an overview of dna sequencing - michigan state university lecture_sequencingassembly.pdfbacs are...
TRANSCRIPT
![Page 1: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/1.jpg)
An Overview ofDNA Sequencing
![Page 2: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/2.jpg)
Prokaryotic DNA
http://en.wikipedia.org/wiki/Image:Prokaryote_cell_diagram.svg
Plasmid
![Page 3: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/3.jpg)
Eukaryotic DNA
http://en.wikipedia.org/wiki/Image:Plant_cell_structure_svg.svg
![Page 4: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/4.jpg)
The two strands of a DNA molecule are held together by weak bonds (hydrogen bonds) between the nitrogenous bases, which are paired in the interior of the double helix.
The two strands of DNA are antiparallel; they run in opposite directions. The carbon atoms of the deoxyribose sugars are numbered for orientation.
DNA Structure
http://en.wikipedia.org/wiki/Image:DNA_chemical_structure.png
![Page 5: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/5.jpg)
The goal of sequencing DNA is to tell the order of the bases, or nucleotides, that form the inside of the double-helix molecule.
We can do this in one of two ways:
• Directed Sequencing• Shotgun Sequencing
Sequencing DNA
![Page 6: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/6.jpg)
Directed Sequencing=Primer Walking
• Start with genome, gene, clone, PCR product
• Design a primer and sequence a certain segment of the genome, usually the beginning.
• From that sequence, design the next primer and sequence the next segment of the genome.
• Continue designing primers and sequencing until the genome is completed.
.
![Page 7: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/7.jpg)
Shotgun Sequencing
• Start with a whole genome or a large piece of the DNA (a BAC).
• Shear the DNA into many different, random segments.
• Sequence each of the random segments.
• Then, put the pieces back together again in their original order.
![Page 8: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/8.jpg)
Theory Behind Shotgun Sequencing
Haemophilus influenzae 1.83 Mb baseCoverage unsequenced (%)
1X 37%2X 13%5X 0.67%6X 0.257X 0.09%
For 1.83 Mb genome, 6X coverage is 10.98 Mb of sequence, or 22,000 sequencing reactions, 11000 clones (1.5-2.0 kb insert), 500 bp average read.
0
500
1000
1500
2000
2500
3000
0 20000 40000 60000 80000
Sequences
Gap
s
![Page 9: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/9.jpg)
BAC based Projects
BACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces of DNA that are 50 to 300 kilobases. To make copies of the DNA we insert the BAC into an E. coli cell.
chromosome
break into large pieces
clone into BAC vector
transform in E. coli and process each BAC as individual
projects
![Page 10: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/10.jpg)
Shotgun vs. Directed: Which is the better, more efficient method?
• With directed, sequences are done in order and there’s no puzzle to put back together. Minimal computing power is required.
• Primers must be continually designed and purchased.
• If an area is difficult to sequence, you could get stuck.
• Shotgun sequencing takes less time; all the sequences can be done at about the same time.
• Minimal cost
• But, the pieces have to be assembled, a time-consuming process requiring extensive computational power.
![Page 11: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/11.jpg)
2. Random Sequencing Phase
a. sequence DNA (15,000 sequences/ Mb)
GGG ACTGTTC ...
a. isolate DNA
b. fragment DNA
c. clone DNA
3. Closure Phase
a. assemble sequences
b. close gaps
d. annotation
c. edit
237 239
2384. COMPLETE GENOME SEQUENCE
1.Library construction
Whole Genome Shotgun Sequencing
![Page 12: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/12.jpg)
Library Construction
• Construct shotgun libraries of the genome or target DNA; sizes of inserts are varied; could be small (2-3 kb), medium (8-12 kb), or fosmid (30-40 kb)
• Start with multiple copies of purified DNA
• Shear the DNA using mechanical force, breaking it into smaller pieces
• DNA fragments are cloned into a plasmid vector to replicate the DNA; these fragments are called “inserts”
![Page 13: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/13.jpg)
Library Construction
• Insert fragment DNA into a vector such as pBR322
• Transform into E. coli cells and, using an antibiotic, select for cells that have a plasmid. The plasmids carry antibiotic resistant genes. When plated in the presence of an antibiotic, the cells without a plasmid die.
