an international journal of - ijeeas vol ii iss 1.pdf · that can be used as the feedstock to...
TRANSCRIPT
An International Journal of
EMERGING ENGINEERING APPLICATIONS
AND BIO-SCIENCES
(IJEEAS)
RESEARCH PUBLICATIONS
VOLUME II
RAJA INSTITUTE OF SCIENCE AND TECHNOLOGY24/5, Meadavilai, Muttacadu - 629 189
Tamilnadu, INDIA
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 2
PREFACE
It is with immeasurable happiness that the International Journal of
Emerging Engineering Applications and Bio-Science (IJEEAS) brings out its
second volume of the Journal publication with a renewed energy and
vitality keeping in mind the new demands and needs of keeping pace with
the change and knowledge & technology-driven world.
India today needs international-standard research-based home of
Institutions that would support modern research and also create potential
resources for innovative research and education in the rapid changing and
technology-driven world of the current century.
The IJEEABS is doing its best to recognize and make true this
concept. The Raja Institute of Science and Technology comprehends the
fact that it is its primary duty to update and adapt itself rapidly to the
needs of the world to make education and research flourishing, significant
and pertinent. The Institution is proud of the reality that it is in the
process of accomplishing its objectives by means of the dedicated and
hardworking efforts of its teachers and researchers.
The Journal Authority expresses its gratitude for the researchers
who have published their research works in our Journal. The Editorial
Board of this journal would expect suggestions and earnestly hope your
precious and productive implications would make our publication
successful and fruitful.
Journal Authority IJEEABS
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 3
CONTENTS
BIOGAS PRODUCTION USING VARIOUS AGRICULTURAL WASTES 4
JATROPHA CURCAS AS A BIODIESEL PLANT - MYTHS AND FACTS 10
BIODEGRADATION OF AZO DYES BY HALOBACILLUS SP. 24
PRODUCTION, OPTIMISATION, CHARACTERISATION AND PARTIAL PURIFICATION OF L-ASPARAGINASE FROM
ASPERGILLUS NIGER 40
ISOLATION OF ANTIBIOTIC PRODUCING ACTINOMYCETES FROM SOIL, PURIFICATION AND
CHARACTERISATION 51
MICROBIAL PRODUCTION OF BIOSURFACTANTS 59
DEGRADATION OF PETROLEUM BY MICROORGANISMS ISOLATED FROM SOIL CONTAMINATED WITH PETROL
AND ITS BY-PRODUCTS 66
ABSTRACTS OF EMINENT PERSONALITIES 82
PAST- MODERN TRENDS IN BIOTECHNOLOGY 83
JATROPHA CURCAS AS A BIODIESEL PLANT – FACTS AND MYTHS 84
BIOFUEL AS AN ALTERNATIVE SUSTAINABLE FUEL TO FOSSIL FUEL 85
EFFECTIVE MICRO ORGANISMS 87
BIOMEDICAL WASTE MANAGEMENT 89
WEALTH FROM WASTES – EDIBLE MUSHROOM CULTIVATION 92
APPLICATION OF BIO TECHNOLOGY IN TREATMENT OF HEAVY METAL CONTAMINATED INDUSTRIAL WASTE
WATER- A CASE STUDY 97
BIOLOGICAL CONTROL FOR SUSTAINABLE AGRICULTURE AND ENVIRONMENTAL MANAGEMENT 98
BIOFERTILIZER 99
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 4
BIOGAS PRODUCTION USING VARIOUS AGRICULTURALWASTES
Bharathi Prakash* and Sumangala C.H.
Department of Microbiology,University College, Mangalore, Karnataka*Corresponding author
ABSTRACTBiogas is a naturally occurring by product of the breakdown of the organic material
and is actively produced from a variety of source including animal waste, municipal solid waste, agricultural wastes using a process called anaerobic digestion. The study was under taken to check the production of maximum biogas using various agricultural wastes (Areca nut, Husk, Cauliflower leaves, Cow dung, Mixture, Bagasse).The experiment was done in bottles of 750 ml capacity using various feed stock and cow dung. To provide anaerobic condition and to collect the amount of biogas produced in each feedstock bottle balloons were fixed. By Serial dilution technique the bacteria were isolated from the bottles after 21days and identified by Gram staining. The carbohydrate fermenting capacity of the isolates was also determined.
Of the various feed stocks used, maximum biogas production was obtained from bagasse within 9 days that was observed by the balloons fixed to the bottle neck. Gram positive bacilli were predominantly found in the cow dung and bagasse and utilized all the three sugars glucose, sucrose, lactose tested for carbohydrate fermentation. Hence the mixture of cow dung and bagasse has proved to give better yield of biogas and is economical too.Keywords: Biogas, Bagasse, Cow dung, Agricultural waste, Biofuel
INTRODUCTION
Biogas is a type of bio fuel. It is produced by anaerobic digestion or fermentation of
biodegradable materials such as biomass, manure or sewage, municipal waste, green waste
and energy crops [1]. With depletion of fissile fuels, increasing crude oil demands with
increasing pollution and population, there is a need of alternative regenerative fuel source like
biogas. Millions of tons of wastes are generated each year from agricultural, municipal and
industrial sources. Agricultural wastes including live stock manure are source of solid waste
that can be used as the feedstock to produce biogas. Different agricultural waste materials are
used for biogas production in the laboratory. Biogas originates from biogenic material and is
a used as a major source of household energy a type of bio fuels [1].Biogas typically refers to
a mixture of different gases produced by the breakdown of organic matter in the absence of
oxygen. In this study various agricultural waste like areca nut, husk Cauliflower leaves, Cow
dung, Bagasse were used with cow dung as inoculums. Glass bottles capped with air tight
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 5
balloons are used the anaerobic digester. This comparative study determines that bagasse is
the efficient feedstock to generate high yield of biogas.
The aim of the study was to determine the production of maximum biogas using
various agricultural wastes. For this purpose, arecanut, husk Cauliflower leaves, Cow dung,
Bagasse and its mixture was used as the raw material for the production of biogas.
METHODOLOGY
The study was conducted in6 sterilized glass bottles of 750 ml capacity using various
feed stock and cow dung for analyzing the amount of biogas produced by each feedstock. In
each bottle 50g of feedstock substrate materials and 50g of cow dung was added and bottles
were labeled. In one of the bottles, a mixture of 50g cow dung and 12.5g of each feed stalk
was added and bottle was marked as ‘mixture’. In a bottle marked as cow dung there was
only 100 gm of cow dung. 200ml of distilled water was added to every bottle. Cow dung
mainly serves as the inoculums with methanogenic bacteria. Good quality balloons without
any hole were fixed to the opening of the bottles and made air tight as shown in the figure1.
The bottles were incubated at room temperature for 21 days. Twice a day, the contents of the
bottles were mixed by shaking the bottle. Production of biogas in the balloons was observed
daily and recorded.
The amount of biogas produced by each feedstock was measured by the rise in the
volume of the balloons tied to the respective bottles. The measurement of biogas was done by
measuring the diameter of the balloon by a thread and thereby measuring its length in cm.
The radius of the balloon was considered for the calculation of volume using a formula V =
⁴⁄₃πr³.
OBSERVATION AND RESULT
The result of biogas formation from day one to 21 days of incubation in all the
feedstock is given in the table 1. Out of the various feed stocks used maximum biogas
production was obtained from bagasse with cow dung within 9 days that was observed by the
balloons fixed to the bottle neck.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 6
ISOLATION OF BACTERIA FROM FERMENTED FEED STALK
After measuring the biogas formation in each bottle, bacteria were isolated from the
bottles after 21 days by Serial dilution technique and plating on Nutrient agar. The CFU were
counted and Gram character was studied by Gram staining. The carbohydrate fermenting
capacity of the bacterial isolates was also determined.
CARBOHYDRATE FERMENTATION
For this purpose, sugar media of glucose, sucrose and lactose respectively were
prepared separately and sterilized with Durham tube. The bacterial isolates were inoculated
in each carbohydrate broth and incubated at 37OC for 24-48hours. The results of acid and gas
production were recorded. Gram positive bacteria were predominantly found in the cow
dung. The bacteria from the mixture of Bagasse and cow dung utilized all the three sugars
tested for the fermentation accompanied by gas formation. Bottles containing Cauliflower,
Husk and Mixture also shoed comparatively good amount of biogas formation. The lowest
amount of biogas was formed in the bottles containing areca nut and cow dung.
Table 1: Biogas production (cm3) using different feed stalk
Day Volume of biogas produced in cm3
AN CL CD HK MX SB
0 0 0 0 0 0 0
3 48 40 10 48 24 60
6 64 60 15 34 32 72
9 72 68 20 78 36 100
12 90 84 36 78 48 100
15 90 84 50 78 80 100
18 90 84 60 78 80 100
21 90 84 60 78 80 100
Note:AN=areca nut ,CL= Cauliflower leaves ,CD = Cow dung ,HK = Rice barn ,MX =
Mixture ,B= Sugarcane Bagasse, Volume of biogas produced in cm3
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 7
DISCUSSION
Biogas had been generated from various biomass waste. [2]. The biogas consists
mainly of methane (55-60%), CO2 (30-35%) and H2 (5-10%); burning this gives an energy
efficiency of >85%, compared with 60% for burning bagasse. [2]. Various studies have been
conducted on the biogas production using waste from various agricultural, dairy waste, palm
head ash solution, municipal sewage, cotton seed etc. [3- 4]. Feedstock of crop residues have
more lignocellulose content with low nitrogen content. Hence for optimizing the Carbon to
Nitrogen ratio of agricultural residues, co-digestion with sewage sludge, animal manure or
poultry litter is recommended [5-7]. Temperature and pH also plays an important role in the
good yield of biogas production. Four basic types of microorganism are involved in the
production of biogas from agricultural feed stock (Biomass). Hydrolytic bacteria break down
complex organic waste into sugar and amino acids. Fermentative bacteria then convert those
products into organic acids. These acids will be converted to hydrogen, carbon dioxide and
acetate by acidogenic microorganism. Later, the methanogenic bacteria produce biogas using
the available acetic acid, hydrogen and carbon dioxide. Complete anaerobic condition favours
the biogas production. Cow dung is a source of biogas forming bacteria hence it was added as
inoculums [8-9]. The similar set up of anaerobic digester was formed for the biogas
production in the lab using airtight bottles. Bottles containing Cauliflower, Husk and Mixture
also shoed comparatively good amount of biogas formation. The lowest amount of biogas
was formed in the bottles containing areca nut and cow dung.
Sugarcane bagasse being rich in sugar and moisture serves as a good source of
nutrients for the anaerobic bacteria present in the cow dung to digests the bagasse effectively
generating good amount of biogas. This fact is supported by the carbohydrate fermentation of
sugars carried out using the material from the Bagasse bottle. Bottles containing Cauliflower,
Husk and Mixture also showed comparatively good amount of biogas formation. The lowest
amount of biogas was formed in the bottles containing areca nut and cow dung. In the cow
dung bottle there was no substrate available for anaerobic digestion hence gas formation was
less. .High content of cellulose in areca nut was difficult to digest for the bacteria present in
the cow dung. Hence there was no noticeable biogas formation. As bagassse has given good
yield, it can be used the large scale biogas production.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 8
This study identifies efficient feedstock materials to be used to generate maximum
biogas. Further efficiency check can be done by studying this under different environmental
factors and parameters. As this is a “mini pilot study”, it needs further qualitative and
quantitative analysis of biogas for large scale production. In the north and south part of
Karnataka and India, there are many sugar factories. [10] The bagasse generated can be
effectively used for the biogas production using cow dung to give clean, safe and smokeless
biogas for the beneficiaries. This co-digestion helps farmers to use own agricultural waste
together with other organic substrates. As a result, they can generate additional revenues by
treating and managing organic waste from other sources and by selling and/or using the
products viz heat, electricity and constant source of stabilised bio fertiliser [11]. By adding
large scale trial parameters,this concept can be applied from “Lab- to –Land” as a renewable
energy source.
ACKNOWLEDGEMENT
Authors thank the department of Microbiology, University College, Mangalore,
Karnataka for supporting the research work.
REFERENCES
1. A.C, Jeffery, J.V. Peter, J.J.B.R. William and. M.G. James, Predicting methane
fermentation. Biodegradability, Biotechnology and Bioengineering Nigerian Symposium,
11: 93-117, 1981.
2. G. L, Shukla and Prabhu, K. A. Bio-gas production from sugarcane biomass and agro-
industrial waste. Book Sugarcane: agro-industrial alternatives. 1995 pp. 157-170,ISBN
81-204-0948-5.
3. A. C. 1, Ofomatah and Okoye C. O. B. , The effects of cow dung inoculum and palm
head ash-solution treatment on biogas yield of Bagasse,International Journal of Physical
Sciences Vol. 8(5), pp. 193-198, 9 February, 2013, ISSN 1992 - 1950 ©2013 Academic
Journals
4. M. Hamed, El-Mashad and Ruihong Zhang, Biogas production from co-digestion of
dairy manure and food waste, Bioresource Technology, 101(11), 4021–4028, 2010
5. http://www.bioenergyconsult.com/anaerobic-digestion-crop-residues/
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 9
6. G Shelef,., H. Grynberg and S. Kimchie, 1981. High rate thermophilic aerobic digestion
of agricultural Symposium, 11: 341-342
7. B Garba, Zuru A, Sambo AS. Effect of slurry concentration on biogas production from
cattle dung. Niger. J. Renew. Energy 4(2):3843, 1996..
8. I.R. Ilaboya, F.F. Asekhame, M.O. Ezugwu, A.A. Erameh and F.E. Omofuma 1Studies
on Biogas Generation from Agricultural Waste; Analysis of the Effects of Alkaline on
Gas Generation, World Applied Sciences Journal 9 (5): 537-545, 2010, ISSN 1818-4952.
9. S. Ghosh, M.P. Henry and D.L. Klass,. Bioconversion of water hyacinth-coastal
Bermuda grass-MSW-Sludge blends to methane Biotechnology and Bioengineering
Symposium, 11: 163-187, 2000..
10. http://www.karnataka.com/industry/sugar/about-sugar/
11. http://www.yourarticlelibrary.com/industries/sugar-industry-in-india-growth-problems-
and-distribution/14144.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 10
JATROPHA CURCAS AS A BIODIESEL PLANT - MYTHS AND
FACTS
Geetaa Singh and Sudheer Shetty
Labland Biotech Private Limited, R & D Division, 8th K.M., K.R.S. Main Road,
Mysore 570 016, India
[email protected]; [email protected]
ABSTRACT The key energy factor that dictates a products’ cost is Energy. In fact, the national
economy is driven by the fuel prices on par with other key production factors like land, labour and capital. The shortage of petroleum fuels and undulating fuel prices have called for the use of alternative sources of energy in addition to the conservation methods. The Governments, all over the world have initiated the use of alternative sources for ensuring energy security, employment generation and mitigating carbon dioxide emissions. The initiatives have differed in different countries. However, biofuels have emerged as an ideal choice to meet these requirements. In India, Jatropha-based biodiesel has emerged as a strong contender. Jatropha is an underutilized, non-edible oil-bearing crop. It produces seeds that can be processed into non-polluting biodiesel. Under best utilization plan, Jatropha provides opportunities for good returns, climate improvement and rural development. The crop has special appeal, in that it is non-demanding crop and animals do not graze on it. However, many of the actual investments and policy decisions on developing Jatropha as an oil crop have been made without the backing of sufficient scientific knowledge. Realizing the true potential of Jatropha requires separating facts from the claims and half-truths. The current article discusses the facts and myths of the crop and the biodiesel obtained from it.Key words – Jatropha curcas, Biofuels, Biodiesel, National Biofuel Policy
INTRODUCTION
Jatropha curcas L. acquired global recognition as a biofuel crop in early 2000s with
multifarious economic attributes. As a result, it has been acclaimed as an economically and
environmentally sustainable feedstock for biofuel production [1]. In Asian countries,
especially in India and China, Governments have launched supporting programs for the
promising Jatropha cultivation and biodiesel manufacturing industries [2,3]. Expectations of
high yields with minimal inputs under marginal conditions have fuelled large investments into
cultivation systems, especially in developing and emerging economies [1,4]. The potential for
pro-poor development has motivated governmental and non-governmental organizations to
involve small-holder farmers in growing the energy crop [5,6,7]. Projects range from schemes
involving smallholders planting, windbreaks and hedge-rows to large monoculture plantations
spanning several thousand hectares [8]. However, ever since the initial wave of excitement
about Jatropha broke in around 2008, many projects have failed. Governments have not been
able to successfully accomplish the set targets as per the plan. Despite setbacks, Jatropha
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 11
production is still being promoted and new projects are being undertaken [8]. The biofuels
division of Labland Biotech Private Limited, Mysore started working on domestication of
Jatropha curcas as early as 2003. The research team has come to understand several of the
key issues pertaining to its cultivation, agronomic practices, oil production, oil
characterization, transesterification and economic feasibilities as a commercial crop. Thus, the
presentation is aimed at shedding light on the myths and facts based on the results obtained
during the course of the study in different agro-climatic regions in India.
OVERVIEW OF BIODIESEL PROGRAM IN INDIA
Apart from the energy crisis, utility of biofuels has a new dimension in the current
scenario. Rapid urbanization, depleting forests, developing industries, poor agricultural
management systems have all led to disastrous climate change, global warming and
diminishing water tables. Biofuels are renewable and biodegradable energy source and possess
environmentally beneficial characteristics. Hence, they are considered as promising
supplements for depleting fossil fuel. The production and use of biofuels has the potential of
reducing dependence on petroleum imports, improving environmental quality, promoting rural
development and creating job opportunities [9]. In India, transport sector is one of the major
consumers of petroleum products in the form of diesel. To mitigate the pressure on import
bill, during April 2003, the National Mission on Biodiesel was launched by the Government of
India (GoI), and identified Jatropha curcas as the most suitable tree-borne oilseed crop for
biodiesel production. Besides, it also set a trial blending ratios of 5, 10 and 20 per cent in
phased manner.
In order to achieve the set targets, the National Planning Commission integrated
Ministries of Petroleum, Rural development, Poverty alleviation, Environmental and other
ministries too. The national mission also planned to utilize about 11 million hectares (M ha)
of unused lands to be brought under cultivation with Jatropha [10]. To plant 11 M ha Jatropha,
the program became a “National Mission” and encouraged a mass movement. The
Government mobilized a large number of stakeholders including individuals, communities,
entrepreneurs, oil companies, business houses, industries, financial sectors, universities as well
as all the state Governments [11,12]. The respective ministries initiated attractive and luring
programs for Jatropha nursery development, plantation on forest and non-forest lands, seed
collection and oil extraction centers, transesterification units, blending and marketing
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 12
arrangements, research and development (R&D) studies to fill gaps in knowledge. In order to
manage the entire program, State and National Biodiesel Board was created.
SALIENT FEATURES OF THE INDIAN BIOFUEL POLICY
The Government of India (GoI), approved India’s National Biofuel Policy on
December 24, 2009. The policy encouraged the use of renewable fuels as an alternative to
petroleum and to supplement India’s fuel supply with 20 % Biofuel (bioethanol and biodiesel)
mandate by 2017 with the following salient features [13]:
• Derive biofuel from non-edible feedstock grown on degraded soils or wastelands which
are not suited for agriculture thus avoiding conflict of food Vs fuel.
• Strengthen India’s energy security by encouraging use of renewable energy resources to
supplement motor transport fuels. An indicative 20 % target for blending of biofuel for
both biodiesel and bioethanol is proposed by end of 12th Five-Year Plan (IFY 2012/13
through fiscal 2016/17).
• Minimum support price (MSP) mechanisms for non-edible oilseeds to provide fair prices
to oilseed growers (subject to periodic revision).
• Oil Marketing Company’s (OMC) to purchase ethanol at a minimum purchase price
(MPP) based on the actual cost of production and import price of ethanol. In the case of
biodiesel, the MPP should be linked to the prevailing retail diesel price.
• If necessary, GoI proposes to consider creating a National Biofuel Fund for providing
financial incentives, including subsidies and grants, for new and second generation feed
stocks, advanced technologies and conversion processes, and production units based on
new and second-generation feedstock.
• Thrust for innovation, (multi-institutional, indigenous and time bound) research and
development on biofuel feedstock (utilization of indigenous biomass feedstock included)
production including second generation biofuels.
• Meet the energy needs of India’s vast rural population by stimulating rural development
and creating employment opportunities and addressing global concerns about
containment of carbon emissions through use of environment friendly biofuels.
• Bring biofuels under the ambit of “Declared Goods” by the GoI to ensure their
unrestricted interstate and intrastate movement. Except for a concessional excise duty of
16 percent on bioethanol, no other central taxes and duties are proposed to be levied on
biodiesel and bioethanol.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 13
• Biofuel technologies and projects would be allowed 100 % foreign ownership through
automatic approval to attract foreign direct investment (FDI), provided the biofuel is for
domestic use only, and not for export. Plantations of non-edible oil-bearing plants would
not be open for FDI participation.
• Setting up of National Biofuel Steering Committee (NBSC) under Prime Minister to
provide policy guidelines.
CURRENT STATUS OF JATROPHA BIODIESEL, POST BIOFUEL POLICY
The central and several state Governments have revised and continued to provide fiscal
incentives for supporting the planting of Jatropha and other non-edible oil seeds. Several
public institutions, Government departments, state biofuel boards, state agricultural
universities and co-operative sectors are also supporting the biofuel mission in various
capacities [13]. A strong Institutional mechanism is proposed by the national biofuel policy to
set up a National Biofuel Co-ordination Committee (NBCC) headed by prime minister. The
NBCC provides policy guidance on different aspects of biofuel development, promotion, and
utilization. It also serves as the principle GoI coordinator for the array of different GoI
agencies and ministries with more minor roles in determining India’s biofuel policy. The
committee meets periodically to review the progress and monitor the biofuel program. NBSC
mandates that various state governments must work closely with respective research
institutions, forestry departments, and universities for developing and promoting biofuel
programs in their respective states. However, to date, few states have actually drafted any
policies and/or set up institutions for promoting biofuel in their states. Several ministries have
been allocated specific roles and responsibilities to deal with different aspects of biofuel
development and promotion [13].
Despite a sound commencement, the programs are facing considerable challenges in its
implementation. Biofuel production accounts for only one per cent of its global production
[14]. Since the Indian biofuel policy does not permit exports of domestic production, it is not
quantified as on date. Particularly, the biodiesel industry is still young and relatively small.
