(CANCER RESEARCH 49. 4305-4310, August 1. 1989|

Amplification of the Integrated Viral Transforming Genes of HumanPapillomavirus 18 and Its 5'-Flanking Cellular Sequence LocatedNear the myc Protooncogene in HeLa Cells1

Pedro A. Lazo, Joseph A. DiPaolo,2 and Nicholas C. Popescu

Institute for Cancer Research, Fox Chase Cancer Center, Philadelphia, Pennsylvania 19111 IP. A. L.], and Laboratory of Biology, Division of Cancer Etiology, NationalCancer Institute, Bethesda, Maryland 20892 fj. A. D., N. C. P.]

ABSTRACT

The human papillomavirus type 18 integrated in the HeLa cell genomeis amplified on chromosome 8. E6, E7, and El open reading frames areamplified S-fold, and the late viral DNA region, the viral long controlregion, and cellular flanking sequences are amplified 15-fold. The common S'-flanking cellular DNA was localized by in situ hybridization of

normal and HeLa cells only on chromosome 8 band q24. This flankingprobe is included in the amplification unit of Colo320 cells, but in thecase of HeLa the amplified region does not include the myc gene whichis structurally conserved. Viral integration on chromosome 8 representsan independent event and not a rearrangement of viral DNA located onother chromosomes. The amplification of HPV-18 E6 and E7 open

reading frames and the constitutive expression of the myc protooncogenemay contribute to immortalization and/or proliferative capacity of HeLacells.

INTRODUCTION

Human papillomaviruses are DNA tumor viruses associatedwith malignancies of epithelial cell origin. Over 50 viral typeshave already been identified and most induce benign papillomasor fibropapiliornas (1). In these lesions the virus is present inan extrachromosomal form. However, a small number, HPVs3

16, 18, 31, and 33, are associated with carcinomas that usuallyhave integrated HPV DNA in the host genome which is tran-scriptionally active. HPV DNA has been detected in 80% ofthe cervical carcinoma cases (2-4).

The sequence of events leading to cervical carcinoma and therole of HPV in this process are not well understood. The virusmay have multiple effects and may be a factor in the initialtransformation of the cell and/or in different stages of tumorprogression. Integration of the viral genome into the hostcellular DNA can have implications for the development ofmalignancy in humans. The consequence of this integrationmay be the acquisition by the host genome of viral transforminggenes with a new regulatory mechanism, either involving theloss of viral regulatory elements or acquisition of new ones ofcellular origin. The latter may occur as an alteration of cellulargenes caused by the integrated virus either as a result of theintegration per se (mutagenic agent) or by the effect of viralregulatory elements on nearby cellular genes.

This study concentrates on the major HPV integration site(5), located on a chromosome band 8q24 (6, 7) and called pal1 for papillomavirus-associated locus 1. There is some evidencesuggesting that this region might be amplified (6, 8, 9), but the

Received 8/1/88; revised 11/14/88, 4/19/89; accepted 4/24/89.The costs of publication of this article were defrayed in part by the payment

of page charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

1Supported by NIH Grants CA-06927 and RR-05539, an appropriation fromthe Commonwealth of Pennsylvania to the Fox Chase Cancer Center, and afellowship from the Cancer Research Institute. Inc., New York (P. A. L.).

2To whom requests for reprints should be addressed, at Laboratory of Biology,

Division of Cancer Etiology, National Cancer Institute. Bethesda, MD 20892.3The abbreviations used are: HPV, human papillomavirus: SDS. sodium

dodecyl sulfate; poly(A)* RNA, polyadenylate-containing RNA; cDNA, comple

mentary DNA; ORF, open reading frame.

details of the amplification have not been characterized. Wereport that viral transforming genes E6, E7, and El and theregulatory region from HPV-18 located near myc protooncogene are amplified in HeLa cells, but myc is not rearranged oramplified, though it may be expressed constitutively possiblybecause of the presence of amplified viral regulatory sequencesin its proximity. Both viral gene amplification and constitutivemyc expression might be important contributing factors to theimmortalization and proliferative properties of HeLa cells.Furthermore, chromosomal in situ hybridization results showthat the flanking sequence of HPV-18 on 8q24 is not transferredto other chromosomes, suggesting that integration on multiplechromosomes occurred independently in these cells. Also, thischromosomal region contains sequences which have not beenpreviously identified, and whose role in carcinogenesis still hasto be determined.

