an international journal of - ijeeas vol ii iss 1.pdf · that can be used as the feedstock to...

An International Journal of

EMERGING ENGINEERING APPLICATIONS

AND BIO-SCIENCES

(IJEEAS)

RESEARCH PUBLICATIONS

VOLUME II

RAJA INSTITUTE OF SCIENCE AND TECHNOLOGY24/5, Meadavilai, Muttacadu - 629 189

Tamilnadu, INDIA

International Journal of Emerging Engineering Applications and Bio-Science

ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 2

PREFACE

It is with immeasurable happiness that the International Journal of

Emerging Engineering Applications and Bio-Science (IJEEAS) brings out its

second volume of the Journal publication with a renewed energy and

vitality keeping in mind the new demands and needs of keeping pace with

the change and knowledge & technology-driven world.

India today needs international-standard research-based home of

Institutions that would support modern research and also create potential

resources for innovative research and education in the rapid changing and

technology-driven world of the current century.

The IJEEABS is doing its best to recognize and make true this

concept. The Raja Institute of Science and Technology comprehends the

fact that it is its primary duty to update and adapt itself rapidly to the

needs of the world to make education and research flourishing, significant

and pertinent. The Institution is proud of the reality that it is in the

process of accomplishing its objectives by means of the dedicated and

hardworking efforts of its teachers and researchers.

The Journal Authority expresses its gratitude for the researchers

who have published their research works in our Journal. The Editorial

Board of this journal would expect suggestions and earnestly hope your

precious and productive implications would make our publication

successful and fruitful.

Journal Authority IJEEABS



CONTENTS

BIOGAS PRODUCTION USING VARIOUS AGRICULTURAL WASTES 4

JATROPHA CURCAS AS A BIODIESEL PLANT - MYTHS AND FACTS 10

BIODEGRADATION OF AZO DYES BY HALOBACILLUS SP. 24

PRODUCTION, OPTIMISATION, CHARACTERISATION AND PARTIAL PURIFICATION OF L-ASPARAGINASE FROM

ASPERGILLUS NIGER 40

ISOLATION OF ANTIBIOTIC PRODUCING ACTINOMYCETES FROM SOIL, PURIFICATION AND

CHARACTERISATION 51

MICROBIAL PRODUCTION OF BIOSURFACTANTS 59

DEGRADATION OF PETROLEUM BY MICROORGANISMS ISOLATED FROM SOIL CONTAMINATED WITH PETROL

AND ITS BY-PRODUCTS 66

ABSTRACTS OF EMINENT PERSONALITIES 82

PAST- MODERN TRENDS IN BIOTECHNOLOGY 83

JATROPHA CURCAS AS A BIODIESEL PLANT – FACTS AND MYTHS 84

BIOFUEL AS AN ALTERNATIVE SUSTAINABLE FUEL TO FOSSIL FUEL 85

EFFECTIVE MICRO ORGANISMS 87

BIOMEDICAL WASTE MANAGEMENT 89

WEALTH FROM WASTES – EDIBLE MUSHROOM CULTIVATION 92

APPLICATION OF BIO TECHNOLOGY IN TREATMENT OF HEAVY METAL CONTAMINATED INDUSTRIAL WASTE

WATER- A CASE STUDY 97

BIOLOGICAL CONTROL FOR SUSTAINABLE AGRICULTURE AND ENVIRONMENTAL MANAGEMENT 98

BIOFERTILIZER 99



BIOGAS PRODUCTION USING VARIOUS AGRICULTURALWASTES

Bharathi Prakash* and Sumangala C.H.

Department of Microbiology,University College, Mangalore, Karnataka*Corresponding author

[email protected]

ABSTRACTBiogas is a naturally occurring by product of the breakdown of the organic material

and is actively produced from a variety of source including animal waste, municipal solid waste, agricultural wastes using a process called anaerobic digestion. The study was under taken to check the production of maximum biogas using various agricultural wastes (Areca nut, Husk, Cauliflower leaves, Cow dung, Mixture, Bagasse).The experiment was done in bottles of 750 ml capacity using various feed stock and cow dung. To provide anaerobic condition and to collect the amount of biogas produced in each feedstock bottle balloons were fixed. By Serial dilution technique the bacteria were isolated from the bottles after 21days and identified by Gram staining. The carbohydrate fermenting capacity of the isolates was also determined.

Of the various feed stocks used, maximum biogas production was obtained from bagasse within 9 days that was observed by the balloons fixed to the bottle neck. Gram positive bacilli were predominantly found in the cow dung and bagasse and utilized all the three sugars glucose, sucrose, lactose tested for carbohydrate fermentation. Hence the mixture of cow dung and bagasse has proved to give better yield of biogas and is economical too.Keywords: Biogas, Bagasse, Cow dung, Agricultural waste, Biofuel

INTRODUCTION

Biogas is a type of bio fuel. It is produced by anaerobic digestion or fermentation of

biodegradable materials such as biomass, manure or sewage, municipal waste, green waste

and energy crops [1]. With depletion of fissile fuels, increasing crude oil demands with

increasing pollution and population, there is a need of alternative regenerative fuel source like

biogas. Millions of tons of wastes are generated each year from agricultural, municipal and

industrial sources. Agricultural wastes including live stock manure are source of solid waste

that can be used as the feedstock to produce biogas. Different agricultural waste materials are

used for biogas production in the laboratory. Biogas originates from biogenic material and is

a used as a major source of household energy a type of bio fuels [1].Biogas typically refers to

a mixture of different gases produced by the breakdown of organic matter in the absence of

oxygen. In this study various agricultural waste like areca nut, husk Cauliflower leaves, Cow

dung, Bagasse were used with cow dung as inoculums. Glass bottles capped with air tight



balloons are used the anaerobic digester. This comparative study determines that bagasse is

the efficient feedstock to generate high yield of biogas.

The aim of the study was to determine the production of maximum biogas using

various agricultural wastes. For this purpose, arecanut, husk Cauliflower leaves, Cow dung,

Bagasse and its mixture was used as the raw material for the production of biogas.

METHODOLOGY

The study was conducted in6 sterilized glass bottles of 750 ml capacity using various

feed stock and cow dung for analyzing the amount of biogas produced by each feedstock. In

each bottle 50g of feedstock substrate materials and 50g of cow dung was added and bottles

were labeled. In one of the bottles, a mixture of 50g cow dung and 12.5g of each feed stalk

was added and bottle was marked as ‘mixture’. In a bottle marked as cow dung there was

only 100 gm of cow dung. 200ml of distilled water was added to every bottle. Cow dung

mainly serves as the inoculums with methanogenic bacteria. Good quality balloons without

any hole were fixed to the opening of the bottles and made air tight as shown in the figure1.

The bottles were incubated at room temperature for 21 days. Twice a day, the contents of the

bottles were mixed by shaking the bottle. Production of biogas in the balloons was observed

daily and recorded.

The amount of biogas produced by each feedstock was measured by the rise in the

volume of the balloons tied to the respective bottles. The measurement of biogas was done by

measuring the diameter of the balloon by a thread and thereby measuring its length in cm.

The radius of the balloon was considered for the calculation of volume using a formula V =

⁴⁄₃πr³.

OBSERVATION AND RESULT

The result of biogas formation from day one to 21 days of incubation in all the

feedstock is given in the table 1. Out of the various feed stocks used maximum biogas

production was obtained from bagasse with cow dung within 9 days that was observed by the

balloons fixed to the bottle neck.



ISOLATION OF BACTERIA FROM FERMENTED FEED STALK

After measuring the biogas formation in each bottle, bacteria were isolated from the

bottles after 21 days by Serial dilution technique and plating on Nutrient agar. The CFU were

counted and Gram character was studied by Gram staining. The carbohydrate fermenting

capacity of the bacterial isolates was also determined.

CARBOHYDRATE FERMENTATION

For this purpose, sugar media of glucose, sucrose and lactose respectively were

prepared separately and sterilized with Durham tube. The bacterial isolates were inoculated

in each carbohydrate broth and incubated at 37OC for 24-48hours. The results of acid and gas

production were recorded. Gram positive bacteria were predominantly found in the cow

dung. The bacteria from the mixture of Bagasse and cow dung utilized all the three sugars

tested for the fermentation accompanied by gas formation. Bottles containing Cauliflower,

Husk and Mixture also shoed comparatively good amount of biogas formation. The lowest

amount of biogas was formed in the bottles containing areca nut and cow dung.

Table 1: Biogas production (cm3) using different feed stalk

Day Volume of biogas produced in cm3

AN CL CD HK MX SB

0 0 0 0 0 0 0

3 48 40 10 48 24 60

6 64 60 15 34 32 72

9 72 68 20 78 36 100

12 90 84 36 78 48 100

15 90 84 50 78 80 100

18 90 84 60 78 80 100

21 90 84 60 78 80 100

Note:AN=areca nut ,CL= Cauliflower leaves ,CD = Cow dung ,HK = Rice barn ,MX =

Mixture ,B= Sugarcane Bagasse, Volume of biogas produced in cm3



DISCUSSION

Biogas had been generated from various biomass waste. [2]. The biogas consists

mainly of methane (55-60%), CO2 (30-35%) and H2 (5-10%); burning this gives an energy

efficiency of >85%, compared with 60% for burning bagasse. [2]. Various studies have been

conducted on the biogas production using waste from various agricultural, dairy waste, palm

head ash solution, municipal sewage, cotton seed etc. [3- 4]. Feedstock of crop residues have

more lignocellulose content with low nitrogen content. Hence for optimizing the Carbon to

Nitrogen ratio of agricultural residues, co-digestion with sewage sludge, animal manure or

poultry litter is recommended [5-7]. Temperature and pH also plays an important role in the

good yield of biogas production. Four basic types of microorganism are involved in the

production of biogas from agricultural feed stock (Biomass). Hydrolytic bacteria break down

complex organic waste into sugar and amino acids. Fermentative bacteria then convert those

products into organic acids. These acids will be converted to hydrogen, carbon dioxide and

acetate by acidogenic microorganism. Later, the methanogenic bacteria produce biogas using

the available acetic acid, hydrogen and carbon dioxide. Complete anaerobic condition favours

the biogas production. Cow dung is a source of biogas forming bacteria hence it was added as

inoculums [8-9]. The similar set up of anaerobic digester was formed for the biogas

production in the lab using airtight bottles. Bottles containing Cauliflower, Husk and Mixture

also shoed comparatively good amount of biogas formation. The lowest amount of biogas

was formed in the bottles containing areca nut and cow dung.

Sugarcane bagasse being rich in sugar and moisture serves as a good source of

nutrients for the anaerobic bacteria present in the cow dung to digests the bagasse effectively

generating good amount of biogas. This fact is supported by the carbohydrate fermentation of

sugars carried out using the material from the Bagasse bottle. Bottles containing Cauliflower,

Husk and Mixture also showed comparatively good amount of biogas formation. The lowest

amount of biogas was formed in the bottles containing areca nut and cow dung. In the cow

dung bottle there was no substrate available for anaerobic digestion hence gas formation was

less. .High content of cellulose in areca nut was difficult to digest for the bacteria present in

the cow dung. Hence there was no noticeable biogas formation. As bagassse has given good

yield, it can be used the large scale biogas production.



This study identifies efficient feedstock materials to be used to generate maximum

biogas. Further efficiency check can be done by studying this under different environmental

factors and parameters. As this is a “mini pilot study”, it needs further qualitative and

quantitative analysis of biogas for large scale production. In the north and south part of

Karnataka and India, there are many sugar factories. [10] The bagasse generated can be

effectively used for the biogas production using cow dung to give clean, safe and smokeless

biogas for the beneficiaries. This co-digestion helps farmers to use own agricultural waste

together with other organic substrates. As a result, they can generate additional revenues by

treating and managing organic waste from other sources and by selling and/or using the

products viz heat, electricity and constant source of stabilised bio fertiliser [11]. By adding

large scale trial parameters,this concept can be applied from “Lab- to –Land” as a renewable

energy source.

ACKNOWLEDGEMENT

Authors thank the department of Microbiology, University College, Mangalore,

Karnataka for supporting the research work.

REFERENCES

1. A.C, Jeffery, J.V. Peter, J.J.B.R. William and. M.G. James, Predicting methane

fermentation. Biodegradability, Biotechnology and Bioengineering Nigerian Symposium,

11: 93-117, 1981.

2. G. L, Shukla and Prabhu, K. A. Bio-gas production from sugarcane biomass and agro-

industrial waste. Book Sugarcane: agro-industrial alternatives. 1995 pp. 157-170,ISBN

81-204-0948-5.

3. A. C. 1, Ofomatah and Okoye C. O. B. , The effects of cow dung inoculum and palm

head ash-solution treatment on biogas yield of Bagasse,International Journal of Physical

Sciences Vol. 8(5), pp. 193-198, 9 February, 2013, ISSN 1992 - 1950 ©2013 Academic

Journals

4. M. Hamed, El-Mashad and Ruihong Zhang, Biogas production from co-digestion of

dairy manure and food waste, Bioresource Technology, 101(11), 4021–4028, 2010

5. http://www.bioenergyconsult.com/anaerobic-digestion-crop-residues/



6. G Shelef,., H. Grynberg and S. Kimchie, 1981. High rate thermophilic aerobic digestion

of agricultural Symposium, 11: 341-342

7. B Garba, Zuru A, Sambo AS. Effect of slurry concentration on biogas production from

cattle dung. Niger. J. Renew. Energy 4(2):3843, 1996..

8. I.R. Ilaboya, F.F. Asekhame, M.O. Ezugwu, A.A. Erameh and F.E. Omofuma 1Studies

on Biogas Generation from Agricultural Waste; Analysis of the Effects of Alkaline on

Gas Generation, World Applied Sciences Journal 9 (5): 537-545, 2010, ISSN 1818-4952.

9. S. Ghosh, M.P. Henry and D.L. Klass,. Bioconversion of water hyacinth-coastal

Bermuda grass-MSW-Sludge blends to methane Biotechnology and Bioengineering

Symposium, 11: 163-187, 2000..

10. http://www.karnataka.com/industry/sugar/about-sugar/

11. http://www.yourarticlelibrary.com/industries/sugar-industry-in-india-growth-problems-

and-distribution/14144.



JATROPHA CURCAS AS A BIODIESEL PLANT - MYTHS AND

FACTS

Geetaa Singh and Sudheer Shetty

Labland Biotech Private Limited, R & D Division, 8th K.M., K.R.S. Main Road,

Mysore 570 016, India

[email protected]; [email protected]

ABSTRACT The key energy factor that dictates a products’ cost is Energy. In fact, the national

economy is driven by the fuel prices on par with other key production factors like land, labour and capital. The shortage of petroleum fuels and undulating fuel prices have called for the use of alternative sources of energy in addition to the conservation methods. The Governments, all over the world have initiated the use of alternative sources for ensuring energy security, employment generation and mitigating carbon dioxide emissions. The initiatives have differed in different countries. However, biofuels have emerged as an ideal choice to meet these requirements. In India, Jatropha-based biodiesel has emerged as a strong contender. Jatropha is an underutilized, non-edible oil-bearing crop. It produces seeds that can be processed into non-polluting biodiesel. Under best utilization plan, Jatropha provides opportunities for good returns, climate improvement and rural development. The crop has special appeal, in that it is non-demanding crop and animals do not graze on it. However, many of the actual investments and policy decisions on developing Jatropha as an oil crop have been made without the backing of sufficient scientific knowledge. Realizing the true potential of Jatropha requires separating facts from the claims and half-truths. The current article discusses the facts and myths of the crop and the biodiesel obtained from it.Key words – Jatropha curcas, Biofuels, Biodiesel, National Biofuel Policy

INTRODUCTION

Jatropha curcas L. acquired global recognition as a biofuel crop in early 2000s with

multifarious economic attributes. As a result, it has been acclaimed as an economically and

environmentally sustainable feedstock for biofuel production [1]. In Asian countries,

especially in India and China, Governments have launched supporting programs for the

promising Jatropha cultivation and biodiesel manufacturing industries [2,3]. Expectations of

high yields with minimal inputs under marginal conditions have fuelled large investments into

cultivation systems, especially in developing and emerging economies [1,4]. The potential for

pro-poor development has motivated governmental and non-governmental organizations to

involve small-holder farmers in growing the energy crop [5,6,7]. Projects range from schemes

involving smallholders planting, windbreaks and hedge-rows to large monoculture plantations

spanning several thousand hectares [8]. However, ever since the initial wave of excitement

about Jatropha broke in around 2008, many projects have failed. Governments have not been

able to successfully accomplish the set targets as per the plan. Despite setbacks, Jatropha



production is still being promoted and new projects are being undertaken [8]. The biofuels

division of Labland Biotech Private Limited, Mysore started working on domestication of

Jatropha curcas as early as 2003. The research team has come to understand several of the

key issues pertaining to its cultivation, agronomic practices, oil production, oil

characterization, transesterification and economic feasibilities as a commercial crop. Thus, the

presentation is aimed at shedding light on the myths and facts based on the results obtained

during the course of the study in different agro-climatic regions in India.

OVERVIEW OF BIODIESEL PROGRAM IN INDIA

Apart from the energy crisis, utility of biofuels has a new dimension in the current

scenario. Rapid urbanization, depleting forests, developing industries, poor agricultural

management systems have all led to disastrous climate change, global warming and

diminishing water tables. Biofuels are renewable and biodegradable energy source and possess

environmentally beneficial characteristics. Hence, they are considered as promising

supplements for depleting fossil fuel. The production and use of biofuels has the potential of

reducing dependence on petroleum imports, improving environmental quality, promoting rural

development and creating job opportunities [9]. In India, transport sector is one of the major

consumers of petroleum products in the form of diesel. To mitigate the pressure on import

bill, during April 2003, the National Mission on Biodiesel was launched by the Government of

India (GoI), and identified Jatropha curcas as the most suitable tree-borne oilseed crop for

biodiesel production. Besides, it also set a trial blending ratios of 5, 10 and 20 per cent in

phased manner.

In order to achieve the set targets, the National Planning Commission integrated

Ministries of Petroleum, Rural development, Poverty alleviation, Environmental and other

ministries too. The national mission also planned to utilize about 11 million hectares (M ha)

of unused lands to be brought under cultivation with Jatropha [10]. To plant 11 M ha Jatropha,

the program became a “National Mission” and encouraged a mass movement. The

Government mobilized a large number of stakeholders including individuals, communities,

entrepreneurs, oil companies, business houses, industries, financial sectors, universities as well

as all the state Governments [11,12]. The respective ministries initiated attractive and luring

programs for Jatropha nursery development, plantation on forest and non-forest lands, seed

collection and oil extraction centers, transesterification units, blending and marketing



arrangements, research and development (R&D) studies to fill gaps in knowledge. In order to

manage the entire program, State and National Biodiesel Board was created.

SALIENT FEATURES OF THE INDIAN BIOFUEL POLICY

The Government of India (GoI), approved India’s National Biofuel Policy on

December 24, 2009. The policy encouraged the use of renewable fuels as an alternative to

petroleum and to supplement India’s fuel supply with 20 % Biofuel (bioethanol and biodiesel)

mandate by 2017 with the following salient features [13]:

• Derive biofuel from non-edible feedstock grown on degraded soils or wastelands which

are not suited for agriculture thus avoiding conflict of food Vs fuel.

• Strengthen India’s energy security by encouraging use of renewable energy resources to

supplement motor transport fuels. An indicative 20 % target for blending of biofuel for

both biodiesel and bioethanol is proposed by end of 12th Five-Year Plan (IFY 2012/13

through fiscal 2016/17).

• Minimum support price (MSP) mechanisms for non-edible oilseeds to provide fair prices

to oilseed growers (subject to periodic revision).

• Oil Marketing Company’s (OMC) to purchase ethanol at a minimum purchase price

(MPP) based on the actual cost of production and import price of ethanol. In the case of

biodiesel, the MPP should be linked to the prevailing retail diesel price.

• If necessary, GoI proposes to consider creating a National Biofuel Fund for providing

financial incentives, including subsidies and grants, for new and second generation feed

stocks, advanced technologies and conversion processes, and production units based on

new and second-generation feedstock.

• Thrust for innovation, (multi-institutional, indigenous and time bound) research and

development on biofuel feedstock (utilization of indigenous biomass feedstock included)

production including second generation biofuels.

• Meet the energy needs of India’s vast rural population by stimulating rural development

and creating employment opportunities and addressing global concerns about

containment of carbon emissions through use of environment friendly biofuels.

• Bring biofuels under the ambit of “Declared Goods” by the GoI to ensure their

unrestricted interstate and intrastate movement. Except for a concessional excise duty of

16 percent on bioethanol, no other central taxes and duties are proposed to be levied on

biodiesel and bioethanol.



• Biofuel technologies and projects would be allowed 100 % foreign ownership through

automatic approval to attract foreign direct investment (FDI), provided the biofuel is for

domestic use only, and not for export. Plantations of non-edible oil-bearing plants would

not be open for FDI participation.

• Setting up of National Biofuel Steering Committee (NBSC) under Prime Minister to

provide policy guidelines.

CURRENT STATUS OF JATROPHA BIODIESEL, POST BIOFUEL POLICY

The central and several state Governments have revised and continued to provide fiscal

incentives for supporting the planting of Jatropha and other non-edible oil seeds. Several

public institutions, Government departments, state biofuel boards, state agricultural

universities and co-operative sectors are also supporting the biofuel mission in various

capacities [13]. A strong Institutional mechanism is proposed by the national biofuel policy to

set up a National Biofuel Co-ordination Committee (NBCC) headed by prime minister. The

NBCC provides policy guidance on different aspects of biofuel development, promotion, and

utilization. It also serves as the principle GoI coordinator for the array of different GoI

agencies and ministries with more minor roles in determining India’s biofuel policy. The

committee meets periodically to review the progress and monitor the biofuel program. NBSC

mandates that various state governments must work closely with respective research

institutions, forestry departments, and universities for developing and promoting biofuel

programs in their respective states. However, to date, few states have actually drafted any

policies and/or set up institutions for promoting biofuel in their states. Several ministries have

been allocated specific roles and responsibilities to deal with different aspects of biofuel

development and promotion [13].

