analysis of nf-κb essential modulator (nemo) binding to linear and

NEMO-binding to linear di-ubiquitin is sufficient and essential for NF-κB activation

1

Analysis of NF-κB essential modulator (NEMO) binding to linear and lysine-linked ubiquitin chains and its role in the activation of NF-κB

Tobias Kensche‡, 1, Fuminori Tokunaga¶, ||, 1, Fumiyo Ikeda‡, 2, Eiji Goto ||, Kazuhiro Iwai¶, §, 3 and Ivan Dikic‡, 4 ‡Buchmann Institute for Molecular Life Sciences and Institute of Biochemistry II, Goethe University

School of Medicine, Theodor-Stern-Kai 7, D-60590 Frankfurt (Main), Germany ¶Department of Biophysics and Biochemistry, Graduate School of Medicine, and §Cell Biology and Metabolism Group, Graduate School of Frontier Biosciences, Osaka University, Suita, Osaka 565-

0871, Japan ||Laboratory of Molecular Cell Biology, Institute for Molecular and Cellular Regulation, Gunma

University, Maebashi, Gunma 371-8512, Japan.

*Running title: NEMO-binding to linear di-ubiquitin is sufficient and essential for NF-κB activation Correspondence to: Ivan Dikic, Buchmann Institute for Molecular Life Sciences and Institute of Biochemistry II, Goethe University School of Medicine, Theodor-Stern-Kai 7, D-60590 Frankfurt (Main), Germany, Tel.: +49 69 6301 5964; Fax: +49 69 6301 5577; E-mail: [email protected] Key words: NEMO, UBAN, NF-κB, TNF-Receptor, linearly linked ubiquitin

Background: Binding of NEMO to ubiquitin chains is essential for the activation of NF-κB. Results: Full-length NEMO preferentially binds linear ubiquitin chains in competition with lysine-linked ubiquitin chains. NEMO binding linear diubiquitin is sufficient for full NF-κB activation. Conclusion: NEMO is a high affinity receptor for linear ubiquitin chains and a low affinity receptor for long lysine-linked ubiquitin chains. Significance: Ubiquitin binding selectivity of NEMO is crucial for understanding the NF-κB activation pathways. SUMMARY

Nuclear factor-κB (NF-κB) essential modulator (NEMO), a component of the inhibitor of κB kinase (IKK)-complex, controls NF-κB signaling by binding to ubiquitin chains. Structural studies of NEMO provided a rationale for the specific binding between the UBAN (ubiquitin binding in ABIN and NEMO) domain of NEMO and linear (Met-1-linked) di-ubiquitin chains. Full-length NEMO can also interact with Lys-11-, Lys-48- and Lys-63-linked ubiquitin chains of varying length in cells. Here we

show that purified full-length NEMO binds preferentially to linear ubiquitin chains in competition with lysine-linked ubiquitin chains of defined length, including long Lys-63-linked deca-ubiquitins. Linear di-ubiquitins were sufficient to activate both the IKK-complex in vitro and to trigger maximal NF-κB activation in cells. In TNFα-stimulated cells, NEMO chimeras engineered to bind exclusively to Lys-63-linked ubiquitin chains mediated partial NF-κB activation as compared to cells expressing NEMO that binds to linear ubiquitin chains. We propose that NEMO functions as a high affinity receptor for linear ubiquitin chains and a low affinity receptor for long lysine-linked ubiquitin chains. This phenomenon could explain quantitatively distinct NF-κB activation patterns in response to numerous cell stimuli.

NF-κB transcription factors play a crucial

role during development as well as in various biological functions including innate and adaptive immunity, inflammation and cell survival (1,2). The NF-κB signaling pathway is activated by various stimuli including LPS,

http://www.jbc.org/cgi/doi/10.1074/jbc.M112.347195The latest version is at JBC Papers in Press. Published on May 17, 2012 as Manuscript M112.347195

Copyright 2012 by The American Society for Biochemistry and Molecular Biology, Inc.

by guest on April 8, 2018

http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/cgi/doi/10.1074/jbc.M112.347195

http://www.jbc.org/


2

TNFα, IL-1 and UV irradiation (1). It is well established that the kinase complex IKK is critical for the mediation of its downstream signal by phosphorylating inhibitor of kappaB (IκB), which leads to its subsequent degradation by the ubiquitin-proteasome system (2). The IKK-complex consists of two kinases, IKKα and IKKβ and a regulatory subunit called NEMO (3). It has been shown that NEMO is a critical component for cell survival and activation of the canonical NF-κB pathway (4,5).