MATERIALS AND METHODS

Cell Lines and DNA Preparation. HeLa cell (ATCC CCL-2) is ahuman cervical carcinoma line. Human fibroblasts IMR-90 were provided by Dr. J. Freed and human colon carcinoma line Colo320DMwere provided by Dr. M. Erisman. Cells were washed twice in phosphate-buffered saline and DNA was prepared as previously described (8).

Southern Blot Analysis. Genomic DNA from the indicated sourcewas digested to apparent completion with the appropriate lestrictionenzyme and fractionated in an 0.8% agarose gel. The DNA was transferred to a nylon membrane (Hybond-N from Amersham International,Arlington Heights, IL) and cross-linked by IV irradiation for 4 min.The filters were prehybridized for 3 h at 67°Cin: 0.2 g/ml Ficoll, 0.2

g/ml polyvinyl pyrrolidone, 0.2 g/ml of bovine serum albumin, 5 IHMEDTA, 0.1% SDS, 0.45 M NaCI, 45 HIMsodium citrate, and 50 ¿ig/mlof salmon sperm DNA. The filters were hybridized with the appropriateprobe in a solution identical to the prehybridization solution but containing 10% dextran sulfate. Hybridization was performed at 67°Cfor16 h. Filters were washed twice at 67"C for 30 min in a solution

containing 0.45 M NaCI, 45 mM sodium acetate, 5 mivi EDTA, 0.1%SDS, and 25 ^g/ml salmon sperm DNA, followed by a wash at 67°C

for l h in 30 mM NaCI, 3 IHMsodium citrate, 5 mM EDTA, 0.1% SDS,and 25 ¿ig/mlof salmon sperm DNA. The gels were scanned by usinga digital densitometer connected to a VAX computer cluster, and thepeaks were analyzed with the PMATN program available at the FoxChase Cancer Center computer facility.

RNA Preparation and Analysis. Cells were washed in 20 ml ofphosphate-buffered saline and total cellular RNA was prepared aspreviously described (8). The poly(A)* RNA fraction was prepared bychromatography on oligothymidylic-acid cellulose (10). The conditionsfor Northern blot analysis have been described before (8).

In Situ Chromosome Hybridization. The DNA probe was labeledwith all four [3H]deoxynucleoside triphosphates to high specific activity(4.8 x IO7cpm/jig) by using a nick translation kit (Amersham Inter

national). Chromosomes were obtained from methotrexate-synchro-nized normal peripheral lymphocytes and HeLa cell cultures. The insitu hybridization was performed under stringent conditions of 50%formamide/2x standard saline citrate at 42°C.All other conditions

have been previously described (6, 11).

4305

Research. on December 29, 2020. © 1989 American Association for Cancercancerres.aacrjournals.org Downloaded from

HUMAN CHROMOSOME 8 AND PAPILLOMAVIRUS INTEGRATION

Probes. HPV-18 cloned in pBR322 was a gift from Drs. H. zurHausen and L. Gissman. The E6/7 ORF probe is a BamHi-Hincllfragment cloned in pUCIS (8). The human upstream probe, phHBg, isa 1.4-kilobase Bglll-Hindlll fragment cloned in pUCIS (5). The mycprobes were a gift of Dr. M. Erisman and have been described before(12). As controls human cDNA probes for 0-actin (13) and 02-micro-globulin (14) were used. Probes were nick translated with a kit fromAmersham International, using either [a-32P] dATP or [a"P] dCTP.

RESULTS

Pattern of Integrated Viral DNA. HPV-18 viral DNA probesdetect multiple bands in the HeLa genome (8, 15-17); furthermore, in situ hybridization implicates the involvement of severalchromosomes (6, 18). When DNA analysis was performed withHindlll, a restriction enzyme which does not cut in the HPV-18 genome, three major bands were detected (Fig. \A): A, 8.4kilobases; B, 7.9 kilobases; and C, 5.8 kilobases. Bands A, B,and C are forming a tandem array of alternating cellular andviral sequences which are the result of a duplication event afterintegration on a single chromosome (5, 9). These bands havebeen cloned and their viral content determined (5). The cellular5'-flanking probe (phHBg) (5) hybridized to segments A, B,

and C which also contain viral DNA. Thus this human DNAregion (pal-l) is preserved in these three segments. This probealso revealed the previously identified germ line alíelein humanplacenta and fibroblast DNA (5) as a Hindlll band of 6 kilo-bases (Fig. \A, Band G). The subgenomic viral probe for theearly region genes with the E6/7 ORF detected only segmentsA and B (Fig. lA). Similar results were obtained with an ElORF probe (not shown).