Despite a sound commencement, the programs are facing considerable challenges in its

implementation. Biofuel production accounts for only one per cent of its global production

[14]. Since the Indian biofuel policy does not permit exports of domestic production, it is not

quantified as on date. Particularly, the biodiesel industry is still young and relatively small.

Till date, commercial sales of Jatropha biodiesel is not in place. Small quantities produced

are used up for various in-house research programs and to blend in the diesel generator as is

done at Labland, Mysore. A small quantity is being sold to other research institutions, public

entities which run blended fuels, and to unorganized consumers.



CLAIMS OF JATROPHA CURCAS

Jatropha is seen by many to be the perfect biodiesel crop. It can be grown in poor soils

actually generating top soil as it grows. It is drought and pest resilient, and it has seeds with

up to 40 % oil content. The positive attributes can be broadly classified as follows:

1. Positive social effects

• Enables local / rural development

• Creates jobs / labour needed

• Generates income

• Does not compete with food production

2. Positive environmental effects

• Reclaims marginal soils

• Conserves, protects and improves soils

• Protects against erosion

• Producer of CO2 neutral biofuel

3. Positive utilities of by-products

•Seed cake - as fertilizer with insecticidal properties

•Seed cake - converted to briquettes/pellets & fed to boilers

• Oil is used to make medicated soap

• Fruit rind & other biomass - fertilizer or attempts to convert the biomass to liquid

(ethanol) energy

• Glycerin - in pharma/cosmetic industries

4. Other uses

• Various parts have medicinal utilities

• Plant part extracts used as insecticide/pesticide

• Latex is used as dye to color the fabric

Finally, complete content and organizational editing before formatting. Please take note of

the following items when proofreading spelling and grammar.

MYTHS AND FACTS OF JATROPHA

The very basic concept of biodiesel of Jatropha began very hastily and projected the

crop as a miracle crop or a wonder plant. In most countries, including India, it was politicized



and was projected differently by different people. It means different things to different people

in different sectors (scientists, financiers, investors, politicians, beurocrats, entrepreneurs etc.).

Interpretations may mean whatever their interpreter wanted them to mean - Relational and

Contextual. It was endlessly constructed, deconstructed and reconstructed rapidly and

differently on space and place. More than a socio-economic and scientific requirement, it is

politicized for vested interests. But, over a period of about a decade of commercial research,

we can now comprehend and distinguish between the myths and facts detailed in Table 1.

TABLE 1. The myths and facts of Jatropha curcas as a biodiesel plant.

Myth Fact

Wild and IllusiveNot really domesticated. Holds potential to become an important economic crop like Tea/Coffee.

Grows on poor, dingy soilsDoes not grow well enough to be economically interesting crop. Garbage in – Garbage out !!

It is a weedNot perpetual. Not dispersed by wind, water, animals or mechanical means. Not a weed. Anti-propaganda!!

Most water demanding; Does not require fertilizers

It needs both; but not a hogger. It is a low intensity agri-crop unlike corn, soy, sugarcane, banana. In Mysore-like conditions, about 20L/plant/week is required during summer to obtain anticipated yields.

Insect/pest resistant

In mono-culture, insects visit for pollination (Increases yield !!). Undesirable insects also visit. Healthy plants can sustain attacks. Appropriate agronomic practices have to be followed.

Labor intensive

Provides rural employment. Annual pruning, harvesting, seed processing can provide employment opportunities @ 1000 for 1000 Acres directly and indirectly.

Toxic and harmful

Unpalatable to animals. It is non-edible hence a top crop for Biofuels in India. Does not attract Food Vs Fuel debate. Curcin is a Lypoprotein that causes intense spasm in the abdomen leading to diarrhea and vomiting. Not lethal unless consumed in large quantities.

Provokes / Prevents cancerLatex is used as medicine. Enough proofs are available to use against skin rashes. It is not carcinogenic.

Developmental opportunity for small scale farmers and poor

communities

In Africa it may be true. For Indian scenario, it should be cultivated as Tea/Coffee plantation model in large acreages. Becomes sustainable for stake-holders and employees.

Economically not viableViable on large acreage. Breaks even in 5th year. By-products add to revenue. Use of quality



Myth Fact

planting material, appropriate cultivation practice, favourable policies in the initial years with tax holiday and subsidies will make it a reality.

JATROPHA PLANTATIONS – AROUND THE WORLD AND IN INDIA

Despite setbacks, Jatropha production is still being promoted and new projects are

being undertaken all over, especially in Asia and Africa. In 2008, 242 Jatropha plantations

were found to cover an estimated total area of some 9,00,000 hectares according to a study by

GEXSI, 2008 [15]. At that time, most Jatropha plantations were located in Asia (84%) and

covered land areas totaling almost 8,00,000 hectares - chiefly in Myanmar, India, China and

Indonesia. Around twelve per cent of the total hectares planted were located in Africa

(approximately 1,20,000 ha), mostly in Madagascar and Zambia, but also in Tanzania and

Mozambique. Latin America accounted for approximately 20,000 hectares of Jatropha,

mostly located in Brazil [15]. From today’s perspective, projections on the development of

Jatropha plantings were rather optimistic at that time: 4.7 million expected hectares

worldwide by 2010 and 12.8 million hectares by 2015. It was assumed that Indonesia would

be the largest Jatropha producer in Asia in 2015 with 5.2 million hectares. Ghana and

Madagascar were expected to have the largest plantation areas in Africa (6,00,000 ha and

5,00,000 ha), and Brazil was projected to be the largest producer in Latin America with 1.3

million hectares [15].

As of 2011, a total of 11,91,625 hectares were planted with Jatropha trees by the

reporting projects in a survey made by Wahl et al. [8]. Out of the total hecterage, 72 per cent,

that is more than 8,60,000 hectares, are cultivated by five large projects in Asia ranging from

1,00,000 hectares to the largest project of 2,50,000 hectares in size. The remaining 106

projects cultivated a total of around 3,31,000 hectares are located in Asia (30 additional

projects) emphasizing that Asia still has a dominant role to play in Jatropha cultivation [8].

CURRENT ACTIVE PLAYERS IN THE BUSINESS OF JATROPHA BASED BIODIESEL IN INDIA

In India, the wave of Jatropha business was sowed by D1 Oils private limited, U.K. as

early as 2003. A number of private entities came to light and gradually disappeared too. As



on date, either in association with Government bodies, or Oil Manufacturing Companies, some

private entrepreneurs are pursuing in the business. Major organizations and institutions

working on commercial scale of Jatropha cultivation are Indian Oil Corporation in association

with Ruchi Soya Industries Limited; Bharat Petroleum Corporation Limited; Hindusthan

Petroleum Corporation Limited in association with Chattisgrah Government and S. G.

Biofuels, USA under the banner of CHBL; Nandan Biomatrix, Hyderabad; Shirke Biofuesl,

Pune; Tinna Oils and Chemicals, New Delhi; Reliance Life Sciences, Kakinada; Emami

Biofuels, Calcutta and Labland Biotech Private Limited, Mysore.

CONTRIBUTIONS OF LABLAND BIOTECH TO JATROPHA PLANT SCIENCE

Labland Biotech started the research on Jatropha plant science and the biodiesel in

2003 by collecting different species of Jatropha and studied the taxonomy and species

identification. About nine species, significant for breeding experiments were characterized

and maintained in the demo plot. Labland has standardized package of practice for large-scale

Jatropha cultivation with very unique techniques of pruning, optimum watering, fertilizers

application, diseases and their management, the by-products and its effective utilization [16].

Labland possess more than 500 accessions, collected from different agro-climatic regions of

India and Africa in its demonstration plot [17,18]. Further, the team has made a comparative

study of seed yield and oil content of these accessions and is an ongoing program for

developing improved accessions. From these unique collection, about 20 superior selections

have been identified as parental lines for hybrid seed production and specific high yielding

hybrids have been produced for scaling up the Jatropha seed production. Labland has

developed its own seed orchards and clonal orchards of these superior accessions and has

evolved successful methods for quality seed selection, developed certification standards for

breeder’s seeds [18,19]. Some of the improved seed technology procedures like breaking the

seed dormancy, rapid seed germination techniques, embryo rescue work [20], production of

quality seedlings, exceptional nursery techniques, seed storage techniques and seed health

testing that are pending patent have also been developed. The in-house Research and

Development team has also developed cost-effective and eco-friendly cultivation methods for

maximizing the seed output by amalgamating the integrated approach of chemical fertilizers &

biofertilizers [20-24]. The team has extensively worked on the development of tissue culture

protocol and mass multiplication of Jatropha curcas [25-27] and also improved the in vitro

rooting efficiency in the tissue cultured regenerants [28-30]. Further, the tissue culture



generated plants have been evaluated for the genetic fidelity and have evaluated the field

performance [31]. In order to study the occurrence of apomixis in J. curcas among the

accessions collected and maintained in Labland’s germplasm bank, experiments were carried

out in 30 different accessions by applying the standard procedure of emasculation and bagging

the female flowers. The studies have confirmed the occurrence of apomixis in J. curcas at low

levels. About 16 % of the accessions showed the occurrence of apomixis. In these accessions,

the apomixis ranged between 7.6 % and 33.3 %. Apomixis is very frequently associated with

polyploidy, hybridization and genomic instability. The possibility of exploiting the apomictic

ability of J. curcas to stabilize hybrid vigour and to maintain high yielding stocks has also

been studied in detail [32].

The seed oil extraction using different organic solvents has been evaluated [33]. The

Jatropha oil and biodiesel has been characterized and compared with mineral diesel [34]. The

effect of storage conditions and storage duration of Jatropha seeds, its effect on oil yield and

free fatty acid content has been worked out in detail [35].

The antimicrobial activity of Jatropha leaf and stem extracts against pathogens of

anthuriums and banana plants have been evaluated [36,37] The results of this investigation

were promising for controlling secondary nursery diseases caused by fungal and bacterial

pathogens of banana and anthuriums effectively. The utility of commercial chemical control

agents are often considered quick, easy, and inexpensive solution for controlling disease. But,

the use of Jatropha stem and leaf extract was a method of biological control to reduce

pesticide contamination in our environment.

CONCLUSIONS

India is heavily dependent on crude oil import. India’s diesel consumption is about 70

million tonnes and imported almost about 80% of the requirement in 2012, pushing the oil

import bill to about USD 120 billion. That is to say that we spend almost about USD 330

million on our oil imports every day. India’s energy future remains in its natural resources for

the production of alternative sources of fuel such as biodiesel. There is an incredible

opportunity to narrow India’s energy imbalance and reinvest a part of USD 330 million spent

daily on oil imports to support these efforts through a commitment to the production of

biodiesel and other innovation and the introduction of technologies that reduce dependence on



foreign energy [38]. Under this scenario, it is apparent that alternative energy source becomes

inevitable. Blending Jatropha oil with conventional fossil fuel makes the project eligible from

replacement to environmental issues. When compared to other feedstocks such as soybean,

rapeseed, pongamia, mahua etc; Jatropha stacks up nicely in India. However, some of the

constraints that are prevailing with our experience are that it is capital intensive for large scale

plantation establishment, there is limited supply of quality planting material, land availability

(Major hindrance), difficulty in establishing a rational supply chain with smaller land-holders,

ownership issues with Government / Community-owned waste lands, labor intensive at one

point of time, technology-driven and Government’s tardiness in executing the policies. The

Biodiesel industry through Jatropha has an enormous future growth, as it is commodity

product. Implementing the use of biofuels is being considered by most of the countries on a

mission-mode approach. There are more than 10 million hectares under Jatropha plantation

worldwide and millions of hectares are being converted within the next 5 years. Evolution of

newer varieties will lead to establishment of better plantations all over the world. Huge scope

remains for plant science R & D; biofuel related R & D. Huge employment opportunities will

await when plantations are planned and government schemes can be best utilized. By-product

utilization and management will prove to be a bigger industry by itself. The need of the hour

remains that a serious action on the implementation of National Biofuel Policy has to be taken

up by both State and Central Governments. Land bank should be made available to

entrepreneurs on subsidized lease charges. Instead of funding for installation of refineries,

state Governments should prioritize the establishment of biofuel plantations in collaboration

with village panchayats.

The time has come to chart out a clear and detailed roadmap for the development of

biofuels. A strong impetus must be provided to expand and accelerate R & D efforts in this

direction. If we undertake efforts to develop local and indigenous production of transportation

fuels, we may meet up to 40 per cent of the transportation fuel market in the future by using

biodiesel. Clearly, we need to push biofuels in the energy sector, which is crucial to attain a

sustainable and secure future!

ACKNOWLEDGEMENT We wish to acknowledge Mr. Saeid Nikdad, research scholar, R & D Division of

Labland Biotech, Mysore for his involvement and help during the preparation of this

manuscript.



REFERENCES1. R. Renner, “Green gold in a shrub. Entrepreneurs target the Jatropha plant as the next big

biofuel” Scientific American, vol. 296, No. 6, pp. 20-23, 2007.

2. H. Weyerhaeuser, Tennigkeit T., Yufang S. and Kahrl, F. “Biofuels in China: an analysis

of the opportunities and challenges of Jatropha curcas in Southwest China,” Beijing,

China: World Agroforestry Centre. ICRAF Working Paper, No. 53, 2007.

3. V. Pandey, Singh, K., Singh J., Kumard A., Singh, B. & Singh, R. “Jatropha curcas: a

potential, biofuel plant for sustainable environmental development, Renewable and

Sustainable Energy” Reviews, vol. 16, No. 5, pp. 2870-2883, 2012.

4. J. van Gelder, German, L. and Bailis, R. “Biofuels investments in tropical forest-rich

countries:implications for responsible finance” Sustainability Accounting, Management

and Policy Journal, vol. 3, No. 2, pp. 134-160, 2012.

5. W. Achten, Maes W., Aerts R., Verchot L., Trabucco A., Mathij, E., Singh, V. and Muys

B. “ Jatropha: From global hype to local opportunity” Journal of Arid Environments, vol.

74, No. 1, pp. 164-165, 2009.

6. FAO “Jatropha: a smallholder bioenergy crop. The Potential for pro-poor development”

Rome, Italy: Food and Agriculture Organization of the United Nations (FAO), 2010.

7. L. German, Schoneveld G., and Pacheco P., “The social and environmental impacts of

biofuels feedstock cultivation: evidence from multisite research in the forest frontier,

Ecology and Society, vol. 16, No. 4, Art. 24, Available at: http://dx.doi.org/10.5751/ES-

04309-160324, 2011

8. N. Wahl, “Insights into Jatropha Projects Worldwide Key Facts & Figures from a Global

Survey. Surveyed and published by Centre for Sustainability Management, Leuphana

University of Lüneburg, and INOCAS, GmbH, Lüneburg. ISBN 978-3-942638-28-9.

pp.72, 2012.

9. S. Kumar, Alok Chaube, Shashi Kumar Jain. “Critical review of jatropha biodiesel

promotion policies in India” Energy Policy, Vol. 41, pp. 775–78, 2012.

10. D. Rajagopal, “Implications of India’s Biofuels policies for food, water and the poor”

Water Policy, vol. 10 Supplement 1, pp. 95-106, 2008.

11. A. Kumar, Kapil Kumarb, Naresh Kaushik , Satyawati Sharma, Saroj Mishra. Renewable

energy in India: Current status and future potentials. Renewable and Sustainable Energy

Reviews vol. 14, pp. 2434–2442, 2010.



12. MNRE 2008. National policy on Biofuels, Government of India.

www.petroleum.nic.in/Bio-Diesel.pdf

13. India. Biofuels Annual. Jul 2014. http://www.agrochart.com/en/news/news/140714/india-

biofuels-annual-jul-2014/

14. P. Shinoj, Raju S. S. Ramesh Chand, Praduman Kumar and Siwa Maangi. Policy Brief.

ICAR report 36. http: //www.ncap.res.in

15. GEXSI: Global market study on Jatropha. Final report prepared for the World Wide Fund

for Nature (WWF). London, UK / Berlin, Germany: Global Exchange for Social

Investment (GEXSI), 2008.

16. Anonymous. In-house R & D annual reports of Labland Biotech Private Limited, Mysore

for year 2005-2008.

17. S. Nikdad, Gurukar A. and Shetty S., “A comparative study of seed yield and oil content

of Jatropha curcas L.” Abstract published in the State level Seminar on “Past, present

and future perspectives of Jatropha as a biodiesel plant” organized by the department of

Botany and Seed Technology, Sahyadri Science College, Kuvempu University, Shimoga

on February 22-23, 2010.

18. S. Nikdad, “Biotechnological approach to improve yield in Jatropha curcas L.” Thesis

submitted to the University of Mysore for the award of Ph. D. with all the work carried

out at Research and Development division of Labland Biotech Private Limited, Mysore,

2015.

19. S. Nikdad, and Shetty S., “An initial study on the commercial production of hybrid seeds

in Jatropha curcas L.” Abstract published in the State level Seminar on “Past, present and

future perspectives of Jatropha as a biodiesel plant” organized by the department of

Botany and Seed Technology, Sahyadri Science College, Kuvempu University, Shimoga

on February 22-23, 2010.

20. Nandini-Mohan, Saeid Nikdad and Geetaa Singh, “ Studies on germination profile and

embryo culture of Jatropha curcas L. selection under in vitro conditions”,

Biotechnology, Bioinformatics and Bioengineering, vol 1, Issue 2: 187-194, 2011.

21. Saritha G. Pandit, Manju-Joseph and Geetaa Singh, “Effect of different concentrations of

NPK on growth, seed yield and seed oil content in Jatropha curcas L. plants” in the

Abstracts of “National Women Science Congress”, organized by Karnataka State Women

University, Bijapur on 5th & 6th December, 2008.



22. G. Saritha-Pandit, Joseph M., and Singh G., “Effect of different concentrations of NPK

on growth, seed yield and seed oil content in Jatropha curcas L. plants” Pariprashna,

Vol IV, Issue-II & vol V, Issue I, pp. 58-64. 2010.

23. Manju Joseph, Saritha-Pandit G. and Geetaa Singh, “A study on the role of biofertilizers

on growth, seed yield and oil content of Jatropha curcas L.” in the Abstracts of “National

Women Science Congress”, organized by Karnataka State Women University, Bijapur on

5th & 6th December, 2008.

24. M. Joseph, Saritha-Pandit G. and Singh G., “Effect of biofertilizers on Biodiesel plant

Jatropha curcas L.” Pariprashna, Vol IV, Issue-II & vol V, Issue I, pp.23-30. 2010.

25. G. Singh and Shetty S., Provisional patent on “Micropropagation of Jatropha curcas”

with the Indian Patent Office on July 14, 2009 with the serial number 01673/CHE/2009.

26. G. Singh and Shetty S., International patent on “A method for Micropropagation of

Jatropha curcas” on July 14, 2010 with the application number PCT/IN2010/000469,

having a publication number WO/2011/021211.

27. G. Singh, “Importance of Tissue Culture in improvement and mass multiplication of

Jatropha curcas L., the biodiesel plant”, Abstracts published in the State level Seminar

on “Past, present and future perspectives of Jatropha as a biodiesel plant” organized by

the department of Botany and Seed Technology, Sahyadri Science College, Kuvempu

University, Shimoga on February 22-23, 2010.

28. “Evaluation of in vitro rooting efficiency in Jatropha curcas, a biodiesel plant”, A

dissertation submitted by Shalini Koshle, VI Semister, M. Sc. (Biotechnology), Boston

college for professional studies, Jiwaji University, Gwalior with all the work carried out

at Research and Development division of Labland Biotech Private Limited, Mysore,

2015.

29. S. Koshle, Saritha-Pandith G., Mohana C. R. and Geetaa Singh, 2010. Evaluation of in

vitro rooting efficiency in Jatropha curcas – the biodiesel plant. Abstract published in

the State level Seminar on “Past, present and future perspectives of Jatropha as a

biodiesel plant” organized by the department of Botany and Seed Technology, Sahyadri

Science College, Kuvempu University, Shimoga on February 22-23, 2010.

30. G. Singh and Shetty S., Evaluation of in vitro rooting efficiency in the biodiesel plant

Jatropha curcas. Biotechnology, Bioinformatics and Bioengineering, vol 2, Issue 1: 591-

596, 2012.

31. G. Singh and Shetty S., “Field evaluation of genetic fidelity and agronomic performance

of Tissue Culture-generated Jatropha curcas plants” In: Abstracts of First International



and Third National Conference on ‘Biotechnology, Bioinformatics and Bioengineering,

page 19, 2013.

32. S. Nikdad, Singh G. and Shetty S., “Occurrence of apomixis in Jatropha curcas L.

accessions at Mysore, Karnataka, India.” In: Abstracts of First International and Third

National Conference on ‘Biotechnology, Bioinformatics and Bioengineering, pp. 168.

2013.

33. “Evaluation of oil extraction efficiency of different organic solvents from Jatropha

seeds” A dissertation submitted by Swati Bhagwat and Deepa Hegde, VI Semister, B. Sc.

(Biotechnology), Department of Biotechnology, St. Agnes College, Mangalore work

carried out at Research and Development division, Labland Biotech Private Limited,

Mysore, 2008.

34. “Extraction and characterization of Jatropha oil and its methyl esters” A dissertation

submitted by Kiran Menon, Department of Biotechnology, Vellore Institute of

Technology for the award of the degree of B. Tech. Biotechnology to the Deemed

University, Vellore Institute of Technology, Vellore work carried out at Research and

Development division, Labland Biotech Private Limited, Mysore, 2008.

35. “Effect of storage conditions and storage duration on oil yield and free fatty acid content

in Jatropha curcas L” A dissertation submitted by Lavanya R. K., Pavithra L., and

Rajalakshmi P., Department of Biochemistry, University of Mysore for the award of the

degree of Master of Science, work carried out at Research and Development division,

Labland Biotech Private Limited, Mysore, 2014.

36. Antimicrobial Activity of Jatropha curcas Leaf and Stem Extract against Isolated

Anthurium Plant Pathogens, March, 2014. A dissertation submitted by Ms. Ashwini C.

Raj, IV Semester, M. Sc., Microbiology, Department of Microbiology, Maharani’s

Science College for Women, Mysore.