Till date, commercial sales of Jatropha biodiesel is not in place. Small quantities produced
are used up for various in-house research programs and to blend in the diesel generator as is
done at Labland, Mysore. A small quantity is being sold to other research institutions, public
entities which run blended fuels, and to unorganized consumers.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 14
CLAIMS OF JATROPHA CURCAS
Jatropha is seen by many to be the perfect biodiesel crop. It can be grown in poor soils
actually generating top soil as it grows. It is drought and pest resilient, and it has seeds with
up to 40 % oil content. The positive attributes can be broadly classified as follows:
1. Positive social effects
• Enables local / rural development
• Creates jobs / labour needed
• Generates income
• Does not compete with food production
2. Positive environmental effects
• Reclaims marginal soils
• Conserves, protects and improves soils
• Protects against erosion
• Producer of CO2 neutral biofuel
3. Positive utilities of by-products
•Seed cake - as fertilizer with insecticidal properties
•Seed cake - converted to briquettes/pellets & fed to boilers
• Oil is used to make medicated soap
• Fruit rind & other biomass - fertilizer or attempts to convert the biomass to liquid
(ethanol) energy
• Glycerin - in pharma/cosmetic industries
4. Other uses
• Various parts have medicinal utilities
• Plant part extracts used as insecticide/pesticide
• Latex is used as dye to color the fabric
Finally, complete content and organizational editing before formatting. Please take note of
the following items when proofreading spelling and grammar.
MYTHS AND FACTS OF JATROPHA
The very basic concept of biodiesel of Jatropha began very hastily and projected the
crop as a miracle crop or a wonder plant. In most countries, including India, it was politicized
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 15
and was projected differently by different people. It means different things to different people
in different sectors (scientists, financiers, investors, politicians, beurocrats, entrepreneurs etc.).
Interpretations may mean whatever their interpreter wanted them to mean - Relational and
Contextual. It was endlessly constructed, deconstructed and reconstructed rapidly and
differently on space and place. More than a socio-economic and scientific requirement, it is
politicized for vested interests. But, over a period of about a decade of commercial research,
we can now comprehend and distinguish between the myths and facts detailed in Table 1.
TABLE 1. The myths and facts of Jatropha curcas as a biodiesel plant.
Myth Fact
Wild and IllusiveNot really domesticated. Holds potential to become an important economic crop like Tea/Coffee.
Grows on poor, dingy soilsDoes not grow well enough to be economically interesting crop. Garbage in – Garbage out !!
It is a weedNot perpetual. Not dispersed by wind, water, animals or mechanical means. Not a weed. Anti-propaganda!!
Most water demanding; Does not require fertilizers
It needs both; but not a hogger. It is a low intensity agri-crop unlike corn, soy, sugarcane, banana. In Mysore-like conditions, about 20L/plant/week is required during summer to obtain anticipated yields.
Insect/pest resistant
In mono-culture, insects visit for pollination (Increases yield !!). Undesirable insects also visit. Healthy plants can sustain attacks. Appropriate agronomic practices have to be followed.
Labor intensive
Provides rural employment. Annual pruning, harvesting, seed processing can provide employment opportunities @ 1000 for 1000 Acres directly and indirectly.
Toxic and harmful
Unpalatable to animals. It is non-edible hence a top crop for Biofuels in India. Does not attract Food Vs Fuel debate. Curcin is a Lypoprotein that causes intense spasm in the abdomen leading to diarrhea and vomiting. Not lethal unless consumed in large quantities.
Provokes / Prevents cancerLatex is used as medicine. Enough proofs are available to use against skin rashes. It is not carcinogenic.
Developmental opportunity for small scale farmers and poor
communities
In Africa it may be true. For Indian scenario, it should be cultivated as Tea/Coffee plantation model in large acreages. Becomes sustainable for stake-holders and employees.
Economically not viableViable on large acreage. Breaks even in 5th year. By-products add to revenue. Use of quality
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 16
Myth Fact
planting material, appropriate cultivation practice, favourable policies in the initial years with tax holiday and subsidies will make it a reality.
JATROPHA PLANTATIONS – AROUND THE WORLD AND IN INDIA
Despite setbacks, Jatropha production is still being promoted and new projects are
being undertaken all over, especially in Asia and Africa. In 2008, 242 Jatropha plantations
were found to cover an estimated total area of some 9,00,000 hectares according to a study by
GEXSI, 2008 [15]. At that time, most Jatropha plantations were located in Asia (84%) and
covered land areas totaling almost 8,00,000 hectares - chiefly in Myanmar, India, China and
Indonesia. Around twelve per cent of the total hectares planted were located in Africa
(approximately 1,20,000 ha), mostly in Madagascar and Zambia, but also in Tanzania and
Mozambique. Latin America accounted for approximately 20,000 hectares of Jatropha,
mostly located in Brazil [15]. From today’s perspective, projections on the development of
Jatropha plantings were rather optimistic at that time: 4.7 million expected hectares
worldwide by 2010 and 12.8 million hectares by 2015. It was assumed that Indonesia would
be the largest Jatropha producer in Asia in 2015 with 5.2 million hectares. Ghana and
Madagascar were expected to have the largest plantation areas in Africa (6,00,000 ha and
5,00,000 ha), and Brazil was projected to be the largest producer in Latin America with 1.3
million hectares [15].
As of 2011, a total of 11,91,625 hectares were planted with Jatropha trees by the
reporting projects in a survey made by Wahl et al. [8]. Out of the total hecterage, 72 per cent,
that is more than 8,60,000 hectares, are cultivated by five large projects in Asia ranging from
1,00,000 hectares to the largest project of 2,50,000 hectares in size. The remaining 106
projects cultivated a total of around 3,31,000 hectares are located in Asia (30 additional
projects) emphasizing that Asia still has a dominant role to play in Jatropha cultivation [8].
CURRENT ACTIVE PLAYERS IN THE BUSINESS OF JATROPHA BASED BIODIESEL IN INDIA
In India, the wave of Jatropha business was sowed by D1 Oils private limited, U.K. as
early as 2003. A number of private entities came to light and gradually disappeared too. As
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 17
on date, either in association with Government bodies, or Oil Manufacturing Companies, some
private entrepreneurs are pursuing in the business. Major organizations and institutions
working on commercial scale of Jatropha cultivation are Indian Oil Corporation in association
with Ruchi Soya Industries Limited; Bharat Petroleum Corporation Limited; Hindusthan
Petroleum Corporation Limited in association with Chattisgrah Government and S. G.
Biofuels, USA under the banner of CHBL; Nandan Biomatrix, Hyderabad; Shirke Biofuesl,
Pune; Tinna Oils and Chemicals, New Delhi; Reliance Life Sciences, Kakinada; Emami
Biofuels, Calcutta and Labland Biotech Private Limited, Mysore.
CONTRIBUTIONS OF LABLAND BIOTECH TO JATROPHA PLANT SCIENCE
Labland Biotech started the research on Jatropha plant science and the biodiesel in
2003 by collecting different species of Jatropha and studied the taxonomy and species
identification. About nine species, significant for breeding experiments were characterized
and maintained in the demo plot. Labland has standardized package of practice for large-scale
Jatropha cultivation with very unique techniques of pruning, optimum watering, fertilizers
application, diseases and their management, the by-products and its effective utilization [16].
Labland possess more than 500 accessions, collected from different agro-climatic regions of
India and Africa in its demonstration plot [17,18]. Further, the team has made a comparative
study of seed yield and oil content of these accessions and is an ongoing program for
developing improved accessions. From these unique collection, about 20 superior selections
have been identified as parental lines for hybrid seed production and specific high yielding
hybrids have been produced for scaling up the Jatropha seed production. Labland has
developed its own seed orchards and clonal orchards of these superior accessions and has
evolved successful methods for quality seed selection, developed certification standards for
breeder’s seeds [18,19]. Some of the improved seed technology procedures like breaking the
seed dormancy, rapid seed germination techniques, embryo rescue work [20], production of
quality seedlings, exceptional nursery techniques, seed storage techniques and seed health
testing that are pending patent have also been developed. The in-house Research and
Development team has also developed cost-effective and eco-friendly cultivation methods for
maximizing the seed output by amalgamating the integrated approach of chemical fertilizers &
biofertilizers [20-24]. The team has extensively worked on the development of tissue culture
protocol and mass multiplication of Jatropha curcas [25-27] and also improved the in vitro
rooting efficiency in the tissue cultured regenerants [28-30]. Further, the tissue culture
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 18
generated plants have been evaluated for the genetic fidelity and have evaluated the field
performance [31]. In order to study the occurrence of apomixis in J. curcas among the
accessions collected and maintained in Labland’s germplasm bank, experiments were carried
out in 30 different accessions by applying the standard procedure of emasculation and bagging
the female flowers. The studies have confirmed the occurrence of apomixis in J. curcas at low
levels. About 16 % of the accessions showed the occurrence of apomixis. In these accessions,
the apomixis ranged between 7.6 % and 33.3 %. Apomixis is very frequently associated with
polyploidy, hybridization and genomic instability. The possibility of exploiting the apomictic
ability of J. curcas to stabilize hybrid vigour and to maintain high yielding stocks has also
been studied in detail [32].
The seed oil extraction using different organic solvents has been evaluated [33]. The
Jatropha oil and biodiesel has been characterized and compared with mineral diesel [34]. The
effect of storage conditions and storage duration of Jatropha seeds, its effect on oil yield and
free fatty acid content has been worked out in detail [35].
The antimicrobial activity of Jatropha leaf and stem extracts against pathogens of
anthuriums and banana plants have been evaluated [36,37] The results of this investigation
were promising for controlling secondary nursery diseases caused by fungal and bacterial
pathogens of banana and anthuriums effectively. The utility of commercial chemical control
agents are often considered quick, easy, and inexpensive solution for controlling disease. But,
the use of Jatropha stem and leaf extract was a method of biological control to reduce
pesticide contamination in our environment.
CONCLUSIONS
India is heavily dependent on crude oil import. India’s diesel consumption is about 70
million tonnes and imported almost about 80% of the requirement in 2012, pushing the oil
import bill to about USD 120 billion. That is to say that we spend almost about USD 330
million on our oil imports every day. India’s energy future remains in its natural resources for
the production of alternative sources of fuel such as biodiesel. There is an incredible
opportunity to narrow India’s energy imbalance and reinvest a part of USD 330 million spent
daily on oil imports to support these efforts through a commitment to the production of
biodiesel and other innovation and the introduction of technologies that reduce dependence on
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 19
foreign energy [38]. Under this scenario, it is apparent that alternative energy source becomes
inevitable. Blending Jatropha oil with conventional fossil fuel makes the project eligible from
replacement to environmental issues. When compared to other feedstocks such as soybean,
rapeseed, pongamia, mahua etc; Jatropha stacks up nicely in India. However, some of the
constraints that are prevailing with our experience are that it is capital intensive for large scale
plantation establishment, there is limited supply of quality planting material, land availability
(Major hindrance), difficulty in establishing a rational supply chain with smaller land-holders,
ownership issues with Government / Community-owned waste lands, labor intensive at one
point of time, technology-driven and Government’s tardiness in executing the policies. The
Biodiesel industry through Jatropha has an enormous future growth, as it is commodity
product. Implementing the use of biofuels is being considered by most of the countries on a
mission-mode approach. There are more than 10 million hectares under Jatropha plantation
worldwide and millions of hectares are being converted within the next 5 years. Evolution of
newer varieties will lead to establishment of better plantations all over the world. Huge scope
remains for plant science R & D; biofuel related R & D. Huge employment opportunities will
await when plantations are planned and government schemes can be best utilized. By-product
utilization and management will prove to be a bigger industry by itself. The need of the hour
remains that a serious action on the implementation of National Biofuel Policy has to be taken
up by both State and Central Governments. Land bank should be made available to
entrepreneurs on subsidized lease charges. Instead of funding for installation of refineries,
state Governments should prioritize the establishment of biofuel plantations in collaboration
with village panchayats.
The time has come to chart out a clear and detailed roadmap for the development of
biofuels. A strong impetus must be provided to expand and accelerate R & D efforts in this
direction. If we undertake efforts to develop local and indigenous production of transportation
fuels, we may meet up to 40 per cent of the transportation fuel market in the future by using
biodiesel. Clearly, we need to push biofuels in the energy sector, which is crucial to attain a
sustainable and secure future!
ACKNOWLEDGEMENT We wish to acknowledge Mr. Saeid Nikdad, research scholar, R & D Division of
Labland Biotech, Mysore for his involvement and help during the preparation of this
manuscript.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 20
REFERENCES1. R. Renner, “Green gold in a shrub. Entrepreneurs target the Jatropha plant as the next big
biofuel” Scientific American, vol. 296, No. 6, pp. 20-23, 2007.
2. H. Weyerhaeuser, Tennigkeit T., Yufang S. and Kahrl, F. “Biofuels in China: an analysis
of the opportunities and challenges of Jatropha curcas in Southwest China,” Beijing,
China: World Agroforestry Centre. ICRAF Working Paper, No. 53, 2007.
3. V. Pandey, Singh, K., Singh J., Kumard A., Singh, B. & Singh, R. “Jatropha curcas: a
potential, biofuel plant for sustainable environmental development, Renewable and
Sustainable Energy” Reviews, vol. 16, No. 5, pp. 2870-2883, 2012.
4. J. van Gelder, German, L. and Bailis, R. “Biofuels investments in tropical forest-rich
countries:implications for responsible finance” Sustainability Accounting, Management
and Policy Journal, vol. 3, No. 2, pp. 134-160, 2012.
5. W. Achten, Maes W., Aerts R., Verchot L., Trabucco A., Mathij, E., Singh, V. and Muys
B. “ Jatropha: From global hype to local opportunity” Journal of Arid Environments, vol.
74, No. 1, pp. 164-165, 2009.
6. FAO “Jatropha: a smallholder bioenergy crop. The Potential for pro-poor development”
Rome, Italy: Food and Agriculture Organization of the United Nations (FAO), 2010.
7. L. German, Schoneveld G., and Pacheco P., “The social and environmental impacts of
biofuels feedstock cultivation: evidence from multisite research in the forest frontier,
Ecology and Society, vol. 16, No. 4, Art. 24, Available at: http://dx.doi.org/10.5751/ES-
04309-160324, 2011
8. N. Wahl, “Insights into Jatropha Projects Worldwide Key Facts & Figures from a Global
Survey. Surveyed and published by Centre for Sustainability Management, Leuphana
University of Lüneburg, and INOCAS, GmbH, Lüneburg. ISBN 978-3-942638-28-9.
pp.72, 2012.
9. S. Kumar, Alok Chaube, Shashi Kumar Jain. “Critical review of jatropha biodiesel
promotion policies in India” Energy Policy, Vol. 41, pp. 775–78, 2012.
10. D. Rajagopal, “Implications of India’s Biofuels policies for food, water and the poor”
Water Policy, vol. 10 Supplement 1, pp. 95-106, 2008.
11. A. Kumar, Kapil Kumarb, Naresh Kaushik , Satyawati Sharma, Saroj Mishra. Renewable
energy in India: Current status and future potentials. Renewable and Sustainable Energy
Reviews vol. 14, pp. 2434–2442, 2010.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 21
12. MNRE 2008. National policy on Biofuels, Government of India.
www.petroleum.nic.in/Bio-Diesel.pdf
13. India. Biofuels Annual. Jul 2014. http://www.agrochart.com/en/news/news/140714/india-
biofuels-annual-jul-2014/
14. P. Shinoj, Raju S. S. Ramesh Chand, Praduman Kumar and Siwa Maangi. Policy Brief.
ICAR report 36. http: //www.ncap.res.in
15. GEXSI: Global market study on Jatropha. Final report prepared for the World Wide Fund
for Nature (WWF). London, UK / Berlin, Germany: Global Exchange for Social
Investment (GEXSI), 2008.
16. Anonymous. In-house R & D annual reports of Labland Biotech Private Limited, Mysore
for year 2005-2008.
17. S. Nikdad, Gurukar A. and Shetty S., “A comparative study of seed yield and oil content
of Jatropha curcas L.” Abstract published in the State level Seminar on “Past, present
and future perspectives of Jatropha as a biodiesel plant” organized by the department of
Botany and Seed Technology, Sahyadri Science College, Kuvempu University, Shimoga
on February 22-23, 2010.
18. S. Nikdad, “Biotechnological approach to improve yield in Jatropha curcas L.” Thesis
submitted to the University of Mysore for the award of Ph. D. with all the work carried
out at Research and Development division of Labland Biotech Private Limited, Mysore,
2015.
19. S. Nikdad, and Shetty S., “An initial study on the commercial production of hybrid seeds
in Jatropha curcas L.” Abstract published in the State level Seminar on “Past, present and
future perspectives of Jatropha as a biodiesel plant” organized by the department of
Botany and Seed Technology, Sahyadri Science College, Kuvempu University, Shimoga
on February 22-23, 2010.
20. Nandini-Mohan, Saeid Nikdad and Geetaa Singh, “ Studies on germination profile and
embryo culture of Jatropha curcas L. selection under in vitro conditions”,
Biotechnology, Bioinformatics and Bioengineering, vol 1, Issue 2: 187-194, 2011.
21. Saritha G. Pandit, Manju-Joseph and Geetaa Singh, “Effect of different concentrations of
NPK on growth, seed yield and seed oil content in Jatropha curcas L. plants” in the
Abstracts of “National Women Science Congress”, organized by Karnataka State Women
University, Bijapur on 5th & 6th December, 2008.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 22
22. G. Saritha-Pandit, Joseph M., and Singh G., “Effect of different concentrations of NPK
on growth, seed yield and seed oil content in Jatropha curcas L. plants” Pariprashna,
Vol IV, Issue-II & vol V, Issue I, pp. 58-64. 2010.
23. Manju Joseph, Saritha-Pandit G. and Geetaa Singh, “A study on the role of biofertilizers
on growth, seed yield and oil content of Jatropha curcas L.” in the Abstracts of “National
Women Science Congress”, organized by Karnataka State Women University, Bijapur on
5th & 6th December, 2008.
24. M. Joseph, Saritha-Pandit G. and Singh G., “Effect of biofertilizers on Biodiesel plant
Jatropha curcas L.” Pariprashna, Vol IV, Issue-II & vol V, Issue I, pp.23-30. 2010.
25. G. Singh and Shetty S., Provisional patent on “Micropropagation of Jatropha curcas”
with the Indian Patent Office on July 14, 2009 with the serial number 01673/CHE/2009.
26. G. Singh and Shetty S., International patent on “A method for Micropropagation of
Jatropha curcas” on July 14, 2010 with the application number PCT/IN2010/000469,
having a publication number WO/2011/021211.
27. G. Singh, “Importance of Tissue Culture in improvement and mass multiplication of
Jatropha curcas L., the biodiesel plant”, Abstracts published in the State level Seminar
on “Past, present and future perspectives of Jatropha as a biodiesel plant” organized by
the department of Botany and Seed Technology, Sahyadri Science College, Kuvempu
University, Shimoga on February 22-23, 2010.
28. “Evaluation of in vitro rooting efficiency in Jatropha curcas, a biodiesel plant”, A
dissertation submitted by Shalini Koshle, VI Semister, M. Sc. (Biotechnology), Boston
college for professional studies, Jiwaji University, Gwalior with all the work carried out
at Research and Development division of Labland Biotech Private Limited, Mysore,
2015.
29. S. Koshle, Saritha-Pandith G., Mohana C. R. and Geetaa Singh, 2010. Evaluation of in
vitro rooting efficiency in Jatropha curcas – the biodiesel plant. Abstract published in
the State level Seminar on “Past, present and future perspectives of Jatropha as a
biodiesel plant” organized by the department of Botany and Seed Technology, Sahyadri
Science College, Kuvempu University, Shimoga on February 22-23, 2010.
30. G. Singh and Shetty S., Evaluation of in vitro rooting efficiency in the biodiesel plant
Jatropha curcas. Biotechnology, Bioinformatics and Bioengineering, vol 2, Issue 1: 591-
596, 2012.
31. G. Singh and Shetty S., “Field evaluation of genetic fidelity and agronomic performance
of Tissue Culture-generated Jatropha curcas plants” In: Abstracts of First International
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 23
and Third National Conference on ‘Biotechnology, Bioinformatics and Bioengineering,
page 19, 2013.
32. S. Nikdad, Singh G. and Shetty S., “Occurrence of apomixis in Jatropha curcas L.
accessions at Mysore, Karnataka, India.” In: Abstracts of First International and Third
National Conference on ‘Biotechnology, Bioinformatics and Bioengineering, pp. 168.
2013.
33. “Evaluation of oil extraction efficiency of different organic solvents from Jatropha
seeds” A dissertation submitted by Swati Bhagwat and Deepa Hegde, VI Semister, B. Sc.
(Biotechnology), Department of Biotechnology, St. Agnes College, Mangalore work
carried out at Research and Development division, Labland Biotech Private Limited,
Mysore, 2008.
34. “Extraction and characterization of Jatropha oil and its methyl esters” A dissertation
submitted by Kiran Menon, Department of Biotechnology, Vellore Institute of
Technology for the award of the degree of B. Tech. Biotechnology to the Deemed
University, Vellore Institute of Technology, Vellore work carried out at Research and
Development division, Labland Biotech Private Limited, Mysore, 2008.
35. “Effect of storage conditions and storage duration on oil yield and free fatty acid content
in Jatropha curcas L” A dissertation submitted by Lavanya R. K., Pavithra L., and
Rajalakshmi P., Department of Biochemistry, University of Mysore for the award of the
degree of Master of Science, work carried out at Research and Development division,
Labland Biotech Private Limited, Mysore, 2014.
36. Antimicrobial Activity of Jatropha curcas Leaf and Stem Extract against Isolated
Anthurium Plant Pathogens, March, 2014. A dissertation submitted by Ms. Ashwini C.
Raj, IV Semester, M. Sc., Microbiology, Department of Microbiology, Maharani’s
Science College for Women, Mysore.
37. Antimicrobial Activity of Jatropha curcas Leaf and Stem Extract against Isolated Banana
Plant Pathogens, March, 2014. A dissertation submitted by Ms. Keerthana T., IV
Semester, M. Sc., Microbiology, Department of Microbiology, Maharani’s Science
College for Women, Mysore.