![Page 14: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/14.jpg)
Template Preparation• Isolation of the plasmid DNA
• Transformed E.coli is plated onto an agar plate. Every E. coli colony will contain plasmids with the same insert.
• Colonies are “picked” & transferred to liquid media where they multiply; use 384 well high throughput plates
• Plasmids are isolated and suspended in a buffer.
![Page 15: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/15.jpg)
Template Production LaboratoryCurrent Capacity: 22,000,000 plasmids/year
![Page 16: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/16.jpg)
Sanger Sequencing
• Utilize dideoxy sequencing method of chain termination (Sanger)
• Each plasmid is reacted with a forward and reverse primer (2 reactions for each piece of DNA).
• Done in high throughput manner in 384 well plates
![Page 17: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/17.jpg)
-Initial dideoxy sequencing involved use of radioactive dATP and 4 separate reactions (ddATP, ddTTP, ddCTP, ddGTP) & separation on 4 separate lanes on an acrylamide gel with detection through autoradiogram
-New techologies use 4 fluorescently labeled bases and separation on capillaries and detection through a CCD camera
Sequencing reactions
![Page 18: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/18.jpg)
DNA sequencing
![Page 19: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/19.jpg)
Plasmid Structure
Antibioticresistance
F primer binds, synthesis
R primer binds,
synthesis
![Page 20: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/20.jpg)
Sequencing Machines
• The DNA fragments are loaded into capillaries in the sequencing machines.
• Polymer in the capillaries provides a matrix for separating the DNA fragments based on size.
• Separation of the fragments through a matrix is called electrophoresis.
![Page 21: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/21.jpg)
Sequence Production LaboratoryCurrent Capacity: 40,000,000 sequences/year
![Page 22: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/22.jpg)
Data Collection• A laser excites the fluorescent dyes.• A camera detects the fluorescence.• Data collection software collects the data.
Capillary array view
![Page 23: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/23.jpg)
Sequencing Machine Output
AACTCATCGAATCCGTACGGGAACTCATCGAATCCGTACGGAACTCATCGAATCCGTACGAACTCATCGAATCCGTACAACTCATCGAATCCGTAAACTCATCGAATCCGTAACTCATCGAATCCGAACTCATCGAATCCAACTCATCGAATCAACTCATCGAATAACTCATCGAAAACTCATCGAAACTCATCGAACTCATCAACTCATAACTCAAACTCAACTAACAAA
Fluorescent Sequencing Gel
Four colors, one lane per sample
Fluorescent Sequencing GelEach fragment differs by one
nucleotide
This is a diagram of just one lane. Reading from the bottom, where the fragment is only one base long, the fluorescent dye is an A. This is the first base in the sequence.
![Page 24: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/24.jpg)
Data Analysis
• An chromatogram is produced and the bases are called
• Software assign a quality value to each base • Phred & TraceTuner
• Read DNA sequencer traces• Call bases• Assign base quality values• Write basecalls and quality values to output files.
![Page 25: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/25.jpg)
Assemble Fragments
SEQUENCER OUTPUT
ASSEMBLE FRAGMENTS
CLOSURE & ANNOTATION
TAGCTAGCAGCTAGC
AGCTAGGCTC
AGCTCGCTAGCTAGCTAGCTAGCTAGGCTC
AGCTCGCTATAGCTAGCTA
CTAGCTAGCTAGGCTCGCTAGCTAGCT
CTCGCTAGCTAG
AGCTCGCTAGCTAGCTAGCTAGC
AGCTAGGCTC AGCTCGCTACTAGCTAGCTAGGCTC
GCTAGCTAGCT
AGCTCGCTAGCTATAGCTAGCTA
AGCTAGC
CTCGCTAGCTAGTAGCTAGC
GCTAGCTAGC
![Page 26: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/26.jpg)
• CONSENSUS SEQUENCE
• FRAGMENTS FROM
SEQUENCING PROCESS
![Page 27: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/27.jpg)
Closure
• Assemble the sequence files, relate them to each other, and close gaps
• Involves many computational programs to identify overlapping sequences, linkages between sequences
• Back to the lab for hard to close gaps
![Page 28: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/28.jpg)
Complicating Factors
• A procedure that works well in one species may not produce the same results in even a closely related species.