Formation of different ubiquitin chains was suggested to control compartment specific signals necessary to efficiently activate NF-κB (6). These ubiquitin signals are transmitted by proteins containing ubiquitin binding domains (UBDs), which directly interact with mono- or poly-ubiquitin chains (7). For example, upon TNFα stimulation the ubiquitin ligases cellular inhibitor of apoptosis protein (cIAP)-1/2 are recruited to the TNF-receptor (TNFR) complex (8), where multiple components, such as TNF receptor associated factor (TRAF) 2/5, receptor interacting protein (RIP) 1 and cIAPs, are ubiquitylated by Lys-63-, Lys-11- or Lys-48-linked ubiquitin chains (9,10). More recent studies have shown that an E3-ligase, linear ubiquitin chain assembly complex (LUBAC) regulates the TNF signaling pathway by linearly ubiquitylating NEMO leading to the activation of IKK kinases (11-13).

In such signaling cascades, the binding of the adaptor protein NEMO to ubiquitin chains appears to be a critical node in linking upstream ubiquitin signals with the activation of the IKK complex and subsequently the NF-κB pathway (10,14-17). NEMO is readily precipitated in protein complexes containing highly Lys-63 polyubiquitylated substrates (18), however, these complexes involved multiple interaction surfaces and it was not clear whether interactions between NEMO and long Lys-63-linked ubiquitin chains are direct. More recent structural and functional studies indicate that the isolated NEMO UBAN domain preferentially binds to linear ubiquitin chains, but it can also bind with lower affinity to other types of ubiquitin chains including Lys-11, Lys-48 and Lys-63, presumably when they form longer chains (10,14). This lead to the hypothesis that in addition to the linkage type also the length of the chains might be a critical determinant in NF-κB activation (19). In order to address these issues

we have undertaken a systematic and thorough biochemical approach by purifying full-length NEMO and analyzing its binding to ubiquitin chains with different linkages and length. In addition, by utilizing engineered NEMO chimeras that recognize exclusively Lys-63-linked ubiquitin chains as well as NEMO that is permanently linearly ubiquitylated we have tested the contribution of the linkage and length of specific ubiquitin chains in the activation of the NF-κB pathway upon TNFα stimulation in vivo.

EXPERIMENTAL PROCEDURES

Plasmids, antibodies and reagents − To generate linear ubiquitin-fused NEMO constructs the ORF of Arabidopsis ubiquitin, whose Gly75 and Gly76 were replaced by Val (ubiquitin-VV) to create an MluI site, was generated by PCR. Two to seven tandem uncleavable ubiquitin cDNAs were prepared by inserting the mutant ubiquitin encoding MluI~BssHI into the MluI site of Ubiquitin-VV. Whole nucleotide sequence was verified, and the respective tandem ubiquitin cDNA was ligated into FLAG-His6-human NEMO in pcDNA3.1 vector (Invitrogen). Full-length murine NEMO and human IκBα-WT (amino acid 1-54) and IκBα-AA (amino acid 1-54 S34A/S36A) were cloned into pMAL-C2x (New England Biolabs). Full-length murine NEMO was cloned into pGEX-4T1 (GE Healthcare) using a standard PCR method. Human TAB2-NZF was swapped with NEMO UBAN (aa 250-339) or ZnF (aa 388-412), in the full-length NEMO cloned into pBABE (described in (14)) or pGEX-4T1, by site directed mutagenesis method using mega-mutagenesis primers. Mega-mutagenesis primers were produced by PCR using the human NZF-domain as template (aa 663-693) with oligonucleotides that contain the complementary sequence flanking the site of insertion. F305A and F312A mutation in mouse and human NEMO respectively were introduced by site directed mutagenesis.

Antibodies against following proteins were obtained and used following manufacturer’s protocols: phospho-Ser32/36-IκBα (#9246, Cell Signaling), phospho-IKKα/β (#2681, Cell Signaling), FLAG (clone M2, Agilent), IKKα/β (sc-7607, Santa Cruz Biotechnology) or IKKα (Imgenex), MBP5 (sc-13564, Santa Cruz Biotechnology), ubiquitin (sc-8017, Santa Cruz


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


3

Biotechnology; Figure 3A only, or 13-1600, Invitrogen), beta-actin (C-2, Santa Cruz Biotechnology), GAPDH (14C16, Cell Signaling), PARP (9542, Cell Signaling), NEMO (sc-8330, Santa Cruz Biotechnology). Antibodies against IκBα, phosho-p38, p38, phosho-JNK, JNK and p65 were described as previously (14). Anti-FLAG M2 was purchased (Sigma). Murine TNFα was purchased (Peprotech). Bovine ubiquitin was purchased (Sigma).