Viral and cellular probes (Fig. IA) clearly detect bands withvery different intensities, suggesting amplification of this DNAregion, and they can be used to determine the relative amplification of each copy. The use of the complete HPV-18 genomeas a probe can be misleading because the viral DNA is partiallydeleted in each viral segment (5) and consequently, differencesobserved with HPV-18 might simply reflect differences in theamount of remaining viral DNA. To quantitate the degree ofamplification, a probe is required whose full length is retainedin the different bands. The full length of the human probe,phHBg, common to viral segments A, B, and C, and germ linealíeleG is present in all bands it detects. Therefore the phHBg

B

23.1-

9.4-

6.6-'i

4.4 —¿�

2.3 —¿�2.0-

-C G-,

HPV-18 E6/7 phHBg

23.1-

94-.

6.6-

4.4-

2.3-2.0-

HeLa

.

IMR-90

Fig. I. A, Southern blot analysis of 10 /¿gof HeLa cell DNA with threedifferent probes. Complete genome of HPV-18. the E6/E7 ORF region in a 0.6-kilobase pair l!nin\\\ lliiK\\ fragment and human probe (phHBg) derived fromthe 5' flank of integrated viral segment B. B, Southern blot of DNA from HeLaand IMR-90 cells digested with /•.'<•»!<I and hybridized to the human probe for the

Mlvi-\B locus for use as reference.

probe is suitable for studying the relative amplification of thedifferent bands. The intensity of Band A was used as thereference by normalization to a probe specific for the humanA//V/-1B locus used as internal standard (Fig. IB), which wascompared to the signals detected in DNA from normal fibro-blasts. This reference locus is related to the rat Mlvi-l locus(19). The aneuploid state of HeLa cells is not a factor in thequantitation because the ratio of chromosome 8 DNA to totalDNA is similar to that of normal cells (6), and its normalizationwith another locus. Results (Table 1) were quantitated by usinga high resolution digital scanner to analyze the intensity of eachindividual band during the phase of its linear response. Thegerm line band (Band G) is also amplified and is likely to bethe result of an additional rearrangement of this band locatedto its 5' side which is not related to pupil loma virus DNA

integration (5). The probe, pKK1.3, which contains sequencesfor the late viral region, confirmed the relative intensity ofBands A, B, C (data not shown). A probe containing the viralE6 and E7 ORF was also used, because the E6 ORF is considered a key viral transforming gene (20) and the E7 gene hasmore recently been identified as also having a transforming role(21-23). This probe only detects Bands A and B (Fig. IA) and

their relative copy number is given in Table 1. A similar resultwas obtained with a probe specific for the El ORF (data notshown).

Chromosomal Location of the phHBg Flanking Cellular Sequence. The human cellular DNA probe derived from the 5'flank of HPV-18 integrated in HeLa cells, thepal-l region, wasdetected by in situ hybridization on homologous sequences at asingle site on the long arm of chromosome 8 of both normaland HeLa (Fig. 2A) cells. Of 70 normal lymphocyte metaphasesor prometaphases, 40% of the grains were localized on chromosome 8 with the largest accumulation at band q24; in 30HeLa cells, 43% of the total grains clustered at 8q24 (Fig. 2B).This observation shows that the duplication event after integration is very localized and did not involve other regions of thesame chromosome or other chromosomes.

Human myc Locus Is Neither Rearranged Nor Amplified inHeLa Cells. Because of the chromosomal location of the integrated and amplified viral DNA to the same band (8q24) as themyc protooncogene, the structural conservation of the myclocus was analyzed. DNA from HeLa cells, human fibroblastcell line IMR-90, and colon carcinoma Colo320 were digestedwith Hindlll and Xbal and analyzed by Southern blot analysiswith a specific probe for exon II derived from the human myclocus (12) and with the flanking phHBg probe. As can be seenin Fig. 3A, the myc locus is similar in HeLa and IMR-90 cells,but it is amplified and rearranged in Colo320 cells (24). Similarresults were obtained with other probes specific for upstreamsequences 5' of myc and for exons I and III spanning a region

of 25 kilobase pairs around the myc locus (data not shown). Onthe other hand, the use of the probe phHBg shows that it is

Table 1 Amplification of integrated HPV-18 and its 5'-flanking sequence

For the phHBg probe the blot shown in Fig. 1 was exposed for 6 h. For thebands detected with the E6/7 ORF probe, a 34-h exposure was used. Band Aused as reference is equivalent to a single copy gene per haploid genome bynormalization to a single copy locus Miri \ in normal human fibroblasts.