37. Antimicrobial Activity of Jatropha curcas Leaf and Stem Extract against Isolated Banana

Plant Pathogens, March, 2014. A dissertation submitted by Ms. Keerthana T., IV

Semester, M. Sc., Microbiology, Department of Microbiology, Maharani’s Science

College for Women, Mysore.

38. GE Global research bulletin, 2015. http://qz.com/247213/why-india-is-spending-330-

million-a-day-on-imported-oil-and-gas



BIODEGRADATION OF AZO DYES BY HALOBACILLUS SP.Shivdas Nayak and Rama Bhat P.*

Department of Post Graduate Studies and Research in Biotechnology

Alva’s College, Moodbidri – 574 227, Karnataka, India

*Corrsponding author

E-mail: [email protected]

ABSTRACTAzo dyes are synthetic organic compounds which are extensively used as a colouring

agent in industries. They are stable and resistance to temperature and light but are degraded by bacteria under anaerobic and aerobic conditions. The present investigation was carried out with the objectives such as isolation, screening of microorganisms, standardization of techniques, characterization of enzymes and biodegradation of two selected azo dyes namely, Reactive Magenta and Reactive Blue 220. Halobacillus species were isolated and cultured in high sodium chloride containing medium produced an enzyme azoreductase. Different biochemical test were performed for their purification and characterization. The degradation analysis was done using HPLC. The enzyme was confirmed as azoreductase E.C. 1.7.1.6, a NADPH dependent enzyme. The degradation of reactive magenta was up to 94.14% and reactive blue was 96.24%. Key words: Azo dyes, azo reductase, biodegradation, Characterization, Halobacillus

INTRODUCTION

The azo dye class accounts for 60-70% of all dyes used globally, they all contain an

azo group -N=N-, which links two sp2 hybridised carbon atoms. These carbons may be a part

of aromatic systems. Most azo dyes contain only one azo group, but some of them may

contain two (disazo), three (trisazo) or more. The textile industry is estimated to consume as

much as two-third of the total annual production of dyes [1]. Since the first commercial

synthetic dye, Mauveine, was discovered in 1856, more than 100 000 dyes have been

generated worldwide with an annual production in excess of 7 x 105 metric tonnes [2]. Azo

dyes are the largest and most versatile class of dyes and are commonly used to dye various

materials such as textiles, leathers, plastics, cosmetics and food [3, 4]. They are the major

group of dyes used in the textile industry and contribute between 50-65% of the colours in

textile dyes [1, 5]. The inefficiencies in the dyeing process results in dyestuff losses between

2-50% to the waste water with the lower limit for basic dyes and the upper for azo dyes.

Ultimately these dyes find there way to the environment and end up contaminating rivers and

groundwater in the locale of the industries [1].



The presence of potentially toxic compounds in wastewaters from textile dyeing

industries shows colour in wastewater which is highly visible and affects esthetics, water

transparency, and gas solubility in water bodies, alter the pH, increase the Biochemical

Oxygen Demand (BOD) and Chemical Oxygen Demand (COD) and thereby make aquatic

life difficult [6]. Azo dyes are the most toxic of the dye types. Many studies have been

conducted showing the toxic potential of azo dyes. The problem associated with azo dyes is

created by the dye metabolites. After releasing dyes into the aquatic environment, they may

be converted into potentially carcinogenic or mutagenic amines [7,8,9]. Substituted benzene

and naphthalene rings are common constituents of azo dyes, and have been identified as

potentially carcinogenic agents [10]. While most azo dyes themselves are non-toxic a

significantly larger portion of their metabolites [11].

The azo dye toxicity and places of mechanism in order of their frequency of citation.

Brown and DeVito (1993) [12] postulated that Azo dyes may be toxic only after reduction

and cleavage of the azo linkage, producing aromatic amines. Azo dyes with structures

containing free aromatic amine groups that can be metabolically oxidized without azo

reduction may cause toxicity. Azo dye toxic activation may occur following direct oxidation

of the azo linkage producing highly reactive electrophilic diazonium salts.

Several treatment methods are available for the decolourization of textile effluents.

These include physiochemical methods such as filtration, specific coagulation, use of

activated carbon and chemical flocculation. Some of these methods are effective but quite

expensive [13, 14]. Some of the microorganism used in biodegradation of azo dyes is

Pseudomonas putida, Streptomyces viridosporus, Phanerochaete chrysosporium, Bacillus

sp., Stenotrophomonas sp. etc. It is quite evident that the biologic waste treatment processes

are sometimes more efficient and less expensive than physical/chemical waste treatment

procedures, hence it would be desirable to provide a biological process using microorganisms

that degrade xenobiotic azo dyes. The objectives of the present investigation were

I. isolation and screening of azo dye degrading microorganisms,

II. Standardization of process and parameters (temperature, pH, incubation time,

nitrogen source),

III. to study biodegradation and characterization of enzyme



MATERIALS AND METHODS

Collection of sample and isolation, and screening on selective media: Water samples and

soil samples were collected from the estuarine region of the Suratkal, an industrial area near

Mangalore. The medium used for the growth of organisms was a modified MEM (Minimal

Essential Media) with only 0.1g of peptone, 100mg of dye and 5 % sodium chloride for the

better growth of halophillic bacterium. Inoculum was mixed by gentle rotation of the Petri

plates (serial dilution method). Colonies of different microorganisms were observed for the

morphological features and observed under microscope. Then Gram staining method was

followed for identification.

Biochemical characterization: The sum of all the chemical reactions that occur within living

organism. Tests such as indole test, methyl red test, Vogus proskauer test, citrate utilization

test, casein hydrolysis, lipid hydrolysis, hydrogen sulfide production test, catalase test,

oxidase tests were carried out.

Degradation: Degradation studies were carried out in Minimal Essential Media broth with

the inoculation of isolated microorganism. The degradation studies were performed for 17

days, till the dye was decolourised. Estimation of degradation was carried out by

spectrophotometric method on alternate days and finally HPLC analysis of the azo dye

concentration was done.

Spectrophotometric estimation of degradation: The concentration of a substance in

solution can be measured by calculating the amount of absorption of light at the appropriate

wavelength or a particular colour. The concentration of azo dyes was determined

spectrophotometrically. Azo dyes, the corresponding reduction products, and the metabolites

from conversion were analyzed at their respective wavelengths on alternate days. The

spectrophotometric analyses were compared with a uninoculated media as blank and

percentage of degradation were calculated by using the following formula:

% Degradation = Initial OD - Final OD X 100

Initial OD

The base line performance absorbance for methyl red dye is 430nm and Reactive blue

220 is 660nm.



HPLC Analysis of degradation: HPLC is one of the mode of chromatography which is a

most widely used analytical technique. It is a separation technique involving mass transfer

between stationary and mobile phase. It is a tool for quantifying and analyzing mixtures of

chemical compounds. It is used to find amount of a chemical compound within a mixture of

other chemicals. Mobile phase was prepared was prepared by mixing HPLC grade methanol

and acetonitrile in the proportion 80: 20.

Cell count determination: Bacterial population or amount of growth can be determined by

measuring turbidity or optical density of a broth culture. The turbid a suspension the less light

will be transmitted through it, since turbidity is directly proportional to the no. of cells. This

property is used as an indicator of bacterial concentration in the sample. The cell suspended

in a culture interrupt the passage of light allowing less light to reach the photoelectric cells

and the amount of light energy transmitted through the suspension is measured as percentage

of transmission on the spectrophotometer as 0-100%. The density of the cell suspension is

expressed as absorbance or optical density which is directly proportional to the cell

concentration. Absorbance is the logarithmic value and is used to plot bacterial growth on a

graph. Cell count is measured by reading the optical absorbance of the sample at 600nm and

comparing it with a blank with uninoculated media. Cell count can be calculated by the

following formula:

Cell count = O.D of blank at 600nm - O.D of sample at 600

ENZYME ASSAY: ENZYME ASSAY IS CARRIED OUT TO CHECK THE ACTIVITY OF ENZYME PRESENT IN BOTH CRUDE AS WELL AS PURIFIED PRODUCT. ENZYME ASSAY OF THE SAMPLES WAS CARRIED OUT ON ALTERNATE DAYS.Enzyme assay unit = (660nm/min Test - 660nm/min Blank) 2.3 X Df

g X 0.1

where,

2 = Volume

Df = Dilution factor

g = Millimolar extinction co efficient of azo dye

0.1= Volume of enzyme in ml

The protein was determined by Lowry’s method [15].Isolation and purification of

enzyme by ammonium sulphate precipitation method [16].

Dialysis: Activation of dialysis membrane pre treatment, 6 cm of dialysing membrane taken

and boiled it in 100 ml of distilled water for 10 minutes with slow stirring. Then decant the



membrane from the boiling water and placed it in 100ml of boiling water containing 2%

sodium bi carbonate. Again replace it in fresh boiling water bath for 10 minutes. Activated

membrane is aken, tie it with a thread on one side and pour the pellet dissolved in phosphate

buffer then tie it on the other side. The dialysis tube was kept on magnetic stirrer at 220-250

rpm for 3 hours in 500ml of distilled water.

Ion exchange chromatography: Ion-exchange chromatography (or ion chromatography) is

a process that allows the separation of ions and polar molecules based on their charge. It can

be used for almost any kind of charged molecule including large proteins, small nucleotides

and amino acids.

SDS PAGE: PROTEIN PROFILING WAS PERFORMED BY SDS-PAGE USING 10% ACRYLAMIDE. PROTEIN BANDS WERE STAINED WITH COOMASSIE BRILLIANT BLUE R-250 [16].RESULTS

The colonies grown over the azo dye containing medium were found to be creamish

white, round, shiny, opaque in morphology and was found to show a zone of degradation

around the colony. The results of Gram staining showed that the microorganisms were Gram

positive short rods in morphology (Fig. 1).

Fig. 1: Culture with Gram positive rods

The results for the various biochemical tests performed for characterization of isolated

microorganisms are tabulated in Table 1.

Table 1: Biochemical characterization

TestCulture

1Culture

2Control Inference



Gram staining + + No Purple coloured short rodsIndole + + No Cherry red colour on the top

Methyl red + - No Yellow to red colourVogues

proskauer- - No No change in colour

Citrate utilization

+ + No Green to blue colour

Catalase + + No Bubbles were formed

Starch hydrolysis + +Clear zone around the culture in

iodineCasein

hydrolysis+ + Clear zone around the culture

Cellulase - - No growthGelatin

hydrolysis- - No solidification

Carbohydrate test

+ +

Glucose + + No No gas formationSucrose + + No No gas formationLactose + + No No gas formationUrease - - No No change in colour

H2S - - No change in colourLipase + + Clear zone around the colony

Oxidase - - No purple colour

Fig.2: Indole test

Formation of cherry red colour ring on the top shows a positive result for the

production of enzyme tryptophanase as shown in figure 2.



Methyl red test was found to be positive by the change in colour from yellow to red,

VP test was found to be negative as there was no change in colour observed and for citrate

utilization showed a positive result, which is indicated the production of blue (Figs. 3-5).

Fig. 3: Methyl red test Fig. 4: Vogues Proskauer test

Fig. 5: Citrate utilization test



Fig. 6- Catalase Test

Bubbles were produced when the bacterial culture was inoculated into Hydrogen

peroxide as shown in figure 6, which confirms the production of enzyme catalase. Casein

hydrolysis was successfully done by the microorganisms by production of some enzymes like

proteinase caseinase, bacterium was able to break the peptide bond present in the media by

the enzyme caseinase, which was shown a clear zone of utilization around the colony.

Fig. 7: Starch Hydrolysis Test

Starch was hydrolysed to simpler glucose units by the production of enzyme amylase,

which could be confirmed by a clear zone around the microbial colony on addition of iodine,

as shown in figure 7. Gelatine hydrolysis was found to be positive which was shown by the

hydrolysis of the solid media to liquid mass.



Fig. 8: Urease Test

Urease test was found to be negative, since there was no change in colour and no

production of urease enzyme shown in figure 8. Lipids present in the media were

successfully utilized by microorganisms, which showed the production of enzyme lipase.

Carbohydrate test was found to be positive indicated by the change in colour from yellow to

red by production of acid but no gas bubbles were observed. H2S test was found to be

negative, since there was no black colour formed by the incorporation of heavy metal

complex FeS around the inoculation.

DEGRADATION OF DYES

Fig. 9: Degradation of Reactive magenta Fig. 10: Degradation of Reactive blue 220

Figure 9 showed the effect of degradation on Reactive magenta after 17 days of

degradation, in this figure the first flask is a control and the second flask is contains degraded

azo dye at the end of 17 days, which is degraded upto 94.14%. The effect of degradation on

Reactive blue 220 after 15 days of degradation is shown in the figure 10. Here the first flask



is a control and the second flask is contains degraded azo dye at the end of 15 days, which

showed degradation upto 96.24%.

In comparison with the degradation effect on Reactive magenta and Reactive blue

220, Reactive blue 220 was degraded to 96.24% in 15 days where as Reactive magenta was

degraded to 94.14% in 17 days (Fig. 11). Degradation in Reactive blue 220 was uniform till

the end of 9th day and than it showed a sudden increase on 11th day and than it was uniform

and quite constant. On the other hand degradation in Reactive magenta dye was uniform till

11th day and than showed quite greater increase in degradation till the end of 15th day and

than remained uniform till the end.

Fig. 11: Spectrophotometric analysis of Azo dye degradation

HPLC ANALYSIS OF AZO DYE DEGADATION

HPLC analysis of dye degradation clearly shows that the dye was reduced to below

detectable level within a period of 15 days (Figure 12 and table 2). The total no. of cells

observed in the coarse of degradation are shown Fig. 13, it shows that there are two peaks in

the graph for both Reactive magenta as well as Reactive blue 220. Cell count with respect to

Reactive magenta was to a maximum at the end of day 7 than suddenly dropped down on the

9th day, finally cell count again increased gradually and remained almost constant. Cell count

in the Reactive blue 220 also showed 2 peaks but the first peak was very small which

0102030405060708090

100

0 5 10 15 20

% D

EGRA

DAT

ION

DAYS

red

blue



declined by the end of 7th day, than it showed a rapid increase till the 13th day than remained

almost constant.

Table 2: HPLC analysis of azo dye degradation

Sample Reactive magenta (mg) Reactive Blue 220(mg)

DAY 1 1.768 3.47

DAY 7 1.61 3.21

DAY 15 Below detectable level 3.17

Fig. 12: HPLC analysis of azo dye degradation

Fig. 13: Cell count determination

The results of enzyme assay for Reactive magenta, Reactive blue 220s as tabulated in

Fig. 14 shows that the enzyme activity was constantly increasing from day to day and was

0

1

2

3

4

0 2 4 6 8 10 12 14 16Dye

con

cent

ratio

n in

mg

DAYS

DEGRADATION

red

blue

00.20.40.60.8

11.21.41.61.8

0 2 4 6 8 10 12 14 16 18

OD

at 6

00nm

DAYS

red

blue



found to be maximum at the end. The protein contents present in the purified enzyme is

lesser than the amount of protein present in the crude sample, which is showed in the figure

15. 200µg/ml of proteins was found to be present in Reactive magenta containing media,

where as 300 µg/ml of proteins were found to be present in Reactive blue 220 containing

media.

Fig 14: Azoreductase enzyme assay

Fig. 15: Protein estimation

It is clear that the isolated azoreductase enzyme is a thermostable enzyme (Fig. 16).

Both of these azoreductases are able to show maximum activity at a temperature around 500

C. They showed a maximum activity in the range of 300-500C. The enzyme is a acidic

1E-11

0.001

0.002

0.003

0.004

0.005

0.006

0.007

0.008

0.009

0 2 4 6 8 10 12 14 16 18 20

Opt

ical

den

sity

Days

red

blue

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

20 40 60 80 100 120 140 160 180 200 220 240 260 280 300 320 340

O.D

at 6

60nm

Concentration

Red = crude RV13Orange = pure RV13Blue = crude RB200sky blue = pure RB220



azoreductase enzyme, since it has maximum activity at a pH around 6 and it suddenly drops

the activity on reaching the alkaline phase (Fig. 17).

Fig. 16: Effect of temperature on azoreductase activity

Fig. 17: Effect of pH on azoreductase activity

The protein profile analysis of the isolated azoreductase enzyme by SDS-PAGE

shown in figure 18, there was a thick band which was close to the band of 65 kDa, which

indicated that the molecular weight of the azoreductase enzyme was found to be around 65

kDa.

1E-071.01E-05

2.01E-053.01E-054.01E-05

5.01E-056.01E-057.01E-058.01E-05

0 20 40 60 80 100

Enzy

me

activ

ivity

in u

nits

Temperature °C

red

blue

0

0.000002

0.000004

0.000006

0.000008

0.00001

0.000012

3 4 5 6 7 8 9 10

enzy

me

activ

ity in

uni

ts

pH

BLUE

red



Fig. 18: SDS PAGE showing protein bands

DISCUSSION

The isolated bacterial species was confirmed as species of Halobacillus by Gram

staining and biochemical tests.

In this study, the freshly isolated Halobacillus species was capable of growing and

producing the enzyme azoreductase in high concentration of sodium chloride. The studies

carried out on two reactive azo dyes confirmed that the enzyme efficiently reduced the azo

dye to a colourless reduced product. Reactive Magenta was reduced upto 94.14% and

reactive blue220 upto 96.24 % by spectrophotometric analysis, within a period of 17 days.

The isolated bacterial azoreductase enzyme readily cleaved more than 2 types of azo

dyes. An extracellular azoreductase enzyme, E.C.1.7.1.6 is responsible for the

decolourization activity, which is in support of earlier works [14, 17]. The enzyme is a

NADPH dependent azoreductase. NADPH is required as a cofactor which enhances the azo

reduction when supplied externally to the reaction mixture; this study also supports the earlier

work [18].

The molecular weight of azoreductase obtained was found to be quite different,

around 65 kDa by SDS-PAGE analysis. This enzyme was unlike the earlier reports which

65 kDa



showed a molecular weight of 21 and 30 kDa from Pseudomonas species [19] and 28 kDa

from Enterobacter agglomonas [20].

More surprisingly the enzyme was found be an acid azoreductase, which had a

maximum activity at pH 6, unlike alkali azoreductase in the earlier reports [14]. The enzyme

isolated was also found to be a thermostable enzyme since the temperature maximum was

around 500C which is in favour of several earlier reports [18, 21, 22].

REFERENCES

1. R.M. Melgoza, A. Cruz and G. Bultron,. Anaerobic/aerobic treatment of colorants present

in textile effluents. Water Sci. Technol., 50: 149-155, 2004.

2. H. Zollinger, Color Chemistry: Syntheses, Properties and Applications of Organic Dyes

and Pigments. VCH Publications, New York, 496p., 1991.

3. R. Anliker, Ecotoxicology of dye stuffs. A joint effort by industries. Ecotoxicol. Environ.

Saf. , 3: 59-74, 1979.

4. S. M. Blumel, M. Contzen, A. Lutz, Stolz and H. J. Knackmuss, Isolation of a bacterial

strain with the ability to utilize the sulfonated azo compound 4-carboxy-4′-

sulfoazobenzene as the sole source of carbon and energy. Appl. Environ. Microbiol., 64:

2315-2317, 1998.

5. K. T. Chung, S. E. Stevens and C. E. Cerniglia, The reduction of azo dyes by the

intestinal microflora. Crit. Rev. Microbiol., 18:175-190, 1992.

6. S. O. Ajayi, O. Osibanjo, The state of environment in Nig. Pollution studies of textile

industries in Nigeria. Monagra, 1: 76-86, 1980.

7. K.T. Chung and C.E. Cerniglia, Mutagenicity of azo dyes: structure-activity relationships.

Mutation Res., 277: 201-220, 1992.

8. K.T. Chung, The significance of azo-reduction in the mutagenesis and carcinogenesis of

azo dyes. Mutation Research, 114, 269-281, 1983.

9. T.P. Cameron, T.J. Hughes, P.E. Kirby, V.A. Fung and V.C. Dunkel, Mutagenic activity

of 27 dyes and related chemicals in the Salmonella/microsome and mouse lymphoma

TK+/- assays. Mutation Research, Genetic Toxicology Testing, 189: 223-261, 1987.

10. IARC, IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to

Humans, Suppl. 4, Chemicals, Industrial Processes and Industries Associated with

Cancer in Humans (IARC Monographs, Volumes 1 to 29), Lyon, IARC. 1982.



11. R, Ganesh,. Fate of Azo Dyes in Sludges, Masters Thesis. Polytechnic High performance

degradation of azo dye acid orange 7 and sulfanilic acid in a laboratory scale reactor after

seeding with cultured bacterial strains. Water Res. 37 (11): 2757-63. 2003.

12. M.A. Brown and S.C. De Vito, Predicting azo dye toxicity. Critical Reviews in

Environmental Science and Technology, 23: 249-324, 1993.

13. T. Do, J. Shen, G. Cawood and R. Jeckins, Biotreatment of textile effluent using

Pseudomonas spp. Immobilized on polymer supports. In: Advances in biotreatment for

textile processing. Hardin IR; Akin DE & Wilson JS (Eds). University of Georgia Press.

2002.

14. J, A. Maier, A. Kandelbauer, A.Erlacher, Cavaco–Paulo and G.M. Gubits, A new alkali

thermostable azoreductase from Bacillus sp. Strain SF. Applied Environ. Microbial. 70:

837-844, 2004.

15. N. J. Lowry, A.Rosebrough, L. Farr, and R. J. Randall, Protein measurement with the

Folin phenol reagent. J. Biol. Chem. 193:265-275, 1951.

16. A. Manikam, and S. Sadashivam, Biochemical Methods, 3rd Edition, New Age

International Publishers, New Delhi, pp.54-60, 2008.

17. Walker, R., Gingell, R. and Murrells, D. F. 1971. Mechanisms of azo reduction by

Streptococcus faecalis. Optimization of assay conditions. Xenobiotica, 221-229. 17

18. K.C. Chen, J.Y. Wu, D.J. Liou and S. Ch. J. Hwang, Decolorization of textile dyes by

newly isolated bacterial strains. J. Biotechnol., 101: 57-68, 2003.

19. T. Zimmermann, H.G. Kulla, T. Leisinger, Properties of purified orange II azoreductase,

the enzyme initiating azo dye degradation by Pseudomonas KF46. Eur. J. Biochem., 129:

197-203, 1982.

