zinc finger nuclease

Zinc Finger Nuclease – The new Technology for Targeted Genome Modification in Animals

Dr. Rainer EbelSales Development Manager

Emerging TechnologiesSigma-Aldrich Corporation

Agenda

• Zinc Finger Nuclease Technology

• Targeted Knockout Zebrafish

• Targeted Knockout/-in Rats and Mice

• Targeted Knockout in Rabbits

• Sigma-Aldrich

www.sageresearchmodels.com

What is a ZFN?

A reagent that creates a very targeted double strand break (DSB) in genomic DNA

ZFP Design via Single Zinc Finger“Mix and Match” Strategy

Fingers:

Triplets:

9bp target site:

3-finger ZFP:

Link fingers of known subsite preference to yield protein with desired composite specificity

In most nucleases, DNA binding and nuclease functions are structurally integrated, making them difficult to engineer.

Zinc Finger Nuclease

Zinc Finger Nuclease Highly-Specific Genomic Scissors

Each homologous arm contains five to six Zinc Finger Proteins

Gene specificity is 30 or 36 bases

ZFN-mediated Knockout

Santiago et al, 2008, PNAS 105, 5809.

Genotype of Three New DHFR -/- CHO Cell Lines

ZFN-mediated Knockin

•Creating endogenous gene reporters

GFP-tubulin

GFP-actin

ZFN-mediated Knockin

Agenda

• Sigma-Aldrich

Animal Models: Somatic Disruption of Zebrafish ntl Gene

Injected ZFN mRNA into single cell embryoScored phenotype after 2 daysSequencing revealed broad range of deletions and insertions at targeted loci (single embryo alleles shown)>60% of founders carry ntl mutationsGermline frequency 20% (average)

Agenda

• Sigma-Aldrich

Historic Limitations in Genome Manipulation

Recombinant Knockout Technology

• Utilizes selectable markers to identify recombination events

• 12 – 18 month timeframe for founder creation

• Well established technology in mice for specific strains

http://nobelprize.org/nobel_prizes/medicine/laureates/2007/adv.html

Knockout Rats Using ZFNs

The World’s First Targeted Knockout Rats

Mutant x WT : Confirmed germline transmission (4/13 pups)

Pronuclear injection of ZFN against GFP into fertilized 1-cell stage embryos of GFP-rats

~ 12% efficiency

p53 Knockout Rat

ZFN Assembly Time: 6 weeksZFN Injection: week 7Founders Born: weeks 10 – 11

– 15/58 Pups Born have Mutation– Identify by PCR and sequence analysis

From Gene Sequence to Founder Identified in 12 weeksFounder Sex Deletion Size Sequence

ttctccagtcttcctccagatgatattctggtaaggagccgg

53 male 5 ttctccagtcttcctccagat--------tctggtaaggagccgg36 female 9 ttctccagtcttcctcc---------------tctggtaaggagccgg

15 ttctccagtcttc----------------------tggtaaggagccggg37 female 3 ctccagtcttcctccagat--------attctggtaaggagccgg38 female 14 ttctccagtcttcctccaga-----------------------agagccgg40 female 11 ttctccagtcttcctccag------------------gtaaggagccgg33 male 3 ttctccagtcttcctccagat-------attctggtaaggagccgg18 male 9 ttctccagtcttcctcc---------------ttctggtaaggagccgg6 female 11 ttctccagtcttcct-------------------tccggtaaggagccgg

74 male 8 ttctccagtcttcctcct-------------tcctggtaaggagccgg

p53 Validation by Western

(PAB240)

non-specific bandp53

WT 731RP KO 733RP

K L K LActin

p53 Pathology

a. b. c.