5'-flanking probe

(phHBg) E6/E7 ORF probe

Band ABand BBand CBand GPeak

area2.7

10.226.55.7Copy

no.1

4102Peak

area0.35

1.56Copy

no.1

4

4306

Research. on December 29, 2020. © 1989 American Association for Cancercancerres.aacrjournals.org Downloaded from

HUMAN CHROMOSOME 8 AND PAPILLOMAVIRUS INTEGRATION

«

i:>̂A*-Fig. 2. Representative metaphase from the

HeLa cell line (ACTT-CCL-2) after in situhybridization with probe phHBg autoradiog-raphy (a) and G banding (è).The distal part ofthe chromosome 8 long arm exhibits silvergrains (arrow). Grain distribution on chromosome 8 from HeLa cells (open circles) andnormal lymphocytes (black circles) after in sitohybridization with a human cellular DNAprobe (phHBg) derived from the 5' flank ofintegrated HPV-18 in HeLa cells (<•).In bothnormal and HeLa cells the largest accumulation of grains was at 8q24.

WÕ.)-

Vs, I '•' \VV2 /v*»

g.—.

H X H X H X

23.1-

9.4-

6.6-

4.4-

2.3-2.0-

B H X H

23.1-

9.4-

6.6-1

4.4-

2.3-2.0-

H X

l

tf

HeLo IMR-90 CoLo320 HeLa IMR-90 CoL6320

Fig. 3. A, Southern blot analysis of DNA from HeLa, fibroblasts IMR-90,and colon carcinoma Colo320 cells digested with //inillll (//) and Xba\ (X) andhybridized to the probe pE2 which is a Sad fragment with mir exon II. B,Southern blot analysis of the same cell lines hybridized to the flanking cellularprobe (phHBg).

amplified in both Colo320 and HeLa cells, but not in fibroblastsIMR-90 (Fig. 35). This observation confirms both the amplification of the HPV integration region and its chromosomallocation.

myc Expression in HeLa, IMR-90, and Colo320 Cells. Theintegration of HPV-18 in the vicinity of the myc locus, althoughnot affecting its structure, could have a significant effect on itsregulation due to the amplification of viral regulatory c/j-actingsequences present in the long control (noncoding) region (LCR)of the virus. To address this question, poly(A)+ RNA fromHeLa, normal human fibroblasts IMR-90, and human colon

carcinoma line Colo320DM, which contains an amplified andoverexpressed myc locus, were analyzed. The RNA was hybridized with probes specific for the exon II of myc and for thehuman /3-actin and 02-microglobulin genes which were used asinternal references. Transcripts of the expected size were observed with each probe, 2.4, 2,0, and 0.6 kilobases for myc, ß-actin, and /32-microglobulin, respectively (Fig. 4).

The relative amount of myc message was normalized relativeto |8-actin and /32-microglobulin present. The myc/ß-actinratiosare 0.39, 0.02, and 12.5 in HeLa, IMR-90, and Colo320DMcells, respectively. The m>>c//32-microglobulin ratios are 0.07,0.02, and 11.4 in HeLa, IMR-90, and Colo320DM, respectively. Both ratios indicate a moderate increase from 3 to 20times depending on the reference, in HeLa cells when comparedwith IMR-90. The myc levels in Colo320DM is well above thatof HeLa and IMR-90, as was expected (24). Increased myc

4307

Research. on December 29, 2020. © 1989 American Association for Cancercancerres.aacrjournals.org Downloaded from

HUMAN CHROMOSOME 8 AND PAPILLOMAVIRUS INTEGRATION

oO CO

co i O

o St oilo

oM

O CO«? o«iozio u

28S-

23S-

18S-16S-

'O CM

I2 rr oO) ^ OX —¿�O

28S-

23S-

18S—

16S-

exon n MYC /3-actin ß-2microglobulinFig. 4. Northern blot analysis of poly(A)* RNA from HeLa, IMR-90, and

Colo320DM cells; 2 ng of poly(A)* RNA was fractionated in 1.5% agarose gel-

6% formaldehyde. The Northern blot was hybridized with probes specific for theexon II of myc, human (¡-actinand human fc-microglobulin.

expression may be caused by enhanced transcription with eithernormal regulation or deregulation, as a consequence of thepresence of amplified transcriptional regulatory elements ofviral origin near myc.