Cell culture, immunoprecipitation, immunoblotting and retroviral transduction − HeLa S3 cells were cultured at 37o C under 7.5 % CO2 in spinner flasks using S-MEM (Sigma) supplemented with 10 % fetal bovine serum (FBS, Sigma), 100 IU/ml penicillin G and 100 µg/ml streptomycin with gentle stirring, and HEK293T cells were cultured in DMEM (Sigma) containing 10 % FBS, 100 IU/ml penicillin G and 100 µg/ml streptomycin. Transfections were performed using Lipofectamine2000 (Invitrogen) or ExGen 500 (Thermo) following manufacture’s protocols. Immunoprecipitation, electrophoresis and immunoblotting were performed as described previously (20). Wild type and NEMO deficient MEF cells were described previously (5). Retroviral transduction of NEMO deficient MEFs with pBABE NEMO constructs was described elsewhere (14).

Luciferase assay − The luciferase reporter assay was performed as described (20). Briefly, pSP-6xNF-κB-Luc, pSV40-Renilla-Luc, and various dose of pcDNA3.1-FLAG-His6-NEMO-[Ub]0-7 were transfected to HEK293T cells. In NEMO-deficient N-1 cells (21), cells were transfected with luciferase vectors, 1 µg of pcDNA3.1-FLAG-His6-NEMO or F312A mutant, with or without LUBAC components of pcDNA3.1-myc-HOIP (0.3 µg), pcDNA3.1-HOIL-1L (0.15 µg), and pcDNA3.1-T7-SHARPIN (0.15 µg). After 24 h, cells were lysed and luciferase activity was measured using Bright-Glo luciferase assay systems (Promega). Some N-1 cells were treated with 10 ng/ml human TNF-α (Promega) for 6 h before harvest.

Preparation of recombinant proteins and cellular extracts − Recombinant E1, UbcH5c, His6-HOIP/HOIL-1L/Myc-SHARPIN complex, and Myc-IKKα/His6-IKKβ/FLAG-NEMO complex were prepared as described (13,20). The MBP-fused IκBα (aa 1-54), IκBα-AA (aa 1-

54, S32A/S36A) and NEMO (expression in E. coli BL21 containing pRARE) were expressed in E. coli and purified using amylose resin (New England Biolabs). Lys-63-, and Lys-48-linked ubiquitin chains were prepared as previously described (22). For the preparation of linear ubiquitin chains GST-di-, tri- or tetra-ubiquitin were expressed in E. coli BL21, purified and cleaved with Thrombin protease (Biotinylated Thrombin Kit, Novagen) according to manufacturer instructions. Thrombin buffer was exchanged with 50 mM Tris-HCl pH 7.5. Other GST-fused proteins were expressed in E. coli BL21 containing pRARE and induced by IPTG (100 µM) at 16° C over night, and purified using Glutathion Sepharose 4B (GE Healthcare).

HeLa S-100 fraction II was prepared according to the method of Hershko and co-workers (23). Briefly, crude HeLa cell extracts in hypotonic buffer (10 mM Tris-HCl pH 7.5, 1.5 mM MgCl2, 20 mM NaCl, 0.5 mM DTT, 0.5 mM PMSF) were lysed by a Dounce homogenizer, and cytosolic fraction was prepared by ultracentrifugation at 100,000 × g for 1 h. The supernatant (S100) was applied to a DEAE-Sepharose column. The bound fraction (fraction II), which excludes endogenous ubiquitin, was eluted with a buffer (10 mM Tris-HCl pH 7.5, 1.5 mM MgCl2, 500 mM NaCl, 0.5 mM DTT, 0.5 mM PMSF), and dialysed with a re-equilibrated buffer (20 mM Tris-HCl pH 7.5, 0.1 M NaCl, 0.5 mM DTT, 0.5 mM PMSF, 1 µg/ml leupeptin).