20. Y. Moutaouakkil, F.Z. Zeroual, M.Dzayri, K. Talbi, Lee, and M. Blaghen. Bacterial

decolorization of the azo dye methyl red by Enterobacter agglomerans Annals of

Microbiology, 53: 161-169, 2003.

21. Arun Prasad and K.V. Bhaskara Rao, Aerobic biodegradation of azo dye Acid Black-24

by Bacillus halodurans . Journal of Environmental Biology, 35: 549-554, 2014.

22. K. Matsumoto, Y. Mukai, D. Ogata, F. Shozui, J.M. Nduko, S. Taguchi and T. Ooi,

Characterization of thermostable FMN-dependent NADH azoreductase from the

moderate thermophile Geobacillus stearothermophilus. Appl Microbiol Biotechnol. 86(5)

: 1431-1438, 2010



PRODUCTION, OPTIMISATION, CHARACTERISATION AND PARTIALPURIFICATION OF L-ASPARAGINASE FROM ASPERGILLUS NIGER

Manisha Shetty, Prateeksha Chelkar, Jenitta Emima Packiyam. E*Rama Bhat. P, Jayadev K.

Department of Post Graduate Studies and Research in BiotechnologyAlva’s College, Moodbidri – 574 227, Karnataka, India

*Corrsponding authorE- mail: [email protected]

ABSTRACTThe genus Aspergillus is important economically, ecologically and medically. It is

cosmopolitan and ubiquitous in nature with over 185 species. They are able to secrete large amounts of their own proteins. Observation made in this work holds great promise for production of L-asparaginase enzyme. It proves that Aspergillus niger is a potent strain for the L-asparaginase production .The studies also revealed that different types of culture media differentially influenced the growth, colony, character and sporulation of the fungi. Out of the three test media (CDM, SDA and PDA), PDA was found to be suitable for highest sporulation. The maximum growth was seen on day 4th (optimum day). Optimization of fermentation parameters such as carbon source and nitrogen source play an important role in enzyme production and are suitable for maximum activity of enzyme. The molecular mass of isozymes varies from 50 to100 kDa. The molecular mass of partially purified L-asparaginase was determined by using SDS-PAGE technique. In this study different substrates like saw dust, coir pith and straw were used for the maximum production of enzyme.

INTRODUCTION

Aspergillus niger is a morphologically complex organism, showing different

morphologies at different times of its life cycle, differing in form between surface and

submerged growth and also differing with the nature of the growth medium and physical

environment .Especially the genus Aspergillus, frequently applied in enzyme production due

to the GRAS status (generally regarded as safe), has received particular attention. Due to

enormous development of genetic engineering and efficient expression systems, Aspergillus

species have also achieved increased attention as host for industrial production of

homologous and heterologous proteins [1].The enzyme L-asparaginase [L-asparagine amino

hydrolase, (E.C. 3.5.1.1)] is an important component in the treatment of pediatric acute

lymphoblastic leukemia and catalyzes the hydrolysis of asparagine and glutamine into

aspartic acid and ammonia.Asparaginase is produced by submerged fermentation of the

asparaginase production strain using a fermentation medium composed of food-grade (or

equivalent) raw materials.The media components are important criteria for fungal culture and

study, along with important physiological parameters that lead to maximum sporulation in

fungi [2]. Aspergillus is capable of utilizing large amount of carbon sources .The carbon



concentration had a positive effect on enzyme production and high titres can be obtained in a

medium rich of carbon source.Next to carbon, nitrogen has pronounced the influence on

enzyme production. The presence of additional nitrogen sources along with nitrogenous

compounds present in the substrate promotes enhanced growth and consequent enzyme

production.Agricultural wastes like coir, paddy straw and saw dust which are sometimes

disposed off in municipal bins or outside for rotting could serve as an ideal substrate for

production of cellulases. Cellulose is commonly degraded by an enzyme called cellulase.

This enzyme is produced by several microorganisms, commonly by bacteria and fungi [3].

Although a large number of microorganisms are capable of degrading cellulose, only a few of

these produce significant quantities of cell free enzymes capable of completely hydrolysing

crystalline cellulose invitro. Fungi are the main cellulase producing microorganisms, though

a few bacteria and actinomycetes have also been reported to yield cellulaseactivity.Hence, the

present study was carried out to determine the cellulolytic enzyme activity of Aspergillus

niger against rice straw, coir waste and saw dust as carbohydrate source.


Sample collection and identification of fungi: Boiled white rice sample was collected from

Alva’s hostel in a sterile container and kept for isolation at room temperature, for 5 - 6 days

.Fungi was identifiedby lactophenol blue method and the preparation was examined under

40X magnification for the presence of characteristic mycelia and fruiting structures.

Selection of production media: The inoculums were prepared by fungal cultivation on a

rotary shaker at 180 rpm in 250 ml Erlenmeyer flask containing100ml of Czapek Dox

Medium (CDM), Sabourad’s Dextrose Agar (SDA), Potato Dextrose Agar ( PDA)

separately. pH was adjusted to 6.0 before sterilization. The medium was autoclaved at 121°

C. After sterilization organism was inoculated and culture flasks were incubated in orbital

shaker (160rpm) at room temperature. After 4th day of incubation, filtrates of media were

isolated,the OD readings and dry mycelial weight were taken every 24 hour interval for seven

days.

ENZYME ASSAY

L- Asparaginase: Screening of isolates for L- asparaginase production by rapid-plate assay

was performed.The isolates were screened for L-asparaginase activity using the following

method. The media used for the screening the enzyme producing Aspergillus strain was



modified media, L-asparagine incorporated with a pH indicator (phenol red). Incubated at

room temperature for 5-6 days. L-asparaginase activity was identified by formation of a pink

zone around colonies. Two plates were prepared using modified media supplemented with

phenol red (0.009%) used as an indicator and the other plate agar was without L-asparagine.

Crude Enzyme Extraction: The crude enzyme from the fermented substrate was extracted

using 0.1M phosphate buffer (pH 8). After mixing the fermented substrate with 41 ml of

buffer, the flasks were kept on a rotary shaker at 150 rpm for 30 min. The slurry was

centrifuged at 10,000 rpm for about10 min at 4°C in a cooling centrifuge. Supernatant was

collected and used for enzyme assay.

Asparaginase assay: The activity of L-asparaginase was determined by the method of Imada

et al., 1973 [4] in which the amount of ammonia liberated from L-asparagine was estimated.

One unit (U) of L-asparaginase was defined as the amount of enzyme that liberates 1μmole of

ammonia under optimal assay conditions. Enzyme yield was expressed as the activity of L-

asparaginase per gram dry substrate (U/ml). Colour developed was read after 10-15 min at

450 nm in a UV-Visible spectrophotometer.

Estimation of proteins: The protein content of the enzyme was determined by Lowry’ s

method [5]. The amount of protein mg/g or 100g sample was obtained.O.D was taken at

660nm.

Effect of carbon source: To determine the effect of carbon sources on enzyme yield,

different carbon sources were tested. Glucose, mannitol, maltose, lactose and xylan were

added separately to the production medium (PDA) as a carbon source KH2PO4, MgSO4,

CuSO4, FeSO4, MnSO4, ZnSO4 and yeast extract were added to the media as

microelements.pH of the media was adjusted to 6 prior to sterilization. Enzyme activity was

checked at OD 400 nm. Mycelial dry weight was taken.

Effect of nitrogen source: In thesynthetic medium along with glucose, NH4Cl, NH4NO3,

CH4N2O, peptone, (NH4)2SO4, NH4H2PO4 were added.KH2PO4, MgSO4, CuSO4, FeSO4,

MnSO4, ZnSO4 were added to the media as microelements.pH of the media was adjusted to 6

prior to sterilization. Enzyme activity was checked at 400 nm.



PURIFICATION OF ENZYME

Partial purification (acetone preparation): Acetone (66%) was added to the crude enzyme

extract. The precipitate was collected by centrifugation, dissolved in the minimal volume of

20 mM buffer (pH7). Decant and properly dispose of the supernatant, being careful not to

dislodge the protein pellet.

Dialysis: The partially purified enzyme was dialyzed overnight against 5mM phosphate

buffer of pH 7at 4° C.

DEAE- cellulose chromatography: The enzyme solution obtained in the above step was

applied to DEAE-cellulose column pre equilibrated with phosphate buffer (pH 7). The

enzyme was eluted with the same buffer. At each step of purification, enzyme activity and

amount of protein was estimated.

SDS-PAGE (SDS-polyacrylamide gel electrophoresis): SDS-PAGE was performed with

25mM tris/192mM glycerin buffer (pH8.3) that contained 0.1 %(w/v) SDS as the running

buffer.

Standard marker as protein: The commercially available standard proteins were prepared

at a concentration of 1mg/ml. The standard markers used were bovine serum albumin and

lysozyme.

Effect of different substrates on enzyme production: Different substrates like coconut coir,

paddy straw and saw dust were used to check the enzyme activity and production. 1g of each

of the coir,paddy straw and saw dust was added to the production media (Potato Dextrose

Broth), incubated for a week and the following enzyme assay was carried out.

Determination of reducing sugars and cellulase activity: The total amount of reducing

sugars in 1.0ml supernatant was determined by modified Dinitro salicylic method (DNS)

Dinitrosalicyclic method (DNS): The culture filtrate was collected from the fermentation

media by centrifugation. 1 ml of culture filtrate was taken in a test tube and it was equalized

with 2ml of distilled water. To the prepared culture filtrate, 3 ml of DNS reagent was added.

The contents in the test tubes were heated in a boiling water bath for 5 min. After heating, the



contents were allowed to cool at room temperature. At the time of cooling, 7 ml of freshly

prepared 40% sodium potassium tartarate solution was added. After cooling, the samples

were read at 540 nm in a U.V. spectrophotometer. The amount of reducing sugar was

determined using a standard graph.

RESULT AND DISCUSSION

Maintenance of pure culture: Aspergillus niger was cultivated on potato dextrose agar and

the spores were stored for longer period for the utilization of the organism in different trials

[Fig .1].

Fig. 1: Maintenance of pure culture

IDENTIFICATION OF THE FUNGUS

Growth pattern: Colonies were seen as perfectly round to oval to irregular in shape. On the

10th day mature colonies with spores were seen as structures in the form of numerous black

dots. The elevation of colonyappeared as raised. The colony margin was entire to undulate.

Reverse of petriplate was white to paleyellow and growth produced radial fissures in the agar.

Selection of Production medium: Aspergillus niger was cultured in three different

production media for a week like Czapeks dextrose medium (CDM) and sabourad’s dextrose

agar(SDA) and potato dextrose broth(PDA). PDA proved to be the best media for mycelial

growth. PDA found to be most suitable for heavy sporulation and PDA was selected on the

basis of mycelial weight and dry biomass weight



Optimum day: Maximum activity was seen on the fourth day and Potato Dextrose Broth was

chosen as the production medium for the subsequent experiments. Activity of the crude

enzyme was measured using L-asparagine as a substrate and the absorbance was monitored at

445 nm [Table 1, Fig.2].

Table 1: Optimum day for substrate concentration

Period of Cultivation(days) Mycelial dry weight Enzyme activity(U/ml)

Day 1 61.5 mg 26.1Day 2 80 mg 36.5Day 3 110 mg 55.06Day 4 250 mg 60.13Day 5 475.1 mg 32.5Day 6 88.4 mg 24.7Day 7 20.4 mg 12.6

Fig. 2: Figure showing the period of cultivation

L- asparaginase rapid plate assay: Asparaginase activity was identified by the formation of

a pink zone [Fig. 3] around colonies on the modified M9 agar medium using phenol red as an

indicator.

0

10

20

30

40

50

60

70

Day 1 Day 2 Day 3 Day 4 Day 5 Day 6 Day 7

ENZY

ME

ACTI

VITY

(U/m

l)

PERIOD OF CULTIVATION(DAYS)

Mycelial dry weight

Enzyme activity(U/ml)



Fig. 3: Modified medium showing the pink colonies

L- asparaginase activity [4] is the amount of enzyme which liberates 1μ mole of

ammonia per minute under assay conditions and was found to be 8.416 U/ml.

Protein: The amount of protein present in crude enzyme filtrate obtained from production

medium was estimated. The amount of protein present in crude enzyme from production

media was found to be 52μg/ml.

Effect of various Carbon sources

Baskar and Renganathan (2011) reported that glucose was found to be best carbon

source for maximum L-asparaginase production using modified czapek-dox media containing

soya bean flour. Chankya and Pallem (2011) reported that Aspergillus tamarri exhibited

maximum activity using glucose as carbon source. In the present study the effect of different

carbon sources like glucose, mannitol, maltose, lactose and xylan on enzyme production were

estimated, the enzyme activity was found to be highest in maltose which is 29.562U/ml and

the mycelial dry weight was highest in lactose which is 0.786 gm [Table2].



Table 2: Effect of different carbon sources on enzyme production

CARBON SOURCEBIOMASS DRY WEIGHT

(gm)ENZYME

ACTIVITY(U/ml)XYLAN 0.620 26.943

MALTOSE 0.752 29.562GLUCOSE 0.721 28.187

MANNITOL 0.752 14.940LACTOSE 0.786 18.560

EFFECT OF NITROGEN SOURCES

Gaffar and Shethna, (1977) observed the positive effect of [9] supplementation of

ammonium sulphate in the production of L-asparaginase has reported that ammonium

sulphateexhibited the maximum production of asparaginase enzyme. In the present study, the

effect of different nitrogen sources like NH4Cl, NH4NO3, CH4N2O, peptone, (NH4)2SO4,

NH4H2PO4 were added. KH2PO4, MgSO4, CuSO4, FeSO4and MnSO4 were added as the

microelements to the media and the enzyme production was studied, the enzyme activity was

found to be highest in peptone which is 28.396U/ml [Table3].

Table 3: Effect of different nitrogen sources on enzyme production

NITROGEN SOURCEBIOMASS DRY WEIGHT(gm)

ENZYME ACTIVITY(U/ml)

Ammonium nitrate 0.622 17.394Ammonium dihydrogen

phosphate0.778 25.722

Sodium nitrate 0.742 17.575Peptone 0.667 28.396

Urea 0.589 13.312Diammoniumsulphate 0.915 28.154Ammonium chloride 0.782 24.842

Enzyme purification: Enzyme was purified from the culture plates using acetone

precipitation, dialysis and DEAE-column chromatography

Table 4: Enzyme activity after different purification steps

Sample Concentration of proteinEnzyme activity

(U/ml)Crude extract 0.52 11.002After dialysis 0.4 10.99

After ionexchange chromatography 0.04 5.981



Table 5: Enzyme activity after acetone precipitation

O.DEnzyme activity after acetone

precipitation(U/ml)400 6.282450 6.436500 4.455550 4.224600 4.994

SDS PAGE

Dhanam Jayam (2013) reported that molecular weight of L-asparagine was 42 kDa. In

the present study we got the molecular weight of L-asparaginase as 54 kDa and 55 kDa.

[Table 6] and [Fig.4].

Fig. 4: Protein profile of L- asparaginase

Table 6: Gel profiles of SDS-PAGE

Lane 1 54 kDaLane 2 55 kDa

EFFECT OF SUBSTRATES

Cellulase Assay

Muniswaram et al., (1994) used banana stalk and coconut coir for production of

cellulases [12] reported the higher enzyme yield using different ratios of rice straw and wheat

bran using Aspergillus sp. In the present study, the cellulase activity was found to be more in

coconut coir (104.50U/ml) and paddy straw(108.60U/ml) as compared to saw dust [Table 7]



Table 7: Effect of different substrates on enzyme production

AGRO WASTES ENZYME ACTIVITY(U/ml)

Coconut coir 104.507Saw dust 18.300

Paddy straw 108.600

CONCLUSION

The observation made in this work holds a great promise for production of L-

asparaginase enzyme. It proves that Aspergillus niger is a potent strain for the L-

asparaginase production and the studies also revealed that different types of culture media

differentially influenced the growth, colony, character and sporulation of the fungi. Out of the

three test media (CDM, SDA and PDA), PDA was found to be suitable for highest

sporulation and the maximum growth was seen on day 4th (optimum day) and optimization of

fermentation parameters, carbon source, nitrogen source. Maltose as carbon source showed

maximum enzyme activity, whereas among nitrogen sources peptone proved to be suitable

for maximum activity of enzyme. Substrates such as coconut coir, paddy straw showed

maximum enzyme activity as compared to saw dust.

REFERENCES

1. Wang Nam, Sum , Enzyme purification by ammonium sulphate precipitation, Department

of chemical engg Unit of Maryland Park MD, 2074-2111,2005

2. A Saha, P Mandal,S Dasgupta,D Saha , Influence of culture media and environmental

factors on mycelial growth and sporulation of Lasiodiplodiatheobromae (pat.). Griffon

and Maubl. Journal Of Environmental Biology, 29(3) 407-410,2008

3. G Immanuel ,R Dhanusa,P Prema, A Palavesam Effect of different growth parameters on

endoglucanase enzyme activity by bacteria isolated from coir retting effluents of estuarine

environment. Int. J.Environ.Sci.Tech., 3 (1): 25-34,2006

4. S Imada,K Igarasi, Nakahama and M Isono, .Asparaginase and Glutaminase Activities of

Microorganisms, Journal Genetics Microbiology, 76(1): 85-99,1973.

5. OH Lowry ,HJ Rosenbrough,AL Faar and R Randall,Protein measurement with the

Folinphenol reagent. J. Biol. Chem., (193), 265-275, 1951.



6. G Baskar,SRenganathan , Design of experiments and artificial neural network linked

genetic algorithm for modelling and optimization of L-asparaginase production by

Aspergillusterreus MTCC 1782. Biotechnology and Bioprocess Engineering.,(16): 50-

58,2011.

7. Chanakya Pallem,V Nagarjun, and M Srikanth, Production of a tumor inhibitory enzyme,

L-asparaginase through solid state fermentation using Fusariumoxysporum, International

Journal of Pharmaceutical Sciences Review and Research., 7(2), 189-192,2011.

8. SA Gaffar,YIShethn , Purification and some biological properties of Asparaginasefrom

Azotobactervinelandii, Appl Environ Microbiol., 33:508–514,1977.

9. V Sreenivasulu,KN Jayaveera and PRaoMallikarjuna, Optimization of process parameters

for the production of L-asparaginase from an isolated fungus, Research J. Pharmacognosy

and Phytochemistry.,1(1), 30-34,2009.

10. G DhanamJayam and S Kannan ,Deparment of Environmental studies,L-asparaginase-

Types, Perspectives and Applications,Review Article,Advanced Biotech.,2013.

11. Muniswaran, PitchaiveluSelvakumar and CharyuluNarasimha NCL, Production of

cellulasesfrom coconut coir pith in solid state fermentationTechnology and

Biotechnology.,Vol 60, Issue 2, pages 147–151,1994.

12. S W Kang ,YS Park , JS Lee ,SI Hong and SW Kim,Bioresource Technology., 91, 153–

156,2004



ISOLATION OF ANTIBIOTIC PRODUCING ACTINOMYCETESFROM SOIL, PURIFICATION AND CHARACTERISATION

Gagana.B, Jenitta Emima Packiyam E*,Ragunathan R1.

Department of Post Graduate Studies and Research in Biotechnology

Alva’s College, Moodbidri – 574 227, Karnataka, India

.1SynkroMax Biotech Private Limited, Chennai.

*Corrsponding author

E- mail: [email protected]

ABSTRACT

Today more than 30,000 diseases are clinically described, less than one third of the diseases can be treated symptomatically and only a few can be cured. Actinomycete is a potential produces of many antibiotics. Antibiotics are the secondary metabolites, the type of antimicrobial used specifically against bacteria are often used in the treatment of bacterial infections. They may either kill or inhibit the growth of bacteria and few are active against fungi, protozoan and are toxic to human and animals. In the present study antibiotics were produced from actinomycetes, isolated from Western Ghats soil. The arecanut husk was used as the supplement for the media preparation. The amount of product obtained was high compared to the normal production media used. The crude antibiotics were then purified by using dialysis membrane and the quality of the product was checked by UV spectrophotometer and FTIR. The antibiotics are made to be produced and are tested against different bacterial species like Staphylococcus, Bacillus., Pseudomonas, Klebsiella, Salmonella, Streptococcus, and E. coli strain – 1,2,3 by well diffusion method. The antibiotics produced using Actinomycets exhibited good inhibition for E. coli strain 1 and 2.

INTRODUCTION

Actinomycetes are the most economically and important valuable prokaryotes able to

produce wide range of bioactive compounds and enzymes. The majority of actinomycetes are

free living, saprophytic bacteria found widely distributed in soil [1] water and colonizing

plants. Actinomycetes population has been identified as one of the major group of soil

population, which may vary with the soil type. They cover around 80% of total antibiotic

product [2] with other genera trailing numerically. Due to large geographic variation, there is

large variation in soil type and their contents in Tamil Nadu and hence it is quite likely that

the distribution of antibiotic producing, Actionmycete is also vary [3]. Several distinct

antibiotics have now been isolated from cultures of Actinomycetes. Some of the antibiotics

are produced in simple synthetic media; others are formed in complex organic substrates; still

others, like streptomycin, require the presence in the medium of a specific nutritive

substance, an “activity factor,” which is either a precursor or a prosthetic group of an enzyme



system essential for the production of the antibiotics agent [4]. It has now been definitely

established that a considerable proportion of all actinomycetes that can be isolated from soils

or other natural substrates have the capacity of inhibiting the growth of, and even of

destroying, bacteria and other microorganism. This was brought out emphatically in several

of the surveys that have been made on the distribution of antagonistic properties among

actinomycete [5-7].The selective antimicrobial activities of Actinomycete differ greatly, both

quantitatively and qualitatively [8], as could easily be demonstrated by their respective

antibiotic spectra. The nature of the active agents or the antibiotics produced by these

organisms depends upon the species; frequently upon the strain; the composition of the

medium in which it is grown, and the conditions of cultivation [9].The Actinomycetes are

Gram positive bacteria having high G+C (>55%) content in their DNA [10]. The present

study was aimed at isolating antibiotics from Actinomycetes capable of acting on clinically

resistant strains of infectious organisms and evaluates its antimicrobial activities.