38. GE Global research bulletin, 2015. http://qz.com/247213/why-india-is-spending-330-
million-a-day-on-imported-oil-and-gas
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 24
BIODEGRADATION OF AZO DYES BY HALOBACILLUS SP.Shivdas Nayak and Rama Bhat P.*
Department of Post Graduate Studies and Research in Biotechnology
Alva’s College, Moodbidri – 574 227, Karnataka, India
*Corrsponding author
E-mail: [email protected]
ABSTRACTAzo dyes are synthetic organic compounds which are extensively used as a colouring
agent in industries. They are stable and resistance to temperature and light but are degraded by bacteria under anaerobic and aerobic conditions. The present investigation was carried out with the objectives such as isolation, screening of microorganisms, standardization of techniques, characterization of enzymes and biodegradation of two selected azo dyes namely, Reactive Magenta and Reactive Blue 220. Halobacillus species were isolated and cultured in high sodium chloride containing medium produced an enzyme azoreductase. Different biochemical test were performed for their purification and characterization. The degradation analysis was done using HPLC. The enzyme was confirmed as azoreductase E.C. 1.7.1.6, a NADPH dependent enzyme. The degradation of reactive magenta was up to 94.14% and reactive blue was 96.24%. Key words: Azo dyes, azo reductase, biodegradation, Characterization, Halobacillus
INTRODUCTION
The azo dye class accounts for 60-70% of all dyes used globally, they all contain an
azo group -N=N-, which links two sp2 hybridised carbon atoms. These carbons may be a part
of aromatic systems. Most azo dyes contain only one azo group, but some of them may
contain two (disazo), three (trisazo) or more. The textile industry is estimated to consume as
much as two-third of the total annual production of dyes [1]. Since the first commercial
synthetic dye, Mauveine, was discovered in 1856, more than 100 000 dyes have been
generated worldwide with an annual production in excess of 7 x 105 metric tonnes [2]. Azo
dyes are the largest and most versatile class of dyes and are commonly used to dye various
materials such as textiles, leathers, plastics, cosmetics and food [3, 4]. They are the major
group of dyes used in the textile industry and contribute between 50-65% of the colours in
textile dyes [1, 5]. The inefficiencies in the dyeing process results in dyestuff losses between
2-50% to the waste water with the lower limit for basic dyes and the upper for azo dyes.
Ultimately these dyes find there way to the environment and end up contaminating rivers and
groundwater in the locale of the industries [1].
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 25
The presence of potentially toxic compounds in wastewaters from textile dyeing
industries shows colour in wastewater which is highly visible and affects esthetics, water
transparency, and gas solubility in water bodies, alter the pH, increase the Biochemical
Oxygen Demand (BOD) and Chemical Oxygen Demand (COD) and thereby make aquatic
life difficult [6]. Azo dyes are the most toxic of the dye types. Many studies have been
conducted showing the toxic potential of azo dyes. The problem associated with azo dyes is
created by the dye metabolites. After releasing dyes into the aquatic environment, they may
be converted into potentially carcinogenic or mutagenic amines [7,8,9]. Substituted benzene
and naphthalene rings are common constituents of azo dyes, and have been identified as
potentially carcinogenic agents [10]. While most azo dyes themselves are non-toxic a
significantly larger portion of their metabolites [11].
The azo dye toxicity and places of mechanism in order of their frequency of citation.
Brown and DeVito (1993) [12] postulated that Azo dyes may be toxic only after reduction
and cleavage of the azo linkage, producing aromatic amines. Azo dyes with structures
containing free aromatic amine groups that can be metabolically oxidized without azo
reduction may cause toxicity. Azo dye toxic activation may occur following direct oxidation
of the azo linkage producing highly reactive electrophilic diazonium salts.
Several treatment methods are available for the decolourization of textile effluents.
These include physiochemical methods such as filtration, specific coagulation, use of
activated carbon and chemical flocculation. Some of these methods are effective but quite
expensive [13, 14]. Some of the microorganism used in biodegradation of azo dyes is
Pseudomonas putida, Streptomyces viridosporus, Phanerochaete chrysosporium, Bacillus
sp., Stenotrophomonas sp. etc. It is quite evident that the biologic waste treatment processes
are sometimes more efficient and less expensive than physical/chemical waste treatment
procedures, hence it would be desirable to provide a biological process using microorganisms
that degrade xenobiotic azo dyes. The objectives of the present investigation were
I. isolation and screening of azo dye degrading microorganisms,
II. Standardization of process and parameters (temperature, pH, incubation time,
nitrogen source),
III. to study biodegradation and characterization of enzyme
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 26
MATERIALS AND METHODS
Collection of sample and isolation, and screening on selective media: Water samples and
soil samples were collected from the estuarine region of the Suratkal, an industrial area near
Mangalore. The medium used for the growth of organisms was a modified MEM (Minimal
Essential Media) with only 0.1g of peptone, 100mg of dye and 5 % sodium chloride for the
better growth of halophillic bacterium. Inoculum was mixed by gentle rotation of the Petri
plates (serial dilution method). Colonies of different microorganisms were observed for the
morphological features and observed under microscope. Then Gram staining method was
followed for identification.
Biochemical characterization: The sum of all the chemical reactions that occur within living
organism. Tests such as indole test, methyl red test, Vogus proskauer test, citrate utilization
test, casein hydrolysis, lipid hydrolysis, hydrogen sulfide production test, catalase test,
oxidase tests were carried out.
Degradation: Degradation studies were carried out in Minimal Essential Media broth with
the inoculation of isolated microorganism. The degradation studies were performed for 17
days, till the dye was decolourised. Estimation of degradation was carried out by
spectrophotometric method on alternate days and finally HPLC analysis of the azo dye
concentration was done.
Spectrophotometric estimation of degradation: The concentration of a substance in
solution can be measured by calculating the amount of absorption of light at the appropriate
wavelength or a particular colour. The concentration of azo dyes was determined
spectrophotometrically. Azo dyes, the corresponding reduction products, and the metabolites
from conversion were analyzed at their respective wavelengths on alternate days. The
spectrophotometric analyses were compared with a uninoculated media as blank and
percentage of degradation were calculated by using the following formula:
% Degradation = Initial OD - Final OD X 100
Initial OD
The base line performance absorbance for methyl red dye is 430nm and Reactive blue
220 is 660nm.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 27
HPLC Analysis of degradation: HPLC is one of the mode of chromatography which is a
most widely used analytical technique. It is a separation technique involving mass transfer
between stationary and mobile phase. It is a tool for quantifying and analyzing mixtures of
chemical compounds. It is used to find amount of a chemical compound within a mixture of
other chemicals. Mobile phase was prepared was prepared by mixing HPLC grade methanol
and acetonitrile in the proportion 80: 20.
Cell count determination: Bacterial population or amount of growth can be determined by
measuring turbidity or optical density of a broth culture. The turbid a suspension the less light
will be transmitted through it, since turbidity is directly proportional to the no. of cells. This
property is used as an indicator of bacterial concentration in the sample. The cell suspended
in a culture interrupt the passage of light allowing less light to reach the photoelectric cells
and the amount of light energy transmitted through the suspension is measured as percentage
of transmission on the spectrophotometer as 0-100%. The density of the cell suspension is
expressed as absorbance or optical density which is directly proportional to the cell
concentration. Absorbance is the logarithmic value and is used to plot bacterial growth on a
graph. Cell count is measured by reading the optical absorbance of the sample at 600nm and
comparing it with a blank with uninoculated media. Cell count can be calculated by the
following formula:
Cell count = O.D of blank at 600nm - O.D of sample at 600
ENZYME ASSAY: ENZYME ASSAY IS CARRIED OUT TO CHECK THE ACTIVITY OF ENZYME PRESENT IN BOTH CRUDE AS WELL AS PURIFIED PRODUCT. ENZYME ASSAY OF THE SAMPLES WAS CARRIED OUT ON ALTERNATE DAYS.Enzyme assay unit = (660nm/min Test - 660nm/min Blank) 2.3 X Df
g X 0.1
where,
2 = Volume
Df = Dilution factor
g = Millimolar extinction co efficient of azo dye
0.1= Volume of enzyme in ml
The protein was determined by Lowry’s method [15].Isolation and purification of
enzyme by ammonium sulphate precipitation method [16].
Dialysis: Activation of dialysis membrane pre treatment, 6 cm of dialysing membrane taken
and boiled it in 100 ml of distilled water for 10 minutes with slow stirring. Then decant the
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 28
membrane from the boiling water and placed it in 100ml of boiling water containing 2%
sodium bi carbonate. Again replace it in fresh boiling water bath for 10 minutes. Activated
membrane is aken, tie it with a thread on one side and pour the pellet dissolved in phosphate
buffer then tie it on the other side. The dialysis tube was kept on magnetic stirrer at 220-250
rpm for 3 hours in 500ml of distilled water.
Ion exchange chromatography: Ion-exchange chromatography (or ion chromatography) is
a process that allows the separation of ions and polar molecules based on their charge. It can
be used for almost any kind of charged molecule including large proteins, small nucleotides
and amino acids.
SDS PAGE: PROTEIN PROFILING WAS PERFORMED BY SDS-PAGE USING 10% ACRYLAMIDE. PROTEIN BANDS WERE STAINED WITH COOMASSIE BRILLIANT BLUE R-250 [16].RESULTS
The colonies grown over the azo dye containing medium were found to be creamish
white, round, shiny, opaque in morphology and was found to show a zone of degradation
around the colony. The results of Gram staining showed that the microorganisms were Gram
positive short rods in morphology (Fig. 1).
Fig. 1: Culture with Gram positive rods
The results for the various biochemical tests performed for characterization of isolated
microorganisms are tabulated in Table 1.
Table 1: Biochemical characterization
TestCulture
1Culture
2Control Inference
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 29
Gram staining + + No Purple coloured short rodsIndole + + No Cherry red colour on the top
Methyl red + - No Yellow to red colourVogues
proskauer- - No No change in colour
Citrate utilization
+ + No Green to blue colour
Catalase + + No Bubbles were formed
Starch hydrolysis + +Clear zone around the culture in
iodineCasein
hydrolysis+ + Clear zone around the culture
Cellulase - - No growthGelatin
hydrolysis- - No solidification
Carbohydrate test
+ +
Glucose + + No No gas formationSucrose + + No No gas formationLactose + + No No gas formationUrease - - No No change in colour
H2S - - No change in colourLipase + + Clear zone around the colony
Oxidase - - No purple colour
Fig.2: Indole test
Formation of cherry red colour ring on the top shows a positive result for the
production of enzyme tryptophanase as shown in figure 2.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 30
Methyl red test was found to be positive by the change in colour from yellow to red,
VP test was found to be negative as there was no change in colour observed and for citrate
utilization showed a positive result, which is indicated the production of blue (Figs. 3-5).
Fig. 3: Methyl red test Fig. 4: Vogues Proskauer test
Fig. 5: Citrate utilization test
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 31
Fig. 6- Catalase Test
Bubbles were produced when the bacterial culture was inoculated into Hydrogen
peroxide as shown in figure 6, which confirms the production of enzyme catalase. Casein
hydrolysis was successfully done by the microorganisms by production of some enzymes like
proteinase caseinase, bacterium was able to break the peptide bond present in the media by
the enzyme caseinase, which was shown a clear zone of utilization around the colony.
Fig. 7: Starch Hydrolysis Test
Starch was hydrolysed to simpler glucose units by the production of enzyme amylase,
which could be confirmed by a clear zone around the microbial colony on addition of iodine,
as shown in figure 7. Gelatine hydrolysis was found to be positive which was shown by the
hydrolysis of the solid media to liquid mass.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 32
Fig. 8: Urease Test
Urease test was found to be negative, since there was no change in colour and no
production of urease enzyme shown in figure 8. Lipids present in the media were
successfully utilized by microorganisms, which showed the production of enzyme lipase.
Carbohydrate test was found to be positive indicated by the change in colour from yellow to
red by production of acid but no gas bubbles were observed. H2S test was found to be
negative, since there was no black colour formed by the incorporation of heavy metal
complex FeS around the inoculation.
DEGRADATION OF DYES
Fig. 9: Degradation of Reactive magenta Fig. 10: Degradation of Reactive blue 220
Figure 9 showed the effect of degradation on Reactive magenta after 17 days of
degradation, in this figure the first flask is a control and the second flask is contains degraded
azo dye at the end of 17 days, which is degraded upto 94.14%. The effect of degradation on
Reactive blue 220 after 15 days of degradation is shown in the figure 10. Here the first flask
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 33
is a control and the second flask is contains degraded azo dye at the end of 15 days, which
showed degradation upto 96.24%.
In comparison with the degradation effect on Reactive magenta and Reactive blue
220, Reactive blue 220 was degraded to 96.24% in 15 days where as Reactive magenta was
degraded to 94.14% in 17 days (Fig. 11). Degradation in Reactive blue 220 was uniform till
the end of 9th day and than it showed a sudden increase on 11th day and than it was uniform
and quite constant. On the other hand degradation in Reactive magenta dye was uniform till
11th day and than showed quite greater increase in degradation till the end of 15th day and
than remained uniform till the end.
Fig. 11: Spectrophotometric analysis of Azo dye degradation
HPLC ANALYSIS OF AZO DYE DEGADATION
HPLC analysis of dye degradation clearly shows that the dye was reduced to below
detectable level within a period of 15 days (Figure 12 and table 2). The total no. of cells
observed in the coarse of degradation are shown Fig. 13, it shows that there are two peaks in
the graph for both Reactive magenta as well as Reactive blue 220. Cell count with respect to
Reactive magenta was to a maximum at the end of day 7 than suddenly dropped down on the
9th day, finally cell count again increased gradually and remained almost constant. Cell count
in the Reactive blue 220 also showed 2 peaks but the first peak was very small which
0102030405060708090
100
0 5 10 15 20
% D
EGRA
DAT
ION
DAYS
red
blue
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 34
declined by the end of 7th day, than it showed a rapid increase till the 13th day than remained
almost constant.
Table 2: HPLC analysis of azo dye degradation
Sample Reactive magenta (mg) Reactive Blue 220(mg)
DAY 1 1.768 3.47
DAY 7 1.61 3.21
DAY 15 Below detectable level 3.17
Fig. 12: HPLC analysis of azo dye degradation
Fig. 13: Cell count determination
The results of enzyme assay for Reactive magenta, Reactive blue 220s as tabulated in
Fig. 14 shows that the enzyme activity was constantly increasing from day to day and was
0
1
2
3
4
0 2 4 6 8 10 12 14 16Dye
con
cent
ratio
n in
mg
DAYS
DEGRADATION
red
blue
00.20.40.60.8
11.21.41.61.8
0 2 4 6 8 10 12 14 16 18
OD
at 6
00nm
DAYS
red
blue
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 35
found to be maximum at the end. The protein contents present in the purified enzyme is
lesser than the amount of protein present in the crude sample, which is showed in the figure
15. 200µg/ml of proteins was found to be present in Reactive magenta containing media,
where as 300 µg/ml of proteins were found to be present in Reactive blue 220 containing
media.
Fig 14: Azoreductase enzyme assay
Fig. 15: Protein estimation
It is clear that the isolated azoreductase enzyme is a thermostable enzyme (Fig. 16).
Both of these azoreductases are able to show maximum activity at a temperature around 500
C. They showed a maximum activity in the range of 300-500C. The enzyme is a acidic
1E-11
0.001
0.002
0.003
0.004
0.005
0.006
0.007
0.008
0.009
0 2 4 6 8 10 12 14 16 18 20
Opt
ical
den
sity
Days
red
blue
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
20 40 60 80 100 120 140 160 180 200 220 240 260 280 300 320 340
O.D
at 6
60nm
Concentration
Red = crude RV13Orange = pure RV13Blue = crude RB200sky blue = pure RB220
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 36
azoreductase enzyme, since it has maximum activity at a pH around 6 and it suddenly drops
the activity on reaching the alkaline phase (Fig. 17).
Fig. 16: Effect of temperature on azoreductase activity
Fig. 17: Effect of pH on azoreductase activity
The protein profile analysis of the isolated azoreductase enzyme by SDS-PAGE
shown in figure 18, there was a thick band which was close to the band of 65 kDa, which
indicated that the molecular weight of the azoreductase enzyme was found to be around 65
kDa.
1E-071.01E-05
2.01E-053.01E-054.01E-05
5.01E-056.01E-057.01E-058.01E-05
0 20 40 60 80 100
Enzy
me
activ
ivity
in u
nits
Temperature °C
red
blue
0
0.000002
0.000004
0.000006
0.000008
0.00001
0.000012
3 4 5 6 7 8 9 10
enzy
me
activ
ity in
uni
ts
pH
BLUE
red
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 37
Fig. 18: SDS PAGE showing protein bands
DISCUSSION
The isolated bacterial species was confirmed as species of Halobacillus by Gram
staining and biochemical tests.
In this study, the freshly isolated Halobacillus species was capable of growing and
producing the enzyme azoreductase in high concentration of sodium chloride. The studies
carried out on two reactive azo dyes confirmed that the enzyme efficiently reduced the azo
dye to a colourless reduced product. Reactive Magenta was reduced upto 94.14% and
reactive blue220 upto 96.24 % by spectrophotometric analysis, within a period of 17 days.
The isolated bacterial azoreductase enzyme readily cleaved more than 2 types of azo
dyes. An extracellular azoreductase enzyme, E.C.1.7.1.6 is responsible for the
decolourization activity, which is in support of earlier works [14, 17]. The enzyme is a
NADPH dependent azoreductase. NADPH is required as a cofactor which enhances the azo
reduction when supplied externally to the reaction mixture; this study also supports the earlier
work [18].
The molecular weight of azoreductase obtained was found to be quite different,
around 65 kDa by SDS-PAGE analysis. This enzyme was unlike the earlier reports which
65 kDa
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 38
showed a molecular weight of 21 and 30 kDa from Pseudomonas species [19] and 28 kDa
from Enterobacter agglomonas [20].
More surprisingly the enzyme was found be an acid azoreductase, which had a
maximum activity at pH 6, unlike alkali azoreductase in the earlier reports [14]. The enzyme
isolated was also found to be a thermostable enzyme since the temperature maximum was
around 500C which is in favour of several earlier reports [18, 21, 22].
REFERENCES
1. R.M. Melgoza, A. Cruz and G. Bultron,. Anaerobic/aerobic treatment of colorants present
in textile effluents. Water Sci. Technol., 50: 149-155, 2004.
2. H. Zollinger, Color Chemistry: Syntheses, Properties and Applications of Organic Dyes
and Pigments. VCH Publications, New York, 496p., 1991.
3. R. Anliker, Ecotoxicology of dye stuffs. A joint effort by industries. Ecotoxicol. Environ.
Saf. , 3: 59-74, 1979.
4. S. M. Blumel, M. Contzen, A. Lutz, Stolz and H. J. Knackmuss, Isolation of a bacterial
strain with the ability to utilize the sulfonated azo compound 4-carboxy-4′-
sulfoazobenzene as the sole source of carbon and energy. Appl. Environ. Microbiol., 64:
2315-2317, 1998.
5. K. T. Chung, S. E. Stevens and C. E. Cerniglia, The reduction of azo dyes by the
intestinal microflora. Crit. Rev. Microbiol., 18:175-190, 1992.
6. S. O. Ajayi, O. Osibanjo, The state of environment in Nig. Pollution studies of textile
industries in Nigeria. Monagra, 1: 76-86, 1980.
7. K.T. Chung and C.E. Cerniglia, Mutagenicity of azo dyes: structure-activity relationships.
Mutation Res., 277: 201-220, 1992.
8. K.T. Chung, The significance of azo-reduction in the mutagenesis and carcinogenesis of
azo dyes. Mutation Research, 114, 269-281, 1983.
9. T.P. Cameron, T.J. Hughes, P.E. Kirby, V.A. Fung and V.C. Dunkel, Mutagenic activity
of 27 dyes and related chemicals in the Salmonella/microsome and mouse lymphoma
TK+/- assays. Mutation Research, Genetic Toxicology Testing, 189: 223-261, 1987.
10. IARC, IARC Monographs on the Evaluation of the Carcinogenic Risk of Chemicals to
Humans, Suppl. 4, Chemicals, Industrial Processes and Industries Associated with
Cancer in Humans (IARC Monographs, Volumes 1 to 29), Lyon, IARC. 1982.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 39
11. R, Ganesh,. Fate of Azo Dyes in Sludges, Masters Thesis. Polytechnic High performance
degradation of azo dye acid orange 7 and sulfanilic acid in a laboratory scale reactor after
seeding with cultured bacterial strains. Water Res. 37 (11): 2757-63. 2003.
12. M.A. Brown and S.C. De Vito, Predicting azo dye toxicity. Critical Reviews in
Environmental Science and Technology, 23: 249-324, 1993.
13. T. Do, J. Shen, G. Cawood and R. Jeckins, Biotreatment of textile effluent using
Pseudomonas spp. Immobilized on polymer supports. In: Advances in biotreatment for
textile processing. Hardin IR; Akin DE & Wilson JS (Eds). University of Georgia Press.
2002.
14. J, A. Maier, A. Kandelbauer, A.Erlacher, Cavaco–Paulo and G.M. Gubits, A new alkali
thermostable azoreductase from Bacillus sp. Strain SF. Applied Environ. Microbial. 70:
837-844, 2004.
15. N. J. Lowry, A.Rosebrough, L. Farr, and R. J. Randall, Protein measurement with the
Folin phenol reagent. J. Biol. Chem. 193:265-275, 1951.
16. A. Manikam, and S. Sadashivam, Biochemical Methods, 3rd Edition, New Age
International Publishers, New Delhi, pp.54-60, 2008.
17. Walker, R., Gingell, R. and Murrells, D. F. 1971. Mechanisms of azo reduction by
Streptococcus faecalis. Optimization of assay conditions. Xenobiotica, 221-229. 17
18. K.C. Chen, J.Y. Wu, D.J. Liou and S. Ch. J. Hwang, Decolorization of textile dyes by
newly isolated bacterial strains. J. Biotechnol., 101: 57-68, 2003.
19. T. Zimmermann, H.G. Kulla, T. Leisinger, Properties of purified orange II azoreductase,
the enzyme initiating azo dye degradation by Pseudomonas KF46. Eur. J. Biochem., 129:
197-203, 1982.
