yellow tailflower mild mottle virus and pelargonium...
Post on 20-May-2018
218 Views
Preview:
TRANSCRIPT
MURDOCH RESEARCH REPOSITORY
This is the author’s final version of the work, as accepted for publication following peer review but without the publisher’s layout or pagination.
The definitive version is available at :
http://dx.doi.org/10.1111/ppa.12416
Li, H., Zhang, C., Luo, H., Jones, M.G.K., Sivasithamparam, K., Koh, S-H, Ong, J.W.L. and Wylie, S.J. (2016) Yellow tailflower mild mottle virus and
Pelargonium zonate spot virusco-infect a wild plant of red-striped tailflower in Australia. Plant Pathology, 65 (3). pp. 503-509.
http://researchrepository.murdoch.edu.a/27335/
Copyright: © 2015 British Society for Plant Pathology It is posted here for your personal use. No further distribution is permitted.
Acc
epte
d A
rtic
le
This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process, which may lead to differences between this version and the Version of Record. Please cite this article as doi: 10.1111/ppa.12416
This article is protected by copyright. All rights reserved.
Article Type: Original Article
Yellow tailflower mild mottle virus and Pelargonium zonate spot virus co-infect a wild
plant of red-striped tailflower in Australia
Hua Li, C. Zhang, H. Luo, M.G.K. Jones, K. Sivasithamparam, S-H Koh, J.W.L. Ong, S.J.
Wylie*
Plant Biotechnology Group –Plant Virology, Western Australian State Agricultural
Biotechnology Centre, School of Veterinary and Life Sciences, Murdoch University, Perth,
Western Australia 6150, Australia.
*Corresponding author. Email: s.wylie@murdoch.edu.au
Running head: YTMMV, PZSV infect Anthocercis ilicifolia
Key words: Plant virus ecology; Solanaceae; tobamovirus; anulavirus, indigenous plant virus,
virus invasion, virus emergenc
Abstract
Isolates of an Australian indigenous virus Yellow tailflower mild mottle virus (YTMMV-
Kalbarri) and an exotic virus Pelargonium zonate spot virus (PZSV-SW13) are described
from Anthocercis ilicifolia Hook. subspecies ilicifolia (red striped tailflower, family
Solanaceae), a species endemic to Western Australia. This is the first report of either virus
from this plant species. The complete genome sequences of YTMMV-Kalbarri and of PZSV-
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
SW13 were obtained. YTMMV-Kalbarri shared 97% nucleotide pairwise identity with the
sequence of the type isolate YTMMV-Cervantes. The sequence PZSV-SW13 shared greatest
sequence identity with the partial sequence of an Australian isolate of PZSV also from a wild
plant, and with a sunflower-derived isolate of PZSV from Argentina. An experimental host
range study was done of YTMMV-Kalbarri using cultivated and wild solanaceous and non-
solanaceous plants. Most solanaceous plants became systemically infected, with symptoms of
systemic infection ranging from asymptomatic to whole plant necrosis. Based on these
studies, we suggest that YTMMV has the potential to become a pathogen of commercial
species of Solanaceae. This study provides further evidence that PZSV is present in wild
plants in Australia, in this case an indigenous host species, and possible routes by which it
invaded Australia are discussed.
Introduction
Anthocercis (family Solanaceae, subfamily Nicotianoideae) is a genus of 15 plant species
endemic to southern Australia (Haegi, 1986). Previously, we isolated a tobamovirus (Genus
Tobamovirus, family Virgaviridae) from A. littoria (yellow tailflower), a spindly shrub 3 m in
height that grows along the coastline in calcareous sand, limestone ridges and sand dunes on
south-western Australia, but the virus was not detected from A. viscosa (sticky tailflower)
plants growing in Albany, 400 km to the south. The new tobamovirus was named Yellow
tailflower mild mottle virus (YTMMV) (Wylie et al 2014).
Pelargonium zonate spot virus (PZSV) (genus Anulavirus, family Bromoviridae) was first
isolated from Pelargonium zonale (Geraniaceae) in Italy (Quacquarelli and Gallitelli, 1979),
but has since been shown to have a broader host range, notably capsicum and tomato
(Solanaceae), in which it is vertically transmitted, sunflower and globe artichoke
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
(Asteraceae), kiwifruit (Actinidiaceae), and several weeds from the families Brassicaceae,
some of which it has been shown to be vertically transmitted in, and Asteraceae (Gallitelli,
1982; Luis-Arteaga et al. 2000; Gebre-Selassie et al. 2002; Finetti-Sialer and Gallitelli, 2003;
Liu and Sears, 2007; Escriu et al. 2009; Gulati-Sakhuja et al. 2009; Lapidot et al. 2010;
Biccheri et al. 2012; Giolitti et al. 2014). Its geographical range includes much of Europe and
the Americas. In Australia, PZSV was recently described for the first time in Cakile maritima
(Brassicaceae), a self-introduced exotic weed species (Luo et al. 2010).