MATERIALS AND METHOD

Soil samples: Soil samples were collected by sterile method from Echanar, Tamil Nadu,

India. Soil samples were air dried under room temperature for 2 weeks before isolation.

Isolation of Actinomycetes producing antimicrobial compound: One gram of soil samples

was suspended in 100ml sterile distilled water,and then homogenized by vortex mixing.

Mixtures were allowed to settle and serial tenfold dilutions up to 10-4 were prepared by using

sterile distilled water , isolation was carried out on actinomycetes isolation agar plates (in

duplicate) by spreading . The plates were incubated at 250C for 7 days. Actinomycetes

colonies were recognized on basis of morphological characteristics by Gram’s staining

method.

Identification of Actinomycetes: The morphological and cultural characteristics of the

Actinomycetes were determined by naked eyes examination of 7th, 14th and21thday’s old

cultures grown on selective media.

Production of antimicrobial compound using starch casein broth: Isolated colonies were

transferred from actinomycetes isolation agar medium into starch agar medium, pH 7.2 and

incubated at 280C for 3 days. Coloration of aerial mycelium (on the surface of agar), substrate

mycelium (underside of plate) and diffusible pigment were observed.



Arecanut husk as substrate for antibiotics production: One gram of dried arecanut husk

was powdered and added along with starch casein 0.25g, NaCl 0.25g, MgSO4 0.1g, KH2PO4

0.1g and H2O 50ml. The flask was inoculated with actinomycetes and was kept in shaker for

3 days at 120rpm. At the end of the fermentation period, the content of each flask was

centrifuged at 10,000 rpm for 5 min at 4oC. The supernatant was used as a source of enzyme

and analyzed for enzyme activity.

Extraction of antimicrobial compound using different solvents: Broth was taken and

centrifuged at 10,000rpm for 20 min to separate the mycelia biomass; the supernatant was

obtained and separated by filtration using what man filter paper. Certain solvents used for

extraction of antimicrobial compound like butanol, ethyl acetate (1:1) ratio. Supernatant

mixture was agitated for 1hour with homogenizer and the solvent was separated by separating

funnel. All extracts obtained through this method were assayed for antimicrobial study

against different microbes.

Test microorganisms used for antimicrobial activity: The bacterial cultures used during

the study includes Staphylococcus, Bacillus, Pseudomonas, Klebsiella, Salmonella,

Streptococcus and E. coli strain 1,2,3. The organisms were cultured and maintained in the

nutrient agar media.

Purification of antibacterial compound:Purification of the compound was performed using

Column chromatography using sephadox gel by dialysis membrane.

Identification of antimicrobial compound:The structure elucidation of the compound was

performed by using UV-FTIR.

PCR amplification:PCR was carried out in 50ml volumes containing 2mM MgCl2 , 2U Taq

polymerase (JMR holdings, USA), 150mM of each dNTP, 0.5mM of each primer and 2ml

template DNA. Primer F1 (59-AGAGTTTGATCITGGCTCAG-39; I=inosine) and primer R5

(59-ACGGITACCTTGTTACGACTT-39) were modified from primers Weisburget al.

(1991). Primer F1 binds to base position 7-26 and primer R5 to base positions of the 16S r

RNA gene of Streptomyces the PCR programmer used was an initial denaturation (960C for 2

mins) , 30 cycles of denaturation (960C for 45sec), annealing (560C for 30sec) and extension



(720C for 2 mins), and a final extension (720C for 5 minutes). The PCR products were

electrophoresed on 1% agarosegels, containing ethidium bromide (10 mg/ml), to ensure that a

fragment of the correct size had been amplified.

Restriction endonuclease digestions and analysis: PCR amplified DNA for PDS 1 a digestion

was purified using the PCR purification kit (qiagen). No pre-treatment of the DNA was

required for the other restriction endonucleases. Restriction digestions were incubated at 370C

for 3-4 hr. Samples were electrophoresed on 15% agarose gels containing ethidium bromide

(10mg/ ml). The restriction fragment patterns were compared manually with those from the in

silico restriction end nuclease digestions.

RESULTS

Actinomycetes were isolated from the soil sample on a selective media. A pinpointed

colony with zone of inhibition was observed [Fig.1]. The presence of relatively large

populations of Actinomycetes in the soil sample indicated their sources in the tropical

ecosystem.

Fig.1: Actinomycete colonies in plates containing selective media

Production and purification of antimicrobial compound: Actinomycetes isolated from

selective media was subjected to the extraction of antimicrobial compound. The extract

obtained through this method [Fig. 2] was further used for antimicrobial study against

different microbes.After purification of the antimicrobial compound using column

chromatography and dialysis membrane, yellow brown powder was obtained which showed

good antibacterial activity [Fig. 3].



Fig. 2: Separation of solvent Fig. 3: Extraction of antimicrobial compound

Zone of inhibition against different microbes by the antibacterial compound: The

antibacterial activity was checked by the antimicrobial compound obtained against some

Gram positive and Gram negative microbial species like Staphylococcus, Bacillus,

Pseudomonas, Klebsiella, Salmonella, Streptococcus, E. coli strain 1,2,3. Of these, E. coli

strain 1 and 2 showed good antibacterial activity against the antimicrobial compound

produced [Fig. 4].

Fig. 4: Zone of inhibition by the antimicrobial compound

Structural analysis of antimicrobial compound: Structural elucidation of the compound

was of the compound was performed by using UV, FTIR . The absorpyion maxima {λ max}

of antimicrobial compound was found at 370nm [ Fig. 6]. The IR spectra revealed the

presence of OH group, presence of aromatic ring and presence of NH2 group.



Fig. 6: I.R Spectra of antimicrobial compound

Molecular identification and gene sequencing: The genomic DNA used for PCR was

prepared from the single colony grown on malt extract agar media. The 16s rRNA gene

fragments was amplified using universal primers. The molecular weight of the product was

484 kDafurther it was submitted to gene bank database. The alignment of the nucleotide

sequence of 238 bp of strain matching with 16s rDNA reported gene sequence in the gene

bank using the NCBI blast available at the website compared with the sequence of the

reference species of the bacteria content in the genomic data base bank exhibited a similarity

level ranged from 98.37% with Streptomyces having the closest match the phylogenic tree

obtained by applying the neighbor-joining method.

STREPTOMYCES SP.

GCAGTCGAACGATGAAGCCTTTCGGGGTGGATTAGTGGCGAACGGGTGAGTAAC

ACGTGGGCAATCTGCCCTTCACTCAAG



TGGGACAAGCCCTGGAAACGGGGTCTAATACCGGATAACACTCTGTCCCGCATG

GGACGGGGTTAAAAGCTCCGGCGTTAAGG

GTGAAGGATGAGCCCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCTACCAA

GGCGACGACGGGTAGCCGGCCTGACGCTA

GAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGC

AGCAGTGGGGAATATTGCACAATGGGCGA

AAGCCTGATGCAGCGACGCCGCGTGAGGGATGACCCCGCATGGGACGGGGTTAA

AAGCGCCTGATGCAGCGACGCCGCGTGATGTC

CONCLUSION

The Actinomycetes were isolated from soil sample and the production of antibacterial

compound was carried out by using production media, which showed antibacterial activity

against Gram positive and Gram negative bacteria. From this study it can be concluded that

antibacterial compound produced by Actinomycetes was Streptomyces sp.

REFERENCES

1. W De Boer, Living in a fungal world: impact of fungi on soil bacterial niche

development, FEMS Microbiology Reviews, 29(4), 95-811, 2005.

2. M G Watve, How many antibiotics are produced by genus Streptomyces. Arch Microb.,

386-90, 2001.

3. U C Borodulina, Interrelation between soil actinomycet and B. mycoides. Microbioogia

production of antibiotic substances by actinomycetes, 4: 561–586, 1935.

4. M Krassilnikov and A I Koreniako, The bactericidal substance of the actinomycetes.

Microbiologia production of antibiotic substances by actinomycetes, 8: 673–68, 1939.

5. M Nakhimovskaia, The antagonism between actinomycetes and soil bacteria,

Microbiology production of antibiotic substances by actinomycetes, 6: 131–157,1937.

6. S A E S Waksman Horning, M Welsch& H B Woodruff , Distribution of antagonistic

actinomycetes in nature production of antibiotic substances by actinomycetes. Soil Sci.,

54:281–296, 1942.

7. M Welsch, Bacteriostatic and bacteriolytic properties of actionmycetes. J. Bact.

production of antibiotic substances by actinomycetes, 44: 571–588,1942.



8. Padmadhas and R Ragunathan, Identification of novel Actinomycetes collected from

Western Ghats region of India, Journal of Pharmaceutical and Biomedical Sciences, 1-7,

2010.

9. Perez-Piqueres, Response of soil microbial communication to compost amendments, Soil

Biol. Biochem., 38, 460-470, 2006.

10. I Saadoun andR Gharaibeh, The Streptomyces flora of Badia region of Jordan and its

potential as a source of antibiotics active against antibiotic-resistant bacteria. J Arid

Enciron., 53, 365-71,2003



MICROBIAL PRODUCTION OF BIOSURFACTANTSPrarthana J.

Department of P.G. Studies & Research in Biotechnology

S.D.M. (Autonomous) College, Ujire-574 240

Karnataka, India

ABSTRACTBiosurfactant is a structurally diverse group of surface-active molecule, synthesized

by microorganisms, has the capability of reducing surface and interfacial tension with low toxicity and high specificity .They reduce surface and interfacial tension by accumulating at the interface of immiscible fluids and thus increase the solubility. The use of biosurfactant is a promising alternative over the chemical surfactant as they are better biodegradable and do not pollute the environment. In the present study, the soil sample from the oil spilled areas were collected serially diluted and screened for hydrocarbon degrading ability by growing on trace mineral salt solution with and without oil .Growth was recorded by measuring absorbance. Isolates were identified through Gram staining and biochemical test. Biosurfactant ability of microorganism was confirmed through oil spread assay, Drop collapse assay, Hydro carbon overlay method and emulsification assay. Nonpathogenic nature of isolates was confirmed through hemolytic assay.Keywords: Biosurfactant, isolates, oil spread assay, Drop collapse assay, Hydro carbon overlay method ,emulsification assay,hemolytic assay.

INTRODUCTION

Oil pollution caused by oil spills, accidental leakage is a major problem in coastal as

well as off shore and remediation technology has become a global phenomenon of increasing

importance [1,2]. Many synthetic surfactants which reduce surface and interfacial tension

between immiscible liquids are used to disperse oil and accelerate its mineralization [3]. But

almost all chemical surfactants are petroleum derived toxic substances nondegraded by micro

organisms. Hence a need for naturally occurring surface active substance produced by

microorganism is focus of study. Biosurfactants have received considerable attention in the

field of environmental remediation processes such as biodegradation, soil washing and soil

flushing. Biosurfactants influence these processes because of their efficacy as dispersion and

remediation agents and their environmentally friendly characteristics such as low toxicity and

high biodegradability [4-6]. Due to their unique properties and vast array of application,

identification of new biosurfactant producing microbes is in great demand. There are many

different screening methods that have been reported as criteria to screen biosurfactant

producing microbes such as hemolytic assay [9], hydro carbon overlay assay [12], blue agar

plate assay, drop collapse assay, oil spreading assay emulsification assay [11], .Among these

methods like hemolytic assays are not reliable and sensitive, because this method will



categorize microbes in two groups as hemolytic and non-hemolytic. Strains that are

hemolytic are believed to be biosurfactant producers, but there are other products such as

virulence factors that can lyse the blood cells and also biosurfactants with poor diffusion in

agar may not be able to lyse the blood cells. Thus, the results from hemolytic assay on blood

agar plate are not so reliable and sensitive. Remaining methods adapted for screening of

biosurfactant producing micro-organism were considerably good with reproducible results.


Sample collection: For the isolation of biosurfactant producing bacteria, the sample was

collected from petrol bunks, oil refineries in and around Ujire. The sample was taken in

sterile polythene bag and was taken to the laboratory and analyzed. Along with isolated

samples pure cultures of Bacillus sp. and Lactic Acid Bacteria were also taken for study.

Isolation and screening of biosurfactant producing organisms: The collected sample was

serially diluted and were grown aerobically in 500 ml Erlenmeyer flask with different

mineral salt medium containing (g l-1)Nazina media, Mc Inerney medium, Coopers medium,

Mukherjees medium etc with varying trace elements.Na2EDTA, MnSO4, FeSO4.7H2O,

CaCl2, CoCl2.6H2O, ZnSO4.7H2O, CuSO4.5H2O, H3BO3, Na2MoO4,KI. Initially grown

without oil and then same media with 1% crude oil. From this organisms were isolated and

identified using different preliminary techniques [13].

Identification of microorganisms: The isolated microorganisms were identified by Gram

staining and Biochemical Tests [5].The isolated colonies were tested for their biosurfactant

production by following methods

Blood Haemolysis Test: The fresh single colonies from the isolated cultures were taken and

streaked on Blood agar plates. The plates were incubated for 48-72 hours at 37 ºC. The

bacterial colonies were then observed for the presence of clear zone around the colonies. This

clear zone indicates the presence of biosurfactant producing organisms.

Oil spreading method: 20ml of distilled water was taken in the pertiplates. 10µl of used

crude oil was added to the centre of the plates containing distilled water. Now add 10μl of the



culture broth or supernatant of the cultures isolated from the soil sample to the centre. The

biosurfactant producing organism can displace the oil and spread in the water.

Drop collapse method: This assay relies on the destabilization of liquid droplets by

surfactants. Therefore, drops of a cell suspension or of culture supernatant are placed onan oil

coated, solid surface. If the liquid does not contain surfactants, the polar water molecules are

repelled from the hydrophobic surface and the drops remain stable. If the liquid contains

surfactants, the drops spread or even collapse because the force or interfacial tension between

the liquid drop and the hydrophobic surface is reduced. The stability of the liquid drop and

the hydrophobic surface isreduced. The stability of drops is dependent on surfactant

concentration and correlates with surface and interfacial tension.

Hydro carbon overlay method: Hydrocarbon overlay agar method was performed with

some modifications. Mineral agar plates [13] were coated individually with 100 μl of crude

oil. Plates were inoculated with isolates and incubated at 30ºC for 48–72hrs. Colony

surrounded by an emulsified halo was considered being positive for biosurfactant

production.

Emulsification Index: Emulsification activity was measured by vortexig 1 ml of culture

supernatant grown on Mineral salt solution at 280C for 24Hrs.Further 4 ml of water and 6 ml

of crude oil for 2 minutes to otain maximum emulsification . After 48 Hrs emulsification

index was calculated by measuring height of emulsified layer (a) divided by total height

(b),multiplied by 100.

RESULTS AND DISCUSSION

In the present study three different soil samples were collected from oil spilled areas

s1:soil from petrol bunk, s2 :soil from oil mill,s3 petrol bunk of in and Ujire place. These soil

samples were serially diluted & inoculated with different hydrocarbon media containing

(Nazina,Mc Inergney,Coopers ,Mukherjees ) trace elements (Table 1). All isolates showed

maximum growth on Mc medium .The isolates were identified through Gram staining and

recorded as s1: Gram positive Cocci(G+C),s2:Gram positive Rod(G+R),s3:Gram positive

Rod(G+R),Pure cultures of Bacillus sp. and Lactic Acid Bacteria (LAB) (Table 3). Since

maximum growth was seen in Mc Inergneg medium , this medium was used with 1% oil as a



sole of carbon, here different isolates showed varied growth (Table 2). Isolates were then

subjected to several screening methods ,like oil spreading assay, the measurement clear zone

on the oil surface was measured(Table 4), in drop collapse assay, increase in the surface area

of the broth containing biosurfactant over the oil coated surface was measured(Table 5). In

hydro carbon overlay assay, bacterial growth on the oil coated surface of mineral salt solution

agar indicating a zone of halo around the streaked surface was recorded as positive (Fig. 2).

Emulsification index(Table 6) and Blood agar Hemolysis test (Fig. 1) were done to confirm

biosurfactant production.From the present study it was found that all isolates had the ability

to degrade oil by producing biosurfactant but,amount of biosurfactant production is seen

considerably high in soil sample S3 which is identified as Gram positive rod.

Table1: Growth of isolates on Mineral salt solution(Trace elements)

Sl.No Samples Isolates NazinaMc

InergneyCoopers Mukherjee

01 Soil 1 G+C 0.06 0.23 0.06 0.0502 Soil 2 G+R 0.05 0.22 0.05 0.0303 Soil 3 G+R 0.06 0.26 0.03 0.01

04Bacillus

spG+R 0.01 0.29 0.03 0.03

05 LAB G+R 0.01 0.29 0.02 0.01

Table: 2 Growth of isolates on Mc Inergney medium with and with out oil

Sl.No Isolates Without oil With oil

01 G+C 0.23 0.802 G+R 0.22 0.7403 G+R 0.26 0.8604 G+R 0.29 0.7905 G+R 0.29 0.76

Table: 3 Identification of micro organism

Sl.No SamplesGram

stainingBiochemical test

MR VP I CUT01 Soil 1 G+C +++ +++ ++ ++02 Soil 2 G+R +++ +++ ++ ++03 Soil 3 G+R +++ ++ +++ ++

04Bacillus

spG+R +++ +++ +++ ++

05 LAB G+R +++ +++ +++ ++



Fig.1: Blood Haemolysis Test

Table: 4 Oil spreading method

Bacterial Culture Culture SupernatantS1 S2 S3 Bac LAB S1 S2 S3 Bac LAB

Initial Measurement of oil surface in (mm)

7 7 7 7 7 7 6.5 7 7 6

Measurement of oil surface after addition of

samples(mm)4 5 5 5 5 3 4 5 4 6

Table 5: Drop collapse method

Bacterial Culture Culture SupernatantS1 S2 S3 Bac LAB S1 S2 S3 Bac LAB

Measurement of water drop size on oil coated

surface in (mm)0.4 0.4 0.5 0.4 0.4 0.8 0.8 1 0.9 1

Measurement of sample drop size on oil

coated surface (mm)0.5 0.4 0.5 0.4 0.4 1 1 1.1 1 1



Fig. 2: Hydro carbon overlay method

Table 6: Emulsification Index

Emulsification Index(%)S1 S2 S3 Bac LAB

Bacterial Culture 47.6 48.5 48.0 45 45Culture Supernatant 52.38 43.56 56 53.33 53

ACKNOWLEDGEMENTS

The author is greatful to UGC for finansial assistance, also would like extent thanks to

the Managements of Shri Dharmasthala Manjunatheshwara College (Autonomous), Ujire

for laboratory ambience.

REFERENCES

1. L Caprino, GJ Togna, Potential health effects of gasoline and its constituents.

Environmental Health Perspectives. V.106, p. 115–125,1998.

2. V.S Millioli, E.L.C Servulo, L.G.S Sobral,D. D de Carvalho, Bioremediation of crude oil-

bearing soil: evaluating the effect of rhamnolipid addition to soil toxicity and to crude oil

biodegradation efficiency.,Global NEST Journal, V. 11, p. 181-188,2009.

3. I. M Banat,“Biosurfactants Productionand Possible Uses in Microbial-En-hanced Oil

Recovery and Oil PollutionRemediation: A Review.”Bioresource Technology, 51, 1-12,

1995a.

4. A.Fiechter, Biosurfactants moving towards industrial applications, Trends Biotechnol 10,

208-217,1992.

5. J Desai ,Microbial surfactants: Evaluation types, production & future application.Jsci Ind

Res.,, 46,440-449,1987.



6. K Hanson , G Nigan, A. Kapadia, M. Desai Bioremidiation of crude oil contamination

with Acinetobacter sp A3. Curr Microbial., 35,191-197,1997.

7. AABodour&RM Maier, Biosurfactants :Types ,screening methods and application in

encyclopedia of environmental microbiology.Edited by G. Bitton (ed),1st ed.(John

Willey) & Sons, Inc., Hoboken, New Jersy, 750-770, 2007.

8. AA Bodour and R Miller Maier ,Application of modified drop collapse technique for

surfactant quantitation and screening of biosurfactant producing microorganism, J

Microbial methods, 32, 273-280,1998.

9. PG carrillo ,C Mardaraz ,SI Pitta Alvarez and AM Giuliett ,Isolation & selection of

Biosurfactant producing bacteria, J Microbial biotechnol., 12 , 82-84,1996.

10. M Morikania Y,Hirata &T,A Imanaka, study on the structure and function relationship of

lipopeptide biosurfactants, Biochem Biophysics Acta ,1488,211-218,2000.

11. P Ellaiar, T Prabhakar, M Sreekanth, AT Taleb, Production of glycolip containing

biosurfactant by Pseudomonas sp. Indian J, Exp Biol 40,1083-1086,2002.

12. M Morikawa and T Imanaka, Isolation of a new surfactin producer Bacillus pumilus A-1

and cloning nucleotide sequence of regulator gene, pst-1,J Ferm Bioengg.,74, 255-

261,1992.

13. YM Alwahaibi, Screening of mineral salt media for biosurfactant production by Bacillus

sp. Int J. Env Ecological Geological Mining Eng.,8(2), 2014.



DEGRADATION OF PETROLEUM BY MICROORGANISMSISOLATED FROM SOIL CONTAMINATED WITH PETROL AND ITS

BY-PRODUCTS

Usha P., Rama Bhat P*., Prajna P.S., Shrinidhi Shetty, Jayadev K. and Jenitta E.

PG Dept. of Biotechnology, Alva’s College, Moodbidri – 574 227, Karnataka, India

*Coresponding author


ABSTRACT An experiment on the plausible role of petroleum degrading microorganisms in

degradation of petroleum and its bye-products was carried out by isolating microbes from petroleum contaminated soil from Moodbidri garage. The soil sample was sprinkled over the media and colonies formed in the culture were isolated and used for enrichment culture in minimal essential medium. Of the different species of bacteria and fungi isolated from by serial dilution technique and enrichment culture. One of the bacterial isolate frequently occurred and was when subjected to morphological and biochemical analysis showed negative reaction with Gram stain and positive result for catalase test. Among the he fungal diversity Penicillium spp. and yeast Candidaspecies were dominant and were later selected for enrichment studies. All isolates degraded petroleum that are provided in the minimal essential media as a carbon source. Fungi and yeast isolates were enriched by comparative study of their growth in different carbon source mainly dextrose, lactose, and fructose. It was found that Penicillium spp. was enriched in media containing fructose as carbon source whereas for yeast it was lactose where they showed maximum growth.