20. Y. Moutaouakkil, F.Z. Zeroual, M.Dzayri, K. Talbi, Lee, and M. Blaghen. Bacterial
decolorization of the azo dye methyl red by Enterobacter agglomerans Annals of
Microbiology, 53: 161-169, 2003.
21. Arun Prasad and K.V. Bhaskara Rao, Aerobic biodegradation of azo dye Acid Black-24
by Bacillus halodurans . Journal of Environmental Biology, 35: 549-554, 2014.
22. K. Matsumoto, Y. Mukai, D. Ogata, F. Shozui, J.M. Nduko, S. Taguchi and T. Ooi,
Characterization of thermostable FMN-dependent NADH azoreductase from the
moderate thermophile Geobacillus stearothermophilus. Appl Microbiol Biotechnol. 86(5)
: 1431-1438, 2010
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 40
PRODUCTION, OPTIMISATION, CHARACTERISATION AND PARTIALPURIFICATION OF L-ASPARAGINASE FROM ASPERGILLUS NIGER
Manisha Shetty, Prateeksha Chelkar, Jenitta Emima Packiyam. E*Rama Bhat. P, Jayadev K.
Department of Post Graduate Studies and Research in BiotechnologyAlva’s College, Moodbidri – 574 227, Karnataka, India
*Corrsponding authorE- mail: [email protected]
ABSTRACTThe genus Aspergillus is important economically, ecologically and medically. It is
cosmopolitan and ubiquitous in nature with over 185 species. They are able to secrete large amounts of their own proteins. Observation made in this work holds great promise for production of L-asparaginase enzyme. It proves that Aspergillus niger is a potent strain for the L-asparaginase production .The studies also revealed that different types of culture media differentially influenced the growth, colony, character and sporulation of the fungi. Out of the three test media (CDM, SDA and PDA), PDA was found to be suitable for highest sporulation. The maximum growth was seen on day 4th (optimum day). Optimization of fermentation parameters such as carbon source and nitrogen source play an important role in enzyme production and are suitable for maximum activity of enzyme. The molecular mass of isozymes varies from 50 to100 kDa. The molecular mass of partially purified L-asparaginase was determined by using SDS-PAGE technique. In this study different substrates like saw dust, coir pith and straw were used for the maximum production of enzyme.
INTRODUCTION
Aspergillus niger is a morphologically complex organism, showing different
morphologies at different times of its life cycle, differing in form between surface and
submerged growth and also differing with the nature of the growth medium and physical
environment .Especially the genus Aspergillus, frequently applied in enzyme production due
to the GRAS status (generally regarded as safe), has received particular attention. Due to
enormous development of genetic engineering and efficient expression systems, Aspergillus
species have also achieved increased attention as host for industrial production of
homologous and heterologous proteins [1].The enzyme L-asparaginase [L-asparagine amino
hydrolase, (E.C. 3.5.1.1)] is an important component in the treatment of pediatric acute
lymphoblastic leukemia and catalyzes the hydrolysis of asparagine and glutamine into
aspartic acid and ammonia.Asparaginase is produced by submerged fermentation of the
asparaginase production strain using a fermentation medium composed of food-grade (or
equivalent) raw materials.The media components are important criteria for fungal culture and
study, along with important physiological parameters that lead to maximum sporulation in
fungi [2]. Aspergillus is capable of utilizing large amount of carbon sources .The carbon
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 41
concentration had a positive effect on enzyme production and high titres can be obtained in a
medium rich of carbon source.Next to carbon, nitrogen has pronounced the influence on
enzyme production. The presence of additional nitrogen sources along with nitrogenous
compounds present in the substrate promotes enhanced growth and consequent enzyme
production.Agricultural wastes like coir, paddy straw and saw dust which are sometimes
disposed off in municipal bins or outside for rotting could serve as an ideal substrate for
production of cellulases. Cellulose is commonly degraded by an enzyme called cellulase.
This enzyme is produced by several microorganisms, commonly by bacteria and fungi [3].
Although a large number of microorganisms are capable of degrading cellulose, only a few of
these produce significant quantities of cell free enzymes capable of completely hydrolysing
crystalline cellulose invitro. Fungi are the main cellulase producing microorganisms, though
a few bacteria and actinomycetes have also been reported to yield cellulaseactivity.Hence, the
present study was carried out to determine the cellulolytic enzyme activity of Aspergillus
niger against rice straw, coir waste and saw dust as carbohydrate source.
MATERIALS AND METHODS
Sample collection and identification of fungi: Boiled white rice sample was collected from
Alva’s hostel in a sterile container and kept for isolation at room temperature, for 5 - 6 days
.Fungi was identifiedby lactophenol blue method and the preparation was examined under
40X magnification for the presence of characteristic mycelia and fruiting structures.
Selection of production media: The inoculums were prepared by fungal cultivation on a
rotary shaker at 180 rpm in 250 ml Erlenmeyer flask containing100ml of Czapek Dox
Medium (CDM), Sabourad’s Dextrose Agar (SDA), Potato Dextrose Agar ( PDA)
separately. pH was adjusted to 6.0 before sterilization. The medium was autoclaved at 121°
C. After sterilization organism was inoculated and culture flasks were incubated in orbital
shaker (160rpm) at room temperature. After 4th day of incubation, filtrates of media were
isolated,the OD readings and dry mycelial weight were taken every 24 hour interval for seven
days.
ENZYME ASSAY
L- Asparaginase: Screening of isolates for L- asparaginase production by rapid-plate assay
was performed.The isolates were screened for L-asparaginase activity using the following
method. The media used for the screening the enzyme producing Aspergillus strain was
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 42
modified media, L-asparagine incorporated with a pH indicator (phenol red). Incubated at
room temperature for 5-6 days. L-asparaginase activity was identified by formation of a pink
zone around colonies. Two plates were prepared using modified media supplemented with
phenol red (0.009%) used as an indicator and the other plate agar was without L-asparagine.
Crude Enzyme Extraction: The crude enzyme from the fermented substrate was extracted
using 0.1M phosphate buffer (pH 8). After mixing the fermented substrate with 41 ml of
buffer, the flasks were kept on a rotary shaker at 150 rpm for 30 min. The slurry was
centrifuged at 10,000 rpm for about10 min at 4°C in a cooling centrifuge. Supernatant was
collected and used for enzyme assay.
Asparaginase assay: The activity of L-asparaginase was determined by the method of Imada
et al., 1973 [4] in which the amount of ammonia liberated from L-asparagine was estimated.
One unit (U) of L-asparaginase was defined as the amount of enzyme that liberates 1μmole of
ammonia under optimal assay conditions. Enzyme yield was expressed as the activity of L-
asparaginase per gram dry substrate (U/ml). Colour developed was read after 10-15 min at
450 nm in a UV-Visible spectrophotometer.
Estimation of proteins: The protein content of the enzyme was determined by Lowry’ s
method [5]. The amount of protein mg/g or 100g sample was obtained.O.D was taken at
660nm.
Effect of carbon source: To determine the effect of carbon sources on enzyme yield,
different carbon sources were tested. Glucose, mannitol, maltose, lactose and xylan were
added separately to the production medium (PDA) as a carbon source KH2PO4, MgSO4,
CuSO4, FeSO4, MnSO4, ZnSO4 and yeast extract were added to the media as
microelements.pH of the media was adjusted to 6 prior to sterilization. Enzyme activity was
checked at OD 400 nm. Mycelial dry weight was taken.
Effect of nitrogen source: In thesynthetic medium along with glucose, NH4Cl, NH4NO3,
CH4N2O, peptone, (NH4)2SO4, NH4H2PO4 were added.KH2PO4, MgSO4, CuSO4, FeSO4,
MnSO4, ZnSO4 were added to the media as microelements.pH of the media was adjusted to 6
prior to sterilization. Enzyme activity was checked at 400 nm.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 43
PURIFICATION OF ENZYME
Partial purification (acetone preparation): Acetone (66%) was added to the crude enzyme
extract. The precipitate was collected by centrifugation, dissolved in the minimal volume of
20 mM buffer (pH7). Decant and properly dispose of the supernatant, being careful not to
dislodge the protein pellet.
Dialysis: The partially purified enzyme was dialyzed overnight against 5mM phosphate
buffer of pH 7at 4° C.
DEAE- cellulose chromatography: The enzyme solution obtained in the above step was
applied to DEAE-cellulose column pre equilibrated with phosphate buffer (pH 7). The
enzyme was eluted with the same buffer. At each step of purification, enzyme activity and
amount of protein was estimated.
SDS-PAGE (SDS-polyacrylamide gel electrophoresis): SDS-PAGE was performed with
25mM tris/192mM glycerin buffer (pH8.3) that contained 0.1 %(w/v) SDS as the running
buffer.
Standard marker as protein: The commercially available standard proteins were prepared
at a concentration of 1mg/ml. The standard markers used were bovine serum albumin and
lysozyme.
Effect of different substrates on enzyme production: Different substrates like coconut coir,
paddy straw and saw dust were used to check the enzyme activity and production. 1g of each
of the coir,paddy straw and saw dust was added to the production media (Potato Dextrose
Broth), incubated for a week and the following enzyme assay was carried out.
Determination of reducing sugars and cellulase activity: The total amount of reducing
sugars in 1.0ml supernatant was determined by modified Dinitro salicylic method (DNS)
Dinitrosalicyclic method (DNS): The culture filtrate was collected from the fermentation
media by centrifugation. 1 ml of culture filtrate was taken in a test tube and it was equalized
with 2ml of distilled water. To the prepared culture filtrate, 3 ml of DNS reagent was added.
The contents in the test tubes were heated in a boiling water bath for 5 min. After heating, the
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 44
contents were allowed to cool at room temperature. At the time of cooling, 7 ml of freshly
prepared 40% sodium potassium tartarate solution was added. After cooling, the samples
were read at 540 nm in a U.V. spectrophotometer. The amount of reducing sugar was
determined using a standard graph.
RESULT AND DISCUSSION
Maintenance of pure culture: Aspergillus niger was cultivated on potato dextrose agar and
the spores were stored for longer period for the utilization of the organism in different trials
[Fig .1].
Fig. 1: Maintenance of pure culture
IDENTIFICATION OF THE FUNGUS
Growth pattern: Colonies were seen as perfectly round to oval to irregular in shape. On the
10th day mature colonies with spores were seen as structures in the form of numerous black
dots. The elevation of colonyappeared as raised. The colony margin was entire to undulate.
Reverse of petriplate was white to paleyellow and growth produced radial fissures in the agar.
Selection of Production medium: Aspergillus niger was cultured in three different
production media for a week like Czapeks dextrose medium (CDM) and sabourad’s dextrose
agar(SDA) and potato dextrose broth(PDA). PDA proved to be the best media for mycelial
growth. PDA found to be most suitable for heavy sporulation and PDA was selected on the
basis of mycelial weight and dry biomass weight
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 45
Optimum day: Maximum activity was seen on the fourth day and Potato Dextrose Broth was
chosen as the production medium for the subsequent experiments. Activity of the crude
enzyme was measured using L-asparagine as a substrate and the absorbance was monitored at
445 nm [Table 1, Fig.2].
Table 1: Optimum day for substrate concentration
Period of Cultivation(days) Mycelial dry weight Enzyme activity(U/ml)
Day 1 61.5 mg 26.1Day 2 80 mg 36.5Day 3 110 mg 55.06Day 4 250 mg 60.13Day 5 475.1 mg 32.5Day 6 88.4 mg 24.7Day 7 20.4 mg 12.6
Fig. 2: Figure showing the period of cultivation
L- asparaginase rapid plate assay: Asparaginase activity was identified by the formation of
a pink zone [Fig. 3] around colonies on the modified M9 agar medium using phenol red as an
indicator.
0
10
20
30
40
50
60
70
Day 1 Day 2 Day 3 Day 4 Day 5 Day 6 Day 7
ENZY
ME
ACTI
VITY
(U/m
l)
PERIOD OF CULTIVATION(DAYS)
Mycelial dry weight
Enzyme activity(U/ml)
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 46
Fig. 3: Modified medium showing the pink colonies
L- asparaginase activity [4] is the amount of enzyme which liberates 1μ mole of
ammonia per minute under assay conditions and was found to be 8.416 U/ml.
Protein: The amount of protein present in crude enzyme filtrate obtained from production
medium was estimated. The amount of protein present in crude enzyme from production
media was found to be 52μg/ml.
Effect of various Carbon sources
Baskar and Renganathan (2011) reported that glucose was found to be best carbon
source for maximum L-asparaginase production using modified czapek-dox media containing
soya bean flour. Chankya and Pallem (2011) reported that Aspergillus tamarri exhibited
maximum activity using glucose as carbon source. In the present study the effect of different
carbon sources like glucose, mannitol, maltose, lactose and xylan on enzyme production were
estimated, the enzyme activity was found to be highest in maltose which is 29.562U/ml and
the mycelial dry weight was highest in lactose which is 0.786 gm [Table2].
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 47
Table 2: Effect of different carbon sources on enzyme production
CARBON SOURCEBIOMASS DRY WEIGHT
(gm)ENZYME
ACTIVITY(U/ml)XYLAN 0.620 26.943
MALTOSE 0.752 29.562GLUCOSE 0.721 28.187
MANNITOL 0.752 14.940LACTOSE 0.786 18.560
EFFECT OF NITROGEN SOURCES
Gaffar and Shethna, (1977) observed the positive effect of [9] supplementation of
ammonium sulphate in the production of L-asparaginase has reported that ammonium
sulphateexhibited the maximum production of asparaginase enzyme. In the present study, the
effect of different nitrogen sources like NH4Cl, NH4NO3, CH4N2O, peptone, (NH4)2SO4,
NH4H2PO4 were added. KH2PO4, MgSO4, CuSO4, FeSO4and MnSO4 were added as the
microelements to the media and the enzyme production was studied, the enzyme activity was
found to be highest in peptone which is 28.396U/ml [Table3].
Table 3: Effect of different nitrogen sources on enzyme production
NITROGEN SOURCEBIOMASS DRY WEIGHT(gm)
ENZYME ACTIVITY(U/ml)
Ammonium nitrate 0.622 17.394Ammonium dihydrogen
phosphate0.778 25.722
Sodium nitrate 0.742 17.575Peptone 0.667 28.396
Urea 0.589 13.312Diammoniumsulphate 0.915 28.154Ammonium chloride 0.782 24.842
Enzyme purification: Enzyme was purified from the culture plates using acetone
precipitation, dialysis and DEAE-column chromatography
Table 4: Enzyme activity after different purification steps
Sample Concentration of proteinEnzyme activity
(U/ml)Crude extract 0.52 11.002After dialysis 0.4 10.99
After ionexchange chromatography 0.04 5.981
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 48
Table 5: Enzyme activity after acetone precipitation
O.DEnzyme activity after acetone
precipitation(U/ml)400 6.282450 6.436500 4.455550 4.224600 4.994
SDS PAGE
Dhanam Jayam (2013) reported that molecular weight of L-asparagine was 42 kDa. In
the present study we got the molecular weight of L-asparaginase as 54 kDa and 55 kDa.
[Table 6] and [Fig.4].
Fig. 4: Protein profile of L- asparaginase
Table 6: Gel profiles of SDS-PAGE
Lane 1 54 kDaLane 2 55 kDa
EFFECT OF SUBSTRATES
Cellulase Assay
Muniswaram et al., (1994) used banana stalk and coconut coir for production of
cellulases [12] reported the higher enzyme yield using different ratios of rice straw and wheat
bran using Aspergillus sp. In the present study, the cellulase activity was found to be more in
coconut coir (104.50U/ml) and paddy straw(108.60U/ml) as compared to saw dust [Table 7]
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 49
Table 7: Effect of different substrates on enzyme production
AGRO WASTES ENZYME ACTIVITY(U/ml)
Coconut coir 104.507Saw dust 18.300
Paddy straw 108.600
CONCLUSION
The observation made in this work holds a great promise for production of L-
asparaginase enzyme. It proves that Aspergillus niger is a potent strain for the L-
asparaginase production and the studies also revealed that different types of culture media
differentially influenced the growth, colony, character and sporulation of the fungi. Out of the
three test media (CDM, SDA and PDA), PDA was found to be suitable for highest
sporulation and the maximum growth was seen on day 4th (optimum day) and optimization of
fermentation parameters, carbon source, nitrogen source. Maltose as carbon source showed
maximum enzyme activity, whereas among nitrogen sources peptone proved to be suitable
for maximum activity of enzyme. Substrates such as coconut coir, paddy straw showed
maximum enzyme activity as compared to saw dust.
REFERENCES
1. Wang Nam, Sum , Enzyme purification by ammonium sulphate precipitation, Department
of chemical engg Unit of Maryland Park MD, 2074-2111,2005
2. A Saha, P Mandal,S Dasgupta,D Saha , Influence of culture media and environmental
factors on mycelial growth and sporulation of Lasiodiplodiatheobromae (pat.). Griffon
and Maubl. Journal Of Environmental Biology, 29(3) 407-410,2008
3. G Immanuel ,R Dhanusa,P Prema, A Palavesam Effect of different growth parameters on
endoglucanase enzyme activity by bacteria isolated from coir retting effluents of estuarine
environment. Int. J.Environ.Sci.Tech., 3 (1): 25-34,2006
4. S Imada,K Igarasi, Nakahama and M Isono, .Asparaginase and Glutaminase Activities of
Microorganisms, Journal Genetics Microbiology, 76(1): 85-99,1973.
5. OH Lowry ,HJ Rosenbrough,AL Faar and R Randall,Protein measurement with the
Folinphenol reagent. J. Biol. Chem., (193), 265-275, 1951.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 50
6. G Baskar,SRenganathan , Design of experiments and artificial neural network linked
genetic algorithm for modelling and optimization of L-asparaginase production by
Aspergillusterreus MTCC 1782. Biotechnology and Bioprocess Engineering.,(16): 50-
58,2011.
7. Chanakya Pallem,V Nagarjun, and M Srikanth, Production of a tumor inhibitory enzyme,
L-asparaginase through solid state fermentation using Fusariumoxysporum, International
Journal of Pharmaceutical Sciences Review and Research., 7(2), 189-192,2011.
8. SA Gaffar,YIShethn , Purification and some biological properties of Asparaginasefrom
Azotobactervinelandii, Appl Environ Microbiol., 33:508–514,1977.
9. V Sreenivasulu,KN Jayaveera and PRaoMallikarjuna, Optimization of process parameters
for the production of L-asparaginase from an isolated fungus, Research J. Pharmacognosy
and Phytochemistry.,1(1), 30-34,2009.
10. G DhanamJayam and S Kannan ,Deparment of Environmental studies,L-asparaginase-
Types, Perspectives and Applications,Review Article,Advanced Biotech.,2013.
11. Muniswaran, PitchaiveluSelvakumar and CharyuluNarasimha NCL, Production of
cellulasesfrom coconut coir pith in solid state fermentationTechnology and
Biotechnology.,Vol 60, Issue 2, pages 147–151,1994.
12. S W Kang ,YS Park , JS Lee ,SI Hong and SW Kim,Bioresource Technology., 91, 153–
156,2004
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 51
ISOLATION OF ANTIBIOTIC PRODUCING ACTINOMYCETESFROM SOIL, PURIFICATION AND CHARACTERISATION
Gagana.B, Jenitta Emima Packiyam E*,Ragunathan R1.
Department of Post Graduate Studies and Research in Biotechnology
Alva’s College, Moodbidri – 574 227, Karnataka, India
.1SynkroMax Biotech Private Limited, Chennai.
*Corrsponding author
E- mail: [email protected]
ABSTRACT
Today more than 30,000 diseases are clinically described, less than one third of the diseases can be treated symptomatically and only a few can be cured. Actinomycete is a potential produces of many antibiotics. Antibiotics are the secondary metabolites, the type of antimicrobial used specifically against bacteria are often used in the treatment of bacterial infections. They may either kill or inhibit the growth of bacteria and few are active against fungi, protozoan and are toxic to human and animals. In the present study antibiotics were produced from actinomycetes, isolated from Western Ghats soil. The arecanut husk was used as the supplement for the media preparation. The amount of product obtained was high compared to the normal production media used. The crude antibiotics were then purified by using dialysis membrane and the quality of the product was checked by UV spectrophotometer and FTIR. The antibiotics are made to be produced and are tested against different bacterial species like Staphylococcus, Bacillus., Pseudomonas, Klebsiella, Salmonella, Streptococcus, and E. coli strain – 1,2,3 by well diffusion method. The antibiotics produced using Actinomycets exhibited good inhibition for E. coli strain 1 and 2.
INTRODUCTION
Actinomycetes are the most economically and important valuable prokaryotes able to
produce wide range of bioactive compounds and enzymes. The majority of actinomycetes are
free living, saprophytic bacteria found widely distributed in soil [1] water and colonizing
plants. Actinomycetes population has been identified as one of the major group of soil
population, which may vary with the soil type. They cover around 80% of total antibiotic
product [2] with other genera trailing numerically. Due to large geographic variation, there is
large variation in soil type and their contents in Tamil Nadu and hence it is quite likely that
the distribution of antibiotic producing, Actionmycete is also vary [3]. Several distinct
antibiotics have now been isolated from cultures of Actinomycetes. Some of the antibiotics
are produced in simple synthetic media; others are formed in complex organic substrates; still
others, like streptomycin, require the presence in the medium of a specific nutritive
substance, an “activity factor,” which is either a precursor or a prosthetic group of an enzyme
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 52
system essential for the production of the antibiotics agent [4]. It has now been definitely
established that a considerable proportion of all actinomycetes that can be isolated from soils
or other natural substrates have the capacity of inhibiting the growth of, and even of
destroying, bacteria and other microorganism. This was brought out emphatically in several
of the surveys that have been made on the distribution of antagonistic properties among
actinomycete [5-7].The selective antimicrobial activities of Actinomycete differ greatly, both
quantitatively and qualitatively [8], as could easily be demonstrated by their respective
antibiotic spectra. The nature of the active agents or the antibiotics produced by these
organisms depends upon the species; frequently upon the strain; the composition of the
medium in which it is grown, and the conditions of cultivation [9].The Actinomycetes are
Gram positive bacteria having high G+C (>55%) content in their DNA [10]. The present
study was aimed at isolating antibiotics from Actinomycetes capable of acting on clinically
resistant strains of infectious organisms and evaluates its antimicrobial activities.
MATERIALS AND METHOD
Soil samples: Soil samples were collected by sterile method from Echanar, Tamil Nadu,
India. Soil samples were air dried under room temperature for 2 weeks before isolation.