Here, we describe the complete genome sequences of new isolates of YTMMV and PZSV
that co-infected a wild plant of Anthocercis ilicifolia subsp. ilicifolia (red-striped tailflower),
a new host species for both viruses. Although details of the host range of PZSV have been
published, the potential host range of YTMMV is not known. The natural hosts of YTMMV
live at the interface between wild and managed systems, and consequently the opportunity
exists for the virus to expand its host range into cultivated plant species. Thus, we undertook
an experimental host range study of the new YTMMV isolate and the type YTMMV isolate,
and we discuss the potential of YTMMV to emerge as a pathogen of commercial importance.
Further, we speculate as to how PZSV may have entered Australia, given that it has not yet
been detected there in commercial plantings.
Materials and Methods
Virus identification
In October 2013 leaves were collected from a red striped tailflower plant exhibiting leaf
chlorosis and a number of dead or dying branches (Fig. 1a). The plant was in visibly poor
health amongst a group of more healthy-looking plants scattered along a limestone ridge
overlooking the Indian Ocean near the coastal town of Kalbarri. Total nucleic acids were
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
extracted from 1 g of leaves and enriched for dsRNA using a cellulose-based method (Morris
and Dodds, 1979) modified by replacing Whatman CF11 cellulose powder with Machery-
Nagel MN100 cellulose powder. cDNA was synthesized from 1 μg heat denatured RNA
using adaptor-tailed random primers and GoScript™ reverse transcription system (Promega).
PCR amplification was carried out using tagged primers that annealed to the adaptor
sequences at the ends of cDNA strands. Amplicons were purified using Mag PCR clean-up
beads (Axygen Biosciences). Library construction and paired-end sequencing of cDNA over
150 cycles using Illumina HiSeq2000 technology (Illumina Inc, San Diego, CA) were done
by Macrogen Inc, Seoul.
Analysis of sequences and assembly of contigs were done after trimming off 20 nucleotides
(nt) from each end of each sequence read. The ‘De Novo Assembly’ function in CLC
Genomics Workbench v7 (Qiagen) was used with default (automatic) word size and bubble
size. Contigs sequences were used to interrogate NCBI GenBank using BlastN and BlastX,
and sequences representing genomes of YTMMV-Kalbarri and PZSV-SW13 RNAs 1-3 were
identified. Editing and alignment of contigs to generate consensus nucleotide (nt) and amino
acid (aa) sequences were done in CLC Genomics Workbench using a Gap open cost of 10
and Gap extension cost of 1.0.
Experimental host range of YTMMV
Macerated leaf material from the original host plants of YTMMV-Kalbarri and YTMMV-
Cervantes was inoculated to plants of N. benthamiana (accession RA-4). Virus-specific
primers (below) were used to confirm that severely symptomatic N. benthamiana plants were
infected with YTMMV, but not with PZSV. Macerated leaf material from symptomatic N.
benthamiana plants was used to inoculate 1-12 plants each of 12 solanaceous species in five
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
genera, comprising commercial species, weeds, and two indigenous species. Additionally, 3-
6 plants of 16 non-solanaceous species were inoculated with the same inoculum (Table 1).
Inoculum consisted of macerated new leaves of YTMMV-infected N. benthamiana mixed
with chilled 100 mM phosphate buffer (pH 7.0). This was gently applied to leaves of test
plants using diatomaceous earth (Sigma-Alrich) as an abrasive. In each case, an equal number
of mock-inoculated plants were tested. Plants were grown in a rotted bark and sand mix to
which 5 g each of lime and dolomite and 40 g of slow release NPK fertiliser were added per
40 L of potting mix. Plants were grown in a temperature-controlled and insect-proof
glasshouse under natural light at 22°C and scored for symptoms there 35 days post-
inoculation (dpi). The presence of YTMMV was tested for using virus-specific primers
(below).
Symptom development indices.
Symptom development was monitored on inoculated plants every day until 35 dpi when they
were scored using a simple qualitative assessment of symptom severity:
1. No infection as determined by RT-PCR using YTMMV-specific primers
2. Local lesions or asymptomatic presence in inoculated leaves only. No systemic
infection detected.
3. No symptoms of infection observed. Systemic spread confirmed by RT-PCR.
4. Mild symptoms of chlorosis, mosaic and/or leaf deformation evident. Slight stunting
may be evident. Ring patterns or small necrotic lesions sometimes visible.
5. Moderate symptoms of chlorosis, mosaic and/or leaf deformation. Moderate to
significant stunting of growth and small necrotic lesions may be present. Flowers
usually present.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
6. Large necrotic lesions on leaf/stem, severe stunting. Plant remains alive but no
flowers present.