The present work on petroleum biodegradation is a rpeliminary work. Further extensive experiments in vitro and in vivo are necessary to know the role of specific strains of bacteria and fungi, on the degradation of various components of petroleum products in the location by individual or in groups of microorganisms as well as their characterizations.

INTRODUCTION

Petroleum-based products are the major source of energy for industry and daily life.

Leaks and accidental spills occur regularly during the exploration, production, refining,

transport, and storage of petroleum and petroleum products. The amount of natural crude oil

seepage was estimated to be 600,000 metric tons per year with a range of uncertainty of

200,000 metric tons per year [1]. Release of hydrocarbons into the environment whether

accidentally or due to human activities is a main cause of water and soil pollution [2]. Soil

contamination with hydrocarbons causes extensive damage of local system since accumulation

of pollutants in animals and plant tissue may cause death or mutations [3]. The technology

commonly used for the soil remediation includes mechanical, burying, evaporation,

dispersion, and washing. However, these technologies are expensive and can lead to

incomplete decomposition of contaminants.



Petroleum hydrocarbons are some of the most widely distributed pollutants resulting

from oil exploration, spills, tankers, ballast water, fuels, mechanic sites and garages [4]. Oil

pollution can cause severe effects on the environment and human health. The presence of

these pollutants in the terrestrial and aquatic environments constitutes health problems and

socioeconomic hazards [5]. Apart from this, used engine oil renders the environment unsightly

and constitutes a potential threat to humans, animals and vegetation [6].

Contaminants can absorb to soil particles, rendering some contaminants unavailable to

microorganisms for biodegradation. Thus, in some circumstances, bioavailability of

contaminants depends not only on the nature of the contaminant but also on soil type.

Hydrophobic contaminants, like petroleum hydrocarbons, have low solubility in water and

tend to adsorb strongly in soil with high organic matter content. In such cases, surfactants are

utilized as part of the bioremediation process to increase solubility and mobility of these

contaminants. The existence of thermophilic bacteria in cool soil also suggests that high

temperatures enhance the rate of biodegradation by increasing the bioavailability of

contaminants [7].

Automobile workshops are an important component of the service sector industry.

The most significant environmental impact associated with the existing workshops is the

seepage of used engine oil and washed water into the soil. Contamination of the soil by oil

causes it to lose its useful properties such as fertility, water-holding capacity, permeability

and binding capacity [8].Petroleum pollutants also contaminate inland water bodies and the

terrestrial ecosystems. Evaporation and biodegradation of petroleum hydrocarbons is mainly

a microbiological process. The ability of the microorganisms to utilize hydrocarbons has

been known since 1800s.

Hydrocarbons in the environment are biodegraded primarily by bacteria, yeast, and

fungi. The reported efficiency of biodegradation ranged from 6% [9] to 82% [10] for soil

fungi, 0.13% [9] to 50% [10] for soil bacteria, and 0.003% [11] to 100% [12] for marine

bacteria. Many scientists reported that mixed populations with overall broad enzymatic

capacities are required to degrade complex mixtures of hydrocarbons such as crude oil in soil

[13], fresh water [14], and marine environments [15, 16].



Fungal genera, namely, Amorphoteca, Neosartorya, Talaromyces, and Graphium and

yeast genera, namely, Candida, Yarrowia, andPichia were isolated from petroleum-

contaminated soil and proved to be the potential organisms for hydrocarbon degradation [17].

Singh [18] also reported a group of terrestrial fungi, namely, Aspergillus, Cephalosporium,

and Pencillium which were also found to be the potential degrader of crude oil hydrocarbons.

The yeast species, namely, Candida lipolytica, Rhodotorula mucilaginosa, Geotrichum sp, and

Trichosporon mucoides isolated from contaminated water were noted to degrade petroleum

compounds [19].

The ability to utilize hydrocarbons is not restricted to a few microbial species. It was

stated that nearly 100 species of bacteria. Yeast and molds has been shown to be endowed

with the ability to attack hydrocarbons. Based on the above view a preliminary research work

is carried out with the following objectives:

To isolate and identify the petroleum degrading microorganisms from the soil sample

collected from near by garage.

To prepare pure culture of selected micro-organisms and to characterize.

To study petroleum degradation in vitro by enrichment experiments.

MATERIAL AND METHODS

A study on plausible role of petroleum degraders in degrading petroleum and its by-

products was conducted at Department of Biotechnology, Alva’s College, Moodbidri.

Petroleum degraders were isolated from the soil sample contaminated with petroleum and

other by-products. The soil samples were collected from in and around garage at Moodbidri,

Karnataka where usually soil is contaminated with petroleum and their by-products. Four

soil samples were collected randomly from different location namely A,B,C and D within the

local area and were brought to the laboratory and incubated for three days.

The petroleum degraders were isolated from the soil by serial dilution and plating

technique (20). For the isolation of bacteria nutrient medium and for fungi PDA medium

were used. In serial dilution method, five gram of the soil sample was suspended in 40ml of

sterile distilled water. The resulting dilution was serially diluted to 102, 103, 104 and 105 by

pipetting one ml of aliquots in to 9 ml of sterile distilled water. Finally one ml of aliquots was

added to sterile Petri dishes to which about 15 ml of cool molten medium was added and



rotated in clockwise and anticlockwise direction, after solidification the plates were incubated

in an inverted position for seven days at 25+20C. For each dilution four replicates were made.

Finally 103 dilution was found to be ideal for culture and isolation.

The media used in plating technique above is a minimal media containing petroleum

as a carbon source and other components are:

NaNO3 2g

Agar 20g

KH2PO4 0.5g

MgSO4 0.5g

FeSO4 100mg

CaCO3 400mg

Distilled water 1000ml

Carbon source (Petrol) 2ml

After 7 days of incubation, the number of colonies developed on media are counted

in Petri plates obtained from four soil sample A, B, C andD.

Characterization of isolated bacteria: Bacteria were isolated from the incubated Petri

plates C and D and are characterized by conducting morphological and biochemical tests.

Morphological test:The bacterial isolates are tested for Gram’s reaction. In this technique

asmear of isolated bacterial culture was prepared on clean grease free glass slide and gram

staining were made and observed under oil immersion objective. Pink colored/purple cells

are observed indicating that isolated bacteria are Gram negative / positive.

BIOCHEMICAL TEST

Catalase test:Nutrient slants in which isolated bacteria is maintained from which using a

nichrome loop cells are picked up and are placed in the centre of glass slides to that one or

two drops of 3% H2O2 solution is added and observed for gas bubbles.



Isolation of fungi which are able to degrade petroleum and its by-products from soil:

The soil sample were collected from in and around garage at moodbidri where usually

soil in contaminated with petroleum and their byproducts four soil samples A, B, C and D

were collected from different location and were brought to the laboratory, then it is incubated

for three days.

The fungi and yeast are isolated by soil sprinkling method of in which about one gram

of soil sample was taken and was sprinkled over the dextrose agar media.

Composition of potato dextrose agar media

Potato Dextrose 200g

Dextrose 20 g

Agar 20 g

Distilled water 1000ml

The Petri plates were incubated at 25 + 2oC for 7 days. The colonies developed were

isolated and identified using standard manuals. These organisms were then tested whether

they are able to degrade petroleum by streaking on to selective media containing petrol as

carbon source.

ENRICHMENT OF ISOLATED MICROORGANISMS

Fungi: Isolated fungi is inoculated to different Petri plates each containing enrichment media

with different carbon sources as given in Table 1.

Table 1: Different enrichment media employed for the enumeration of fungi from soil

Media 1 Media 2 Media 3NaNO3 0.5g NaNO3 0.5g NaNO3 0.5gK2HPO4 1g K2HPO4 1g K2HPO4 1g

MgSO4 . 7H2O 0.5g MgSO4. 7H2O 0.5g MgSO4. 7H2O 0.5gKCl 0.5g KCl 0.5g Fe2 (SO4)3 TraceFe2 (SO4)3 Trace Fe2 (SO4)3 Trace Fructose 10 gLactose 10g Dextrose 10 g Agar 20 g

Agar 20gm Agar 20 g Distilled water 1000mlDistilled water 1000 ml Distilled water 1000 ml



The plates were incubated for 24 hour at 25+ 2oC radial growth is measured in each

plate as given below:

SL. No Carbon source used Diameter of colonies

12.3.

LactoseDextroseFructose

R1

R2

R3

Yeast: For the isolation of yeast three different enrichment media containing different carbon

source areshowed in table 2.

Table 2: Different enrichment media employed for the enumeration of yeast

Media 1 Media 2 Media 3

NaNO3 0.5g NaNO3 0.5g NaNO3 0.5gK2HPO4 1g K2HPO4 1g K2HPO4 1g

MgSO4 . 7H2O 0.5g MgSO4. 7H2O 0.5g MgSO4. 7H2O 0.5gKCl 0.5g KCl 0.5g Fe2 (SO4)3 TraceFe2 (SO4)3 Trace Fe2 (SO4)3 Trace Fructose 10 gLactose 10g Dextrose 10 g Distilled water 1000ml

Distilled water 1000 ml Distilled water 1000 ml

Incubated for 24 hr at 25+ 20. Then optical density of inoculated broth is measured at

660nm using colorimeter as follows:

SL. No Carbon source used Diameter of colonies

12.3.

LactoseFructoseDextrose

OD1

OD2

OD3

By observing the optical density the major carbon source for the growth of microbe in

the enrichment media is selected.

RESULTS

The results of different parameters used during the enumeration, biochemical and

enrichment studies of degradation of petroleum products by the microbes are presented.



Isolation of petroleum degraders: By serial dilution technique and enrichment culture

technique fungi including yeast and bacteria colonies were isolated from the soil sample

contaminated with petroleum product such as grease, oil, petrol collected from nearby garage

area. By studying its morphology the fungi was identified as Aspergillus, Curvularia,

Cylindrocarpon, Chlamydospore, Mucorand Penicillium spp.Yeast was identified as

Candida sp.

Characterization of bacterial isolates: Bacteria isolated from the minimal essential media

containing petroleum as a carbon source was subjected to biochemical characterization. The

study revealed that the isolated bacteria was positive for catalase test and negative reaction

for Gram staining indicating that it was Gram negative bacteria.

Colony characterization: Isolated bacteria were grown in minimal essential media

containing petroleum as carbon source upon incubation at 25 +2oC and after 24 hr observed

cream white 3 to 4 colonies of bacteria, which are then used for biochemical

characterization study It was found that Pseudomonas and Bacillus were dominant.

Characterization of isolated fungi and yeast: Fungi and a yeast- Candida sp. was isolated

from the soil sample. By using soil sprinkling method, the colony characterization,

morphology and fungi was found to be of Penicillium species. Enrichment of isolated fungi

by determining the carbon source mainly lactose, fructose and dextrose by observing the

radial colony growth. The maximum growth was recorded in medium containing fructose as

carbon source while minimum in lactose containing medium (Table 3). This is further clears

that fructose as carbon source supports the good growth of the isolated fungi (Fig. 1).

Table 3: Variation in the radial growth of microbes in enriched media

Carbon source Radial growth (cm)

Lactose 1.075Fructose 1.35Dextrose 1.325

Enrichment of isolated yeast: Enrichment of isolated yeast by determining the carbon

source mainly lactose, fructose and dextrose by observing the optical density. The maximum

optical density was recorded in medium containing lactose as carbon source while minimum



in dextrose containing medium (Table 4). This is further clears that lactose as carbon source

supports the good growth of the isolated fungi (Fig. 2). The growth of yeast and fungi in the

minimal and enriched media were showed in plates 1-4.

Table 4: Variation in the optical density of yeast culture in enriched media

Carbon source Blank Optical density at 660nm

Lactose 0 0.06Fructose 0 0.05Dextrose 0 0.03

Carbon Source

Fig. 1: Growth of fungal colony in the medium enriched with different carbon

sources -lactose, dextrose and fructose.

1.075

1.35 1.325

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

Lactose Fructose Dextrose

Centimeter



Carbon Source

Fig. 2: Variation in optical density (at 660 nm) of yeast culture in the medium

enriched with different carbon source - lactose, dextrose and fructose.

DISCUSSION

The degradation of aliphatic hydrocarbons understandably is associated with the

petroleum industry. Aliphatic hydrocarbons are the major components of crude oils and

petroleum products and much of the earlier research on biodegradation of these compounds

are born from ideas on the use of microbes for waste disposal form refineries and the

synthesis of petrochemicals and other industrial compounds. Because of markedly increased

exploration for oil and related energy sources, public attention has been directed to

environment effects of such as exploration, particularly with respect to potential

contamination of the environment by oil, since the first line of defense so to speak against oil

pollution in the environment is the microbial population, it becomes imperative to know

whether microbial degrades of oil are present in water and soil of the area to be

impacted.There are reportsavailable regarding degradation of petroleum and its other

products as well as inhabitant of microbes on petroleum polluted/contaminated soil [21, 22].

In the present study, soil samples collected from in and around the garage were culturedon

medium we found few isolates of bacteria comprising species of Bacillus sp. And

Pseudomonas sp. Among fungi Aspergillus, Curvularia, Cylindrocarpon, Chlamydospore,

Mucor and Penicillium spp. and yeast were isolated. Adams et al. [23] in their study on

bioremediation of automobile mechanic workshop contaminated with spent oils, known

0.060.05

0.03

0

0.01

0.02

0.03

0.04

0.05

0.06

0.07

Lactose Fructose Dextrose

Optical density



bacterial and fungal petroleum hydrocarbon degraders such as Bacillus sp., Staphylococcus

sp., Pseudomonas sp., Flavobacterium sp., Arthobacter sp., Enterobacter sp., Aspergilus sp,

Mucor sp., and Trichoderma sp. were identified in contaminated soil, poultry litter and cow

dung. There was an increase in the quantity of bacterial cells present as the quantity and

duration of treatment increased. This could be because of the simple reason that the growth

and proliferation of microbial cells depend on time and quantity of nutrients available. The

ability of some of the microbial species to utilize hydrocarbons as carbon source is limited to

about 100 species of bacteria, yeast and molds [24]. He also reported that representative

species of 30 microbial genera are able to attack one or more types of contaminated soils.

Both bacteria and fungi are heterotrophic in nature and related to a large number of

taxonomic genera which are capable of utilizing hydrocarbons as sources of energy and

carbon for their growth [25]. This is again supported by earlier few reports [26-29].Several

bacteria are even known to feed exclusively on hydrocarbons [30]. Floodgate [31] listed 25

genera of hydrocarbon degrading bacteria and 25 genera of hydrocarbon degrading fungi

which were isolated from marine environment. A similar compilation by Bartha and Bossert

[13] included 22 genera of bacteria and 31 genera of fungi. In earlier days, the extent to

which bacteria, yeast, and filamentous fungi participate in the biodegradation of petroleum

hydrocarbons was the subject of limited study, but appeared to be a function of the ecosystem

and local environmental conditions [31]. Crude petroleum oil from petroleum contaminated

soil from North East India was reported by Das and Mukherjee [32].

It was discovered that some important strains of Pseudomonas carry the genetic

information for the degradation of certain hydrocarbons on extra chromosomal DNA [33].

According to Zobell [24] all Kennels of gaseous and soil hydrocarbonaliphatic, aromatic

derivatives and naphthonic series appears to be susceptible to oxidant by micro-organisms.

In the present study the soil samples from garage were not analyzed for different components

of hydrocarbons. Even though the organisms isolated from these sample after

characterization were cultured on petrol containing minimal media, in which they flourished

well. Generally, the degradation of aliphatic hydrocarbons has been shown to be inducible.

Atlas [31] conducted an experiment degradation of petroleum hydrocarbons by

microorganisms by supplying varied concentrations of phosphorous nitrogen and physical

parameters like temperatures oxygen , salinity and found that each type organism survive at



different nutrition limits where they shows maximal rate of degradation. However, in the

present study minimal media supplemental with carbons sources like dextrose, fructose and

lactose showed varied number of colonies.

The microorganisms isolated from the petroleum polluted soil showed varied no

better growth are the minimal media supplemented with different carbon source and

petroleum application. Such reports were made by earlier works also with different groups of

bacteria and fungi [29, 34, 35].

Austin et al. (36) examined different strains of petroleum degrading bacteria isolated

from bay Wales and sediment by numericaltaxonomic procedure and obtained 85% similarity

level within different group, by comparing to this in the present study also different isolates

of bacteria and fungi including yeast were found in different locations from where the soil

samples were collected.

Petroleum biodegradation by available concentrations of nitrogen and phosphorus in

the soil sample or seawater are severely limiting to microbial hydrocarbon degradation.

Researchers examining the fate of large oil spills have thus properly concluded in many

cases. That concentration of N and P are limiting with respect to rate of hydrocarbon

biodegradation. In the present study estimation of N and P were not made even though

different medium were employed are adequateyl supplied in the medium.By considering the

limitations of nutrients to biodegradation of hydrocarbons are the sea the concept of nitrogen

demand has been established (Floodgate). It was found that concentration of 1 mg of nitrogen

and 0.07 mg of phosphorus per litre supports maximal degradation of crude oil in New Jersey

coastal sea water at a concentration of 8g of oil / litre (37).

Hydrocarbon degrading bacteria and fungi are widely distributed in marine, fresh

water and soil habitats. The use of silica gel as a solidifying agent has been shown to improve

the reliability of producers for enumerating hydrocarbon utilisers (38). The medium

containing 0.5% oil and 0.003% phenol red was best for enumerating petroleum degrading

microorganisms. They also found that addition of Amphotericin B permitted selective

utilization of hydrocarbon utilizing bacteria. It was found that location, number and variety of

microbial hydrocarbon utilizes illustrated their inequality and that the broad enzymatic



capacity for hydrocarbon degradation indicated the microbial potential for removal or

conversion of oil in the environment examined. (39).

REFERENCES

1. K. A. Kvenvolden and C. K. Cooper, “Natural seepage of crude oil into the marine

environment,” Geo-Marine Letters, vol. 23, no. 3-4, pp. 140–146, 2003.

2. C. Holliger, S. Gaspard, G. Glod, C. Heijman, W. Schumacher, R. P. Schwarzenbach, and

F. Vazquez, “Contaminated environments in the subsurface and bioremediation: organic

contaminants,”FEMS Microbiology Reviews, vol. 20, no. 3-4, pp. 517–523, 1997.

3. P. J. J. Alvarez and T. M. Vogel, “Substrate interactions of benzene, toluene, and para-

xylene during microbial degradation by pure cultures and mixed culture aquifer

slurries,” Applied and Environmental Microbiology, vol. 57, no. 10, pp. 2981–2985,

1991.

4. P.O. Okerentugba, and O.U. Ezeronye, Petroleum Degrading Potentials of Single

Microbial Cultures isolated from Riivers and Effluent in Nigeria. African Journal of

Biotechnology. 2 (9), pp. 288-292,2003.

5. M.D. Makut and P. Ishaya, Bacterial species associated with soils contaminated with used

petroleum products in Keffi town, Nigeria. African Journal of Microbiology Research, 4

(16); pp. 1698-1702, 2010.

6. M. C., Chukwuma, E. T. Eshett, E. U. Onweremaduand M. A.Okon, Zinc availability in

relation to selected soil properties in a crude oil polluted eutrictropofluvent. International

Journal of Environmental Science and Technology, 7 (2), pp. 261-270,2010.

7. B.R.Perfumo, D.R.Schieche, P.M. DiGrazia, J. Werner and S.Palmer, Microbial

desulfurization of alkylated dibenzothiphenes from a hydrodesulfurized middle distillate

by Rhodococcus erythropolis I-19. Applied Environmental Microbiology. 65, pp. 4967-

4972, 2007.

8. V.J. Odjegba and A.O. Sadiq, Effect of spent engine oil on the growth parameters,

chlorophyll and protein levels of Amaranthushybridus. The Environmentalist, 22, pp. 23-

28, 2002

9. J. Jones, M. Knight, and J. A. Byron, “Effect of gross population by kerosene

hydrocarbons on the microflora of a moorland soil,” Nature, vol. 227, p. 1166, 1970.

10. Y. Pinholt, S. Struwe, and A. Kjoller, “Microbial changes during oil decomposition in

soil,” Holarctic Ecology, vol. 2, pp. 195–200, 1979.



11. S. L. Hollaway, G. M. Faw, and R. K. Sizemore, “The bacterial community composition

of an active oil field in the Northwestern Gulf of Mexico,” Marine Pollution Bulletin, vol.

11, no. 6, pp. 153–156, 1980.

12. G. J. Mulkins Phillips and J. E. Stewart, “Distribution of hydrocarbon utilizing bacteria in

Northwestern Atlantic waters and coastal sediments,” Canadian Journal of Microbiology,

vol. 20, no. 7, pp. 955–962, 1974.

13. R. Bartha and I. Bossert, “The treatment and disposal of petroleum wastes,” in Petroleum

Microbiology, R. M. Atlas, Ed., pp. 553–578, Macmillan, New York, NY, USA, 1984.

14. J. J. Cooney, “The fate of petroleum pollutants in fresh water ecosystems,” in Petroleum

Microbiology, R. M. Atlas, Ed., pp. 399–434, Macmillan, New York, NY, USA, 1984.

15. R. M. Atlas, “Effects of hydrocarbons on micro-organisms and biodegradation in Arctic

ecosystems,” in Petroleum Effects in the Arctic Environment, F. R. Engelhardt, Ed., pp.

63–99, Elsevier, London, UK, 1985.

16. G. Floodgate, “The fate of petroleum in marine ecosystems,” in Petroleum Microbiology,

R. M. Atlas, Ed., pp. 355–398, Macmillion, New York, NY, USA, 1984.

17. J. N. Baruah, Y Alory and R. I. Mateles, Incorporation of liquid hydrocarbons in to agar

media. Appl. Microbial. 15: 561,1967.

18. H. Singh, Mycoremediation: Fungal Bioremediation, Wiley-Interscience, New York, NY,

USA, 2006.