Expression of the S'-Flanking Cellular Region. The cellularprobe phHBg from the cellular region flanking integrated HPV-18 was used to study its possible expression. For that purpose2 ¿igof poly(A)+ RNA from HeLa, IMR-90, and Colo320DM

cells were analyzed by Northern blot (Fig. 5). This cellularprobe detects a novel transcript of larger than 10 kilobases inHeLa and Colo320DM cells but not in IMR-90, though it ispartially degraded because of its very large size. Recently wehave isolated three cDNA clones by using the probe phHBgfrom a HeLa cDNA library, but we could not obtain any clonefrom an IMR-90 cDNA library. This observation is consistentwith the data presented in Fig. 5. We are currently characterizing these cDNA clones.

Cellular Open Reading Frame in the Flanking Region. Thehuman DNA fragment used as probe was sequenced to determine if it contains any open reading frame as would be expectedfrom the Northern blot analysis. The BgHl-Hinalil fragmentcontains an open reading frame of 177 nucleotides which isinterrupted by the ffindlll cloning site (Fig. 6). This openreading frame is preceded by an AG splice acceptor site and atposition 27 from the first codon there is a heptamer ACCTGATwhich is consistent in sequence and location with the heptamerrequired for lariat formation during the splicing process (25).

DISCUSSION

Amplification of cellular protooncogenes is a common observation in a variety of tumors (26). Although the biologicalsignificance of oncogene amplification is not clearly established,amplification might provide a growth advantage (27). The studyof the amplification of integrated transforming genes from

Fig. 5. Northern blot analysis of 2 fig of poIy(A)* RNA from HeLa, fibroblastIMR-90, and colon carcinoma Colo320DM cells. The blot was hybridized toprobe phHBg which is a unique cellular DNA sequence from the 5' flank ofHPV-18 DNA integrated in chromosome 8 band q24.

10 30 60AGGAGAGCATAAAAGTATTATAATCAGGGAACCTGATTTGGGAGTCTTTTTTCATTTTAA

- 70 90 110

AGCAATATCCAAATCTACCCAGAAAGTCTAATTAAATCTTACGGATCTACTTCTAATTGCAsnl IeG InI leTyrProG IuS»rL»u!IeLysSerTyrG lySerThrSerAsnCy*

130 150 170TGCTATCCAATTAGCATTCTAAACCTGAATGCTCAGATACAGCCCTCCTTCCCATCTTGGCysTy rProI I»SeriIeLeuAsnLeuAsnA IaG In1 1eu InProSerPheProSerTrp

190 210 230 HindlllTGTAGGGGCACGGGGGAGTACATTAGAGGAACAAAAGAACAAAAAAGAGGCTTTAAGCTTCysArgGlyThrGlyGluTyrII«ArgGlyThrLysGluGlnLysArgGlyPh«Ly»L»u

Fig. 6. Nucleotide sequence of the open reading frame detected in probephHBg determined by the dideoxy chain termination method. The location of thesplice acceptor site and the heptamer required for lariat formation are indicated.

DNA tumor viruses in the genome of human tumors hasreceived little attention. This study demonstrates that the viraltransforming genes E6, E7, and El genes of HPV-18 areamplified and present on only one copy of the duplicatedchromosome; duplication took place after viral integration (5).However, the E2 gene, which modulates E6, E7, and El geneexpression (28) has been lost. Nevertheless, these three genesin HeLa cells have a high rate of transcription (8, 15, 17), eventhough their own viral promoter is rather weak (29). Amplification of the integrated virus might be a mechanism to compensate for the low level of transcription from the viral promoter. While the messages for the E6, E7, and El are readilydetected in the HeLa cells, only the E7 and El proteins havebeen detected in these cells (30). The lack of correlation betweenthe presence of gene products at the RNA and protein level andthe weak activity of the promoter of these genes suggests thatthis promoter might be under the influence of cellular factorseither in the form of c«-acting sequences or trans-acting pro-

4308

Research. on December 29, 2020. © 1989 American Association for Cancercancerres.aacrjournals.org Downloaded from

HUMAN CHROMOSOME 8 AND PAPILLOMAVIRUS INTEGRATION

teins, resulting in a new regulatory situation of the integratedviral genes.