7. Plant is dead
RT-PCR assays for YTMMV and PZSV.
All inoculated plants were screened at 20, or 25 and/or 35 dpi for presence of YTMMV and
PZSV using virus-specific primers in RT-PCR assays. MyTaq™ One-Step RT-PCR system
(Bioline) was used to synthesise cDNA and amplify fragments of virus genomes in the
presence of virus-specific forward and reverse primers from total RNA extracted from plants
using the RNeasy Plant Mini kit (Qiagen), or the dsRNA enrichment protocol described
above. Virus-specific primers that annealed within the replicase gene of YTMMV were
YTMMV461F 5’-GATGTTCGTGACGTCATGCG-3’ and YTMMV809R 5’-
TAGCGGGTAACTCCACGGTA-3’ to yield an amplicon of 348 bp. Primers used to detect
the PZSV genome were R3-F 5’ CTCACCAACTGAATGCTCTGGAC 3’ and R3-R 5’
TGGATGCGTCTTTCCGAACC 3’ (Liu and Sears, 2007) that annealed to the movement
protein gene in RNA3 to yield an amplicon of 427 bp.
Transmission Electron Microscopy.
A single YTMMV-Kalbarri infected Solanum betaceum leaf was collected and cut to expose
leaf sap. A small quantity of sap was dropped onto a 400 mesh square copper grid and coated
with formvar stain by adding a drop of 1 % phosphotungstic acid. It was left to incubate at
room temperature for 5 min, with excess liquid was removed by blotting onto filter paper.
The grid was viewed under a Philips CM100 Bio transmission electron microscope and
images recorded.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Results
Genome assembly and sequence analysis.
The complete genome sequence of the YTMMV-Kalbarri, isolated from a plant of A.
ilicifolia subspecies ilicifolia was 6548 nt in length. The consensus genome sequence was
assembled from 4599 reads. Coverage ranged from 14-fold at nt 3573 within the replicase to
636-fold at nt 5469 within the movement protein. Overall mean coverage across the genome
was 76.5-fold. Pairwise identity was 96.6%.
Comparison of the new isolate with the type isolate YTMMV-Cervantes showed they shared
96.7% nt identity. Nucleotide (nt) and amino acid (aa) pairwise identities of individual
proteins between the two YTMMV isolates were: Replicase, 96.7% nt, 99.3% aa; Movement
Protein (MP), 98.0% nt, 98.9% aa; Coat Protein (CP), 98.5% nt, 98.7% aa. The overall
nucleotide sequence difference is below 10%, a species demarcation criterion advised by the
International Committee on the Taxonomy of Viruses for tobamoviruses (King et al. 2012),
confirming that the new virus isolate is a strain of Yellow tailflower mild mottle virus. The
genome sequence of YTMMV-Kalbarri was granted GenBank accession KJ683937.
The complete genome sequence of new isolate of PZSV was determined and compared with
the complete genomes available from tomato in Italy (GenBank accessions AJ272327,
AJ272328, AJ272329) and from sunflower in Argentina (JQ350736, JQ350737, JQ350739),
and partial genomes from capsicum and tomato from Spain (GQ178216, GQ178217), and
tomato from the USA (EU906913) (Table 2). RNA1, encoding Methyltransferase and
Helicase domains of the replicase, was 3386 nt in length. RNA1 shared 89 % and 95 % aa
pairwise identities with isolates from tomato and sunflower, respectively. The RNA2
sequence, encoding the RNA-dependent RNA polymerase domain of the replicase, was 2433
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
nt in length. It shared 95 % and 97 % aa identity with the tomato and sunflower isolates of
PZSV, respectively. RNA3, encoding a movement protein and coat protein, was 2664 nt in
length. The movement protein (MP) sequence shared 97 % and 99 % aa identity with the
tomato and sunflower isolates, respectively. The partial movement protein sequences of
Spanish isolates collected from capsicum and tomato shared 97 % aa with the new sequence,
and was identical to the other Australian isolate of PZSV from Cakile maritima (GenBank
accession GU046705) (Luo et al. 2010). The three complete genome fragments of PZSV-
SW13 were granted GenBank accession codes KF790760 (RNA1), KF790761 (RNA2) and
KF790762 (RNA3).
Symptoms associated with virus infection.
YTMMV-Kalbarri and PZSV-SW13 isolates naturally co-infected a symptomatic plant of A.
ilicifolia subsp. ilicifolia. When leaf sap from the original host plant was inoculated to N.
benthamiana plants, YTMMV was able to systemically infect them, but not PZSV, despite
PZSV having been reported to systemically infect N. benthamiana plants (Lapidot et al.
2010).