Isolation of Actinomycetes producing antimicrobial compound: One gram of soil samples
was suspended in 100ml sterile distilled water,and then homogenized by vortex mixing.
Mixtures were allowed to settle and serial tenfold dilutions up to 10-4 were prepared by using
sterile distilled water , isolation was carried out on actinomycetes isolation agar plates (in
duplicate) by spreading . The plates were incubated at 250C for 7 days. Actinomycetes
colonies were recognized on basis of morphological characteristics by Gram’s staining
method.
Identification of Actinomycetes: The morphological and cultural characteristics of the
Actinomycetes were determined by naked eyes examination of 7th, 14th and21thday’s old
cultures grown on selective media.
Production of antimicrobial compound using starch casein broth: Isolated colonies were
transferred from actinomycetes isolation agar medium into starch agar medium, pH 7.2 and
incubated at 280C for 3 days. Coloration of aerial mycelium (on the surface of agar), substrate
mycelium (underside of plate) and diffusible pigment were observed.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 53
Arecanut husk as substrate for antibiotics production: One gram of dried arecanut husk
was powdered and added along with starch casein 0.25g, NaCl 0.25g, MgSO4 0.1g, KH2PO4
0.1g and H2O 50ml. The flask was inoculated with actinomycetes and was kept in shaker for
3 days at 120rpm. At the end of the fermentation period, the content of each flask was
centrifuged at 10,000 rpm for 5 min at 4oC. The supernatant was used as a source of enzyme
and analyzed for enzyme activity.
Extraction of antimicrobial compound using different solvents: Broth was taken and
centrifuged at 10,000rpm for 20 min to separate the mycelia biomass; the supernatant was
obtained and separated by filtration using what man filter paper. Certain solvents used for
extraction of antimicrobial compound like butanol, ethyl acetate (1:1) ratio. Supernatant
mixture was agitated for 1hour with homogenizer and the solvent was separated by separating
funnel. All extracts obtained through this method were assayed for antimicrobial study
against different microbes.
Test microorganisms used for antimicrobial activity: The bacterial cultures used during
the study includes Staphylococcus, Bacillus, Pseudomonas, Klebsiella, Salmonella,
Streptococcus and E. coli strain 1,2,3. The organisms were cultured and maintained in the
nutrient agar media.
Purification of antibacterial compound:Purification of the compound was performed using
Column chromatography using sephadox gel by dialysis membrane.
Identification of antimicrobial compound:The structure elucidation of the compound was
performed by using UV-FTIR.
PCR amplification:PCR was carried out in 50ml volumes containing 2mM MgCl2 , 2U Taq
polymerase (JMR holdings, USA), 150mM of each dNTP, 0.5mM of each primer and 2ml
template DNA. Primer F1 (59-AGAGTTTGATCITGGCTCAG-39; I=inosine) and primer R5
(59-ACGGITACCTTGTTACGACTT-39) were modified from primers Weisburget al.
(1991). Primer F1 binds to base position 7-26 and primer R5 to base positions of the 16S r
RNA gene of Streptomyces the PCR programmer used was an initial denaturation (960C for 2
mins) , 30 cycles of denaturation (960C for 45sec), annealing (560C for 30sec) and extension
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 54
(720C for 2 mins), and a final extension (720C for 5 minutes). The PCR products were
electrophoresed on 1% agarosegels, containing ethidium bromide (10 mg/ml), to ensure that a
fragment of the correct size had been amplified.
Restriction endonuclease digestions and analysis: PCR amplified DNA for PDS 1 a digestion
was purified using the PCR purification kit (qiagen). No pre-treatment of the DNA was
required for the other restriction endonucleases. Restriction digestions were incubated at 370C
for 3-4 hr. Samples were electrophoresed on 15% agarose gels containing ethidium bromide
(10mg/ ml). The restriction fragment patterns were compared manually with those from the in
silico restriction end nuclease digestions.
RESULTS
Actinomycetes were isolated from the soil sample on a selective media. A pinpointed
colony with zone of inhibition was observed [Fig.1]. The presence of relatively large
populations of Actinomycetes in the soil sample indicated their sources in the tropical
ecosystem.
Fig.1: Actinomycete colonies in plates containing selective media
Production and purification of antimicrobial compound: Actinomycetes isolated from
selective media was subjected to the extraction of antimicrobial compound. The extract
obtained through this method [Fig. 2] was further used for antimicrobial study against
different microbes.After purification of the antimicrobial compound using column
chromatography and dialysis membrane, yellow brown powder was obtained which showed
good antibacterial activity [Fig. 3].
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 55
Fig. 2: Separation of solvent Fig. 3: Extraction of antimicrobial compound
Zone of inhibition against different microbes by the antibacterial compound: The
antibacterial activity was checked by the antimicrobial compound obtained against some
Gram positive and Gram negative microbial species like Staphylococcus, Bacillus,
Pseudomonas, Klebsiella, Salmonella, Streptococcus, E. coli strain 1,2,3. Of these, E. coli
strain 1 and 2 showed good antibacterial activity against the antimicrobial compound
produced [Fig. 4].
Fig. 4: Zone of inhibition by the antimicrobial compound
Structural analysis of antimicrobial compound: Structural elucidation of the compound
was of the compound was performed by using UV, FTIR . The absorpyion maxima {λ max}
of antimicrobial compound was found at 370nm [ Fig. 6]. The IR spectra revealed the
presence of OH group, presence of aromatic ring and presence of NH2 group.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 56
Fig. 6: I.R Spectra of antimicrobial compound
Molecular identification and gene sequencing: The genomic DNA used for PCR was
prepared from the single colony grown on malt extract agar media. The 16s rRNA gene
fragments was amplified using universal primers. The molecular weight of the product was
484 kDafurther it was submitted to gene bank database. The alignment of the nucleotide
sequence of 238 bp of strain matching with 16s rDNA reported gene sequence in the gene
bank using the NCBI blast available at the website compared with the sequence of the
reference species of the bacteria content in the genomic data base bank exhibited a similarity
level ranged from 98.37% with Streptomyces having the closest match the phylogenic tree
obtained by applying the neighbor-joining method.
STREPTOMYCES SP.
GCAGTCGAACGATGAAGCCTTTCGGGGTGGATTAGTGGCGAACGGGTGAGTAAC
ACGTGGGCAATCTGCCCTTCACTCAAG
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 57
TGGGACAAGCCCTGGAAACGGGGTCTAATACCGGATAACACTCTGTCCCGCATG
GGACGGGGTTAAAAGCTCCGGCGTTAAGG
GTGAAGGATGAGCCCGCGGCCTATCAGCTTGTTGGTGGGGTAATGGCCTACCAA
GGCGACGACGGGTAGCCGGCCTGACGCTA
GAGGGCGACCGGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGGGAGGC
AGCAGTGGGGAATATTGCACAATGGGCGA
AAGCCTGATGCAGCGACGCCGCGTGAGGGATGACCCCGCATGGGACGGGGTTAA
AAGCGCCTGATGCAGCGACGCCGCGTGATGTC
CONCLUSION
The Actinomycetes were isolated from soil sample and the production of antibacterial
compound was carried out by using production media, which showed antibacterial activity
against Gram positive and Gram negative bacteria. From this study it can be concluded that
antibacterial compound produced by Actinomycetes was Streptomyces sp.
REFERENCES
1. W De Boer, Living in a fungal world: impact of fungi on soil bacterial niche
development, FEMS Microbiology Reviews, 29(4), 95-811, 2005.
2. M G Watve, How many antibiotics are produced by genus Streptomyces. Arch Microb.,
386-90, 2001.
3. U C Borodulina, Interrelation between soil actinomycet and B. mycoides. Microbioogia
production of antibiotic substances by actinomycetes, 4: 561–586, 1935.
4. M Krassilnikov and A I Koreniako, The bactericidal substance of the actinomycetes.
Microbiologia production of antibiotic substances by actinomycetes, 8: 673–68, 1939.
5. M Nakhimovskaia, The antagonism between actinomycetes and soil bacteria,
Microbiology production of antibiotic substances by actinomycetes, 6: 131–157,1937.
6. S A E S Waksman Horning, M Welsch& H B Woodruff , Distribution of antagonistic
actinomycetes in nature production of antibiotic substances by actinomycetes. Soil Sci.,
54:281–296, 1942.
7. M Welsch, Bacteriostatic and bacteriolytic properties of actionmycetes. J. Bact.
production of antibiotic substances by actinomycetes, 44: 571–588,1942.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 58
8. Padmadhas and R Ragunathan, Identification of novel Actinomycetes collected from
Western Ghats region of India, Journal of Pharmaceutical and Biomedical Sciences, 1-7,
2010.
9. Perez-Piqueres, Response of soil microbial communication to compost amendments, Soil
Biol. Biochem., 38, 460-470, 2006.
10. I Saadoun andR Gharaibeh, The Streptomyces flora of Badia region of Jordan and its
potential as a source of antibiotics active against antibiotic-resistant bacteria. J Arid
Enciron., 53, 365-71,2003
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 59
MICROBIAL PRODUCTION OF BIOSURFACTANTSPrarthana J.
Department of P.G. Studies & Research in Biotechnology
S.D.M. (Autonomous) College, Ujire-574 240
Karnataka, India
ABSTRACTBiosurfactant is a structurally diverse group of surface-active molecule, synthesized
by microorganisms, has the capability of reducing surface and interfacial tension with low toxicity and high specificity .They reduce surface and interfacial tension by accumulating at the interface of immiscible fluids and thus increase the solubility. The use of biosurfactant is a promising alternative over the chemical surfactant as they are better biodegradable and do not pollute the environment. In the present study, the soil sample from the oil spilled areas were collected serially diluted and screened for hydrocarbon degrading ability by growing on trace mineral salt solution with and without oil .Growth was recorded by measuring absorbance. Isolates were identified through Gram staining and biochemical test. Biosurfactant ability of microorganism was confirmed through oil spread assay, Drop collapse assay, Hydro carbon overlay method and emulsification assay. Nonpathogenic nature of isolates was confirmed through hemolytic assay.Keywords: Biosurfactant, isolates, oil spread assay, Drop collapse assay, Hydro carbon overlay method ,emulsification assay,hemolytic assay.
INTRODUCTION
Oil pollution caused by oil spills, accidental leakage is a major problem in coastal as
well as off shore and remediation technology has become a global phenomenon of increasing
importance [1,2]. Many synthetic surfactants which reduce surface and interfacial tension
between immiscible liquids are used to disperse oil and accelerate its mineralization [3]. But
almost all chemical surfactants are petroleum derived toxic substances nondegraded by micro
organisms. Hence a need for naturally occurring surface active substance produced by
microorganism is focus of study. Biosurfactants have received considerable attention in the
field of environmental remediation processes such as biodegradation, soil washing and soil
flushing. Biosurfactants influence these processes because of their efficacy as dispersion and
remediation agents and their environmentally friendly characteristics such as low toxicity and
high biodegradability [4-6]. Due to their unique properties and vast array of application,
identification of new biosurfactant producing microbes is in great demand. There are many
different screening methods that have been reported as criteria to screen biosurfactant
producing microbes such as hemolytic assay [9], hydro carbon overlay assay [12], blue agar
plate assay, drop collapse assay, oil spreading assay emulsification assay [11], .Among these
methods like hemolytic assays are not reliable and sensitive, because this method will
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 60
categorize microbes in two groups as hemolytic and non-hemolytic. Strains that are
hemolytic are believed to be biosurfactant producers, but there are other products such as
virulence factors that can lyse the blood cells and also biosurfactants with poor diffusion in
agar may not be able to lyse the blood cells. Thus, the results from hemolytic assay on blood
agar plate are not so reliable and sensitive. Remaining methods adapted for screening of
biosurfactant producing micro-organism were considerably good with reproducible results.
MATERIALS AND METHODS
Sample collection: For the isolation of biosurfactant producing bacteria, the sample was
collected from petrol bunks, oil refineries in and around Ujire. The sample was taken in
sterile polythene bag and was taken to the laboratory and analyzed. Along with isolated
samples pure cultures of Bacillus sp. and Lactic Acid Bacteria were also taken for study.
Isolation and screening of biosurfactant producing organisms: The collected sample was
serially diluted and were grown aerobically in 500 ml Erlenmeyer flask with different
mineral salt medium containing (g l-1)Nazina media, Mc Inerney medium, Coopers medium,
Mukherjees medium etc with varying trace elements.Na2EDTA, MnSO4, FeSO4.7H2O,
CaCl2, CoCl2.6H2O, ZnSO4.7H2O, CuSO4.5H2O, H3BO3, Na2MoO4,KI. Initially grown
without oil and then same media with 1% crude oil. From this organisms were isolated and
identified using different preliminary techniques [13].
Identification of microorganisms: The isolated microorganisms were identified by Gram
staining and Biochemical Tests [5].The isolated colonies were tested for their biosurfactant
production by following methods
Blood Haemolysis Test: The fresh single colonies from the isolated cultures were taken and
streaked on Blood agar plates. The plates were incubated for 48-72 hours at 37 ºC. The
bacterial colonies were then observed for the presence of clear zone around the colonies. This
clear zone indicates the presence of biosurfactant producing organisms.
Oil spreading method: 20ml of distilled water was taken in the pertiplates. 10µl of used
crude oil was added to the centre of the plates containing distilled water. Now add 10μl of the
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 61
culture broth or supernatant of the cultures isolated from the soil sample to the centre. The
biosurfactant producing organism can displace the oil and spread in the water.
Drop collapse method: This assay relies on the destabilization of liquid droplets by
surfactants. Therefore, drops of a cell suspension or of culture supernatant are placed onan oil
coated, solid surface. If the liquid does not contain surfactants, the polar water molecules are
repelled from the hydrophobic surface and the drops remain stable. If the liquid contains
surfactants, the drops spread or even collapse because the force or interfacial tension between
the liquid drop and the hydrophobic surface is reduced. The stability of the liquid drop and
the hydrophobic surface isreduced. The stability of drops is dependent on surfactant
concentration and correlates with surface and interfacial tension.
Hydro carbon overlay method: Hydrocarbon overlay agar method was performed with
some modifications. Mineral agar plates [13] were coated individually with 100 μl of crude
oil. Plates were inoculated with isolates and incubated at 30ºC for 48–72hrs. Colony
surrounded by an emulsified halo was considered being positive for biosurfactant
production.
Emulsification Index: Emulsification activity was measured by vortexig 1 ml of culture
supernatant grown on Mineral salt solution at 280C for 24Hrs.Further 4 ml of water and 6 ml
of crude oil for 2 minutes to otain maximum emulsification . After 48 Hrs emulsification
index was calculated by measuring height of emulsified layer (a) divided by total height
(b),multiplied by 100.
RESULTS AND DISCUSSION
In the present study three different soil samples were collected from oil spilled areas
s1:soil from petrol bunk, s2 :soil from oil mill,s3 petrol bunk of in and Ujire place. These soil
samples were serially diluted & inoculated with different hydrocarbon media containing
(Nazina,Mc Inergney,Coopers ,Mukherjees ) trace elements (Table 1). All isolates showed
maximum growth on Mc medium .The isolates were identified through Gram staining and
recorded as s1: Gram positive Cocci(G+C),s2:Gram positive Rod(G+R),s3:Gram positive
Rod(G+R),Pure cultures of Bacillus sp. and Lactic Acid Bacteria (LAB) (Table 3). Since
maximum growth was seen in Mc Inergneg medium , this medium was used with 1% oil as a
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 62
sole of carbon, here different isolates showed varied growth (Table 2). Isolates were then
subjected to several screening methods ,like oil spreading assay, the measurement clear zone
on the oil surface was measured(Table 4), in drop collapse assay, increase in the surface area
of the broth containing biosurfactant over the oil coated surface was measured(Table 5). In
hydro carbon overlay assay, bacterial growth on the oil coated surface of mineral salt solution
agar indicating a zone of halo around the streaked surface was recorded as positive (Fig. 2).
Emulsification index(Table 6) and Blood agar Hemolysis test (Fig. 1) were done to confirm
biosurfactant production.From the present study it was found that all isolates had the ability
to degrade oil by producing biosurfactant but,amount of biosurfactant production is seen
considerably high in soil sample S3 which is identified as Gram positive rod.
Table1: Growth of isolates on Mineral salt solution(Trace elements)
Sl.No Samples Isolates NazinaMc
InergneyCoopers Mukherjee
01 Soil 1 G+C 0.06 0.23 0.06 0.0502 Soil 2 G+R 0.05 0.22 0.05 0.0303 Soil 3 G+R 0.06 0.26 0.03 0.01
04Bacillus
spG+R 0.01 0.29 0.03 0.03
05 LAB G+R 0.01 0.29 0.02 0.01
Table: 2 Growth of isolates on Mc Inergney medium with and with out oil
Sl.No Isolates Without oil With oil
01 G+C 0.23 0.802 G+R 0.22 0.7403 G+R 0.26 0.8604 G+R 0.29 0.7905 G+R 0.29 0.76
Table: 3 Identification of micro organism
Sl.No SamplesGram
stainingBiochemical test
MR VP I CUT01 Soil 1 G+C +++ +++ ++ ++02 Soil 2 G+R +++ +++ ++ ++03 Soil 3 G+R +++ ++ +++ ++
04Bacillus
spG+R +++ +++ +++ ++
05 LAB G+R +++ +++ +++ ++
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 63
Fig.1: Blood Haemolysis Test
Table: 4 Oil spreading method
Bacterial Culture Culture SupernatantS1 S2 S3 Bac LAB S1 S2 S3 Bac LAB
Initial Measurement of oil surface in (mm)
7 7 7 7 7 7 6.5 7 7 6
Measurement of oil surface after addition of
samples(mm)4 5 5 5 5 3 4 5 4 6
Table 5: Drop collapse method
Bacterial Culture Culture SupernatantS1 S2 S3 Bac LAB S1 S2 S3 Bac LAB
Measurement of water drop size on oil coated
surface in (mm)0.4 0.4 0.5 0.4 0.4 0.8 0.8 1 0.9 1
Measurement of sample drop size on oil
coated surface (mm)0.5 0.4 0.5 0.4 0.4 1 1 1.1 1 1
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 64
Fig. 2: Hydro carbon overlay method
Table 6: Emulsification Index
Emulsification Index(%)S1 S2 S3 Bac LAB
Bacterial Culture 47.6 48.5 48.0 45 45Culture Supernatant 52.38 43.56 56 53.33 53
ACKNOWLEDGEMENTS
The author is greatful to UGC for finansial assistance, also would like extent thanks to
the Managements of Shri Dharmasthala Manjunatheshwara College (Autonomous), Ujire
for laboratory ambience.
REFERENCES
1. L Caprino, GJ Togna, Potential health effects of gasoline and its constituents.
Environmental Health Perspectives. V.106, p. 115–125,1998.
2. V.S Millioli, E.L.C Servulo, L.G.S Sobral,D. D de Carvalho, Bioremediation of crude oil-
bearing soil: evaluating the effect of rhamnolipid addition to soil toxicity and to crude oil
biodegradation efficiency.,Global NEST Journal, V. 11, p. 181-188,2009.
3. I. M Banat,“Biosurfactants Productionand Possible Uses in Microbial-En-hanced Oil
Recovery and Oil PollutionRemediation: A Review.”Bioresource Technology, 51, 1-12,
1995a.
4. A.Fiechter, Biosurfactants moving towards industrial applications, Trends Biotechnol 10,
208-217,1992.
5. J Desai ,Microbial surfactants: Evaluation types, production & future application.Jsci Ind
Res.,, 46,440-449,1987.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 65
6. K Hanson , G Nigan, A. Kapadia, M. Desai Bioremidiation of crude oil contamination
with Acinetobacter sp A3. Curr Microbial., 35,191-197,1997.
7. AABodour&RM Maier, Biosurfactants :Types ,screening methods and application in
encyclopedia of environmental microbiology.Edited by G. Bitton (ed),1st ed.(John
Willey) & Sons, Inc., Hoboken, New Jersy, 750-770, 2007.
8. AA Bodour and R Miller Maier ,Application of modified drop collapse technique for
surfactant quantitation and screening of biosurfactant producing microorganism, J
Microbial methods, 32, 273-280,1998.
9. PG carrillo ,C Mardaraz ,SI Pitta Alvarez and AM Giuliett ,Isolation & selection of
Biosurfactant producing bacteria, J Microbial biotechnol., 12 , 82-84,1996.
10. M Morikania Y,Hirata &T,A Imanaka, study on the structure and function relationship of
lipopeptide biosurfactants, Biochem Biophysics Acta ,1488,211-218,2000.
11. P Ellaiar, T Prabhakar, M Sreekanth, AT Taleb, Production of glycolip containing
biosurfactant by Pseudomonas sp. Indian J, Exp Biol 40,1083-1086,2002.
12. M Morikawa and T Imanaka, Isolation of a new surfactin producer Bacillus pumilus A-1
and cloning nucleotide sequence of regulator gene, pst-1,J Ferm Bioengg.,74, 255-
261,1992.
13. YM Alwahaibi, Screening of mineral salt media for biosurfactant production by Bacillus
sp. Int J. Env Ecological Geological Mining Eng.,8(2), 2014.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 66
DEGRADATION OF PETROLEUM BY MICROORGANISMSISOLATED FROM SOIL CONTAMINATED WITH PETROL AND ITS
BY-PRODUCTS
Usha P., Rama Bhat P*., Prajna P.S., Shrinidhi Shetty, Jayadev K. and Jenitta E.
PG Dept. of Biotechnology, Alva’s College, Moodbidri – 574 227, Karnataka, India
*Coresponding author
E-mail: [email protected]
ABSTRACT An experiment on the plausible role of petroleum degrading microorganisms in
degradation of petroleum and its bye-products was carried out by isolating microbes from petroleum contaminated soil from Moodbidri garage. The soil sample was sprinkled over the media and colonies formed in the culture were isolated and used for enrichment culture in minimal essential medium. Of the different species of bacteria and fungi isolated from by serial dilution technique and enrichment culture. One of the bacterial isolate frequently occurred and was when subjected to morphological and biochemical analysis showed negative reaction with Gram stain and positive result for catalase test. Among the he fungal diversity Penicillium spp. and yeast Candidaspecies were dominant and were later selected for enrichment studies. All isolates degraded petroleum that are provided in the minimal essential media as a carbon source. Fungi and yeast isolates were enriched by comparative study of their growth in different carbon source mainly dextrose, lactose, and fructose. It was found that Penicillium spp. was enriched in media containing fructose as carbon source whereas for yeast it was lactose where they showed maximum growth.