MBP- and GST-pull down experiments − GST- or MBP-fused proteins immobilized with sepharose beads were incubated with 1 µg of indicated ubiquitin chains in pull down buffer (150 mM NaCl, 50 mM Tris-HCl pH 7.5, 5 mM DTT, 0.1 % NP-40, 0.25 mg/ml BSA) at 4° C for 16 h on a rotator, or Flag-tagged proteins were expressed in HEK293-T cells, which were lysed 24 h after transfection and incubated with GST-proteins at 4° C for 16 h on a rotator. The beads were washed 3 times with pull down buffer without BSA. The proteins were then eluted with SDS-sample buffer and boiled at 95° C for 1 minute. The samples were separated on a 12 % or 15 % SDS- polyacrylamide-gels and transferred to PVDF membranes.

In vitro IKK kinase assay − A total of 30 µl of samples containing 10 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 2 mM DTT, 0.5 mM ATP, 10 mM creatine phosphate, 50 µg/ml creatine


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


4

phosphokinase, 2 mg/ml HeLa-S100 fraction II, 250 µg/ml ubiquitin, 20 µM ubiquitin aldehyde (Boston Biochem), 100 ng E1, 200 ng UbcH5c, 2 µg LUBAC, and 100 ng MBP-IκBα or MBP-IκBα-AA were mixed and incubated at 37° C for 1 h. Effects of di-ubiquitins on IKK activation were examined in total 20 µl of samples containing 10 mM Tris-HCl, pH 7.5, 5 mM MgCl2, 2 mM DTT, 1 mM ATP, 100 ng IKK complex, 100 ng MBP-IκBα or MBP-IκBα-AA, and increasing amounts (0.1, 0.3, and 1 µg) of linear-, Lys-63-, and Lys-48-di-ubiquitins. Samples were incubated at 37° C for 1 h.

qPCR − RNA was isolated from MEFs using an RNeasy kit (Qiagen). mRNA (2 µg) was reverse transcribed to cDNA using random primer. qPCR was perfomed using SensiMix SYBR & Fluorescein kit (Bioline) and primer pairs specific for mouse A20 (for primer: ctccagcctcacttccagta, rev primer: aatacatgcagccagctttc) or mouse actin (for primer:tgttaccaactgggacgaca, rev primer:ggggtgttgaaggtctcaaa).

Nuclear fractionation − Cells were first lysed in hypotonic buffer (20 mM HEPES pH 7.9, 10 mM KCl, 1 mM EDTA, 0.2 % EDTA, 10 % glycerol, 1.5 mM MgCl2, 1 mM DTT, 1 mM PMSF), left on ice for 2 minutes and centrifuged for 1 min at 13000 rpm. Supernatant was collected as cytoplasmic fraction. Pellet was resuspended in 3 x pellet volume of hypertonic buffer (20 mM HEPES pH 7.9, 10 mM KCl, 0.2 mM EDTA, 20 mM gylcerol, 1.5 mM MgCl2, 400 mM NaCl, 1mM DTT, 1 mM PMSF), kept on ice for 30 min and centrifuged for 5 min at 13K rpm.

Statistical analysis − The Student’s t test was performed using GraphPad Prism software. RESULTS

Full-length NEMO preferentially binds to linear ubiquitin chains − We have previously shown that linear di-ubiquitin binds to NEMO UBAN domain, while Lys-63-linked di-ubiquitin could not be detected in GST-binding assays (14,24). However, it was proposed that the C-terminus of NEMO, comprising the UBAN and the ZnF, has a higher affinity towards Lys-63- and Lys-48-linked ubiquitin chains consisting of three or more ubiquitin moieties (25). To elucidate the ubiquitin binding preferences of full-length NEMO we performed in vitro binding studies with bacterially purified recombinant