Zinc Finger Nuclease Knockout Mouse

•ZFN Assembly Time: 6 weeks•ZFN Injection: week of 4/21/09•Founders Born: 5/12, 5/13

– 34/44 Pups Have Mutation– Mutations Sequenced– Knockouts range from 3 to 695bps

9/9 Founders passed the knockout to F1s

Founder ID # Deletion size (bp)

2 53 44 35 6466 6957 198 24811 69113 39217 20

18 219 2320 1921 53323 39625 53326 11

53427 75

29 31231710

Weinstein et al, 2010, Nat. Biotech

2.01.5

HA-L HA-R

PF PRNotI

0.840.97

1 2 3 4 5 6 7 8MKb

The Not I site was also integrated into the rat Mdr1a site using a similar donor construct

Targeted Integration of NotI into PXR in Rat Embryos

Agenda

• Sigma-Aldrich

PLoS One. 2011;6(6):e21045. Epub 2011 Jun 13.

The Rabbit as a Model

• Cardiovascular disease• AMD• Dermal• Joint

Microinjection Statistics

Session 1 Session 2 Session 3 Session 4 Total

Embryos Collected 207 119 120 111 557

Embryos Microinjected 196 98 96 75 465

Embryos Transferred 122 76 68 60 326

Rabbits Born 9 1 2 4 16

Embryos collected/rabbit born 35Embryos microinjected/rabbit born 29Embryos transfered/rabbit born 20

5/16 founders were identified (mutations ranging from 8bp to ~300bp deletion (some with insertions).

• Sigma-Aldrich

Agenda

• CompoZr® Targeted Integration Kit 2.125 €• Human AAVS1• Murin Rosa26

– Rapid Gene Insertion into the Human or Murine Cell Line of Your Choice– ZFNs engineered to target human AAVS1 or murine Rosa26 site

• Knockout ZFN (human, rat, mouse) 5.100 € (Plasmid only)– Production time: 3 – 12 weeks

• Custom ZFN against human, rat, mouse, hamster 12.000 € (Plasmid only)– Best performing custom validated ZFN against gene of interest– Production time: 9 – 12 weeks

• Custom ZFN against “non-standard species” 12.000 € (Plasmid only)– Up to Top three ZFN against gene of interest– Production time: 9 – 12 weeks (up to 6 months)

Available from SAGE Labs

• Priority access to catalog knockout rat models

• Access to SAGEspeed™ custom model creation platform– Rat / Mouse / Rabbit– Founder animals (rat or mouse) produced in as little as 5 months– Limited researcher ‘slots’ available to customers per Year

• ModelShare™ Program– First of its kind rat model repository

• ADME/Tox• Mdr1a• PXR• Mrp1• Mrp2• Bcrp

Immunodeficiency• Rag1• Rag 2• DNAPK• Foxn

Carcinogenicity• p53

• CNS• ApoE• Leptin• BDNF• DISC1

• Pink1• Parkin• α-synuclein• DJ-1• Lrrk2

Looking Beyond the Rodent…..

Dr. Rainer EbelSales Development Manager Central EuropeEmerging

Technologies

0172 / 83 64 714rainer.ebel@sial.com

zinc finger nuclease – the new technology for targeted …€¦ · • zinc finger nuclease...

Documents

production and purification of staphylococcal nuclease in

knockout implementing mvvm in java script with knockout

transcription activator-like effector nuclease...

nuclease enrichment

observation of recbcd helicase/nuclease activity

targeted knockout of a chemokine-like gene increases ... ·...

small-molecule targeted recruitment of a nuclease to...

knockout js

genetic separation of sae2 nuclease activity from mre11 .......

2d knockout

the active site of staphylococcal nuclease: paramagnetic

supplementary information in format provided by sims and...

targeted knockout of the rickettsia rickettsii ompa surface...

gene knockout: the technology of gene · pdf filethe...

supplementary figure 1 strategy for targeted knockout of...

synthesis and characterization, nuclease activity studies

biorxiv preprint doi: ...jul 11, 2020 · comparing with...

generation of targeted knockout mutants in arabidopsis...

nuclease-resistant synthetic drug-dna adducts ...€¦ ·...