HPV integration not only provides the host cells with viraloncogenes in a new regulatory situation, but introduces a set ofregulatory viral as-acting sequences which may have an effecton the regulation of host genes. This report demonstrates thatthe viral regulatory sequences present in the HPV-18 longcontrol region are amplified 15-fold and are located on chromosome region 8q24, a region including the myc oncogene(31). Because of the difficulty to find a suitable control forHeLa cells to determine the level of myc RNA, we decided touse two references, 0-actin and /32-microglobulin. This is required in order to minimize errors in interpretation because thereferences may also vary depending on the cell type. In ourcase, both reference probes show an increase in myc expression,though of different magnitudes. We opted conservatively forthe lower value which is consistent with that reported by otherauthors (7) and with constitutive expression of myc instead ofcell cycle-dependent expression (32). Nevertheless, this observation cannot be directly linked to any of the alíelescontainingmyc because all alíelesfrom chromosome 8 have a structuralalteration (5) and an effect of the viral LCR on myc could notbe demonstrated. The difference in the degree of overexpressiondepending on the reference gene used clearly suggests cautionin the interpretation of results based on one reference. Anothergroup has reported a 3- to 20-fold amplification of myc mRNAin 25 of 72 invasive cervical squamous cell carcinomas (33, 34),but no association with HPV integration was detected by Southern blot analysis, although the virus was present. This increasedexpression was correlated with a greater incidence of earlyrelapse (34). This range of overexpression is similar to the onedetected in HeLa cells in this report and in other cervicalcarcinoma cell lines (7). Whether myc alterations contribute tothe induction or progression of cervical cancer is not known.However, one fact is highly significant; structural or functionalalterations of myc are detectable in a number of cervical cancers(33, 35). In addition to the possible effect on myc other genesmight be located in this area. With the probe phHBg a newlocus called pal-1 has been detected and several cDNA clonesare currently being characterized.4 Its biological significance is

not yet known, but this region is frequently involved in chromosome 8 translocations present in the endemic form of Bur-kitt's lymphoma (36) and the chromosomal region 8q24 is

involved in many malignancies, many times without any clearcorrelation to myc; the molecular base of this observation is notyet well understood but clearly deserves further exploration.

HPV integration site on chromosome 8 demonstrated withboth viral DNA (6, 7) and cellular flanking sequences of HPV-integrated DNA (this report) coincides with the location of afragile site (6, 37). Based on these data we advanced the hypothesis that constitutive or heritable fragile sites may be preferred sites for viral integration (6, 38). Region 8q24 is one ofthe four previously localized HPV-18 DNA integration sites onHeLa cells. The specificity of the flanking sequences at 8q24suggests that viral integration occurred independently at multiple sites and that this region of chromosome 8 was amplifiedafter viral integration. Malignant transformation, however, mayrequire the cooperation of other genetic elements. In D98AH2,a HeLa-derived line, 12 other oncogenes, in addition to mycare expressed (39). These include the abl gene, the location ofwhich corresponds with a HPV-18 integration site in HeLacells (6). Possibly alterations of several oncogenes in HeLa cells

may be important contributing factors to the particularly malignant properties of the cervical carcinoma from which HeLacells were derived, and these alterations might play a role in themalignant transformation of a cell containing integrated HPVDNA, for which the viral integration was only an early event inthe transformation process.

ACKNOWLEDGMENTS

The typing of the manuscript by Pat Bateman is greatly appreciated.Dr. Michael Erisman provided us with probes for the myc locus free ofrepetitive sequences.

REFERENCES

10.

11.

12.

13.

14.

15.

16.

17.

18.

19.

20.

21.

' P. Lazo, unpublished data. 22.