full-length NEMO and ubiquitin chains of different linkage types and lengths. Purified NEMO was incubated with equal concentrations of different ubiquitin chain types in the same tube and binding of NEMO was monitored, by washing off unbound chains and Western blot analysis (Fig. 1). Since ubiquitin chains of the same length but with different linkage display different mobility on SDS-gels, it is possible to distinguish the different types of chains by using the same anti-ubiquitin antibody (Fig. 1). We first examined the binding preference of full-length MBP-tagged NEMO towards Lys-11-, Lys-63- and linear-tri-ubiquitin (Fig. 1A). Incubation of MBP-NEMO with these different chain types led to a selective binding of linear tri-ubiquitin in competition with the other chain types (Fig. 1A). We have previously shown that only tetra- and longer ubiquitin chains of Lys-63-linkage could be involved in binding to NEMO and mutational analysis indicated that they bind only to distal patches on the NEMO UBAN domain as compared to longitudinal arrangement of linear chains that recognizes both proximal and distal patches (14). Based on this evidence NEMO binding to linear and Lys-63-linked ubiquitin chains is competitive and it is not possible that both are bound to NEMO at the same time. In accordance, we observed that linear tetra-ubiquitin was able to block binding of Lys-63-linked tetra-ubiquitin with GST-NEMO or MBP-NEMO in vitro (Supplementary Figure S1, Figure 1B and 1F). In contrast to NEMO, receptor-associated protein 80 (RAP80) selectively bound to Lys-63-linked tetra-ubiquitin (Fig. 1C). This is in accordance with a previous study showing that the two ubiquitin interacting motif (UIM) domains of RAP80 as a unit selectively bind Lys-63-linked but not Lys-48- or linearly linked di-ubiquitin (26). Since the length of ubiquitin chains might influence the affinity towards NEMO, we set out to analyze the binding of Lys-63-linked hexa- or hepta-ubiquitin to NEMO, in competition with linear tetra-ubiquitin (Fig. 1D). In both cases we found that NEMO selectively bound to linear tetra-ubiquitin compared to the binding to hexa- or to hepta- Lys-63-linked ubiquitin chains. Comparing the ubiquitin binding preference of NEMO with a mixture of long Lys-63-linked ubiquitin chains revealed that NEMO didn’t pull down Lys-63-linked chains up to at least deca-ubiquitin in the presence of linear tetra-ubiquitin


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


5

(Fig. 1E). Chains that were longer than deca-ubiquitin showed interaction with NEMO despite the presence of linear tetra-ubiquitin, but since ubiquitin chains longer than deca-ubiquitin were not separated it’s not clear what size of Lys-63-linked chains was necessary for binding and also if this precipitation of high molecular weight ubiquitin chains is a specific interaction. In order to get more detailed information about the ubiquitin binding preference of NEMO, we incubated 1 µg of Lys-63-linked tetra-ubiquitin together with different amounts of linearly linked tetra-ubiquitin (Figure 1F). Interaction of NEMO with linear tetra-ubiquitin alone is rather weak (Figure 1F). In contrast, already the addition of 20 ng of linear tetra-ubiquitin leads to a strong linear chain binding, emphasizing the high binding preference of NEMO to linear chains. The increase of binding of NEMO to linear chains correlates strongly with an increasing input where already 100 ng of linear ubiquitin chains shows a much stronger binding than Lys-63-linked ubiquitin chains, of which 1 µg was used. Moreover, the linear chains compete out the binding towards Lys-63-linked ubiquitin chains, clearly visible by a decreased Lys-63-linked chain binding, already in the presence of only 200 ng of linear ubiquitin chains.

Taken together these results demonstrate the quantitative distinction in ubiquitin chain-binding selectivity of full-length NEMO towards linear ubiquitin chains as compared to long Lys-63-linked ubiquitin chains.

The E3-ligase LUBAC activates the IKK-complex and NF-κB in a NEMO dependent manner − Currently reported evidences indicate that NEMO binding to linear ubiquitin chains is essential for NF-κB activation in cells (14,17). To further assess if linear ubiquitin chains can activate the IKK-complex we investigated the effect of LUBAC-induced linear ubiquitylation on IKK activation in vitro. To this end we examined the phosphorylation of IκBα using HeLa-S100 fraction II, lacking endogenous ubiquitin, together with E1, E2 (UbcH5c) and LUBAC, which specifically produces linear ubiquitin chains (Fig. 2A), (27). Both, endogenous IκBα and exogenously added MBP-IκBα (aa 1-54) were efficiently phosphorylated by addition of E1, E2 and LUBAC to fraction II of HeLa S100 lysates that contain the IKK complex and IκBα (Fig. 2A). The addition of E1

and E2 alone failed to phosphorylate IκBα (Fig. 2A), indicating a linear ubiquitin chain dependent activation of the IKK complex.

