – 1000 bp

• 4 kapiláry - destička s 96 vzorky za noc

• Jsou i sekvenátory s 96 kapilárami

Použití nových přístupů

Metagenomické knihovny Ursus spelaeus> 28 000 bp (jaderná i mitochondriální DNA)(Noonan et al. 2005)

sekvenování

„Next generation“ sequencing (Hudson 2008)

„polonies“(polymerase colonies)

454 pyrosequencing

• emulzní techniky amplifikace pikolitrové objemy

• simultánní sekvenování na destičce z optických vlákendetekce pyrofosfátů uvolňovaných při inkorporaci bazí

• První generace GS20 → 200 000 reakcí najednou (zhruba 20 milionů bp) dnes FLX → 400 000 reakcí najednou

• Problémy s homopolymery

• Délka jednotlivých sekvencí 100 – 400

1 600 000 well plate

Solexa/Illumina 1G SBS technology(SBS = sequencing by synthesis)

• 1 Gb (šestinásobek genomu Drosophily)

• Výrazně levnější

• Sekvence délky 35 bp

• Flourescence, reversibilní terminátory

• Spíš pro resequencing

SOLiD(sequencing by Oligonucleotide Ligation and Detection)

SNP genotyping - old standardsPCR-RFLP

(restriction fragments length polymorphism)

CCGATCAATGCGGCAAGGCTAGTTACGCCGTT

CCGATCACTGCGGCAAGGCTAGTGACGCCGTT

cutting by restriction endonuclease

Allele 1

Allele 2

-

+allele 1 allele 2

PCR-SSCP (gel or capillary)(single strand conformation

polymorphism)

Allele 1 Allele 2

FAM

HEX

allele 1

allele 2

+ -

no cut

SNP genotyping – new methods1) ASPE: allele-specific primer extension

CCGATCAATGCGGCAA

CCGATCAATGCGGCAA

T

G

• primer extension with deoxy nucleotides and highly specific polymerase enables allele-specific amplification

• 3’ terminal nucleotide of the two primers contains the SNP nucleotide

• two PCRs with specific primers are necessary

succesfull PCR

no PCR product

SNP genotyping – new methods

2) SBE: single base extension

CCGATCAATGCGGCAA

CCGATCACTGCGGCAA

T

G

only one dideoxy nucleotide is added to the primer

T

G

+ -

Detection or SBE products

+ -

electrophoresis in a capillary

microarrays – multicolor detection(using of 5’ oligonucleotide tags on SBE primers)

CCGATCACTGCGGCAA

Gtagother methods: flow cytometry, fluorescence polarization