4309

Lazo, P. A. Human papillomaviruses in oncogenesis. BioEssays. 9:158-162,1988.Boshart, M., Gissmann, L., Ikenberg, M., Kleinheinz, A., Scheurlen, W., andzur Hausen, H. A new type of papillomavirus DNA, its presence in genitalcancer biopsies and in cell lines derived from cervical cancer. EMBO J., 3:1151-1157,1984.Durst, M.. Gissman. I... Ikenberg, II.. and zur Hausen, H. A papillomavirusDNA from a cervical carcinoma and its prevalence in cancer biopsy samplesfrom different geographic regions. Proc. Nati. Acad. Sci. USA, SO: 3812-3815, 1983.Lorincz, A. T., Lancaster. W. D., and Temple, G. F. Cloning and characterization of the DNA of a new human papillomavirus from a woman withdysplasia of the uterine cervix. J. Viro!., 58: 225-229, 1986.Lazo, P. A. Rearrangements of both alíelesof human chromosome 8, one ofthem as a result of papillomavirus DNA integration. J. Biol. Chem., 263:360-367, 1988.Popescu, N. C-, DiPaolo, J. A., and Amsbaugh. S. C. Integration sites ofhuman papillomavirus 18 DNA sequences on the HeLa cell chromosomes.Cytogenet. Cell Genet.. 44: 58-62, 1987.Durst, M., Croce, C. M., Gissman, L., Schwarz, E., and Huebner, K.Papillomavirus sequences integrate near cellular oncogenes in some cervicalcarcinomas. Proc. Nati. Acad. Sci. USA, 84: 1070-1074, 1987.Lazo, P. A. Structure, DNasel hypersensitivity and expression of integratedpapilloma virus in the genome of HeLa cells. Eur. J. Biochem., 765: 393-401, 1987.Picken, R. N., and Yang, H-L. The integration of HPV-18 into HeLa cellshas involved duplication of the viral genome as well as human DNA flankingsequences. Nucleic Acids Res., 15: 10068, 1987.Aviv, H., and Leder, P. Purification of biologically active globin messengerRNA by chromatography on oligothymidylic acid-cellulose. Proc. Nati. Acad.Sci. USA, 69: 1408-1412, 1972.Popescu, N., Amsbaugh, S. C., Swan, D. C.. and DiPaolo. J. A. Induction ofchromosome banding to trypsin/EDTA for gene mapping by in situ hybridization. Cytogenet. Cell Genet., 39: 73-74, 1985.Rothberg, P. G., Erisman, M. D., Diehl. R. E., Rovigatti. U. G., and Astrin,S. M. Structure and expression of the oncogene c-myc in fresh tumor materialfrom patients with hematopoietic malignancies. Mol. Cell. Biol., 4: 1096-1103,1984.Gunning, P., Ponte, P., Okayama, H., Engel, J., Blau, H., and Kedes, L.Isolation and characterization of full cDNA clones for human a, /i-, and y-actin mRNAs: skeletal but not cytoplasmic actins have an amino-terminalcysteine that is subsequently removed. Mol. Cell. Biol., 3: 787-795. 1983.Suggs, S. V., Wallace. R. B., Hirose, T.. Kawashima. E. H., and Itakura, K.Use of synthetic oligonucleotides as hybridization probes: isolation of clonedcDNA sequences for 02-microglobulin. Proc. Nati. Acad. Sci. USA, 78:6613-6617, 1981.Schwarz, E., Freese, U. K.. Gissmann, L., Mayer. W., Roggenbuck, B.,Stremla, A., and zur Haussen, H. Structure and transcription of humanpapillomavirus sequences in cervical carcinoma cells. Nature (Lond.), 314:111-114. 1985.Pater, M. M., and Pater, A. Human papillomavirus types 16 and 18 sequencesin carcinoma cell lines of the cervix. Virology, 145: 313-318, 1985.Yee, C., Krisnan-Hewlett, I., Baker, C. C.. Schlegel, R., and Howley, P. M.Presence and expression of human papillomavirus sequences in humancervical carcinoma cell lines. Am. J. Pathol-, 119: 361-366, 1985.Ambros. F. P., and Karlic, H. I. Chromosomal insertion of human papillomavirus 18 sequences in HeLa cells detected by nonisotopic in situ hybridization and reflection contrast microscopy. Hum. Genet., 77: 251-254, 1987.Tsichlis, P. N.. Strauss. P. G., and Lohse, M. A. Concerted DNA rearrangements in Moloney murine-leukemia virus-induced thymomas: a potential synergistic relationship in oncogenesis. J. Virol., 56: 258-267. 1985.Bedell, M. A., Jones, K. H., and Laimins, L. The E6-E7 region of humanpapillomavirus type 18 is sufficient for transformation of NIH 3T3 and Rat-I cells. J. Virol.. 61: 3635-3640. 1987.Phelps, W. C., Yee, C. L., Munger, K., and Howley, P. M. The humanpapillomavirus type 16 E7 gene encodes transactivation and transformationfunctions similar to those of adenovirus EIA. Cell, 53: 539-547, 1988.Watanabe, S., and Yoshiike, K. Transformation of rat 3Y1 cells by human

Research. on December 29, 2020. © 1989 American Association for Cancercancerres.aacrjournals.org Downloaded from

HUMAN CHROMOSOME 8 AND PAPILLOMAVIRUS INTEGRATION

papillomavirus type-18 DNA. Int. J. Cancer, 41:896-900, 1988.23. Le, J-Y., and Defendi, V. A viral-cellular junction fragment from a human

papillomavirus type 16 positive tumor is competent in transformation ofNIH 3T3 cells. J. Virol., 62: 4420-4426, 1988.