Next we wanted to examine if LUBAC can activate NF-κB and if this action depends on the ability of NEMO to bind ubiquitin chains. To this end we utilized from Rat-1 cells derived NEMO deficient N-1 cells and performed a luciferase assay (Fig. 2B), (21). As expected, TNFα treatment of N-1 cells didn’t activate NF-κB. In contrast, N-1 cells reconstituted with human wt-NEMO showed strong NF-κB activation upon TNFα treatment. However, TNFα treatment didn’t activate NF-κΒ when N-1 cells were reconstituted with the NEMO-UBAN mutant F312A that cannot bind to ubiquitin. To evaluate the role of LUBAC in the activation of NF-κB in the context of NEMO-ubiquitin binding we overexpressed LUBAC in N-1 cells reconstituted with wt-NEMO or NEMO-F312A (Fig. 2B). LUBAC overexpression in N-1 cells reconstituted with wt-NEMO showed a strong activation of NF-κB, while NF-κB didn’t get activated in NEMO deficient N-1 cells or in cells that were reconstituted with NEMO-F312A. This indicates that the binding of NEMO to LUBAC-produced linear chains is important for the activation of NF-κB.

Modification of NEMO with linear di-ubiquitin is sufficient for full NF-κB activation in a NEMO-UBAN dependent manner − Since LUBAC produces linear chains and its addition to cell lysate activates IKK, we asked if linear ubiquitin-chains can activate the IKK-complex directly and also if other chain types are able to do so. To test this we incubated di-ubiquitin chains with the purified IKK complex and analyzed its activity (Fig. 3A). Addition of purified linearly linked di-ubiquitin to the IKK complex induced phosphorylation of MBP-IκBα (Fig. 3A). This activation was specific for the linear-ubiquitin linkage since when we tested Lys-63- and Lys-48-linked di-ubiquitins, which bind with around 100-fold lower affinity to the UBAN domain of NEMO (14,17), activation of the IKK-complex couldn’t be observed (Fig. 3A).

Since linear ubiquitin chains can activate the IKK-complex in vitro (Fig. 3A) and di-ubiquitin is sufficient to do so, we asked whether linearly ubiquitylated NEMO can activate NF-κB in vivo and what chain length is required for efficient


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


6

activation. To this end, we generated FLAG-NEMO fused with one to seven non-cleavable linear ubiquitin moieties (FLAG-NEMO-Ub1-7) at the C-terminus of the protein, thus mimicking the linearly ubiquitylated NEMO. Introduction of NEMO together with NF-κB luciferase reporter in HEK293T cells showed no activation of NF-κB, whereas NEMO-Ub1 partially activated NF-κB (Fig. 3B). Introduction of NEMO having two to seven linearly conjugated ubiquitins potentiated NF-κB strongly and in a similar manner, indicating that the essential unit for full activation of NF-κB is linear di-ubiquitin (Fig. 3B). As a control, GFP fused to seven linearly conjugated ubiquitins at the C-terminus could not activate NF-κB (data not shown). To further validate the activation of IKK, we immunoprecipitated endogenous IKKα/β in complex with NEMO or ubiquitin-fused NEMO and checked the phosphorylation levels of IKKs (Fig. 3C). Although similar levels of endogenous IKKα/β were co-immunoprecipitated with NEMO or ubiquitin-fused NEMO, IKKα/β in combination with NEMO-Ub2 was heavily phosphorylated as compared to that with NEMO or NEMO-Ub1 (Fig. 3C). The proper activation of NF-κB by linear di-ubiquitin attached to NEMO depended on the ability of NEMO to bind to ubiquitin, since when we overexpressed the ubiquitin binding deficient mutant NEMO-F312A-Ub2, NF-κB activation was significantly weaker compared to wt-NEMO-Ub2 (compare Fig.3B and Fig. 3D). This residual NF-κB activation in cell expressing NEMO-F312A-Ub1,

2-4 was also not specific for the linear linkage as activation with NEMO-F312A-Ub4 was even weaker than with NEMO-F312A-Ub1 (Fig. 3D). In order to examine if the binding of IKKα or IKKβ to linear ubiquitin might be involved in the activation of the IKK-complex we overexpressed FLAG-tagged IKKα, IKKβ or NEMO in HEK293-T cells and perfomed pull down assay with GST-di- or tetra-ubiquitin (Supplementary Figure S2). While Flag-NEMO strongly bound to GST-di- and tetra-ubiquitin, there was no interaction of IKKα or IKKβ with linear ubiquitin chains. These results strongly suggest that conjugation of linear di-ubiquitin to NEMO in concert with the interaction of NEMO with linear di-ubiquitin induces efficient canonical IKK activation.