• Each genome is uniquely different in its size and how it sequences and assembles
• New technologies must be developed to tackle the unique characteristics and properties of difficult genomes
![Page 29: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/29.jpg)
Whole Genome Shotgun Sequencing:Modifying for Eukaryotes
Not restricted to bacterial organisms
Sequence eukaryotes:
whole genome draft sequence; same approach as
with bacteria
chromosome by chromosome; sequence genome
using large insert bacterial artificial chromosome
(BAC) clones anchored to the chromosomes
combination of whole genome and chromosome
by chromosome
![Page 30: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/30.jpg)
Whole Genome Draft Sequencing
2. Random Sequencing Phase
a. sequence DNA (15,000 sequences/ Mb)
GGG ACTGTTC ...
a. isolate DNA
b. fragment DNA
c. clone DNA
3. Closure Phase
a. assemble sequences
b. close gaps
d. annotation
c. edit
237 239
2384. COMPLETE GENOME SEQUENCE
1.Library construction
![Page 31: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/31.jpg)
Whole Genome Draft Sequencing
2. Random Sequencing Phase
a. sequence DNA (15,000 sequences/ Mb)
GGG ACTGTTC ...
a. isolate DNA
b. fragment DNA
c. clone DNA
3. Closure Phase
a. assemble sequences
b. close gaps
d. annotation
c. edit
237 239
2384. COMPLETE GENOME SEQUENCE
1.Library construction
Advantages:Saves time and money
(~50 %)
Disadvantages: Incomplete sequence, contains errors
![Page 32: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/32.jpg)
454 Genome Sequencing System• Library prep, amplification and sequencing: 2-4 days• Single sample preparation from bacterial to human genomic DNA• Single amplification per genome with no cloning or cloning artifacts• Picoliter volume molecular biology• 100 Mb per run (4-5 hr); less than $ 20,000 per run• Read lengths 200-230 bases• Massively parallel imaging, fluidics and data analysis • Requires high genome coverage for good assembly• Error rate of 1-2%
![Page 33: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/33.jpg)
454-Pyrosequencing
Perform emulsion PCR
Depositing DNA Beads into the PicoTiter™Plate
Construct Single stranded
adaptor liagated DNA
Sequencing by Synthesis:Simultaneous sequencing of the entire genome in
hundreds of thousands of picoliter-size wells
Pyrophosphate signal generation
![Page 34: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/34.jpg)
What is an EST? single pass sequence from cDNAspecific tissue, stage, environment, etc.
Multiple tissues, states..with enough sequences, can ask quantitative
questions
cDNAlibrary in E.coli
pick individual clones
template prep
pBluescript
T7 T3
Insert in
Expressed Sequence Tags (ESTs): Sampling the Transcriptome and Genic Regions
![Page 35: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/35.jpg)
Uses of EST sequencing:-Gene discovery-Digital northerns/insights into transcriptome-Genome analyses, especially annotation of genomic DNA
Issues with EST sequencing:-Inherent low quality due to single pass nature-Not 100 % full length cDNA clones -Redundant sequencing of abundant transcripts
Address throughclustering/
assembly to buildconsensus sequences
= Gene Index,Unigene Set,
Transcript Assembly
![Page 36: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/36.jpg)
EST Clustering
All ESTs and mRNAs from an organismCluster and Assemble
Set of clustered, assembled sequences=
contigs, Transcript Assembly, Tentative Consensus, Unigene
Longer, more accurate sequence of the transcript
Sequences which do not cluster or
assemble=Singletons, singlets
Single pass transcript
![Page 37: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/37.jpg)
http://www.jgi.doe.gov/education/how/how30minflash.html
http://www.illumina.com/media.ilmn?Title=Sequencing-By-Synthesis%20Demo&Cap=&PageName=solexa%20technology&PageURL=203&Media=1
Web Links for Animation on Genome Sequencing
![Page 38: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/38.jpg)
From Fragments to Finished Genome
Overview of Sequencing, Assembly, and Closure Processes
![Page 39: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/39.jpg)
![Page 40: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/40.jpg)
Genome Sequencing Process
Library Construction
Clone Picking
Template Preparation
Sequencing Reactions
Electrophoresis andBase Calling
Genome Assembly
Genome ClosureOrder ContigsClose Gaps
Identify RepeatsFinish the Genome
Annotation
rDNAMolecules
![Page 41: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/41.jpg)