The present work on petroleum biodegradation is a rpeliminary work. Further extensive experiments in vitro and in vivo are necessary to know the role of specific strains of bacteria and fungi, on the degradation of various components of petroleum products in the location by individual or in groups of microorganisms as well as their characterizations.
INTRODUCTION
Petroleum-based products are the major source of energy for industry and daily life.
Leaks and accidental spills occur regularly during the exploration, production, refining,
transport, and storage of petroleum and petroleum products. The amount of natural crude oil
seepage was estimated to be 600,000 metric tons per year with a range of uncertainty of
200,000 metric tons per year [1]. Release of hydrocarbons into the environment whether
accidentally or due to human activities is a main cause of water and soil pollution [2]. Soil
contamination with hydrocarbons causes extensive damage of local system since accumulation
of pollutants in animals and plant tissue may cause death or mutations [3]. The technology
commonly used for the soil remediation includes mechanical, burying, evaporation,
dispersion, and washing. However, these technologies are expensive and can lead to
incomplete decomposition of contaminants.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 67
Petroleum hydrocarbons are some of the most widely distributed pollutants resulting
from oil exploration, spills, tankers, ballast water, fuels, mechanic sites and garages [4]. Oil
pollution can cause severe effects on the environment and human health. The presence of
these pollutants in the terrestrial and aquatic environments constitutes health problems and
socioeconomic hazards [5]. Apart from this, used engine oil renders the environment unsightly
and constitutes a potential threat to humans, animals and vegetation [6].
Contaminants can absorb to soil particles, rendering some contaminants unavailable to
microorganisms for biodegradation. Thus, in some circumstances, bioavailability of
contaminants depends not only on the nature of the contaminant but also on soil type.
Hydrophobic contaminants, like petroleum hydrocarbons, have low solubility in water and
tend to adsorb strongly in soil with high organic matter content. In such cases, surfactants are
utilized as part of the bioremediation process to increase solubility and mobility of these
contaminants. The existence of thermophilic bacteria in cool soil also suggests that high
temperatures enhance the rate of biodegradation by increasing the bioavailability of
contaminants [7].
Automobile workshops are an important component of the service sector industry.
The most significant environmental impact associated with the existing workshops is the
seepage of used engine oil and washed water into the soil. Contamination of the soil by oil
causes it to lose its useful properties such as fertility, water-holding capacity, permeability
and binding capacity [8].Petroleum pollutants also contaminate inland water bodies and the
terrestrial ecosystems. Evaporation and biodegradation of petroleum hydrocarbons is mainly
a microbiological process. The ability of the microorganisms to utilize hydrocarbons has
been known since 1800s.
Hydrocarbons in the environment are biodegraded primarily by bacteria, yeast, and
fungi. The reported efficiency of biodegradation ranged from 6% [9] to 82% [10] for soil
fungi, 0.13% [9] to 50% [10] for soil bacteria, and 0.003% [11] to 100% [12] for marine
bacteria. Many scientists reported that mixed populations with overall broad enzymatic
capacities are required to degrade complex mixtures of hydrocarbons such as crude oil in soil
[13], fresh water [14], and marine environments [15, 16].
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 68
Fungal genera, namely, Amorphoteca, Neosartorya, Talaromyces, and Graphium and
yeast genera, namely, Candida, Yarrowia, andPichia were isolated from petroleum-
contaminated soil and proved to be the potential organisms for hydrocarbon degradation [17].
Singh [18] also reported a group of terrestrial fungi, namely, Aspergillus, Cephalosporium,
and Pencillium which were also found to be the potential degrader of crude oil hydrocarbons.
The yeast species, namely, Candida lipolytica, Rhodotorula mucilaginosa, Geotrichum sp, and
Trichosporon mucoides isolated from contaminated water were noted to degrade petroleum
compounds [19].
The ability to utilize hydrocarbons is not restricted to a few microbial species. It was
stated that nearly 100 species of bacteria. Yeast and molds has been shown to be endowed
with the ability to attack hydrocarbons. Based on the above view a preliminary research work
is carried out with the following objectives:
To isolate and identify the petroleum degrading microorganisms from the soil sample
collected from near by garage.
To prepare pure culture of selected micro-organisms and to characterize.
To study petroleum degradation in vitro by enrichment experiments.
MATERIAL AND METHODS
A study on plausible role of petroleum degraders in degrading petroleum and its by-
products was conducted at Department of Biotechnology, Alva’s College, Moodbidri.
Petroleum degraders were isolated from the soil sample contaminated with petroleum and
other by-products. The soil samples were collected from in and around garage at Moodbidri,
Karnataka where usually soil is contaminated with petroleum and their by-products. Four
soil samples were collected randomly from different location namely A,B,C and D within the
local area and were brought to the laboratory and incubated for three days.
The petroleum degraders were isolated from the soil by serial dilution and plating
technique (20). For the isolation of bacteria nutrient medium and for fungi PDA medium
were used. In serial dilution method, five gram of the soil sample was suspended in 40ml of
sterile distilled water. The resulting dilution was serially diluted to 102, 103, 104 and 105 by
pipetting one ml of aliquots in to 9 ml of sterile distilled water. Finally one ml of aliquots was
added to sterile Petri dishes to which about 15 ml of cool molten medium was added and
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 69
rotated in clockwise and anticlockwise direction, after solidification the plates were incubated
in an inverted position for seven days at 25+20C. For each dilution four replicates were made.
Finally 103 dilution was found to be ideal for culture and isolation.
The media used in plating technique above is a minimal media containing petroleum
as a carbon source and other components are:
NaNO3 2g
Agar 20g
KH2PO4 0.5g
MgSO4 0.5g
FeSO4 100mg
CaCO3 400mg
Distilled water 1000ml
Carbon source (Petrol) 2ml
After 7 days of incubation, the number of colonies developed on media are counted
in Petri plates obtained from four soil sample A, B, C andD.
Characterization of isolated bacteria: Bacteria were isolated from the incubated Petri
plates C and D and are characterized by conducting morphological and biochemical tests.
Morphological test:The bacterial isolates are tested for Gram’s reaction. In this technique
asmear of isolated bacterial culture was prepared on clean grease free glass slide and gram
staining were made and observed under oil immersion objective. Pink colored/purple cells
are observed indicating that isolated bacteria are Gram negative / positive.
BIOCHEMICAL TEST
Catalase test:Nutrient slants in which isolated bacteria is maintained from which using a
nichrome loop cells are picked up and are placed in the centre of glass slides to that one or
two drops of 3% H2O2 solution is added and observed for gas bubbles.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 70
Isolation of fungi which are able to degrade petroleum and its by-products from soil:
The soil sample were collected from in and around garage at moodbidri where usually
soil in contaminated with petroleum and their byproducts four soil samples A, B, C and D
were collected from different location and were brought to the laboratory, then it is incubated
for three days.
The fungi and yeast are isolated by soil sprinkling method of in which about one gram
of soil sample was taken and was sprinkled over the dextrose agar media.
Composition of potato dextrose agar media
Potato Dextrose 200g
Dextrose 20 g
Agar 20 g
Distilled water 1000ml
The Petri plates were incubated at 25 + 2oC for 7 days. The colonies developed were
isolated and identified using standard manuals. These organisms were then tested whether
they are able to degrade petroleum by streaking on to selective media containing petrol as
carbon source.
ENRICHMENT OF ISOLATED MICROORGANISMS
Fungi: Isolated fungi is inoculated to different Petri plates each containing enrichment media
with different carbon sources as given in Table 1.
Table 1: Different enrichment media employed for the enumeration of fungi from soil
Media 1 Media 2 Media 3NaNO3 0.5g NaNO3 0.5g NaNO3 0.5gK2HPO4 1g K2HPO4 1g K2HPO4 1g
MgSO4 . 7H2O 0.5g MgSO4. 7H2O 0.5g MgSO4. 7H2O 0.5gKCl 0.5g KCl 0.5g Fe2 (SO4)3 TraceFe2 (SO4)3 Trace Fe2 (SO4)3 Trace Fructose 10 gLactose 10g Dextrose 10 g Agar 20 g
Agar 20gm Agar 20 g Distilled water 1000mlDistilled water 1000 ml Distilled water 1000 ml
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 71
The plates were incubated for 24 hour at 25+ 2oC radial growth is measured in each
plate as given below:
SL. No Carbon source used Diameter of colonies
12.3.
LactoseDextroseFructose
R1
R2
R3
Yeast: For the isolation of yeast three different enrichment media containing different carbon
source areshowed in table 2.
Table 2: Different enrichment media employed for the enumeration of yeast
Media 1 Media 2 Media 3
NaNO3 0.5g NaNO3 0.5g NaNO3 0.5gK2HPO4 1g K2HPO4 1g K2HPO4 1g
MgSO4 . 7H2O 0.5g MgSO4. 7H2O 0.5g MgSO4. 7H2O 0.5gKCl 0.5g KCl 0.5g Fe2 (SO4)3 TraceFe2 (SO4)3 Trace Fe2 (SO4)3 Trace Fructose 10 gLactose 10g Dextrose 10 g Distilled water 1000ml
Distilled water 1000 ml Distilled water 1000 ml
Incubated for 24 hr at 25+ 20. Then optical density of inoculated broth is measured at
660nm using colorimeter as follows:
SL. No Carbon source used Diameter of colonies
12.3.
LactoseFructoseDextrose
OD1
OD2
OD3
By observing the optical density the major carbon source for the growth of microbe in
the enrichment media is selected.
RESULTS
The results of different parameters used during the enumeration, biochemical and
enrichment studies of degradation of petroleum products by the microbes are presented.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 72
Isolation of petroleum degraders: By serial dilution technique and enrichment culture
technique fungi including yeast and bacteria colonies were isolated from the soil sample
contaminated with petroleum product such as grease, oil, petrol collected from nearby garage
area. By studying its morphology the fungi was identified as Aspergillus, Curvularia,
Cylindrocarpon, Chlamydospore, Mucorand Penicillium spp.Yeast was identified as
Candida sp.
Characterization of bacterial isolates: Bacteria isolated from the minimal essential media
containing petroleum as a carbon source was subjected to biochemical characterization. The
study revealed that the isolated bacteria was positive for catalase test and negative reaction
for Gram staining indicating that it was Gram negative bacteria.
Colony characterization: Isolated bacteria were grown in minimal essential media
containing petroleum as carbon source upon incubation at 25 +2oC and after 24 hr observed
cream white 3 to 4 colonies of bacteria, which are then used for biochemical
characterization study It was found that Pseudomonas and Bacillus were dominant.
Characterization of isolated fungi and yeast: Fungi and a yeast- Candida sp. was isolated
from the soil sample. By using soil sprinkling method, the colony characterization,
morphology and fungi was found to be of Penicillium species. Enrichment of isolated fungi
by determining the carbon source mainly lactose, fructose and dextrose by observing the
radial colony growth. The maximum growth was recorded in medium containing fructose as
carbon source while minimum in lactose containing medium (Table 3). This is further clears
that fructose as carbon source supports the good growth of the isolated fungi (Fig. 1).
Table 3: Variation in the radial growth of microbes in enriched media
Carbon source Radial growth (cm)
Lactose 1.075Fructose 1.35Dextrose 1.325
Enrichment of isolated yeast: Enrichment of isolated yeast by determining the carbon
source mainly lactose, fructose and dextrose by observing the optical density. The maximum
optical density was recorded in medium containing lactose as carbon source while minimum
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 73
in dextrose containing medium (Table 4). This is further clears that lactose as carbon source
supports the good growth of the isolated fungi (Fig. 2). The growth of yeast and fungi in the
minimal and enriched media were showed in plates 1-4.
Table 4: Variation in the optical density of yeast culture in enriched media
Carbon source Blank Optical density at 660nm
Lactose 0 0.06Fructose 0 0.05Dextrose 0 0.03
Carbon Source
Fig. 1: Growth of fungal colony in the medium enriched with different carbon
sources -lactose, dextrose and fructose.
1.075
1.35 1.325
0
0.2
0.4
0.6
0.8
1
1.2
1.4
1.6
Lactose Fructose Dextrose
Centimeter
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 74
Carbon Source
Fig. 2: Variation in optical density (at 660 nm) of yeast culture in the medium
enriched with different carbon source - lactose, dextrose and fructose.
DISCUSSION
The degradation of aliphatic hydrocarbons understandably is associated with the
petroleum industry. Aliphatic hydrocarbons are the major components of crude oils and
petroleum products and much of the earlier research on biodegradation of these compounds
are born from ideas on the use of microbes for waste disposal form refineries and the
synthesis of petrochemicals and other industrial compounds. Because of markedly increased
exploration for oil and related energy sources, public attention has been directed to
environment effects of such as exploration, particularly with respect to potential
contamination of the environment by oil, since the first line of defense so to speak against oil
pollution in the environment is the microbial population, it becomes imperative to know
whether microbial degrades of oil are present in water and soil of the area to be
impacted.There are reportsavailable regarding degradation of petroleum and its other
products as well as inhabitant of microbes on petroleum polluted/contaminated soil [21, 22].
In the present study, soil samples collected from in and around the garage were culturedon
medium we found few isolates of bacteria comprising species of Bacillus sp. And
Pseudomonas sp. Among fungi Aspergillus, Curvularia, Cylindrocarpon, Chlamydospore,
Mucor and Penicillium spp. and yeast were isolated. Adams et al. [23] in their study on
bioremediation of automobile mechanic workshop contaminated with spent oils, known
0.060.05
0.03
0
0.01
0.02
0.03
0.04
0.05
0.06
0.07
Lactose Fructose Dextrose
Optical density
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 75
bacterial and fungal petroleum hydrocarbon degraders such as Bacillus sp., Staphylococcus
sp., Pseudomonas sp., Flavobacterium sp., Arthobacter sp., Enterobacter sp., Aspergilus sp,
Mucor sp., and Trichoderma sp. were identified in contaminated soil, poultry litter and cow
dung. There was an increase in the quantity of bacterial cells present as the quantity and
duration of treatment increased. This could be because of the simple reason that the growth
and proliferation of microbial cells depend on time and quantity of nutrients available. The
ability of some of the microbial species to utilize hydrocarbons as carbon source is limited to
about 100 species of bacteria, yeast and molds [24]. He also reported that representative
species of 30 microbial genera are able to attack one or more types of contaminated soils.
Both bacteria and fungi are heterotrophic in nature and related to a large number of
taxonomic genera which are capable of utilizing hydrocarbons as sources of energy and
carbon for their growth [25]. This is again supported by earlier few reports [26-29].Several
bacteria are even known to feed exclusively on hydrocarbons [30]. Floodgate [31] listed 25
genera of hydrocarbon degrading bacteria and 25 genera of hydrocarbon degrading fungi
which were isolated from marine environment. A similar compilation by Bartha and Bossert
[13] included 22 genera of bacteria and 31 genera of fungi. In earlier days, the extent to
which bacteria, yeast, and filamentous fungi participate in the biodegradation of petroleum
hydrocarbons was the subject of limited study, but appeared to be a function of the ecosystem
and local environmental conditions [31]. Crude petroleum oil from petroleum contaminated
soil from North East India was reported by Das and Mukherjee [32].
It was discovered that some important strains of Pseudomonas carry the genetic
information for the degradation of certain hydrocarbons on extra chromosomal DNA [33].
According to Zobell [24] all Kennels of gaseous and soil hydrocarbonaliphatic, aromatic
derivatives and naphthonic series appears to be susceptible to oxidant by micro-organisms.
In the present study the soil samples from garage were not analyzed for different components
of hydrocarbons. Even though the organisms isolated from these sample after
characterization were cultured on petrol containing minimal media, in which they flourished
well. Generally, the degradation of aliphatic hydrocarbons has been shown to be inducible.
Atlas [31] conducted an experiment degradation of petroleum hydrocarbons by
microorganisms by supplying varied concentrations of phosphorous nitrogen and physical
parameters like temperatures oxygen , salinity and found that each type organism survive at
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 76
different nutrition limits where they shows maximal rate of degradation. However, in the
present study minimal media supplemental with carbons sources like dextrose, fructose and
lactose showed varied number of colonies.
The microorganisms isolated from the petroleum polluted soil showed varied no
better growth are the minimal media supplemented with different carbon source and
petroleum application. Such reports were made by earlier works also with different groups of
bacteria and fungi [29, 34, 35].
Austin et al. (36) examined different strains of petroleum degrading bacteria isolated
from bay Wales and sediment by numericaltaxonomic procedure and obtained 85% similarity
level within different group, by comparing to this in the present study also different isolates
of bacteria and fungi including yeast were found in different locations from where the soil
samples were collected.
Petroleum biodegradation by available concentrations of nitrogen and phosphorus in
the soil sample or seawater are severely limiting to microbial hydrocarbon degradation.
Researchers examining the fate of large oil spills have thus properly concluded in many
cases. That concentration of N and P are limiting with respect to rate of hydrocarbon
biodegradation. In the present study estimation of N and P were not made even though
different medium were employed are adequateyl supplied in the medium.By considering the
limitations of nutrients to biodegradation of hydrocarbons are the sea the concept of nitrogen
demand has been established (Floodgate). It was found that concentration of 1 mg of nitrogen
and 0.07 mg of phosphorus per litre supports maximal degradation of crude oil in New Jersey
coastal sea water at a concentration of 8g of oil / litre (37).
Hydrocarbon degrading bacteria and fungi are widely distributed in marine, fresh
water and soil habitats. The use of silica gel as a solidifying agent has been shown to improve
the reliability of producers for enumerating hydrocarbon utilisers (38). The medium
containing 0.5% oil and 0.003% phenol red was best for enumerating petroleum degrading
microorganisms. They also found that addition of Amphotericin B permitted selective
utilization of hydrocarbon utilizing bacteria. It was found that location, number and variety of
microbial hydrocarbon utilizes illustrated their inequality and that the broad enzymatic
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 77
capacity for hydrocarbon degradation indicated the microbial potential for removal or
conversion of oil in the environment examined. (39).
REFERENCES
1. K. A. Kvenvolden and C. K. Cooper, “Natural seepage of crude oil into the marine
environment,” Geo-Marine Letters, vol. 23, no. 3-4, pp. 140–146, 2003.
2. C. Holliger, S. Gaspard, G. Glod, C. Heijman, W. Schumacher, R. P. Schwarzenbach, and
F. Vazquez, “Contaminated environments in the subsurface and bioremediation: organic
contaminants,”FEMS Microbiology Reviews, vol. 20, no. 3-4, pp. 517–523, 1997.
3. P. J. J. Alvarez and T. M. Vogel, “Substrate interactions of benzene, toluene, and para-
xylene during microbial degradation by pure cultures and mixed culture aquifer
slurries,” Applied and Environmental Microbiology, vol. 57, no. 10, pp. 2981–2985,
1991.
4. P.O. Okerentugba, and O.U. Ezeronye, Petroleum Degrading Potentials of Single
Microbial Cultures isolated from Riivers and Effluent in Nigeria. African Journal of
Biotechnology. 2 (9), pp. 288-292,2003.
5. M.D. Makut and P. Ishaya, Bacterial species associated with soils contaminated with used
petroleum products in Keffi town, Nigeria. African Journal of Microbiology Research, 4
(16); pp. 1698-1702, 2010.
6. M. C., Chukwuma, E. T. Eshett, E. U. Onweremaduand M. A.Okon, Zinc availability in
relation to selected soil properties in a crude oil polluted eutrictropofluvent. International
Journal of Environmental Science and Technology, 7 (2), pp. 261-270,2010.
7. B.R.Perfumo, D.R.Schieche, P.M. DiGrazia, J. Werner and S.Palmer, Microbial
desulfurization of alkylated dibenzothiphenes from a hydrodesulfurized middle distillate
by Rhodococcus erythropolis I-19. Applied Environmental Microbiology. 65, pp. 4967-
4972, 2007.
8. V.J. Odjegba and A.O. Sadiq, Effect of spent engine oil on the growth parameters,
chlorophyll and protein levels of Amaranthushybridus. The Environmentalist, 22, pp. 23-
28, 2002
9. J. Jones, M. Knight, and J. A. Byron, “Effect of gross population by kerosene
hydrocarbons on the microflora of a moorland soil,” Nature, vol. 227, p. 1166, 1970.
10. Y. Pinholt, S. Struwe, and A. Kjoller, “Microbial changes during oil decomposition in
soil,” Holarctic Ecology, vol. 2, pp. 195–200, 1979.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 78
11. S. L. Hollaway, G. M. Faw, and R. K. Sizemore, “The bacterial community composition
of an active oil field in the Northwestern Gulf of Mexico,” Marine Pollution Bulletin, vol.
11, no. 6, pp. 153–156, 1980.
12. G. J. Mulkins Phillips and J. E. Stewart, “Distribution of hydrocarbon utilizing bacteria in
Northwestern Atlantic waters and coastal sediments,” Canadian Journal of Microbiology,
vol. 20, no. 7, pp. 955–962, 1974.
13. R. Bartha and I. Bossert, “The treatment and disposal of petroleum wastes,” in Petroleum
Microbiology, R. M. Atlas, Ed., pp. 553–578, Macmillan, New York, NY, USA, 1984.
14. J. J. Cooney, “The fate of petroleum pollutants in fresh water ecosystems,” in Petroleum
Microbiology, R. M. Atlas, Ed., pp. 399–434, Macmillan, New York, NY, USA, 1984.
15. R. M. Atlas, “Effects of hydrocarbons on micro-organisms and biodegradation in Arctic
ecosystems,” in Petroleum Effects in the Arctic Environment, F. R. Engelhardt, Ed., pp.
63–99, Elsevier, London, UK, 1985.
16. G. Floodgate, “The fate of petroleum in marine ecosystems,” in Petroleum Microbiology,
R. M. Atlas, Ed., pp. 355–398, Macmillion, New York, NY, USA, 1984.
17. J. N. Baruah, Y Alory and R. I. Mateles, Incorporation of liquid hydrocarbons in to agar
media. Appl. Microbial. 15: 561,1967.
18. H. Singh, Mycoremediation: Fungal Bioremediation, Wiley-Interscience, New York, NY,
USA, 2006.