19. E. Bogusławska-Was and W. Dąbrowski, “The seasonal variability of yeasts and yeast-

like organisms in water and bottom sediment of the Szczecin Lagoon,”International

Journal of Hygiene and Environmental Health, vol. 203, no. 5-6, pp. 451–458, 2001.

20. J. H. Warcup, The soil plate method for isolation of fungi from soil. Nature166: 117-

118, 1950.

21. J.D. Walker, B.F. Conrad, P.A.Seesmanand R.R. Colwell, Comparison of membrane filter

counts on heterotrophic and oil agar used to estimate populations of yeast, fungi and

bacteria. In symposium on recovery of indicator organisms employing membrane filters.

American society for Testing and Materials, Fort Lauderdale, Fla, 1976.

22. K.S.M.Rahman, T.J. Rahman,Y. Kourkoutas, I. Petsas, R. Marchant

andI.M.Banat,Enhanced bioremediation of n-alkane in petroleum sludge using bacterial

consortium amended with rhamnolipid and micronutrients. Bioresource Technology 90:

159-168, 2003.



23. Adams, G.O., P. Tawari-Fufeyin, and Igelenyah Ehinomen. "Laboratory Scale

Bioremediation of Soils from Automobile Mechanic Workshops Using Cow Dung."

Journal of Applied & Environmental Microbiology 2(4): 128-134, 2004.

24. C.E. Zobell. “Action of microorganisms on hydrocarbons,” Bacteriological Reviews, vol.

10, pp. 1–49, 1946.

25. M., Vidali, Bioremediation: An overview. Journal of Applied Chemistry, 73 (7), pp. 1163-

1172, 2001.

26. D.Bhattacharya, P.M. Sarma, S. Krishnan, S.Mishra and B.Lal, Evaluation of genetic

diversity among Pseudomonas citronellolis strains isolated from oily sludge-contaminated

sites. Applied Environmental Microbiology. 69(3), pp. 1435-1441, 2003.

27. N.Das and P.Chandran, Microbial Degradation of Petroleum Hydrocarbon Contaminants:

An Overview. Biotechnology Research International Article ID 941810, 13 pages

http://dx.doi.org/10.4061/2011/941810, 2011.

28. A.J. Daugulis andC.M.McCracken, Microbial degradation of high and low molecular

weight polyaromatic hydrocarbons in a two-phase partitioning bioreactor by two strains

of Sphingomonas sp. Biotechnology Letters25:1441-1444, 2003.

29. F.Chaillan, A.Le Fleche andE.Bury, Identification and biodegradation potential of

tropical aerobic hydrocarbon degrading microorganisms. Research in Microbiology 155:

587-595, 22004.

30. R. J. W. Brooijmans, M. I. Pastink, and R. J. Siezen, “Hydrocarbon-degrading bacteria:

the oil-spill clean-up crew,” Microbial Biotechnology, vol. 2, no. 6, pp. 587–594, 2009.

31. R.M. Atlas, AnAssessment of biodegradation of petroleum in the Aoctic, pp. 86-90.

In:.Locotit,M.W and Miles, J.A..R. (Eds), Microbial Ecology. Springer-verlag, Berlin,

21978, 1978.

32. K. Das andA.K.Mukherjee, Crude petroleum-oil biodegradation efficiency of Bacillus

subtilis and Pseudomonas aeruginosa strains isolated from a petroleum-oil contaminated

soil from North-east India. Bioresource Technology 98: 1339-1345, 2007.

33. F. D.Cook and D.W.S Westlake,Microbiological degradation of northern crude oils.

Environmental social Committee; Northern Pipelines. Task force on Northern oil

Development, report no. 74 -1. Catalog no. R – 72- 12774. Information Canada.

Ottawa,1974.

34. A.M. Cundell.andR.W. Traxler, The isolation and characterization of hydrocarbon

utilizing bacteria from chedabucto bay, Nova Scotia, pp. 421-426. In:Proceedings of Joint



conference on prevention and control of oil spills. American petroleum Institute

Washington D.C., 1973.

35. N. Das andP.Chandran, Microbial degradation of petroleum hydrocarbon contaminants:

An overview. Biotechnology Research International 1-13, 2011.

36. B.Austin, R. R. Colwell, J. D. Walker and J. J. Calomiris, The application of numerical

taxonomy to the study of petroleum degradation bacteria. Apply. Environ. Microbiol.

34:60-68, 1997.

37. R. M. Atlas and R.Bartha, Degradation and mineralization of petroleum in water limitation

by nitrogen and phosphorus. Biotechnol. Boeing14: 309.317, 1972.

38. J.D. Walker, and R.R. Colwell, Microbial petroleum degradation: The use of mixed

hydrocarbon substrates. Appl. Microbiol. 27:1053-1060, 1974.

39. Mulkins – Philips and Stewart, Distribution of hydrocarbon utilizing bacteria in North

western Atlantic waters and coastal sediments. Can. J. Microbio. 20: 955-962, 11974.

Plate 1: Colonies of fungi and yeast grown on minimalmedium after soil sprinkling

Plate 2: Colonies of yeast on minimal medium supplemented with lactose and fructose

as carbon source



Plate 3: Colonies of fungi in minimal medium - fructose as carbon source

Plate 4: Colonies of fungi in minimal medium - petroleum as carbon source



ABSTRACTS OF EMINENT PERSONALITIES



PAST- MODERN TRENDS IN BIOTECHNOLOGYHarish R. Bhat

Energy and Wetland Research Group,

Centre for Ecological Sciences,

Indian Institute of Science

Bangalore 560 012


INTRODUCTION

The wide concept of biotechnology encompasses a wide range of procedures for

modifying living organisms according to the human needs, going back to domesticating

animals for livelihood, cultivation of plants, and improving these plants through breeding

programs. Biotechnology by definition, is the use of living systems and organisms to develop

or make useful products, or "any technological application that uses biological systems,

living organisms or derivatives thereof, to make or modify products or processes for specific

use" (UN Convention on Biological Diversity, Art.2). Modern usage also includes genetic

engineering as well as cell and tissue culture technologies.

RICHNESS

Traditionally, Indian tradition (Garuda Purana) estimates 84 lakh different species of

plants and animals in the world. Modern science estimates that there are somewhere between

80 to 120 lakh different species of living organisms on the earth today. About 16 lakh species

are known to science. India with a land area of 2.2% of the earth as a whole harbours over 1.2

lakh. Seven percent of the world's total land area is home to half of the world’s species, with

the tropics alone accounting for 5 million. With a mere 2.4% of the world's area, India

accounts for 7.31% of the global faunal total with a faunal species count of 89,451 species

(MoEF. 1999). India is a center of crop diversity - the homeland of 167 cultivated species and

320 wild relatives of crop plants. There are 167 crop species and wild relatives of these

cultivated plants in the wild. India is considered to be the center of origin of 30,000-50,000

varieties of rice, pigeon-pea, mango, turmeric, ginger, sugarcane, gooseberries etc. India

ranks seventh in terms of contribution to world agriculture. Biotechnology draws on the pure

biological sciences (genetics, microbiology, animal cell culture, molecular biology,

biochemistry, embryology, cell biology).



APPLICATIONS

For thousands of years, humankind has used biotechnology in agriculture, food

production, and medicine. Throughout the history of agriculture, farmers have inadvertently

altered the genetics of their crops through introducing them to new environments and

breeding them with other plants. These processes also were included in early fermentation of

beer. Cultures such as those in Mesopotamia, Egypt and India developed the process of

brewing beer. It is still done by the same basic method of using malted grains (containing

enzymes) to convert starch from grains into sugar and then adding specific yeasts to produce

beer. Biotechnology applications classify the group into four types: Blue - marine and aquatic

applications of biotechnology; Green - biotechnology applied to agricultural processes; Red -

applied to medical processes; White - Industrial biotechnology.

Trends in Biotechnology are unique in drawing together a wide readership of

scientists and engineers from the many disciplines of the applied biosciences. It also reflects

the view that biotechnology is the integrated use of many biological technologies - from

molecular genetics to biochemical engineering. This integration is essential for the effective

translation of novel research into application.

JATROPHA CURCAS AS A BIODIESEL PLANT – FACTS AND MYTHS

Dr. Geetaa Singh

Labland Biotech Private Limited,

R & D Division, 8th K.M., K.R.S. Main Road

Mysore 570 016, India

E-mail: [email protected]; [email protected]

The key energy factor that dictates a products cost is Energy. In fact, the national

economy is driven by the fuel prices on par with other key production factors like land,

labour and capital. The shortage of petroleum fuels and undulating fuel prices has called for

use of alternative sources of energy in addition to the conservation methods. The

Governments, all over the world have initiated the use of alternative sources for ensuring

energy security, employment generation and mitigating carbon dioxide emissions. The

initiatives have differed in different countries. However, biofuels have emerged as an ideal

choice to meet these requirements. In India, Jatropha-based biodiesel has emerged as a



strong contender. Jatropha is an underutilized, non-edible oil-bearing crop. It produces

seeds that can be processed into non-polluting biodiesel. Under best utilization plan, Jatropha

provides opportunities for good returns, climate improvement and rural development. The

crop has special appeal, in that it is non-demanding crop and animals do not graze on it.

However, many of the actual investments and policy decisions on developing Jatropha as an

oil crop have been made without the backing of sufficient scientific knowledge. Realizing

the true potential of Jatropha requires separating facts from the claims and half-truths. The

current presentation discusses the facts and myths of the crop and the biodiesel obtained from

it.

BIOFUEL AS AN ALTERNATIVE SUSTAINABLE FUEL TO FOSSIL FUEL

Dr. C.Vaman Rao

Professor & Head

Dept. of Biotechnology Engineering, NMAM Institute of Technology,

NITTE, 574110 (Udupi Dist.)

Biofuel is the term used for the fuel produced from biological materials by various

processes. Biofuel is of three types namely, bioethanol, biodiesel and biogas. Biofuels can

be produced from different biological sources. Accordingly they are classified in to three

types depending on the source of biofuel production. First generation biofuel, i.e bioethanol is

produced from starchy grains like maize, wheat, tubers (potato) and sugar cane. The second

generation biofuel is produced from lignocellulosic residues of agricultural (hey, wheat,

maize and jowar straw), corn cob, sugar cane shoot, sugar cane bagasse and non-agricultural

origin like wild grasses, leaves and wood. The third generation biofuel is produced from

marine and fresh water algae. Biodiesel is produced from non-edible oils of non-edible seed

origin and the waste vegetable oils obtained after several uses for cooking as well as animal

fat obtained from abattoir or fish processing industry. The oil obtained from certain species

of marine and fresh water algae can be also used for the production of biodiesel. Bioethanol

is produced from the biological sources after conversion of the biological source into simple

sugar by enzymatic hydrolysis or by acid hydrolysis. The sugars obtained are subjected to

anaerobic fermentation by bakers yeast (Sacharomyces cerevisiae) or other species of yeast

like Pichia sp. The end product of anaerobic yeast fermentation is alcohol, which is

separated from the fermented liquor by distillation process. The alcohol produced in this



manner by using biological sources is called bioethanol, which contains mixtures of alcohols

in different proportion like methanol, ethanol, propanol and butanol. This mixture of alcohol

of 99% purity can be used for mixing (doping) with petrol or diesel at a concentration 5 to

10%. Mixing of bioethanol in petrol and diesel leads to decreased consumption of fossil fuels

and also decreased emission of noxious gases. It is estimated that the annual savings for our

country will be 4 lakh to 6 lakh tons of petrol and diesel, which is a significant amount of

savings in terms of foreign exchange in dollars. For mixing ethanol with diesel, a special

catalyst is required as well as a mixer at the pump outlet.

Biodiesel is an environmental friendly diesel produced from the used waste cooking

oil, non-edible vegetable oils, algal oils and animal fats. These oils and fats are esterified in

the presence of a catalyst at a suitable temperature to yield fatty acyl esters and glycerol. The

fatty acyl ester is called biodiesel, which can be used as it is in diesel engines or can be mixed

with diesel at 10 to 20% level. Diesel mixed with biodiesel is known to significantly reduce

noxious gas (CO2, nitrogen oxides-NOX, SO2 and SO3) emission from the automobiles

resulting in significant reduction in environmental burden. The oil cake obtained from non-

edible oil seeds as a result of pressing the oil seeds for the expulsion of oil, can be used for

the production of biogas. Initially to start the biogas production, the starter culture of cow

dung is required to which the oil cake mixed. Once the gas production starts, only oil cake

can be used to keep the biogas production continuously. Biogas produced in this manner is

environmental friendly could be used for cooking purpose, industries for power generation..

Fossil fuel is expected to last up to 2030 or 2040. When the world runs out of stock

of fossil fuel, biofuel will take the centre stage and it will be the fuel of the future to keep the

automobiles and industries running. One may argue stating that there are other fuels like

hydrogen fuel and solar energy for the future for use, but both are costly ventures leading to

escalation in the cost of fuel, which will be beyond the reach of a common man. Therefore,

research and development of biofuels in our country is of utmost importance for the future of

the country.



EFFECTIVE MICRO ORGANISMSDr.R.Ragunathan

Senior Scientist, SynKroMax Biotech (DSIR, Govt. of India Approved R&D) Pvt. Limited,

Porur, Chennai – 116.

Scientific Advisor, Centre for Bioscience and Nanoscience Research , Eachanari,

Coimbatore – 21.

A major problem facing municipalities throughout the world is the treatment, disposal

and/or recycling of sewage sludge. Generally sludge from municipal waste consists mainly of

biodegradable organic materials with a significant amount of inorganic matter . At the present

time, there are a number of methods being used to dispose of sewage sludge from disposal to

landfill to land application. Although there are many methods used, there are numerous

concerns raised regarding the presence of constituents including heavy metals, pathogens and

other toxic substances. This requires the selection of the correct disposal method focussing on

efficient and environmentally safe disposal. New technologies are being produced to assist in

the treatment and disposal of sewage sludge, conforming to strict environmental regulations.

One of these new technologies being proposed is the use of Effective Microorganisms (EM).

The technology of Effective Microorganisms (EM) was developed during the 1970’s at the

University of Ryukyus, Okinawa, Japan by Professor Dr.Teruo Higa.

EM is a combination of useful regenerated micro-organisms that exist freely in nature

and are not manipulated in any way. The possibilities and benefits in using EM are numerable

and include the following:

For use in the home in daily life for everyone

The recycling of kitchen waste and turning it into valuable organic material;

In the garden to improve soil structure, increase productivity and to suppress both

disease and weeds

For solving all kinds of environmental problems such as water, air, and soil pollution;

In agriculture and horticulture, fruit and flower cultivation;

In animal husbandry and for all kinds of pets;

In fisheries, aquariums and swimming pools;

In personal bodily hygiene and for the prevention and treatment of health problems.

Pest Management with EM5 and FPE

Animal husbandry with EM



Vermiwash and EM

EM is a combination of useful regenerated micro-organisms that exist freely in nature and

are not manipulated in any way.

1. Lactic acid bacteria: these bacteria are differentiated by their powerful sterilizing

properties. They suppress harmful micro-organisms and encourage quick breakdown

of organic substances. In addition, they can suppress the reproduction of Fusarium, a

harmful fungus.

2. Yeasts: these manufacture anti-microbial and useful substances for plant growth.

Their metabolites are food for other bacteria such as the lactic acid and actinomycete

groups.

3. Actinomycetes: these suppress harmful fungi and bacteria and can live together with

photosynthetic bacteria.

4. Photosynthetic bacteria: these bacteria play the leading role in the activity of EM.

They synthesize useful substances from secretions of roots, organic matter and/or

harmful gases (e.g. hydrogen sulphide) by using sunlight and the heat of soil as

sources of energy. They contribute to a better use of sunlight or, in other words, better

photosynthesis. The metabolites developed by these micro-organisms are directly

absorbed into plants. In addition, these bacteria increase the number of other bacteria

and act as nitrogen binders.

5. Fungi that bring about fermentation these break down the organic substances quickly.

This suppresses smell and prevents damage that could be caused by harmful insects.

Effective Microorganisms, or EM is one of the most popular microbial technologies

being used worldwide now and EM products have been on the market since 1983 in Japan.

What EM is not, is harmful, pathogenic, genetically-engineered/modified (GMO), nor

chemically-synthesized. Neither is EM a drug or fertilizer.

EM Technology has shown beneficial effects on many aspects of the environment,

agricultural crops and animal husbandry. EM leads to the improvement of soil nutritional

status, physical, chemical and microbiological properties, helping crops to grow healthy and

strong. There is no more need to use chemicals and pesticides. The same holds for animal

husbandry. It helps the farmer maintain an eco-friendly system, minimising the damage to

natural cycles.



BIOMEDICAL WASTE MANAGEMENTDr. Ethel Suman

Associate Professor in Microbiology,

Kasturba Medical College, Mangalore, Manipal University

DEFINITION

Waste generated during diagnosis, treatment, immunisation of human beings or

animals or in research activities pertaining to or in production or testing of biologicals is

termed as Biomedical waste

CLASSIFICATION

The World Health Organization (WHO) has classified medical waste into eight categories:

General Waste

Pathological

Radioactive

Chemical

Infectious to potentially infectious waste

Sharps

Pharmaceuticals

Pressurized containers

Major sources of Biomedical Wastes:

1. Govt. hospitals/private hospitals/nursing homes/ dispensaries.

2. Primary health centers

3. Medical colleges and research centers/ paramedic services

4. Veterinary colleges and animal research centers

5. Blood banks/mortuaries/autopsy centers

6. Biotechnology institutions

Minor sources are:

1. Physicians/ dentists’ clinics

2. Animal houses/slaughter houses.

3. Blood donation camps.

4. Vaccination centers.

Routes of infection:

Through non – intact skin (cuts and puncture) or intact skin.



Through mucous membranes

Inhalation of dust particles containing germs.

By ingestion - through contaminated unwashed hands, water and foodstuff.

PRECAUTIONS

All personnel must be vaccinated against Hepatitis B

Heavy duty gloves muat be worn while dealing with infectious waste specially

sharps

Sharps should not be left casually on counter tops, trays or beds

Recapping needles should be discouraged

Need for Biomedical waste Management:

1. Prevent nosocomial infections

2. Prevent Misutilisation of left over drugs.

3. Check the risk of infection outside hospital for waste handlers and scavengers

4. Check the risk associated with hazardous chemicals, drugs to persons handling

wastes at all levels.

5. Minimise the risk of air, water and soil pollution directly due to waste ,or due to

defective incineration emissions and ash.

Biomedical waste management rules in India

Ministry of enviroment and forest has revised the bio medical waste management and

handling rules under the environment protection act of 1986.Rules now called as the

Bio medical wastes (management and handling) rules 2011, in Karnataka; KPCB

follows the biomedical waste management & handling rules 1998.

Environment Legislation:

The environment(protection) act,1986

The biomedical waste (management and handling)rules,1998

The municipal solid waste( management and handling)rules,2000

Steps in waste management

1. Waste collection

2. Segregation

3. Transportation and storage

4. Treatment & Disposal

5. Transport to final disposal site



6. Final disposal

7. Recycling

Waste collection and survey

Differentiate & quantify the waste generated.

Determine the points of generation.

Types of waste at each point.

Level of generation of waste.

Disinfection within the hospital.

Helps to determine the method of waste disposal.

Waste segregation

Different kinds of waste in different containers or coded bags at the point of

generation.

Schedule I of BMW rules show the categories of bio-medical waste in India.

Schedule II of BMW rules elaborate about the colour coding of the bags.

Colour Coding of Bags:

Pink bag

► Rubber gloves (after disinfection)

► Disinfected plastic material

► Plastic vials with nonpathogenic material

► Culture plates (after autoclaving)

Yellow bag

► Specimens

► Contaminated/ soiled cotton/ paper

► Linen/swabs

► Soiled material other than sharps

Black bag

► Non-contaminated articles only

Plastic can

► All sharps

► Syringes/needles/scalpel blades

► Broken glass

► Broken slides

The following should NOT be done



Put the waste indiscriminately.

Put wrong bags in bin. (Adhere to colour code.)

Fill the bags till neck. (Waste would otherwise spill over.)

Handle waste without protective clothing.

Drag the bags after removal. (Bags can burst and the site could be repulsive.)

Never recap the needle. (Never re-use needle without disinfection)

Mix non infectious waste with infectious waste.

CONCLUSION

Hazards of poor management of biomedical waste have aroused the concern world

over, especially in effects on human, health and the environment Biomedical Waste has to be

managed appropriately..

WEALTH FROM WASTES – EDIBLE MUSHROOM CULTIVATIONDr. A. Panneerselvam

Associate Professor & Head,

Department of Botany and Microbiology,

A.V.V.M Sri Pushpam College (Autonomous),

Poondi-613 503, Thanjavur District, Tamil Nadu.

Mobile: 9443661858

Email: [email protected]; [email protected]

Residues from crops after harvest can be recycled in agriculture not only to conserve

energy but also to minimize pollution. Intensive agriculture in the last two decades has no

doubt increased food production but the disposal of plant residues has posed fresh problems.

Some of the important residues are straw from rye, wheat, barley, rice, oat, trash from

sugarcane, husk from paddy etc. Now-a-days, the attention of the Government is also focused

on wealth from wastes. The cultivation of edible mushroom is possible from agrowastes

containing cellulose. Since mushrooms possess cellulolytic property, they can be grown on

cellulosic substrates like paddy straw, sugarcane trash, paddy husk etc. Mushroom cultivation

involves a number of different operations including preparation of pure culture, spawn and

compost as well as crop management and marketing.



The great value in promoting the cultivation of mushrooms lies in their ability to grow

on cheap carbohydrate materials. This is extremely important in the rural areas where there is

enormous quantity of wastes that have been found to be ideal as substrates for tropical

mushrooms. Furthermore the spent compost, which is the substrate left over after mushroom

harvesting, can be converted into stock feed and plant fertilizer as a soil conditioner. It is

obvious that mushroom cultivation opens the dead lock in the biological degradation of

natural resources. Thus its immediate potential contributions should be properly recognized.

The Government of India also included “Edible mushroom cultivation” as one of the

trades under the TRYSEM (Training for Rural Youth and Self employment) project during

the VIII five year plan and under this project training were being given to the rural youths in

the Department of Botany, A.V.V.M Sri Pushpam College (Autonomous), Poondi from 1992

onwards.