NEMO that selectively binds to Lys-63-linked ubiquitin chains weakly activates NF-κB − Previous studies proposed that complex formation between NEMO and Lys-63-linked ubiquitin chains is important for the TNFα-induced activation of NF-κB signaling (18,28). In order to test whether the binding of NEMO to Lys-63-linked ubiquitin chains is sufficient to activate the NF-κB pathway, we engineered NEMO chimeras that contain the Npl4 zinc finger (NZF)-domain of TAK1 binding protein (TAB) 2, an exclusive binder of Lys-63-linked ubiquitin chains (29) (Fig. 4A). To this end we swapped the NEMO-ZnF with the TAB2-NZF domain in combination with or without UBAN mutation at Phe-305 (F305A-NZF-ΔZnF-K63 or NZF-ΔZnF-K63/M1, Figure 4A). In addition, we constructed a NEMO chimera, where we replaced the UBAN of NEMO with the NZF (NZF-ΔUBAN-K63, Figure 4A). With these selective Lys-63 binding NEMO chimeras we set out to analyze the relevance of NEMO binding to Lys-63-linked ubiquitin chains in the activation of NF-κB.

To first confirm the ubiquitin-binding properties of these NEMO variants we purified the respective GST-fusion proteins and incubated them with linearly or Lys-63-linked tetra-ubiquitin chains (Fig. 4B). We observed an exclusive binding of the two NZF-containing chimeras F305A-NZF-ΔZnF-K63 and NZF-ΔUBAN-K63 to Lys-63-linked ubiquitin chains. On the other hand, NEMO mutant NZF-ΔZnF-K63/M1 bound to both linearly and Lys-63-linked ubiquitin chains. In contrast, GST-wt-NEMO is a selective linear ubiquitin chain binder, whereas weak binding to Lys-63-linked tetra-ubiquitin was visible only after longer exposures of the film to the Western blot membrane (data not shown). The F305A mutation abolished the binding to ubiquitin, as also previously shown (14).

To further test how these chimeras bind to different ubiquitin chain types, we performed binding competition assays with the different GST-NEMO-chimeras and linearly- and Lys-63-linked tetra-ubiquitin chains (Fig. 4C). While wt-NEMO and the NZF-containing but UBAN-deficient chimeras selectively bound linearly and Lys-63-linked tetra-ubiquitin chains respectively as expected, the NEMO mutant NZF-ΔZnF-K63/M1 bound to linearly and Lys-63-linked tetra-ubiquitin chains with similar strength.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


7

Next we examined if these Lys-63-selective NEMO chimeras are able to mediate TNFα-induced NF-κB signaling by generating reconstituted NEMO-deficient MEF lines with the respective NEMO mutants or wt-NEMO (Fig. 5A-C). In these cell lines wt-NEMO and mutants were expressed at similar levels and could form an IKK complex (Supplementary Figure S3). TNFα-induced IKK activation was then examined using the reconstituted MEFs (Fig. 5A). In NEMO deficient MEFs reconstituted with wt-NEMO or the mutant NEMO-NZF-ΔZnF-K63/M1, we observed degradation of IκBα after treatment with TNFα for 15 minutes (Fig. 5A). Interestingly, MEFs, which express either NEMO-NZF-ΔUBAN-K63 or NEMO-F305A-NZF-ΔZnF-K63, showed only partial degradation of IκBα with both mutants. The impaired activation of IKK in NEMO knock out MEFs reconstituted with NEMO-F305A-mutant has previously been shown (14). These observations suggest that binding of NEMO to Lys-63-linked ubiquitin chains is not sufficient to efficiently regulate TNFα-induced activation of NF-κB signaling. To examine if the signaling defects in NEMO mutant-expressing cells were specific for NF-κB activation, we tested the TNFR-dependent activation of MAP kinase signaling pathways (Supplementary Figure S4). As indicated by their phosphorylation, both MAP-kinases p38 and JNK are activated in cells expressing wt-NEMO and NEMO-chimeras, suggesting that NEMO-chimeras do not non-specifically affect other signaling functions of the TNFR.

Next we examined the nuclear translocation of p65 in TNFα-stimulated cells to analyze NF-κB activation in these MEFs downstream of IκBα-degradation (Fig. 5B). MEFs reconstituted with wt-NEMO or NEMO-NZF-ΔZnF-K63/M1 showed strong activation of NF-κB as determined by the amount of nuclear p65 after 15 and 30 minutes of TNFα-treatment. On the other hand, MEFs reconstituted with the ubiquitin binding deficient F305A-mutant did not mediate efficient p65 translocation. In contrast to MEFs with linear ubiquitin chain binding NEMO, nuclear translocation of p65 was markedly impaired in MEFs expressing NEMO-NZF-ΔUBAN-K63 or NEMO-F305A-NZF-ΔZnF-K63 (Fig. 5B).