19. E. Bogusławska-Was and W. Dąbrowski, “The seasonal variability of yeasts and yeast-
like organisms in water and bottom sediment of the Szczecin Lagoon,”International
Journal of Hygiene and Environmental Health, vol. 203, no. 5-6, pp. 451–458, 2001.
20. J. H. Warcup, The soil plate method for isolation of fungi from soil. Nature166: 117-
118, 1950.
21. J.D. Walker, B.F. Conrad, P.A.Seesmanand R.R. Colwell, Comparison of membrane filter
counts on heterotrophic and oil agar used to estimate populations of yeast, fungi and
bacteria. In symposium on recovery of indicator organisms employing membrane filters.
American society for Testing and Materials, Fort Lauderdale, Fla, 1976.
22. K.S.M.Rahman, T.J. Rahman,Y. Kourkoutas, I. Petsas, R. Marchant
andI.M.Banat,Enhanced bioremediation of n-alkane in petroleum sludge using bacterial
consortium amended with rhamnolipid and micronutrients. Bioresource Technology 90:
159-168, 2003.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 79
23. Adams, G.O., P. Tawari-Fufeyin, and Igelenyah Ehinomen. "Laboratory Scale
Bioremediation of Soils from Automobile Mechanic Workshops Using Cow Dung."
Journal of Applied & Environmental Microbiology 2(4): 128-134, 2004.
24. C.E. Zobell. “Action of microorganisms on hydrocarbons,” Bacteriological Reviews, vol.
10, pp. 1–49, 1946.
25. M., Vidali, Bioremediation: An overview. Journal of Applied Chemistry, 73 (7), pp. 1163-
1172, 2001.
26. D.Bhattacharya, P.M. Sarma, S. Krishnan, S.Mishra and B.Lal, Evaluation of genetic
diversity among Pseudomonas citronellolis strains isolated from oily sludge-contaminated
sites. Applied Environmental Microbiology. 69(3), pp. 1435-1441, 2003.
27. N.Das and P.Chandran, Microbial Degradation of Petroleum Hydrocarbon Contaminants:
An Overview. Biotechnology Research International Article ID 941810, 13 pages
http://dx.doi.org/10.4061/2011/941810, 2011.
28. A.J. Daugulis andC.M.McCracken, Microbial degradation of high and low molecular
weight polyaromatic hydrocarbons in a two-phase partitioning bioreactor by two strains
of Sphingomonas sp. Biotechnology Letters25:1441-1444, 2003.
29. F.Chaillan, A.Le Fleche andE.Bury, Identification and biodegradation potential of
tropical aerobic hydrocarbon degrading microorganisms. Research in Microbiology 155:
587-595, 22004.
30. R. J. W. Brooijmans, M. I. Pastink, and R. J. Siezen, “Hydrocarbon-degrading bacteria:
the oil-spill clean-up crew,” Microbial Biotechnology, vol. 2, no. 6, pp. 587–594, 2009.
31. R.M. Atlas, AnAssessment of biodegradation of petroleum in the Aoctic, pp. 86-90.
In:.Locotit,M.W and Miles, J.A..R. (Eds), Microbial Ecology. Springer-verlag, Berlin,
21978, 1978.
32. K. Das andA.K.Mukherjee, Crude petroleum-oil biodegradation efficiency of Bacillus
subtilis and Pseudomonas aeruginosa strains isolated from a petroleum-oil contaminated
soil from North-east India. Bioresource Technology 98: 1339-1345, 2007.
33. F. D.Cook and D.W.S Westlake,Microbiological degradation of northern crude oils.
Environmental social Committee; Northern Pipelines. Task force on Northern oil
Development, report no. 74 -1. Catalog no. R – 72- 12774. Information Canada.
Ottawa,1974.
34. A.M. Cundell.andR.W. Traxler, The isolation and characterization of hydrocarbon
utilizing bacteria from chedabucto bay, Nova Scotia, pp. 421-426. In:Proceedings of Joint
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 80
conference on prevention and control of oil spills. American petroleum Institute
Washington D.C., 1973.
35. N. Das andP.Chandran, Microbial degradation of petroleum hydrocarbon contaminants:
An overview. Biotechnology Research International 1-13, 2011.
36. B.Austin, R. R. Colwell, J. D. Walker and J. J. Calomiris, The application of numerical
taxonomy to the study of petroleum degradation bacteria. Apply. Environ. Microbiol.
34:60-68, 1997.
37. R. M. Atlas and R.Bartha, Degradation and mineralization of petroleum in water limitation
by nitrogen and phosphorus. Biotechnol. Boeing14: 309.317, 1972.
38. J.D. Walker, and R.R. Colwell, Microbial petroleum degradation: The use of mixed
hydrocarbon substrates. Appl. Microbiol. 27:1053-1060, 1974.
39. Mulkins – Philips and Stewart, Distribution of hydrocarbon utilizing bacteria in North
western Atlantic waters and coastal sediments. Can. J. Microbio. 20: 955-962, 11974.
Plate 1: Colonies of fungi and yeast grown on minimalmedium after soil sprinkling
Plate 2: Colonies of yeast on minimal medium supplemented with lactose and fructose
as carbon source
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 81
Plate 3: Colonies of fungi in minimal medium - fructose as carbon source
Plate 4: Colonies of fungi in minimal medium - petroleum as carbon source
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 82
ABSTRACTS OF EMINENT PERSONALITIES
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 83
PAST- MODERN TRENDS IN BIOTECHNOLOGYHarish R. Bhat
Energy and Wetland Research Group,
Centre for Ecological Sciences,
Indian Institute of Science
Bangalore 560 012
E-mail: [email protected]
INTRODUCTION
The wide concept of biotechnology encompasses a wide range of procedures for
modifying living organisms according to the human needs, going back to domesticating
animals for livelihood, cultivation of plants, and improving these plants through breeding
programs. Biotechnology by definition, is the use of living systems and organisms to develop
or make useful products, or "any technological application that uses biological systems,
living organisms or derivatives thereof, to make or modify products or processes for specific
use" (UN Convention on Biological Diversity, Art.2). Modern usage also includes genetic
engineering as well as cell and tissue culture technologies.
RICHNESS
Traditionally, Indian tradition (Garuda Purana) estimates 84 lakh different species of
plants and animals in the world. Modern science estimates that there are somewhere between
80 to 120 lakh different species of living organisms on the earth today. About 16 lakh species
are known to science. India with a land area of 2.2% of the earth as a whole harbours over 1.2
lakh. Seven percent of the world's total land area is home to half of the world’s species, with
the tropics alone accounting for 5 million. With a mere 2.4% of the world's area, India
accounts for 7.31% of the global faunal total with a faunal species count of 89,451 species
(MoEF. 1999). India is a center of crop diversity - the homeland of 167 cultivated species and
320 wild relatives of crop plants. There are 167 crop species and wild relatives of these
cultivated plants in the wild. India is considered to be the center of origin of 30,000-50,000
varieties of rice, pigeon-pea, mango, turmeric, ginger, sugarcane, gooseberries etc. India
ranks seventh in terms of contribution to world agriculture. Biotechnology draws on the pure
biological sciences (genetics, microbiology, animal cell culture, molecular biology,
biochemistry, embryology, cell biology).
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 84
APPLICATIONS
For thousands of years, humankind has used biotechnology in agriculture, food
production, and medicine. Throughout the history of agriculture, farmers have inadvertently
altered the genetics of their crops through introducing them to new environments and
breeding them with other plants. These processes also were included in early fermentation of
beer. Cultures such as those in Mesopotamia, Egypt and India developed the process of
brewing beer. It is still done by the same basic method of using malted grains (containing
enzymes) to convert starch from grains into sugar and then adding specific yeasts to produce
beer. Biotechnology applications classify the group into four types: Blue - marine and aquatic
applications of biotechnology; Green - biotechnology applied to agricultural processes; Red -
applied to medical processes; White - Industrial biotechnology.
Trends in Biotechnology are unique in drawing together a wide readership of
scientists and engineers from the many disciplines of the applied biosciences. It also reflects
the view that biotechnology is the integrated use of many biological technologies - from
molecular genetics to biochemical engineering. This integration is essential for the effective
translation of novel research into application.
JATROPHA CURCAS AS A BIODIESEL PLANT – FACTS AND MYTHS
Dr. Geetaa Singh
Labland Biotech Private Limited,
R & D Division, 8th K.M., K.R.S. Main Road
Mysore 570 016, India
E-mail: [email protected]; [email protected]
The key energy factor that dictates a products cost is Energy. In fact, the national
economy is driven by the fuel prices on par with other key production factors like land,
labour and capital. The shortage of petroleum fuels and undulating fuel prices has called for
use of alternative sources of energy in addition to the conservation methods. The
Governments, all over the world have initiated the use of alternative sources for ensuring
energy security, employment generation and mitigating carbon dioxide emissions. The
initiatives have differed in different countries. However, biofuels have emerged as an ideal
choice to meet these requirements. In India, Jatropha-based biodiesel has emerged as a
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 85
strong contender. Jatropha is an underutilized, non-edible oil-bearing crop. It produces
seeds that can be processed into non-polluting biodiesel. Under best utilization plan, Jatropha
provides opportunities for good returns, climate improvement and rural development. The
crop has special appeal, in that it is non-demanding crop and animals do not graze on it.
However, many of the actual investments and policy decisions on developing Jatropha as an
oil crop have been made without the backing of sufficient scientific knowledge. Realizing
the true potential of Jatropha requires separating facts from the claims and half-truths. The
current presentation discusses the facts and myths of the crop and the biodiesel obtained from
it.
BIOFUEL AS AN ALTERNATIVE SUSTAINABLE FUEL TO FOSSIL FUEL
Dr. C.Vaman Rao
Professor & Head
Dept. of Biotechnology Engineering, NMAM Institute of Technology,
NITTE, 574110 (Udupi Dist.)
Biofuel is the term used for the fuel produced from biological materials by various
processes. Biofuel is of three types namely, bioethanol, biodiesel and biogas. Biofuels can
be produced from different biological sources. Accordingly they are classified in to three
types depending on the source of biofuel production. First generation biofuel, i.e bioethanol is
produced from starchy grains like maize, wheat, tubers (potato) and sugar cane. The second
generation biofuel is produced from lignocellulosic residues of agricultural (hey, wheat,
maize and jowar straw), corn cob, sugar cane shoot, sugar cane bagasse and non-agricultural
origin like wild grasses, leaves and wood. The third generation biofuel is produced from
marine and fresh water algae. Biodiesel is produced from non-edible oils of non-edible seed
origin and the waste vegetable oils obtained after several uses for cooking as well as animal
fat obtained from abattoir or fish processing industry. The oil obtained from certain species
of marine and fresh water algae can be also used for the production of biodiesel. Bioethanol
is produced from the biological sources after conversion of the biological source into simple
sugar by enzymatic hydrolysis or by acid hydrolysis. The sugars obtained are subjected to
anaerobic fermentation by bakers yeast (Sacharomyces cerevisiae) or other species of yeast
like Pichia sp. The end product of anaerobic yeast fermentation is alcohol, which is
separated from the fermented liquor by distillation process. The alcohol produced in this
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 86
manner by using biological sources is called bioethanol, which contains mixtures of alcohols
in different proportion like methanol, ethanol, propanol and butanol. This mixture of alcohol
of 99% purity can be used for mixing (doping) with petrol or diesel at a concentration 5 to
10%. Mixing of bioethanol in petrol and diesel leads to decreased consumption of fossil fuels
and also decreased emission of noxious gases. It is estimated that the annual savings for our
country will be 4 lakh to 6 lakh tons of petrol and diesel, which is a significant amount of
savings in terms of foreign exchange in dollars. For mixing ethanol with diesel, a special
catalyst is required as well as a mixer at the pump outlet.
Biodiesel is an environmental friendly diesel produced from the used waste cooking
oil, non-edible vegetable oils, algal oils and animal fats. These oils and fats are esterified in
the presence of a catalyst at a suitable temperature to yield fatty acyl esters and glycerol. The
fatty acyl ester is called biodiesel, which can be used as it is in diesel engines or can be mixed
with diesel at 10 to 20% level. Diesel mixed with biodiesel is known to significantly reduce
noxious gas (CO2, nitrogen oxides-NOX, SO2 and SO3) emission from the automobiles
resulting in significant reduction in environmental burden. The oil cake obtained from non-
edible oil seeds as a result of pressing the oil seeds for the expulsion of oil, can be used for
the production of biogas. Initially to start the biogas production, the starter culture of cow
dung is required to which the oil cake mixed. Once the gas production starts, only oil cake
can be used to keep the biogas production continuously. Biogas produced in this manner is
environmental friendly could be used for cooking purpose, industries for power generation..
Fossil fuel is expected to last up to 2030 or 2040. When the world runs out of stock
of fossil fuel, biofuel will take the centre stage and it will be the fuel of the future to keep the
automobiles and industries running. One may argue stating that there are other fuels like
hydrogen fuel and solar energy for the future for use, but both are costly ventures leading to
escalation in the cost of fuel, which will be beyond the reach of a common man. Therefore,
research and development of biofuels in our country is of utmost importance for the future of
the country.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 87
EFFECTIVE MICRO ORGANISMSDr.R.Ragunathan
Senior Scientist, SynKroMax Biotech (DSIR, Govt. of India Approved R&D) Pvt. Limited,
Porur, Chennai – 116.
Scientific Advisor, Centre for Bioscience and Nanoscience Research , Eachanari,
Coimbatore – 21.
A major problem facing municipalities throughout the world is the treatment, disposal
and/or recycling of sewage sludge. Generally sludge from municipal waste consists mainly of
biodegradable organic materials with a significant amount of inorganic matter . At the present
time, there are a number of methods being used to dispose of sewage sludge from disposal to
landfill to land application. Although there are many methods used, there are numerous
concerns raised regarding the presence of constituents including heavy metals, pathogens and
other toxic substances. This requires the selection of the correct disposal method focussing on
efficient and environmentally safe disposal. New technologies are being produced to assist in
the treatment and disposal of sewage sludge, conforming to strict environmental regulations.
One of these new technologies being proposed is the use of Effective Microorganisms (EM).
The technology of Effective Microorganisms (EM) was developed during the 1970’s at the
University of Ryukyus, Okinawa, Japan by Professor Dr.Teruo Higa.
EM is a combination of useful regenerated micro-organisms that exist freely in nature
and are not manipulated in any way. The possibilities and benefits in using EM are numerable
and include the following:
For use in the home in daily life for everyone
The recycling of kitchen waste and turning it into valuable organic material;
In the garden to improve soil structure, increase productivity and to suppress both
disease and weeds
For solving all kinds of environmental problems such as water, air, and soil pollution;
In agriculture and horticulture, fruit and flower cultivation;
In animal husbandry and for all kinds of pets;
In fisheries, aquariums and swimming pools;
In personal bodily hygiene and for the prevention and treatment of health problems.
Pest Management with EM5 and FPE
Animal husbandry with EM
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 88
Vermiwash and EM
EM is a combination of useful regenerated micro-organisms that exist freely in nature and
are not manipulated in any way.
1. Lactic acid bacteria: these bacteria are differentiated by their powerful sterilizing
properties. They suppress harmful micro-organisms and encourage quick breakdown
of organic substances. In addition, they can suppress the reproduction of Fusarium, a
harmful fungus.
2. Yeasts: these manufacture anti-microbial and useful substances for plant growth.
Their metabolites are food for other bacteria such as the lactic acid and actinomycete
groups.
3. Actinomycetes: these suppress harmful fungi and bacteria and can live together with
photosynthetic bacteria.
4. Photosynthetic bacteria: these bacteria play the leading role in the activity of EM.
They synthesize useful substances from secretions of roots, organic matter and/or
harmful gases (e.g. hydrogen sulphide) by using sunlight and the heat of soil as
sources of energy. They contribute to a better use of sunlight or, in other words, better
photosynthesis. The metabolites developed by these micro-organisms are directly
absorbed into plants. In addition, these bacteria increase the number of other bacteria
and act as nitrogen binders.
5. Fungi that bring about fermentation these break down the organic substances quickly.
This suppresses smell and prevents damage that could be caused by harmful insects.
Effective Microorganisms, or EM is one of the most popular microbial technologies
being used worldwide now and EM products have been on the market since 1983 in Japan.
What EM is not, is harmful, pathogenic, genetically-engineered/modified (GMO), nor
chemically-synthesized. Neither is EM a drug or fertilizer.
EM Technology has shown beneficial effects on many aspects of the environment,
agricultural crops and animal husbandry. EM leads to the improvement of soil nutritional
status, physical, chemical and microbiological properties, helping crops to grow healthy and
strong. There is no more need to use chemicals and pesticides. The same holds for animal
husbandry. It helps the farmer maintain an eco-friendly system, minimising the damage to
natural cycles.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 89
BIOMEDICAL WASTE MANAGEMENTDr. Ethel Suman
Associate Professor in Microbiology,
Kasturba Medical College, Mangalore, Manipal University
DEFINITION
Waste generated during diagnosis, treatment, immunisation of human beings or
animals or in research activities pertaining to or in production or testing of biologicals is
termed as Biomedical waste
CLASSIFICATION
The World Health Organization (WHO) has classified medical waste into eight categories:
General Waste
Pathological
Radioactive
Chemical
Infectious to potentially infectious waste
Sharps
Pharmaceuticals
Pressurized containers
Major sources of Biomedical Wastes:
1. Govt. hospitals/private hospitals/nursing homes/ dispensaries.
2. Primary health centers
3. Medical colleges and research centers/ paramedic services
4. Veterinary colleges and animal research centers
5. Blood banks/mortuaries/autopsy centers
6. Biotechnology institutions
Minor sources are:
1. Physicians/ dentists’ clinics
2. Animal houses/slaughter houses.
3. Blood donation camps.
4. Vaccination centers.
Routes of infection:
Through non – intact skin (cuts and puncture) or intact skin.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 90
Through mucous membranes
Inhalation of dust particles containing germs.
By ingestion - through contaminated unwashed hands, water and foodstuff.
PRECAUTIONS
All personnel must be vaccinated against Hepatitis B
Heavy duty gloves muat be worn while dealing with infectious waste specially
sharps
Sharps should not be left casually on counter tops, trays or beds
Recapping needles should be discouraged
Need for Biomedical waste Management:
1. Prevent nosocomial infections
2. Prevent Misutilisation of left over drugs.
3. Check the risk of infection outside hospital for waste handlers and scavengers
4. Check the risk associated with hazardous chemicals, drugs to persons handling
wastes at all levels.
5. Minimise the risk of air, water and soil pollution directly due to waste ,or due to
defective incineration emissions and ash.
Biomedical waste management rules in India
Ministry of enviroment and forest has revised the bio medical waste management and
handling rules under the environment protection act of 1986.Rules now called as the
Bio medical wastes (management and handling) rules 2011, in Karnataka; KPCB
follows the biomedical waste management & handling rules 1998.
Environment Legislation:
The environment(protection) act,1986
The biomedical waste (management and handling)rules,1998
The municipal solid waste( management and handling)rules,2000
Steps in waste management
1. Waste collection
2. Segregation
3. Transportation and storage
4. Treatment & Disposal
5. Transport to final disposal site
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 91
6. Final disposal
7. Recycling
Waste collection and survey
Differentiate & quantify the waste generated.
Determine the points of generation.
Types of waste at each point.
Level of generation of waste.
Disinfection within the hospital.
Helps to determine the method of waste disposal.
Waste segregation
Different kinds of waste in different containers or coded bags at the point of
generation.
Schedule I of BMW rules show the categories of bio-medical waste in India.
Schedule II of BMW rules elaborate about the colour coding of the bags.
Colour Coding of Bags:
Pink bag
► Rubber gloves (after disinfection)
► Disinfected plastic material
► Plastic vials with nonpathogenic material
► Culture plates (after autoclaving)
Yellow bag
► Specimens
► Contaminated/ soiled cotton/ paper
► Linen/swabs
► Soiled material other than sharps
Black bag
► Non-contaminated articles only
Plastic can
► All sharps
► Syringes/needles/scalpel blades
► Broken glass
► Broken slides
The following should NOT be done
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 92
Put the waste indiscriminately.
Put wrong bags in bin. (Adhere to colour code.)
Fill the bags till neck. (Waste would otherwise spill over.)
Handle waste without protective clothing.
Drag the bags after removal. (Bags can burst and the site could be repulsive.)
Never recap the needle. (Never re-use needle without disinfection)
Mix non infectious waste with infectious waste.
CONCLUSION
Hazards of poor management of biomedical waste have aroused the concern world
over, especially in effects on human, health and the environment Biomedical Waste has to be
managed appropriately..
WEALTH FROM WASTES – EDIBLE MUSHROOM CULTIVATIONDr. A. Panneerselvam
Associate Professor & Head,
Department of Botany and Microbiology,
A.V.V.M Sri Pushpam College (Autonomous),
Poondi-613 503, Thanjavur District, Tamil Nadu.
Mobile: 9443661858
Email: [email protected]; [email protected]
Residues from crops after harvest can be recycled in agriculture not only to conserve
energy but also to minimize pollution. Intensive agriculture in the last two decades has no
doubt increased food production but the disposal of plant residues has posed fresh problems.
Some of the important residues are straw from rye, wheat, barley, rice, oat, trash from
sugarcane, husk from paddy etc. Now-a-days, the attention of the Government is also focused
on wealth from wastes. The cultivation of edible mushroom is possible from agrowastes
containing cellulose. Since mushrooms possess cellulolytic property, they can be grown on
cellulosic substrates like paddy straw, sugarcane trash, paddy husk etc. Mushroom cultivation
involves a number of different operations including preparation of pure culture, spawn and
compost as well as crop management and marketing.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 93
The great value in promoting the cultivation of mushrooms lies in their ability to grow
on cheap carbohydrate materials. This is extremely important in the rural areas where there is
enormous quantity of wastes that have been found to be ideal as substrates for tropical
mushrooms. Furthermore the spent compost, which is the substrate left over after mushroom
harvesting, can be converted into stock feed and plant fertilizer as a soil conditioner. It is
obvious that mushroom cultivation opens the dead lock in the biological degradation of
natural resources. Thus its immediate potential contributions should be properly recognized.
The Government of India also included “Edible mushroom cultivation” as one of the
trades under the TRYSEM (Training for Rural Youth and Self employment) project during
the VIII five year plan and under this project training were being given to the rural youths in
the Department of Botany, A.V.V.M Sri Pushpam College (Autonomous), Poondi from 1992
onwards.