Sequence Requirements
1. Free vector should be at low or undetectable level.
2. No chimeric clones. Chimeras occur two or more random fragments from separate parts of the genome recombine and end up next to each other.
3. The majority of the inserts should be of relatively uniform size.
4. Libraries need to be random and cover the whole genome.
![Page 42: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/42.jpg)
Basecalling & Quality AssignmentsPhred & TraceTuner
•Read DNA sequencer traces
•Call bases
•Assign base quality values
•Write basecalls and quality values to output files.
Warner Brothers, Inc.
![Page 43: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/43.jpg)
What are phred quality values?
The quality value q assigned to a base call is defined as:
q q = = -- 10 x log10 x log1010((pp))
where where pp is the estimated error probability is the estimated error probability for that basefor that base--call.call.
![Page 44: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/44.jpg)
OR
A base-call having a probability of 1/1000 of being incorrect is assigned a quality value of
30.
ProbabilityProbability Quality ValueQuality Value1/1001/100 20201/101/10 1010
![Page 45: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/45.jpg)
![Page 46: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/46.jpg)
Assembling the fragments
![Page 47: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/47.jpg)
Merging two sequences
…AGCCTAGACCTACAGGATGCGCGGACACGTAGCCAGGACCAGTACTTGGATGCGCTGACACGTAGCTTATCCGGT…
overlap (19 bases)overhang (6 bases)
overhang
overlap - region of similarity between regionsoverhang - un-aligned ends of the sequences
The assembler screens merges based on: • length of overlap• % identity in overlap region• maximum overhang size.
% identity = 18/19 % = 94.7%
![Page 48: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/48.jpg)
TIGR Assembler
Greedy
• Build a rough map of fragment overlaps
• Pick the largest scoring overlap• Merge the two fragments• Repeat until no more merges can be
done
![Page 49: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/49.jpg)
Forward-reverse constraints
• The sequenced ends are facing towards each other • The distance between the two fragments is known
(within certain experimental error)
clone length
sequenced ends
F R
![Page 50: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/50.jpg)
Scaffolding
• Given a set of non-overlapping contigsorder and orient them along a chromosome
III III IV
I
IIIII
IV
![Page 51: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/51.jpg)
Clone-mates
Vector
Insert
F R
FR
I II
R
I
F
II
F
II
R
I
![Page 52: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/52.jpg)
Linking information
• Overlaps
• Mate-pair links
• Similarity links
• Physical markers
• Gene synteny
reference genome
physical map
![Page 53: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/53.jpg)
Grouping the contigs
![Page 54: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/54.jpg)
Assembly gaps
group A group B
physical gap
sequencing gaps
sequencing gap - we know the order and orientation of the contigs and have at least one clone spanning the gap
physical gap - no information known about the adjacent contigs, nor about the DNA spanning the gap
![Page 55: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/55.jpg)
Unifying view of assembly
Assembly
Scaffolding
![Page 56: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/56.jpg)
Why Completeness is Important
• Improves characterization of genome features• Gene order, replication origins
• Better comparative genomics• Genome duplications, inversions
• Determination of presence and absence of particular genes and features is less subjective
• Missing sequence might be important (e.g., centromere)• Allows researchers to focus on biology not sequencing• Facilitates large scale correlation studies• Controls for contamination
![Page 57: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/57.jpg)
What Is Closure?