Host responses to the new YTMMV isolate were compared to those induced by the type
isolate YTMMV-Cervantes. Leaf sap from infected N. benthamiana plants was used to
inoculate a range of experimental host plants. Visible symptoms were recorded if present, and
RT-PCR assays of inoculated and new (uninoculated) leaves were done. In most cases,
visible responses by the plants to the two isolates could not be distinguished (Table 1).
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Amaranthaceae: Chenopodium amaranticolor exhibited local lesions but did not become
systemically infected. In contrast, A. quinoa exhibited no response to inoculation, and no
virus could be detected from inoculated leaves 35 dpi.
Amaryllidaceae: Neither of the two Allium species tested exhibited visible symptoms of
infection or became locally or systemically infected.
Asteraceae: Neither sunflower nor lettuce exhibited visible symptoms of infection or became
locally or systemically infected.
Brassicaceae: Of the three species tested, none exhibited symptoms of infection. YTMMV-
Cervantes was detected in the inoculated leaves of all plants of Chinese cabbage tested 25
dpi. Sap extracted from these Chinese cabbage leaves was not infectious on N. benthamiana
plants.
Cucurbitaceae: The three cucurbits tested did not exhibit visible symptoms of infection or
became locally or systemically infected.
Fabaceae: Common bean plants exhibited no symptoms nor supported local or systemic
infection.
Lamiaceae: Basil plants exhibited no symptoms nor supported local or systemic infection.
Malvaceae: Okra plants exhibited no symptoms nor supported local or systemic infection.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Solanaceae:Only one Yellow tailflower (Anthocercis littoria) seedling was inoculated with
YTMMV-Kalbarri because of the difficulty of achieving seed germination in this species.
Compared to the mock-inoculated plant, the YTMMV-infected A. littoria plant exhibited
premature yellowing of leaves and slower growth. The two Nicotiana species tested
responded differently to YTMMV infection. Plants of N. benthamiana accession RA-4
(indigenous to Australia) died quickly after infection (Fig.1b.), whereas plants of N. glutinosa
(indigenous to Peru) exhibited local necrotic lesions but systemic infection did not occur.
Two cultivars of Capsicum annuum (bell and chili pepper varieties) exhibited mild mottling
symptoms on young leaves, or there was more generalized chlorosis and reduction in leaf
size, and plants became stunted and yellow (Fig. 1d). Fruits produced from infected plants
were smaller and distorted in comparison to those produced from mock-infected control
plants. The upper leaves of infected Petunia hybrida plants were slightly distorted and
mottled, and flower petals were paler between the veins while the petal veins were darker.
Flowers were smaller and distorted. Petunia plants infected by YTMMV-Cervantes exhibited
more severe symptoms than those induced by YTMMV-Kalbarri. Two of the three members
of the genus Physalis tested - P angulata (wild gooseberry, Mullaca,), P. philadelphica
(tomatillo) – exhibited similar symptoms to one another; leaves and fruits senesced
prematurely and were shed. In contrast, P. peruviana (Cape gooseberry, Inca berry) plants
exhibited comparatively milder symptoms. Members of the genus Solanum exhibited
variable responses to YTMMV infection. S. betaceum (tamarillo) plants became severely
stunted, oval-shaped lesions appeared on stems and petioles, leaves were heavily distorted,
and no flower was produced (Fig. 1h, i). Infected S. lasiophyllum (flannel bush, an Australian
native species) plants exhibited no obvious symptom on leaves, but infected plants grew less
vigorously than control plants. In S. lycopersicum cv Money Maker, symptoms were initial
pallor and/or a faint mosaic on young leaves followed by a generalised chlorosis and
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
reduction in leaf size as plants aged (Fig. 1c). In S. lycopersicum cv Pomodoro Marglobe, the
symptoms resembled those seen in the other tomato cultivar with the addition of bunching of
young leaves. Infection in S. melongena (eggplant) was associated with pallor, chlorosis,
mosaic, and moderate to significant stunting (Fig. 1f). Few fruits were produced, and those
produced were lighter in colour (pink rather than purple) and smaller than controls. In S.
nigrum (black nightshade, a naturalised weed), symptoms of infection of YTMMV-Kalbarri
were not apparent until the fourth week post inoculation when mild mottling and leaf
distortion became visible on young leaves. There was no visible difference in size or number
of fruit between infected and control plants. In contrast, S. nigrum plants infected with
YTMMV-Cervantes exhibited more severe symptoms, resulting in generalized stunting.
YTMMV infection of S. tuberosum (potato) plants resulted in small local lesions on
inoculated leaves (Fig. 1e, 1g) followed by systemic infection. The emerging leaves of
infected plant showed faint mottling symptoms.
Electron microscopy.