The Tamil Nadu state council for science and Technology Chennai also launched
various scheme to popularize edible mushroom cultivation. Dissemination of Innovative
Technology (DIT), Science popularization programme, women’s self help group programme,
Application of Science and Technology in Rural Area (ASTRA), Anna Marumalarchi
Thittam, are some of the successful scheme implemented in the state.
Types of Mushroom popular in India
Botanical Name Common name
1. Pleurotus sp. Oyster mushroom
2. Valvariella sp. Paddy straw mushroom
3. Agaricus sp. Button mushroom
4. Calocybe sp. Milky mushroom
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 94
Techniques in mushroom culture
Mother spawn preparation
The first generation of fungal culture is called the “mother spawn”. The mother spawn
can be successfully used upto third or fourth generation continuously to prepare ordinary
spawn for mushroom cultivation.
The cholam grain (small size) (1Kg) are placed in a trough of water to remove the
chaffy grains. Then it is half cooked (approximately 20 minutes). The excess water is drained
and spread on sterilized cloth. Then 20 g of Calcium carbonate coating prevents the grain
from sticking. These grains are filled in clean glucose drip bottles (300 g/bottle) or
polypropylene bag. Then the bottles are tightly plugged with non- absorbing cotton and
wrapped with a paper, tied with a thread and placed in an autoclave for sterilization (20lbs
pressure for 30 minutes). After cooling the bottles are ready for inoculation.
Inoculation Technique
The sterilized bottles are taken into the culture room. The UV lamp is switched on for
15 minutes to sterilize the air inside. Then it is switched off and the ordinary fluorescent tube
is switched on. The inoculation work can be done in the laminar air flow chamber. With the
help of cork borer 10mm diameter disc made from the petriplates having fully grown
mushroom fungus. The disc is transferred into the sterilized spawn bottle with the help of an
inoculation needle. This is done over the Bunsen burner flame to avoid contamination. The
bottles are incubated at room temperature. The white mycelium is observed in the entire
bottle after 12 days of inoculation. This is known as “mother spawn”.
Multiplication of spawn from mother spawn
From a single mother spawn at least 25 spawn bottles can be prepared. The calcium
carbonate mixed grains are sterilized and then the sterilized bottles are inoculated with
mother spawn. About 10 g of Cholam grains along with the mushroom fungus is required for
inoculation. The inoculated bottles is plugged with the non – absorbent cotton immediately
and wrapped with paper and tied with a thread. The spawn bottle is incubated for 15 days for
spawn run. One can use this spawn upto a period of 30days from the date of inoculation.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 95
Preparation of Mushroom bed and cultivations of mushrooms
Mushroom beds can be prepared using different substrates viz., Paddy straw,
sugarcane trash and paddy husk. For each spawn bottle two beds can be prepared. Size of
each bed is 30 × 60 cm. fresh paddy straw are chopped into pieces of 2-3 inches length and
soaked in water for 10 hours. Water is then drained off from the paddy straw. Afterwards, the
paddy straws are sterilized using vertical autoclave at 15 lbs pressure for 20 minutes. The
sterilized paddy straws are placed on a wire mesh net for draining excess water. Polythene
covers in the size of 30 × 60 cm are procured and filled with the treated paddy straw as
follows. Before preparing mushroom beds hands and all the instruments should be sterilized
with a dilute solution of KMnO4/alcohol. A polythene bag is tied at one end and sterilized
paddy straw is filled through the open end for about 5 cm in length. A handful of spawn from
the bottle is spread (15 g) towards the periphery of this layer. Over the spawn some more
paddy straw are put and pressed lightly. This process is repeated five times. The mouth of the
bag is rolled and closed with stapler pins. Holes are made over the bag for aeration. One
bottle of spawn is enough to inoculate two bags of paddy straw. Inoculation paddy straw bags
are kept in a ventilated dark chamber. The mycelia will colonize the entire paddy straw bag
within 15 days. Now the polythene cover is peeled off and the compact lump of paddy straw
is placed in a cools shady room and sprayed with water 3-4 times per day. The young fruit
bodies will come out from the bag. When the fruit bodies attain their full growth, they will be
harvested.
Mushroom Recipes
1. Mushroom soup
2. Mushroom vegetable curry/Peas curry
3. Mushroom fry
4. Mushroom pickle
5. Mushroom cutlet
6. Mushroom kuruma
7. Mushroom Briyani
8. Mushroom snacks
9. Mushroom Pagodas
10. Mushroom omelets
11. Mushroom sandwiches
12. Mushroom biscuits
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 96
13. Mushroom puppets
14. Mushroom pulavu
15. Mushroom baji
16. Mushroom masala
17. Mushroom panneer
18. Mushroom chappathi
19. Mushroom Gheer
20. Mushroom ketchup
21. Creamy Mushroom
22. Marinated Mushroom salad
Possible health benefits of consuming mushroomsConsuming fruits and vegetables of all kinds has long been associated with a reduced
risk of many lifestyle-related health conditions. Countless studies have suggested that
increasing consumption of naturally-grown foods like mushrooms decreases the risk of
obesity and overall mortality, diabetes, heart disease and promotes a healthy complexion and
hair, increased energy, and overall lower weight.
Cancer
Selenium is a mineral that is not present in most fruits and vegetables but can be
found in mushrooms. It plays a role in liver enzyme function, and helps detoxify some
cancer-causing compounds in the body. Additionally, selenium prevents inflammation and
also decreases tumor growth rates.
The vitamin D in mushrooms has also been shown to inhibit the growth
of cancer cells by contributing to the regulation of the cell growth cycle. The float in
mushrooms plays an important role in DNA synthesis and repair, thus preventing the
formation of cancer cells from mutations in the DNA.
Diabetes
Studies have shown that type 1 diabetics who consume high-fiber diets have lower
blood glucose levels and type 2 diabetics may have improved blood sugar, lipids and insulin
levels. One cup of grilled portabella mushrooms and one cup of stir-fried shiitake mushrooms
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 97
both provide about 3 grams of fiber. The Dietary Guidelines for Americans recommends 21-
25 g/day for women and 30-38 g/day for men.
Heart health
The fiber, potassium and vitamin C content in mushrooms all contribute to
cardiovascular health. Potassium and sodium work together in the body to help regulate blood
pressure. Consuming mushrooms, which are high in potassium and low in sodium helps to
lower blood pressure and decrease the risk of high blood pressure and cardiovascular
diseases. Additionally, an intake of 3 grams of beta-glucans per day can lower blood
cholesterol levels by 5%.
Immunity
Selenium has also been found to improve immune response to infection by
stimulating production of killer T-cells. The beta-glucan fibers found in the cell walls of
mushrooms stimulate the immune system to fight cancer cells and prevent tumors from
forming.
Weight management and satiety:
Dietary fiber plays an important role in weight management by functioning as a
"bulking agent" in the digestive system. Mushrooms contain two types of dietary fibers in
their cell walls: beta-glucans and chitin which increase satiety and reduce appetite, making
you feel fuller longer and thereby lowering your overall calorie intake.
APPLICATION OF BIO TECHNOLOGY IN TREATMENT OF HEAVY METAL CONTAMINATED INDUSTRIAL WASTE WATER-
A CASE STUDY
H. Lakshmikantha, Nagarathna N D# and Saranya D$
Deputy E nvironmental Officer
KSPCB, Mangaluru
Human life, as with all animals and plants life on this planet, is dependent upon water.
Effluents from industries like; textile, leather, electroplating, dyes and pigment, metallurgical,
contains considerable amount of toxic metal ions. These metal ions pose problems to the
water environment as the industries often indulge in discharging waste water into
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 98
underground and open drains or pit. The potential impacts from leaching operations on the
environment are most likely to be experienced as changes to surface and groundwater quality.
In this study an attempt has been made to utilize the microbes in treatment of industrial waste
water collected from textile, electroplating industries. Studies have been carried out to
specifically utilize the selected species of locally available microbal species in treatment of
chromium contaminated industrial waste water. Waste water samples were collected from
various industries, subjected to characterization and compared analysis results. The waste
water was subjected to bio remediation process to treat the waste water and the results have
shown that the possibility of application Acidthiobacilus microbal community in effective
treatment of chromium contaminated industrial waste water.
BIOLOGICAL CONTROL FOR SUSTAINABLE AGRICULTURE AND ENVIRONMENTAL MANAGEMENT
S. Shishupala
Department of Microbiology
Davangere University, Shivaganogotri Campus,
Davangere – 577002
E.mail:[email protected]
Biological control makes use of natural process of competition between organisms.
Successful agriculture always depends upon effective pest and disease management
strategies. Use of antagonistic microorganisms for preventing or curing plant diseases has
become one of the eco-friendly approaches in sustainable agriculture and environmental
management. Biological control agents belonging to Trichoderma spp. have been exploited
for their capacity to antagonize plant pathogenic fungi. Various mechanisms have been
attributed to different strains and species of Trichoderma showing antagonism. Major
mechanisms of action of these fungi involve aggressive growth, rhizosphere competence,
mycoparastism, production of hydrolytic enzymes, antibiosis and induction of plant
resistance. These fungi are known to have rapid growth pattern and hence able to
successfully compete well to establish in the crop rhizosphere. They are capable of utilizing
plant pathogenic fungi as source nutrients. Enzymes like cellulases, chitinases and
glucanases are effective in destroying cell walls of pathogenic fungi. Antibiosis involves
production of peptaibol antibiotics which induce membrane channels in the target fungi.
Apart from direct antagonism these fungi are capable of improving plant growth and induce
plant defence mechanisms as well. Ability of these fungi to elicit the plant to produce
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 99
defence proteins and phytoalexins is evident. These fungi are also involved in compositing
and hence useful in biomass utilization. All the unique features of these fungi may be
exploited for conversion of garbage to garden compost. Surely, these fungi will be able
contribute for sustainable agriculture and environmental management.
BIOFERTILIZERDr. A. Panneerselvam
Associate Professor & Head
Department of Botany and Microbiology
A.V.V.M Sri Pushpam College (Autonomous),
Poondi-613 503, Thanjavur District, Tamil Nadu.
Mobile: 9443661858
Email: [email protected]; [email protected]
INTRODUCTION
The increasing demand for higher food production to feed increased population, there
is an increased demand for chemical fertilizers which are based on non- renewable fossil
fuels, improved seeds, agro chemicals etc.
The term Biofertilizer refers to preparations containing living cells of efficient strains
of nitrogen fixing, phosphate solubilizing or cellulolytic microorganisms which have the
capacity to enrich the soil fertility either as free living or in the association with host plants.
Biofertilizers are used to reduce the use of chemical fertilizers, enhance soil fertility and yield
of crops in agriculture. They may be used either by mixing them with seeds or by spreading
them over the field during cultural operations. The microbes also produce some organic
substance which is readily used by green plants. In recent years, due emphasis has been paid
towards the use of biofertilizers in view of shortage of chemical nitrogenous and phosphatic
fertilizers.
I. N2 Providing Biofertilizer
1. Symbiotic Bacteria
Rhizobium
Rhizobia, the soil bacteria, have the ability to fix atmospheric nitrogen in symbiotic
associations with legumes and certain non legumes like Parasponia. Rhizobia was
discovered by Frank (1877) and Beijernick (1888). They normally enter the root hairs,
multiply there and form root nodules. The amount of nitrogen fixed varies with the strain of
Rhizobium, the plant species and environmental conditions.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 100
Structurally Rhizobium are rod shaped but great variation can be observed during their
life cycles. These symbiotic bacteria (Rhizobium) are difficult to cultivate in ordinary culture
media but they grow in mannitol agar. A transverse section of a nodule reveals a central
“Bacteroid Zone” which is enveloped in a nodule cortex. The bacteroid zone is made up of
host cells containing bacteroids encased in membranous envelopes which are of host orgin.
Bacteroids are non- motile stage in the life cycles Rhizobium act on the primary site of
nitrogen fixation as they contain the key enzyme nitrogenase.
2. Non- Symbiotic Bacteria
Azotobacter
Azotobacter is a gram negative free-living non symbiotic, nitrogen fixing bacterium.
It occurs in soil and fresh water ponds. Beijerinick, in the early part of this century, was the
first to isolate and described. A.chroococcum and A.agilis, during later years several other
species have been described. A.vinelandii, A.beijerinckii, A.insignis, A.macrocytogenes and
A.paspaii. one of the dominant bacterium occurring in Indian soils is A.chroococcum which
rarely exceeds 104 to 105/g soil in Indian soils.
3. Associative Bacteria
Azospirillum
Azospirillum was first described as Spirillum lipofrum by Beijerinck in 1925 as
nitrogen fixing bacterium. Tarrand, Krieg and Dobereiner (1978) re-named this organism as
Azospirillum (N- fixing Spirillum). Azospirillum have been found to be associated with the
roots and rhizospheres of many members of the Gramineae, particularly in the tropics.
Digitaria, Maize, Sorgum, Rice, Sugarcane, Wheat and forage grasses are most frequently
cited as hosts. Da silva and Dobereiner (1978) found that soils under grasses retained more
Azospirillum than others.
Occurrence of Azospirillum in certain saline and saline – alkali soils of India has also
been reported by Tilak and Krishnamurthi (1981). Azospirillum is recognized as a ubiquitous
soil organism capable of colonizing effectively not only the roots of wide variety of plants
but also their above ground portions forming apparently an associative symbiosis.
4. Cyanobacteria (Blue Green Algae)
Frank (1889) first reported the ability of nitrogen fixation by blue green algae. They
are ubiquitous in distribution. They are either single celled or consist of branched or
unbranched filaments. Some of them possess a peculiar structure known as “heterocyst” and
all heterocysts forms can fix nitrogen from air. Recently, some blue green algae without
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 101
heterocystes have also been found to fix nitrogen under special conditions like low O2 tension
(microaerophilic condition).
Blue Green Algae (BGA) Biofertilizer has been proved to be the most efficient source
of organic nitrogen in low land paddy. The algae utilize inexhaustible energy source of solar
radiation. The BGA promotes the growth of paddy crop by supplying fixed nitrogen through
exudation and microbial degradation of dead algal cells. Algalizatioin increases the fertilizer
use efficiency of the crop plants, reduces the loss of fertilizer nitrogen and above all provides
these benefits in a recurring manner.
5. Actinomycetes
Actinomycetes, any member of a heterogeneous group of gram-positive, generally
anaerobic bacteria noted for a filamentous and branching growth pattern that results, in most
forms, in an extensive colony, or mycelium. The mycelium in some species may break apart
to form rod- or coccoid-shaped forms. Many genera also form spores; the sporangia, or spore
cases, may be found on aerial hyphae, on the colony surface, or free within the environment.
Motility, when present, is conferred by flagella. Many species of actinomycetes occur in soil
and are harmless to animals and higher plants, while some are important pathogens, and
many others are beneficial sources of antibiotics.
Frankia
Frankia is a genus of nitrogen fixing, filamentous bacteria that live in symbiosis
with actinorhizal plants, similar to the Rhizobia bacteria that are found in the root nodules
of legumes in the Fabaceae family. Bacteria of this genus also form root nodules.
This genus was originally named by Jorgen Brunchorst in 1886 to honor the German
biologist, A. B. Frank. Brunchorst considered the organism he had identified to be a
filamentous fungus. Becking redefined the genus in 1970 as
containing prokaryotic actinomycetes and created the family Frankiaceae within
the Actinomycetales. He retained the original name of Frankia for the genus.
Frankia alni is the only named species in this genus, but a great many strains are
specific to different plant species. The bacteria are filamentous and convert atmospheric
nitrogen into ammonia via the enzyme nitrogenase, a process known as nitrogen fixation.
They do this while living in root nodules on actinorhizal plants. The bacteria can supply most
or all of the nitrogen requirements of the host plant. As a result, actinorhizal plants colonise
and often thrive in soils that are low in plant nutrients.
Several Frankia genomes are now available which may help clarify how the symbiosis
between prokaryote and plant evolved, how the environmental and geographical adaptations
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 102
occurred, the metabolic diversity, and the horizontal gene flow among the symbiotic
prokaryotes.
II. Phosphate providing biofertilizer
Phosphorous is a vital nutrient for plants and microorganisms. The phosphorous
content of most soils is quite low. In such conditions applications of phosphatic fertilizer in
the available form is essential for better crop yield. It is well known that more than two thirds
of phosphatic fertilizer is rendered unavailable within a very short period of its application
due to fixation in the soil complex (Gaur, 1990).
It has been established that there are specific groups of soil microorganisms which
increase the availability of phosphate to plants, not only by mineralizing organic phosphorous
compounds but also by rendering inorganic phosphorous compounds more available to them
(Garretsen, 1948 and Sundara Rao, 1968). Considerable success was earlier claimed,
particularly by Russian workers, in increases yield and quality of crops by inoculating seeds
with pure and efficient strains of Bacillus megaterium var. phosphaticum commonly called
phosphobacterin mineralizing organophosphate. Microbial solubilization of inorganic and
organic phosphate compounds has been extensively studied under Indian conditions (Sundara
Rao and Sinha, 1963). Therefore one of the approaches would be to increase the number and
activity of efficient phosphate solubilizing microorganisms in the root zone of plants by use
of microbial inoculants for increasing phosphorous availability to the plants from the soil as
well as added phosphate (Gaur, 1990).
Having world’s largest area under crops where biofertilizer use has been quite
beneficial, India has significant potential to promote biofertilizer technology. For this it is
essential to understand the steps involved in microbial inoculants production involving
phosphate solubilizing microorganisms.
1.Phosphate mobilisers
Mycorrhizal Fungi
The term mycorrhiza was first coined by Frank (1885) for the mutualistic associations
formed between plant roots and certain fungi. Such associations exist in the majority of land
plant species and therefore in ecosystems throughout the world. A study of the occurrence of
mycorrhizas in the Indian flora provides an example of their distribution; 90% of the
angiosperm species, 100% of the gymnosperms and 70% of the pteridophytes are able to
form mycorrhizal association are morphologically and physiologically divers, and their
structures and functions depend on the symbionts involved. There are different types of
mycorrhia viz.,ectomycorrhiza, ericoid mycorrhiza, orchid mycorrhiza, arbuscular
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 103
mycorrhiza, arbutoid mycorrhiza, and monotropoid mycorrhiza, distinguished primarily by
the morphology of contact zone between the partners. The difference in the morphology of
the mycorrhizal type is refelected in the resulting physiological relationships. Among the
different types of mycorrhiza,, Arbuscular Mycorrhiza,(AM) occupy a unique ecological
position and are the most abundant and widespread forming symbiotic association in the roots
of many angiosperms, gymnosperms, pteridophytes, bryophytes and thallophytes. AM
represents one of nature’s best gifts to mankind in the conversion of arid soil to productive
and fertile.
The development of the AM association’s involves a complex series of interactions
between the plant and the fungus and the coordinate cellular development both symbionts is
required to achieve the functional symbiotic state in which reciprocal transfer of nutrient
occur. The plant provides the fungus with carbon and receives an additional supply of
phosphate and other mineral nutrients, imported from the soil by the fungus. Thus, the
symbiosis can be particularly beneficial for the plant especially when growing in nutrient-
poor conditions. Reports of increased growth health and stress tolerance of mycorrhizal
plants are accordingly widespread. Mycorrhizal plants may also show enhanced disease
resistance, which in some cases may be mediated by factors other than enhanced mineral
nutrition.
2. Phosphate solubilizers
a. Phosphate Solubilizing Bacteria (PSB)
Phosphate solubilizing bacteria (PSB) are a group of beneficial bacteria capable of
hydrolysing organic and inorganic phosphorus from insoluble compounds.[1] P-solubilization
ability of the microorganisms is considered to be one of the most important traits associated
with plant phosphate nutrition. It is generally accepted that the mechanism of mineral
phosphate solubilization by PSB strains is associated with the release of low molecular
weight organic acids, through which their hydroxyl and carboxyl groups chelate
the cations bound to phosphate, there by converting it into soluble forms. In addition, some
PSB produce phosphatase like phytase that hydrolyse organic forms of phosphate compounds
efficiently. One or both types of PSB have been introduced to Agricultural community as
phosphate Biofertilizer. Phosphorus (P) is one of the major essential macronutrients for plants
and is applied to soil in the form of phosphate fertilizers. However, a large portion of soluble
inorganic phosphate which is applied to the soil as chemical fertilizer is immobilized rapidly
and becomes unavailable to plants.
International Journal of Emerging Engineering Applications and Bio-Science
ISBN:978-93-5009-346-7 Volume II || Issue 1 || Page 104
Most of the cultivable soil being alkaline in nature contains less available
phosphorus. Due to higher concentration of Calcium, whenever phosphatic fertilizers are
applied in such soil, the large quantity of it gets fixed as Tri-Calcium Phosphate as it is water
insoluble and hence becomes unavailable to the crop. Certain soil microorganisms have
inherent capacity to dissolve part of the fixed phosphorus and make it available to the crop by
secreting certain organic acids. Phosphate Solubilizing Bacteria are useful for all the crops
i.e. Cereals, Cash crops Leguminous crops Horticultural crops. Vegetables etc.
Advantages of PSB
The effective strain of Phosphate Solubilized Bacteria used, increase the level of
available P2O5 in the soil.
With the increase in available P2O5 level, overall plant growth can be increased.
In certain condition they also exhibit anti-fungal activities and thereby fungal diseases
may be controlled indirectly.
About 10 to 15% increase of crop yield can be achieved with the use of this culture.
Phosphate Solubilizing Fungi
The mechanisms of phosphate solubilization, development and mode of fungal
inoculants application and mechanisms of growth promotion by phosphate-solubilizing fungi
for crop productivity under a wide range of agro-ecosystems and the understanding and
management of P nutrition of plants through the application of phosphate-solubilizing fungi.
Eg., Aspergillus niger and Penicillium notatum
Advantages of Biofertilizer
Renewable source of nutrients
Sustain soil health
Supplement chemical fertilizers.
Replace 25-30% chemical fertilizers
Increase the grain yields by 10-40%.
Decompose plant residues, and stabilize C:N ratio of soil
Improve texture, structure and water holding capacity of soil
No adverse effect on plant growth and soil fertility.
Stimulates plant growth by secreting growth hormones.
Secrete fungistatic and antibiotic like substances
Solubilize and mobilize nutrients
Eco-friendly, non-pollutants and cost effective method