24. Alitalo, K., Koskinen, P., Mäkela,T. P., Saksela, K., Sistonen, L., andWingvist, R. myc oncogenes: activation and amplification. Biochem. Biophys.Acta, 907: 1-32, 1987.

25. Green, M. R. Pre-mRNA splicing. Annu. Rev. Genet., 20: 671-708, 1986.26. Alitalo, K., and Schwab, M. Oncogene amplification in tumor cells. Adv.

Cancer Res., 47: 235-281, 1986.27. Schimke, R. T. Gene amplification in cultured animal cells. Cell, 37: 705-

713, 1984.28. Spulimi/. B. A., Yang, Y-C., and Howley, P. M. /rani-Activation of a bovine

papillomavirus transcriptional regulatory element by the E2 gene product.Cell, 42: 183-191, 1985.

29. Thierry, F., Heard, J. M., Dartmann, K., and Yaniv, M. Characterization ofa transcriptional promoter of human papillomavirus-18 and modulation ofits expression by simian virus 40 and adenovirus early antigen. J. Virol., 61:134-142, 1987.

30. Seedorf, K., Oltersdof, T., Krummer. G., and Röwekamp,W. Identificationof the early proteins of the human papillomaviruses type 16 (HPV-16) andtype 18 (HPV-18) in cervical carcinoma cells. EMBO J., 6:139-144, 1987.

31. Neel, B. G., Jhanwar, S. C., Chaganti, R. S. K., and Hayward, W. S. Twohuman c-onc genes are located on the long arm of chromosome 8. Proc. Nati.

Acad. Sci. USA, 79: 7842-7846, 1982.32. Cole, M. D. The myc oncogene: its role in transformation and differentiation.

Annu. Rev. Genet., 20: 361-384, 1986.33. Riou, G., Hanois. M., Tordjman, I., Dutronquay, V., and Orth, G. Presence

de genomes de papillomavirus et amplification des oncogenes c-myc et c-Ha-ras dans des cancers envahissants du col de l'utérus.CR Hebd. Seances Acad.Sci., 299: 575-580, 1984.

34. Riou, G., Barrais, M., Le, M. G., George, M., Le Doussal, V., and Haie, C.c-myc protooncogene expression and prognosis in early carcinoma of theuterine cervix. Lancet, 1: 761-763, 1987.

35. Ocadiz, R., Sauceda, R., Cruz, M., Graef, A. M., and Gariglio, P. Highcorrelation between molecular alterations of the c-myc oncogene and carcinoma of the uterine cervix. Cancer Res., 47:4173-4177, 1987.

36. Haluska, F. G., Tsujimoto, Y., and Croce, C. M. The 1(8:14) breakpoint ofthe EW36 undifferentiated lymphoma cell line lines 5' of myc in a regionprone to involvement in endemic Burkitt's lymphomas. Nucleic Acids Res.,16: 2077-2085, 1988.

37. Yunis, J. J., and Soreng, A. L. Constitutive fragile sites and cancer. Science(Wash. DC), 226: 1199-1204, 1984.

38. Popescu, N. C., Amsbaugh, S. C., and DiPaolo, J. A. Human papillomavirustype 18 DNA is integrated at a single chromosome site in cervical carcinomacell line SW756. J. Virol. 61:1682-1685, 1987.

39. O'Hara, B., Klinger, H. P., and Blair, D. G. Many oncogenes are transcribed

in the D98AH2 derivative of the HeLa carcinoma cell line. Cytogenet. CellGenet., «.-97-102, 1986.

4310

Research. on December 29, 2020. © 1989 American Association for Cancercancerres.aacrjournals.org Downloaded from

1989;49:4305-4310. Cancer Res   Pedro A. Lazo, Joseph A. DiPaolo and Nicholas C. Popescu 

Protooncogene in HeLa CellsmycLocated Near the -Flanking Cellular Sequence′Human Papillomavirus 18 and Its 5

Amplification of the Integrated Viral Transforming Genes of

  Updated version

  http://cancerres.aacrjournals.org/content/49/15/4305

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/49/15/4305To request permission to re-use all or part of this article, use this link

Research. on December 29, 2020. © 1989 American Association for Cancercancerres.aacrjournals.org Downloaded from