Rod-shaped virus particles of 240 nm long and 14 nm wide were observed in YTMMV
infected leaf tissue of S. betaceum (Fig. 2), consistent with those produced by other
tobamoviruses (Hatta et al. 1983).
Discussion
In this study, we sampled a single affected A. ilicifolia subsp. ilicifolia plant from a site near
Kalbarri Western Australia and found that it was infected with isolates of two viruses –
YTMMV and PZSV.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
A host range study showed that most solanaceous plants are susceptible to systemic infection
by YTMMV-Kalbarri, including Anthocercis littoria, the species from which the type isolate
of YTMMV was described. The exception was N. glutinosa, the original source of the
Tobacco mosaic virus (genus Tobamovirus) resistance gene in N. tabacum (Holmes, 1938).
Thus, YTMMV isolates probably have the potential to infect members of the Solaneaceae, of
which approximately 192 indigenous and naturalised exotic species grow in Western
Australia (Anon, 1998), in addition to the commercially important cultivated food and flower
species.
The two isolates of YTMMV tested are genetically close, yet a comparison of symptom
induction revealed small differences in virulence on solanaceous hosts, notably on petunia
and black nightshade plants where symptoms were consistently more severe upon infection
with YTMMV-Cervantes. The detection of YTMMV-Cervantes in inoculated leaves of
Chinese cabbage was surprising, as solanaceous-infected tobamoviruses have not been
recorded infecting brassicas (Stobbe et al. 2012). The RT-PCR assay result was robust and
consistent in all Chinese cabbage samples tested. However, we were unable to establish
infection in highly vulnerable N. benthamiana plants using sap from apparently locally-
infected Chinese cabbage plants, indicating that virus particle titre was probably very low.
PZSV has a broad recorded host range including members of five plant families (Gallitelli,
1982; Liu and Sears, 2007), and as such constitutes a potentially greater risk to indigenous
plant communities and to commercial production species in Australia. YTMMV and PZSV
infected red-striped tailflower, a species whose geographical range overlaps those of five
other Anthocercis species: A. anisantha, A. genistoides, A. gracilis (threatened), A. intrica
(threatened) and A. littoria. Other wild solanaceous species that live naturally within the same
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
geographical range are S. aviculare, S. capsiciforme, S. lasiophyllum, S. linneanum, S.
symonii, and the exotic weed S. nigrum. The mild symptoms shown by both S. lasiophyllum
and S. nigrum (YTMMV-Kalbarri) under experimental conditions suggest that some
YTMMV-infected wild plants may be difficult to identify from the presence of visual
symptoms alone. Similarly, YTMMV-infected potatoes, tomatoes, capsicums and cape
gooseberries exhibited mild symptoms. Cultivars of potato, tomato and capsicum are farmed
within the natural geographical range of Anthocercis species. Thus, it is conceivable that
YTMMV infection of commercial species has already occurred naturally, but so far has gone
unnoticed or unrecorded. No attempt was made in the current study to quantify potential
losses to commercial crops by YTMMV infection, but further research is underway to
examine this.
The presence of PZSV was unexpected. Most reports of PZSV from the Americas, the
Middle East and Europe are from horticultural crop species, with a minority from weeds (Liu
et al. 2007; Escriu et al. 2009; Lapidot et al. 2010; Biccheri et al. 2012; Giolitti et al. 2014),
but in Australia both reports are from wild plants, one an exotic weed (C. maritima) (Luo et
al. 2010) and the other indigenous (A. ilicifolia) . The location of the doubly-infected red-
striped tailflower was 150 km north of the nearest horticultural production area (Geraldton)
and more than 600 km north of Woodman point where the other Australian isolate of PZSV
was identified from C. maritima (Luo et al. 2010). The sequence of the new PZSV isolate
shared greatest identity with the other Australian isolate, suggesting that the two Australian
isolates have the same original source. How PZSV came to Australia is unknown, but it may
not be in tomato seed because PZSV infection is characterised by chlorotic and necrotic ring
patterns on the leaves and fruit, plant stunting, leaf malformation, reduced fruit set, and plant
death (Gallitelli, 1982), all symptoms that commercial growers would notice and report to
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
authorities. A clue to the source of PZSV may be in the identity of one of its hosts and the
proximity of both Australian hosts to the ocean. The first isolate was described from C.
maritima (sea rocket) plants growing on a beach, and the new isolate described here is also
from a plant growing within metres of the same ocean. PZSV is described as seed borne in
the brassica Diplotaxis erucoides (White wall rocket) (Lapidot et al. 2010), and it is
reasonable to assume seed transmission also occurs in Cakile species, although this has not
been tested. We hypothesise that PZSV entered Australia in seed of C. maritima or C.