• Obtaining sequence that was not obtained during random sequencing which resulted in:
• Sequencing Gaps• Physical Ends
• Confirming the integrity of assemblies
• Repeats and misassemblies• Verification of Clone Coverage
• Confirming the base sequence of the consensus
• Editing• Verification of Sequence Coverage
![Page 58: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/58.jpg)
Sequence Validation: Sequence coverage
1X 2X 3X
Sequence coverage rule:Every base in an assembly must be covered by at least two sequences of high quality.
Why?Validating sequence coverage provides a high degree of confidence in the consensus base calls.
![Page 59: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/59.jpg)
Sequence editor
• In this example there is an obvious discrepancy between the base calls of several of the underlying clones in this region.
![Page 60: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/60.jpg)
Causes for gaps• Non-random shotgun library
• Toxicity of genes or promoters in E. coli• Genomic DNA difficult to clone (capsular polysaccharides)• Unstable regions (low complexity)
• Sequencing problems• Hard stops
• Secondary structures• Very high or low GC content• Small unit tandem repeats
• Loss of signal• Homopolymeric tracts• Very high or low GC content
![Page 61: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/61.jpg)
Closure Challenges: Sequencing Through Secondary Structures
![Page 62: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/62.jpg)
Hairpin structure
![Page 63: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/63.jpg)
Homopolymeric tracts
![Page 64: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/64.jpg)
![Page 65: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/65.jpg)
Solutions• Apply different sequencing chemistries
• Big-Dye terminator (default)• Dye-primer• dGTP mix (GC rich regions)
• Denature structures - Additives• Betaine• DMSO
• Break structure• Restriction digest• Transposon insertion• Micro-libraries
![Page 66: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/66.jpg)
Repetitive Areas
• Repetitive areas are regions of high similarity within the genome/BAC.
• Sequences in these areas may be misassembled by the Assembler.
• Verification of the sequence of repetitive areas:
• A. Identify potential repetitive areas, using repeatFinder and other tools.
• B. Classify repeats based on length, copy number, % similarity, structure and complexity.
• C. If repeats are misassembled, transpose spanning clones or obtain PCR products and sequence to verify assembly.
![Page 67: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/67.jpg)
Mis-assembled repeatClones link different repeat flanks
![Page 68: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/68.jpg)
Resolved Repeat• Unique flank order is correct
• Use linking information across the repeat (large insert clones or PCR)
• Consensus sequence is correct• Use linked clones that have one mate in the
repeat and the other anchored in unique sequence
• Transposon mediated libraries
![Page 69: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/69.jpg)
> GDRFE25TFCATTGAACACTAGGAGCCATAGAC………(up to 60 bases per line)GTTCAACCGTTTAAGGCAAAACTTA………AATTTTGGGCAGACTCTAGATCATG………GGTAATACATACTCTGGGATTACGA………
Fasta Format
![Page 70: An Overview of DNA Sequencing - Michigan State University Lecture_SequencingAssembly.pdfBACs are Bacterial Artificial Chromosomes. They are large transport systems that can hold pieces](https://reader033.vdocument.in/reader033/viewer/2022041713/5e49ac18cc9665573f1dcc8e/html5/thumbnails/70.jpg)
> GDRFE25TFCATTGAACACTAGGAGCCATAGACT………(up to 60 bases per line)GTTCAACCGTTTAAGGCAAAACTTA………AATTTTGGGCAGACTCTAGATCATG………GGTAATACATACTCTGGGATTACGA………
> GDRFE45TFACTGGTTCACATGGAGGGATAGTAC………(up to 60 bases per line)GACACTCCGTAGCTGGCAATCCTTA………GGCTCTCAATCGAGACTCTAGTTAC………TCCAATATGGGCTCATGGAACAAGA………
> GDRFE67TFCATTGAACACTAGGAGCCATAGATC………(up to 60 bases per line)AATGTGGCGTAGCTGCCACTTGGTA………TACCGTCAATCGTATTGTCTAGTTAC………GGGAGATAATATGGGCTCATATGGT………
>
Multifasta Format