The Tamil Nadu state council for science and Technology Chennai also launched

various scheme to popularize edible mushroom cultivation. Dissemination of Innovative

Technology (DIT), Science popularization programme, women’s self help group programme,

Application of Science and Technology in Rural Area (ASTRA), Anna Marumalarchi

Thittam, are some of the successful scheme implemented in the state.

Types of Mushroom popular in India

Botanical Name Common name

1. Pleurotus sp. Oyster mushroom

2. Valvariella sp. Paddy straw mushroom

3. Agaricus sp. Button mushroom

4. Calocybe sp. Milky mushroom



Techniques in mushroom culture

Mother spawn preparation

The first generation of fungal culture is called the “mother spawn”. The mother spawn

can be successfully used upto third or fourth generation continuously to prepare ordinary

spawn for mushroom cultivation.

The cholam grain (small size) (1Kg) are placed in a trough of water to remove the

chaffy grains. Then it is half cooked (approximately 20 minutes). The excess water is drained

and spread on sterilized cloth. Then 20 g of Calcium carbonate coating prevents the grain

from sticking. These grains are filled in clean glucose drip bottles (300 g/bottle) or

polypropylene bag. Then the bottles are tightly plugged with non- absorbing cotton and

wrapped with a paper, tied with a thread and placed in an autoclave for sterilization (20lbs

pressure for 30 minutes). After cooling the bottles are ready for inoculation.

Inoculation Technique

The sterilized bottles are taken into the culture room. The UV lamp is switched on for

15 minutes to sterilize the air inside. Then it is switched off and the ordinary fluorescent tube

is switched on. The inoculation work can be done in the laminar air flow chamber. With the

help of cork borer 10mm diameter disc made from the petriplates having fully grown

mushroom fungus. The disc is transferred into the sterilized spawn bottle with the help of an

inoculation needle. This is done over the Bunsen burner flame to avoid contamination. The

bottles are incubated at room temperature. The white mycelium is observed in the entire

bottle after 12 days of inoculation. This is known as “mother spawn”.

Multiplication of spawn from mother spawn

From a single mother spawn at least 25 spawn bottles can be prepared. The calcium

carbonate mixed grains are sterilized and then the sterilized bottles are inoculated with

mother spawn. About 10 g of Cholam grains along with the mushroom fungus is required for

inoculation. The inoculated bottles is plugged with the non – absorbent cotton immediately

and wrapped with paper and tied with a thread. The spawn bottle is incubated for 15 days for

spawn run. One can use this spawn upto a period of 30days from the date of inoculation.



Preparation of Mushroom bed and cultivations of mushrooms

Mushroom beds can be prepared using different substrates viz., Paddy straw,

sugarcane trash and paddy husk. For each spawn bottle two beds can be prepared. Size of

each bed is 30 × 60 cm. fresh paddy straw are chopped into pieces of 2-3 inches length and

soaked in water for 10 hours. Water is then drained off from the paddy straw. Afterwards, the

paddy straws are sterilized using vertical autoclave at 15 lbs pressure for 20 minutes. The

sterilized paddy straws are placed on a wire mesh net for draining excess water. Polythene

covers in the size of 30 × 60 cm are procured and filled with the treated paddy straw as

follows. Before preparing mushroom beds hands and all the instruments should be sterilized

with a dilute solution of KMnO4/alcohol. A polythene bag is tied at one end and sterilized

paddy straw is filled through the open end for about 5 cm in length. A handful of spawn from

the bottle is spread (15 g) towards the periphery of this layer. Over the spawn some more

paddy straw are put and pressed lightly. This process is repeated five times. The mouth of the

bag is rolled and closed with stapler pins. Holes are made over the bag for aeration. One

bottle of spawn is enough to inoculate two bags of paddy straw. Inoculation paddy straw bags

are kept in a ventilated dark chamber. The mycelia will colonize the entire paddy straw bag

within 15 days. Now the polythene cover is peeled off and the compact lump of paddy straw

is placed in a cools shady room and sprayed with water 3-4 times per day. The young fruit

bodies will come out from the bag. When the fruit bodies attain their full growth, they will be

harvested.

Mushroom Recipes

1. Mushroom soup

2. Mushroom vegetable curry/Peas curry

3. Mushroom fry

4. Mushroom pickle

5. Mushroom cutlet

6. Mushroom kuruma

7. Mushroom Briyani

8. Mushroom snacks

9. Mushroom Pagodas

10. Mushroom omelets

11. Mushroom sandwiches

12. Mushroom biscuits



13. Mushroom puppets

14. Mushroom pulavu

15. Mushroom baji

16. Mushroom masala

17. Mushroom panneer

18. Mushroom chappathi

19. Mushroom Gheer

20. Mushroom ketchup

21. Creamy Mushroom

22. Marinated Mushroom salad

Possible health benefits of consuming mushroomsConsuming fruits and vegetables of all kinds has long been associated with a reduced

risk of many lifestyle-related health conditions. Countless studies have suggested that

increasing consumption of naturally-grown foods like mushrooms decreases the risk of

obesity and overall mortality, diabetes, heart disease and promotes a healthy complexion and

hair, increased energy, and overall lower weight.

Cancer

Selenium is a mineral that is not present in most fruits and vegetables but can be

found in mushrooms. It plays a role in liver enzyme function, and helps detoxify some

cancer-causing compounds in the body. Additionally, selenium prevents inflammation and

also decreases tumor growth rates.

The vitamin D in mushrooms has also been shown to inhibit the growth

of cancer cells by contributing to the regulation of the cell growth cycle. The float in

mushrooms plays an important role in DNA synthesis and repair, thus preventing the

formation of cancer cells from mutations in the DNA.

Diabetes

Studies have shown that type 1 diabetics who consume high-fiber diets have lower

blood glucose levels and type 2 diabetics may have improved blood sugar, lipids and insulin

levels. One cup of grilled portabella mushrooms and one cup of stir-fried shiitake mushrooms



both provide about 3 grams of fiber. The Dietary Guidelines for Americans recommends 21-

25 g/day for women and 30-38 g/day for men.

Heart health

The fiber, potassium and vitamin C content in mushrooms all contribute to

cardiovascular health. Potassium and sodium work together in the body to help regulate blood

pressure. Consuming mushrooms, which are high in potassium and low in sodium helps to

lower blood pressure and decrease the risk of high blood pressure and cardiovascular

diseases. Additionally, an intake of 3 grams of beta-glucans per day can lower blood

cholesterol levels by 5%.

Immunity

Selenium has also been found to improve immune response to infection by

stimulating production of killer T-cells. The beta-glucan fibers found in the cell walls of

mushrooms stimulate the immune system to fight cancer cells and prevent tumors from

forming.

Weight management and satiety:

Dietary fiber plays an important role in weight management by functioning as a

"bulking agent" in the digestive system. Mushrooms contain two types of dietary fibers in

their cell walls: beta-glucans and chitin which increase satiety and reduce appetite, making

you feel fuller longer and thereby lowering your overall calorie intake.

APPLICATION OF BIO TECHNOLOGY IN TREATMENT OF HEAVY METAL CONTAMINATED INDUSTRIAL WASTE WATER-

A CASE STUDY

H. Lakshmikantha, Nagarathna N D# and Saranya D$

Deputy E nvironmental Officer

KSPCB, Mangaluru

Human life, as with all animals and plants life on this planet, is dependent upon water.

Effluents from industries like; textile, leather, electroplating, dyes and pigment, metallurgical,

contains considerable amount of toxic metal ions. These metal ions pose problems to the

water environment as the industries often indulge in discharging waste water into



underground and open drains or pit. The potential impacts from leaching operations on the

environment are most likely to be experienced as changes to surface and groundwater quality.

In this study an attempt has been made to utilize the microbes in treatment of industrial waste

water collected from textile, electroplating industries. Studies have been carried out to

specifically utilize the selected species of locally available microbal species in treatment of

chromium contaminated industrial waste water. Waste water samples were collected from

various industries, subjected to characterization and compared analysis results. The waste

water was subjected to bio remediation process to treat the waste water and the results have

shown that the possibility of application Acidthiobacilus microbal community in effective

treatment of chromium contaminated industrial waste water.

BIOLOGICAL CONTROL FOR SUSTAINABLE AGRICULTURE AND ENVIRONMENTAL MANAGEMENT

S. Shishupala

Department of Microbiology

Davangere University, Shivaganogotri Campus,

Davangere – 577002

E.mail:[email protected]

Biological control makes use of natural process of competition between organisms.

Successful agriculture always depends upon effective pest and disease management

strategies. Use of antagonistic microorganisms for preventing or curing plant diseases has

become one of the eco-friendly approaches in sustainable agriculture and environmental

management. Biological control agents belonging to Trichoderma spp. have been exploited

for their capacity to antagonize plant pathogenic fungi. Various mechanisms have been

attributed to different strains and species of Trichoderma showing antagonism. Major

mechanisms of action of these fungi involve aggressive growth, rhizosphere competence,

mycoparastism, production of hydrolytic enzymes, antibiosis and induction of plant

resistance. These fungi are known to have rapid growth pattern and hence able to

successfully compete well to establish in the crop rhizosphere. They are capable of utilizing

plant pathogenic fungi as source nutrients. Enzymes like cellulases, chitinases and

glucanases are effective in destroying cell walls of pathogenic fungi. Antibiosis involves

production of peptaibol antibiotics which induce membrane channels in the target fungi.

Apart from direct antagonism these fungi are capable of improving plant growth and induce

plant defence mechanisms as well. Ability of these fungi to elicit the plant to produce



defence proteins and phytoalexins is evident. These fungi are also involved in compositing

and hence useful in biomass utilization. All the unique features of these fungi may be

exploited for conversion of garbage to garden compost. Surely, these fungi will be able

contribute for sustainable agriculture and environmental management.

BIOFERTILIZERDr. A. Panneerselvam

Associate Professor & Head

Department of Botany and Microbiology

A.V.V.M Sri Pushpam College (Autonomous),

Poondi-613 503, Thanjavur District, Tamil Nadu.

Mobile: 9443661858

Email: [email protected]; [email protected]

INTRODUCTION

The increasing demand for higher food production to feed increased population, there

is an increased demand for chemical fertilizers which are based on non- renewable fossil

fuels, improved seeds, agro chemicals etc.

The term Biofertilizer refers to preparations containing living cells of efficient strains

of nitrogen fixing, phosphate solubilizing or cellulolytic microorganisms which have the

capacity to enrich the soil fertility either as free living or in the association with host plants.

Biofertilizers are used to reduce the use of chemical fertilizers, enhance soil fertility and yield

of crops in agriculture. They may be used either by mixing them with seeds or by spreading

them over the field during cultural operations. The microbes also produce some organic

substance which is readily used by green plants. In recent years, due emphasis has been paid

towards the use of biofertilizers in view of shortage of chemical nitrogenous and phosphatic

fertilizers.

I. N2 Providing Biofertilizer

1. Symbiotic Bacteria

Rhizobium

Rhizobia, the soil bacteria, have the ability to fix atmospheric nitrogen in symbiotic

associations with legumes and certain non legumes like Parasponia. Rhizobia was

discovered by Frank (1877) and Beijernick (1888). They normally enter the root hairs,

multiply there and form root nodules. The amount of nitrogen fixed varies with the strain of

Rhizobium, the plant species and environmental conditions.



Structurally Rhizobium are rod shaped but great variation can be observed during their

life cycles. These symbiotic bacteria (Rhizobium) are difficult to cultivate in ordinary culture

media but they grow in mannitol agar. A transverse section of a nodule reveals a central

“Bacteroid Zone” which is enveloped in a nodule cortex. The bacteroid zone is made up of

host cells containing bacteroids encased in membranous envelopes which are of host orgin.

Bacteroids are non- motile stage in the life cycles Rhizobium act on the primary site of

nitrogen fixation as they contain the key enzyme nitrogenase.

2. Non- Symbiotic Bacteria

Azotobacter

Azotobacter is a gram negative free-living non symbiotic, nitrogen fixing bacterium.

It occurs in soil and fresh water ponds. Beijerinick, in the early part of this century, was the

first to isolate and described. A.chroococcum and A.agilis, during later years several other

species have been described. A.vinelandii, A.beijerinckii, A.insignis, A.macrocytogenes and

A.paspaii. one of the dominant bacterium occurring in Indian soils is A.chroococcum which

rarely exceeds 104 to 105/g soil in Indian soils.

3. Associative Bacteria

Azospirillum

Azospirillum was first described as Spirillum lipofrum by Beijerinck in 1925 as

nitrogen fixing bacterium. Tarrand, Krieg and Dobereiner (1978) re-named this organism as

Azospirillum (N- fixing Spirillum). Azospirillum have been found to be associated with the

roots and rhizospheres of many members of the Gramineae, particularly in the tropics.

Digitaria, Maize, Sorgum, Rice, Sugarcane, Wheat and forage grasses are most frequently

cited as hosts. Da silva and Dobereiner (1978) found that soils under grasses retained more

Azospirillum than others.

Occurrence of Azospirillum in certain saline and saline – alkali soils of India has also

been reported by Tilak and Krishnamurthi (1981). Azospirillum is recognized as a ubiquitous

soil organism capable of colonizing effectively not only the roots of wide variety of plants

but also their above ground portions forming apparently an associative symbiosis.

4. Cyanobacteria (Blue Green Algae)

Frank (1889) first reported the ability of nitrogen fixation by blue green algae. They

are ubiquitous in distribution. They are either single celled or consist of branched or

unbranched filaments. Some of them possess a peculiar structure known as “heterocyst” and

all heterocysts forms can fix nitrogen from air. Recently, some blue green algae without



heterocystes have also been found to fix nitrogen under special conditions like low O2 tension

(microaerophilic condition).

Blue Green Algae (BGA) Biofertilizer has been proved to be the most efficient source

of organic nitrogen in low land paddy. The algae utilize inexhaustible energy source of solar

radiation. The BGA promotes the growth of paddy crop by supplying fixed nitrogen through

exudation and microbial degradation of dead algal cells. Algalizatioin increases the fertilizer

use efficiency of the crop plants, reduces the loss of fertilizer nitrogen and above all provides

these benefits in a recurring manner.

5. Actinomycetes

Actinomycetes, any member of a heterogeneous group of gram-positive, generally

anaerobic bacteria noted for a filamentous and branching growth pattern that results, in most

forms, in an extensive colony, or mycelium. The mycelium in some species may break apart

to form rod- or coccoid-shaped forms. Many genera also form spores; the sporangia, or spore

cases, may be found on aerial hyphae, on the colony surface, or free within the environment.

Motility, when present, is conferred by flagella. Many species of actinomycetes occur in soil

and are harmless to animals and higher plants, while some are important pathogens, and

many others are beneficial sources of antibiotics.

Frankia

Frankia is a genus of nitrogen fixing, filamentous bacteria that live in symbiosis

with actinorhizal plants, similar to the Rhizobia bacteria that are found in the root nodules

of legumes in the Fabaceae family. Bacteria of this genus also form root nodules.

This genus was originally named by Jorgen Brunchorst in 1886 to honor the German

biologist, A. B. Frank. Brunchorst considered the organism he had identified to be a

filamentous fungus. Becking redefined the genus in 1970 as

containing prokaryotic actinomycetes and created the family Frankiaceae within

the Actinomycetales. He retained the original name of Frankia for the genus.

Frankia alni is the only named species in this genus, but a great many strains are

specific to different plant species. The bacteria are filamentous and convert atmospheric

nitrogen into ammonia via the enzyme nitrogenase, a process known as nitrogen fixation.

They do this while living in root nodules on actinorhizal plants. The bacteria can supply most

or all of the nitrogen requirements of the host plant. As a result, actinorhizal plants colonise

and often thrive in soils that are low in plant nutrients.

Several Frankia genomes are now available which may help clarify how the symbiosis

between prokaryote and plant evolved, how the environmental and geographical adaptations



occurred, the metabolic diversity, and the horizontal gene flow among the symbiotic

prokaryotes.

II. Phosphate providing biofertilizer

Phosphorous is a vital nutrient for plants and microorganisms. The phosphorous

content of most soils is quite low. In such conditions applications of phosphatic fertilizer in

the available form is essential for better crop yield. It is well known that more than two thirds

of phosphatic fertilizer is rendered unavailable within a very short period of its application

due to fixation in the soil complex (Gaur, 1990).

It has been established that there are specific groups of soil microorganisms which

increase the availability of phosphate to plants, not only by mineralizing organic phosphorous

compounds but also by rendering inorganic phosphorous compounds more available to them

(Garretsen, 1948 and Sundara Rao, 1968). Considerable success was earlier claimed,

particularly by Russian workers, in increases yield and quality of crops by inoculating seeds

with pure and efficient strains of Bacillus megaterium var. phosphaticum commonly called

phosphobacterin mineralizing organophosphate. Microbial solubilization of inorganic and

organic phosphate compounds has been extensively studied under Indian conditions (Sundara

Rao and Sinha, 1963). Therefore one of the approaches would be to increase the number and

activity of efficient phosphate solubilizing microorganisms in the root zone of plants by use

of microbial inoculants for increasing phosphorous availability to the plants from the soil as

well as added phosphate (Gaur, 1990).

Having world’s largest area under crops where biofertilizer use has been quite

beneficial, India has significant potential to promote biofertilizer technology. For this it is

essential to understand the steps involved in microbial inoculants production involving

phosphate solubilizing microorganisms.

1.Phosphate mobilisers

Mycorrhizal Fungi

The term mycorrhiza was first coined by Frank (1885) for the mutualistic associations

formed between plant roots and certain fungi. Such associations exist in the majority of land

plant species and therefore in ecosystems throughout the world. A study of the occurrence of

mycorrhizas in the Indian flora provides an example of their distribution; 90% of the

angiosperm species, 100% of the gymnosperms and 70% of the pteridophytes are able to

form mycorrhizal association are morphologically and physiologically divers, and their

structures and functions depend on the symbionts involved. There are different types of

mycorrhia viz.,ectomycorrhiza, ericoid mycorrhiza, orchid mycorrhiza, arbuscular



mycorrhiza, arbutoid mycorrhiza, and monotropoid mycorrhiza, distinguished primarily by

the morphology of contact zone between the partners. The difference in the morphology of

the mycorrhizal type is refelected in the resulting physiological relationships. Among the

different types of mycorrhiza,, Arbuscular Mycorrhiza,(AM) occupy a unique ecological

position and are the most abundant and widespread forming symbiotic association in the roots

of many angiosperms, gymnosperms, pteridophytes, bryophytes and thallophytes. AM

represents one of nature’s best gifts to mankind in the conversion of arid soil to productive

and fertile.

The development of the AM association’s involves a complex series of interactions

between the plant and the fungus and the coordinate cellular development both symbionts is

required to achieve the functional symbiotic state in which reciprocal transfer of nutrient

occur. The plant provides the fungus with carbon and receives an additional supply of

phosphate and other mineral nutrients, imported from the soil by the fungus. Thus, the

symbiosis can be particularly beneficial for the plant especially when growing in nutrient-

poor conditions. Reports of increased growth health and stress tolerance of mycorrhizal

plants are accordingly widespread. Mycorrhizal plants may also show enhanced disease

resistance, which in some cases may be mediated by factors other than enhanced mineral

nutrition.

2. Phosphate solubilizers

a. Phosphate Solubilizing Bacteria (PSB)

Phosphate solubilizing bacteria (PSB) are a group of beneficial bacteria capable of

hydrolysing organic and inorganic phosphorus from insoluble compounds.[1] P-solubilization

ability of the microorganisms is considered to be one of the most important traits associated

with plant phosphate nutrition. It is generally accepted that the mechanism of mineral

phosphate solubilization by PSB strains is associated with the release of low molecular

weight organic acids, through which their hydroxyl and carboxyl groups chelate

the cations bound to phosphate, there by converting it into soluble forms. In addition, some

PSB produce phosphatase like phytase that hydrolyse organic forms of phosphate compounds

efficiently. One or both types of PSB have been introduced to Agricultural community as

phosphate Biofertilizer. Phosphorus (P) is one of the major essential macronutrients for plants

and is applied to soil in the form of phosphate fertilizers. However, a large portion of soluble

inorganic phosphate which is applied to the soil as chemical fertilizer is immobilized rapidly

and becomes unavailable to plants.



Most of the cultivable soil being alkaline in nature contains less available

phosphorus. Due to higher concentration of Calcium, whenever phosphatic fertilizers are

applied in such soil, the large quantity of it gets fixed as Tri-Calcium Phosphate as it is water

insoluble and hence becomes unavailable to the crop. Certain soil microorganisms have

inherent capacity to dissolve part of the fixed phosphorus and make it available to the crop by

secreting certain organic acids. Phosphate Solubilizing Bacteria are useful for all the crops

i.e. Cereals, Cash crops Leguminous crops Horticultural crops. Vegetables etc.

Advantages of PSB

The effective strain of Phosphate Solubilized Bacteria used, increase the level of

available P2O5 in the soil.

With the increase in available P2O5 level, overall plant growth can be increased.

In certain condition they also exhibit anti-fungal activities and thereby fungal diseases

may be controlled indirectly.

About 10 to 15% increase of crop yield can be achieved with the use of this culture.

Phosphate Solubilizing Fungi

The mechanisms of phosphate solubilization, development and mode of fungal

inoculants application and mechanisms of growth promotion by phosphate-solubilizing fungi

for crop productivity under a wide range of agro-ecosystems and the understanding and

management of P nutrition of plants through the application of phosphate-solubilizing fungi.

Eg., Aspergillus niger and Penicillium notatum

Advantages of Biofertilizer

Renewable source of nutrients

Sustain soil health

Supplement chemical fertilizers.

Replace 25-30% chemical fertilizers

Increase the grain yields by 10-40%.

Decompose plant residues, and stabilize C:N ratio of soil

Improve texture, structure and water holding capacity of soil

No adverse effect on plant growth and soil fertility.

Stimulates plant growth by secreting growth hormones.

Secrete fungistatic and antibiotic like substances

Solubilize and mobilize nutrients

Eco-friendly, non-pollutants and cost effective method

an international journal of - ijeeas vol ii iss 1.pdf · that can be used as the feedstock to...

Documents