edentula carried on ocean currents from other continents, where it subsequently spread to
tailflower plants nearby via the aphids that widely colonise both species. The fruit of Cakile
is adapted to dispersal by sea currents, and viability of seed and seedlings is not affected by
immersion in salt water for at least 10 weeks (Barbour, 1970; Clausing et al. 2000). The two
Cakile species that occur commonly along Australian coastlines were self-introduced at least
100 years ago (Rodman, 1986), and the original source location is unknown. Elsewhere,
Cakile species have spread along coastlines in the Americas, Europe and western and eastern
Asia (Clausing et al. 2000; Fukuda et al. 2013). The nearest continent to Australia is Asia,
and ocean currents originating from South-east Asia sweep in a north to south direction past
the collection sites of the two Australian PZSV isolates. A survey for PZSV in Cakile
populations in Australia and elsewhere may clarify the origin of PZSV in Australia.
The risks of YTMMV and PZSV in managed and wild plant systems are difficult to assess
without more information on distribution, host range and natural transmission. PZSV is
vertically transmitted through seed and pollen in tomato and brassicas (Vovlas et al. 1989;
Lapidot et al. 2010), but its transmission status in Anthocercis seed is unknown.
Tobamoviruses are also transmitted vertically, although this has not been tested with
YTMMV, and tobamovirus particles are highly stable, enabling incidental transmission to
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
new hosts through direct contact between plants and by humans, animals, invertebrates,
vehicles, etc. Thus, the inadvertent spread of these viruses through human-mediated
transport of infected host plants or propagules such as seeds and cuttings is probably the
principle means by which they may emerge into commercial species. Identification and
characterisation of viruses from wild plants has been a neglected area of research, yet it is an
important one (Anderson et al. 2004). Studies such as this relate to how viruses harboured by
wild plants may potentially respond to new opportunities presented by changes in land use,
weather patterns and water flow, human movement and trade.
Acknowledgements
This study was funded in part by Australia Research Council Linkage grant LP110200180
and by studentships granted to JWLO and SHK by Murdoch University.
References
Anderson PK, Cunningham AA, Patel NG, Morales FJ, Epstein PR, Daszak P, 2004.
Emerging infectious disease of plants: pathogen pollution, climate change and
agrotechnology drivers. Trends in Ecology and Evolution 19, 535-544.
Anon. 1998. Western Australian Herbarium. FloraBase-the Western Australian Flora.
Department of Parks and Wildlife. [https://florabase.dpaw.wa.gov.au/]. Accessed 13
March 2015.
Barbour MG, 1970. Germination and early growth of the strand plant Cakile maritima.
Bulletin of the Torrey Botanical Club 97, 13-22.
Biccheri R, Babini AR, Blouin A, Lanzoni C, Pisi A, Poggi-Pollini C, Credi R, Laghi L,
Rocculi P, Rubies-Autonell C, Pearson MN, Ratti C, 2012. Pelargonium zonate spot
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
virus infecting kiwifruit plants in Italy. Proceedings 22nd International Conference on
Virus and Other Graft Transmissible Diseases of Fruit Crops, 2012. Rome, 27.
Clausing G, Vickers K, Kadereit JW, 2000. Historical biogeography in a linear system:
genetic variation of sea rocket (Cakile maritima) and sea holly (Eryngium maritimum)
along European coasts. Molecular Ecology 9, 1823–1833.
Dawson WO, Hilf ME, 1992. Host-range determinants of plant viruses. Annual Review of
Plant Physiology and Plant Molecular Biology 43, 527-555.
Escriu F, Cambra MA, Luis-Arteaga M, 2009. First report of pepper as a natural host for
Pelargonium zonate spot virus in Spain. Plant Disease 93, 1346-1346.
Finetti-Sialer M, Gallitelli D, 2003. Complete nucleotide sequence of Pelargonium zonate
spot virus and its relationship with the family Bromoviridae. Journal of General
Virology 84, 3143-3151.
Fukuda T, Kato Y, Sato H, Taran AA, 2013. Naturalization of Cakile edentula (Brassicaceae)
on the beaches of Kunashiri and Etorofu Islands – the first record for the species from
the Kuril Islands. Journal of Japanese Botany 88, 124-128.
Gallitelli D, 1982. Properties of a tomato isolate of Pelargonium zonate spot virus. Annals of
Applied Biology 100, 457-466.
Gebre-Selassie K, Delecolle B, Gognalons P, Dufour O, Gros C, Cotillon AC, Parrella G,
Marchoux G, 2002. First report of an isolate of Pelargonium zonate spot virus in
commercial glasshouse tomato crops in Southeastern France. Plant Disease 86, 1052.
Gibbs AJ, 1999. Evolution and origins of tobamoviruses. Philosophical Transactions of the
Royal Society London B 354, 593-602.
Giolitti F, Bejerman N, Nome C, Visintin G, Breuil S. de Lenardon S, 2014. Biological and
molecular characterization of an isolate of Pelargonium zonate spot virus infecting
sunflower in Argentina. Journal of Plant Pathology 96, 189-194.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Gulati-Sakhuja A, Sears JL, Nunez A, Liu HY, 2009. Production of polyclonal antibodies
against Pelargonium zonate spot virus coat protein expressed in Escherichia coli and
application for immunodiagnosis. Journal of Virological Methods 160, 29-37.
Haegi L, 1986. The affinities of Anthocercis (Solanaceae) and related genera. In: D’Arcy
WG, ed. Solanaceae: Biology and Systematics. New York: Columbia University
Press, 27-40.
Hatta T, Francki RIB, Grivell CJ, 1983. Particle morphology and cytopathology of galinsoga
mosaic virus. Journal of General Virology 64, 687-692.
Holmes FO, 1938. Inheritance of resistance to tobacco mosaic disease in tobacco.
Phytopathology 28, 553–561.
King AM, Adams MJ, Carstens EB, Lefkowitz EJ, eds, 2012. Virus taxonomy: classification
and nomenclature of viruses: Ninth Report of the International Committee on
Taxonomy of Viruses. Amsterdam, the Netherlands: Elsevier/Academic Press.
Lapidot M, Guenoune-Gelbart D, Leibman D, Holdengreber V, Davidovitz M, Machbash Z,
Klieman-Shoval S, Cohen S, Gal-On A, 2010. Pelargonium zonate spot virus is
transmitted vertically via seed and pollen in tomato. Phytopathology 100, 798-804.
Liu HY, Sears JL, 2007. First report of Pelargonium zonate spot virus from tomato in the
United States. Plant Disease 91, 633.
Luis-Arteaga M, Cambra MA, 2000. First report of natural infection of greenhouse-grown
tomato and weed species by Pelargonium zonate spot virus in Spain. Plant Disease
84, 807.
Luo H, Wylie, SJ, Jones MGK, 2010. Identification of plant viruses using one-dimensional
gel electrophoresis and peptide mass fingerprints. Journal of Virological Methods
165, 297-301.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Luo H, Wylie SJ, Coutts B, Jones RAC, Jones MGK, 2011. A virus of an isolated indigenous
flora spreads naturally to an introduced crop species. Annals of Applied Biology 159,
339-347.
Morris TJ, Dodds JA, 1979. Isolation and analysis of double-stranded RNA from virus-
infected plant and fungal tissue. Phytopathology 69, 854-858.
Ollier CD, 1995. Tectonics and landscape evolution in southeast Australia. Geomorphology
12, 37-44.
Quacquarelli A, Gallitelli D, 1979. Three viruses of Pelargonium zonale in Apulia.
Phytopathologia Mediterranea 18, 61-70.
Rodman JE, 1986. Introduction, establishment and replacement of sea-rockets (Cakile,
Cruciferae) in Australia. Journal of Biogeography 13, 159-171.
Särkinen T, Bohs L, Olmstead RG, Knapp, S, 2013. A phylogenetic framework for
evolutionary study of the nightshades (Solanaceae): a dated 1000-tip tree. BMC
Evolutionary Biology 13, 214.
Stobbe AH, Melcher U, Palmer MW, Roossinck MJ, Shen G, 2012. Co-divergence and host-
switching in the evolution of tobamoviruses. Journal of General Virology 93, 408-
418.
Vovlas C, Gallitelli D, Conti M, 1989. Preliminary evidence for an unusual mode of
transmission in the ecology of Pelargonium zonate spot virus (PZSV). IVth
International Plant Virus Epidemiology Workshop. Montpellier, France: 302-305.
Wylie SJ, Li H, Jones MGK, 2014. Yellow tailflower mild mottle virus: a new tobamovirus
described from Anthocercis littorea (Solanaceae) in Western Australia. Archives of Virology
159, 791-795.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Fig. 1. Red-striped tailflower (Anthocercis ilicifolia) plant and symptoms of plants infected
with Yellow tailflower mild mottle virus. a: A Red-striped tailflower (A. ilicifolia) plant in its
natural environment. b: Infected Nicotiana benthamiana accession RA-4 35 days post
inoculation (dpi). c: Infected tomato plant: arrow indicates leaf distortion. d: Infected chilli
plant: plant was stunted, with mosaic leaves. e: Infected N. glutinosa showing necrotic lesions
from YTMMV infection (arrow). f: Infected eggplant: plant stunted, with yellow and mosaic
leaves. g: Infected potato plant 14 dpi. Arrow indicates position of local necrotic lesions on
inoculated leaf. h: oval-shaped necrotic rings and lesions on the stem (arrow) on tamarillo. i:
tamarillo exhibiting stunting, leaf distortion, mosaic and necrotic lesions on emerging leaves.
Fig. 2. Transmission electron micrograph negatively stained showing tobamovirus-like
particles in sap from a Solanum betaceum (tamarillo) leaf infected with Yellow tailflower
mild mottle virus.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Table 1
Plants species used in this study and a comparison of responses to inoculation with Yellow
tailflower mild mottle virus isolates Kalbarri and Cervantes.
Plant species Family Common name/cultivar/line (if known)
Number of plants
tested per virus
isolate
Symptom severity index
YTMMV-Kalbarri
Symptom severity index
YTMMV-Cervantes
Allium tuberosum Amaryllidaceae
Chinese Chive 3-6 1 1
A. cepa var. aggregatum
Amaryllidaceae
Shallot 3-6 1 1
Anthocercis littoria Solanaceae Yellow tailflower 1 4
Brassica chinensisa Brassicaceae Chinese cabbage cv Pai-Tsai
3-6 1 1
Brassica napus Brassicaceae Canola 3-6 1 1
Capsicum annuum Solanaceae Bell pepper 3-6 4 4
Capsicum annuum Solanaceae Chili 3 4
Chenopodium amaranticolor
Amaranthaceae
- 5-6 2 2
Chenopodium quinoa Amaranthaceae
Quinoa 5-6 1 1
Cucumis melo Cucurbitaceae Rockmelon cv Planters Jumbo
3-6 1 1
Cucumis sativus Cucurbitaceae Cucumber cv Burpless F1
3-6 1 1
Cucurbita pepo Cucurbitaceae Squash cv White scallop
3-6 1 1
Helianthus annus Asteraceae Sunflower 3-6 1 1
Hibiscus esculentus Malvaceae Okra cv Yellow F1 3-6 1 1
Lactuca sativa Asteraceae Lettuce cv Great Lakes
3-6 1 1
Nicotiana benthamiana
Solanaceae RA-4 6-12 7 7
Nicotiana glutinosa Solanaceae - 6-9 2 2
Ocimum basilicum Lamiaceae Basil cv Gourmet 3-6 1 1
Petunia hybrida Solanaceae Petunia, Mixed cv 4 3 4
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Phaseolus vulgaris Fabaceae Bean cv Blue Lake 3-6 1 1
Physalis angulata Solanaceae Balloon cherry 3 5
Physalis peruviana Solanaceae Cape gooseberry 3 4
Phyalis philadelphica Solanaceae Tomatillo 5 5
Raphanus sativus L. Brassicaceae Chinese radish 3-6 1 1
Solanum betaceum Solanaceae Tamarillo 4 5
S. lasiophyllum Solanaceae Flannel bush 3 2
S. lycopersicum Solanaceae Tomato cv Money Maker
5-6 4 4
S. lycopersicum Solanaceae Tomato cv Pomodoro Marglobe
5 4
S. melongena Solanaceae Eggplant. 1722 6 4 4
S. nigrum Solanaceae Black nightshade 3-6 3 5
S. tuberosum Solanaceae Potato cv Nadine 3 3
S. tuberosum Solanacea Potato cv Royal Blue 3 3
Zea mays Poacea Sweet corn cv Sweet bicolour F1
3-6 1 1
a YTMMV detected by RT-PCR on inoculated leaves of all inoculated plants 25 dpi, but no symptoms of local
infection or evidence of systemic infection was found.
Acc
epte
d A
rtic
le
This article is protected by copyright. All rights reserved.
Table 2 Comparison of pairwise identities of amino acid and nucleotide (in parentheses) sequences of open reading frames (ORF) of Pelargonium zonate spot virus isolate SW13 (red-striped tailflower, Australia, KF790760, KF790761, KF790762) with those of isolates Tomato (tomato, Italy, AJ272327, AJ272328, AJ272329), Parana (sunflower, Argentina, JQ350736, JQ350737, JQ350739), Woodman Point (sea rocket, Australia, GU046705), P-1-06 (capsicum, Spain, GQ178217), T-2-06 (tomato, Spain, GQ178216), and California (tomato, USA, EU906913).
a Met, methyltransferase domain of replicase; Hel, helicase domain of replicase; RdRp, RNA polymerase domain of replicase; MP, movement protein; CP, capsid protein.
b Partial ORF sequence
ORFa PZSV-Tomato
PZSV-Parana
PZSV Woodman Pointb
PZSV P-1-06b
PZSV T-2-06b
PZSV-California
RNA 1a (Met, Hel)
89 (89) 95 (96) - - - -
RNA 2a (RdRp)
97 (95) 98 (97) - - - -
RNA 3a (MP)
97 (96) 99 (98) 100 (100) 97 (94) 97 (94) -
RNA 3b (CP)
95 (92) 98 (98) - - - 95 (93)
top related