To further assess the NF-κB activation potential of Lys-63-selective NEMO chimeras,

we analyzed the induction of the NF-κB target gene A20 (Fig. 5C). After 30 min of TNFα treatment, A20 gene expression was induced at 24.8 ± 2.33 S.E.M fold in wt-NEMO expressing cells and 19.1 ± 4.6 S.E.M fold in NEMO-NZF-ΔZnF-K63/M1 cells compared to NEMO deficient cells (Fig. 5C). In contrast, induction of A20 gene expression was significantly impaired in cells with Lys-63-binding NEMO or NEMO-F305 mutant (Fig. 5C). Although only wt-NEMO or the chimera that binds linear ubiquitin chains activated NF-κB properly, the Lys-63-binding selective NEMO chimera NEMO-F305A-NZF-ΔZnF-K63 was also able to induce A20-expression at a certain level, which is significantly higher then with the non-ubiquitin binding NEMO-F305A-mutant (Fig. 5C). This is in agreement with a recent study showing that linear chain binding deficient NEMO-mutants could still partially activate NF-κB when they have a lower affinity towards Lys-63-linked ubiquitin chains (15). DISCUSSION

Since direct NEMO-ubiquitin interactions have only been determined by using isolated NEMO fragments, we examined how full-length NEMO interacts with different types of ubiquitin chain linkages. By applying competition assays using full-length NEMO, we found that NEMO preferably binds linear ubiquitin chains compared to Lys-63- or Lys-11-linked chains, even when lysine-linked ubiquitin chains were longer than the linear chains (Fig. 1). The preference for linear ubiquitin chains is in agreement with previous studies, which showed that the NEMO-UBAN has an up to 100x higher affinity to linear di-ubiquitin over Lys-63-, or Lys-48-linked di-ubiquitin (14,16,17). This might suggest that in a cellular environment where different ubiquitin chain types exist, e.g. at the activated TNFR complex (10,11,30), NEMO will preferentially bind to linear ubiquitin chains, whereas in the absence of linear ubiquitin chains other lysine-linked chains can engage in binding to NEMO and the activation of NF-κB. In line with this, recent studies provided several lines of evidence that linear ubiquitylation by LUBAC E3 ligases is essential for the control of NF-κB signaling (11-13,20). In the case of endogenous TNFα-receptor complexes linear ubiquitylation was detected on RIP1 and NEMO molecules (11). The absolute


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


8

quantification of ubiquitin amounts using the absolute quantification of proteins method (AQUA) revealed a very low abundance of linear-ubiquitin chains upon overexpression of LUBAC ligase, comprising less than 3 % of the total ubiquitin pool in untreated cells (12). This suggests that linear ubiquitin chains are tightly regulated in their production e.g. in a compartment-specific manner and/or are forming preferentially shorter chains due to their rapid cleavage in the cellular cytosol. In this context it is interesting that linear ubiquitin chains, as short as dimer, fused to NEMO can activate NF-κB to a full extend compared to longer chains (Fig. 3). Thus, linearly linked di-ubiquitin conjugated to NEMO, due to its rather high affinity to the UBAN, constitute an efficient and robust signal for IKK-activation. On the other hand, MEFs reconstituted with NEMO-chimeras harboring the highly Lys-63-selective NZF and unable to bind to linear chains led to only partial activation of NF-κB signaling (Fig. 5). This partial activation confirms that binding of NEMO to Lys-63-linked ubiquitin chains can have an effect on NF-κB activation that is quantitatively different than linear chain-dependent activation.

These results collectively suggest that NEMO can act as bi-functional ubiquitin receptor: on one side a high affinity linear ubiquitin decoder

leading to an efficient activation of NF-κB and a lower affinity receptor for lysine-linked chains leading to quantitatively different patterns of NF-κB activation. Moreover the length of the ubiquitin chains appears to be important in such pathways: linear di-ubiquitin is a sufficient signal for the full activation of NF-κB, whereas tetra- or longer lysine-linked ubiquitin chains are required for TNFα-induced activation of the NF-κB pathway. The future challenge in the field is to monitor endogenous ubiquitylation events at the activated TNF receptors by using ubiquitin sensors that recognize specific chains in cells e.g. fluorophore tagged ubiquitin chain type selective UBDs. Current data suggests that Lys-63- and Lys-11-linked ubiquitin chains are the most proximal signals conjugated to the receptor-associated complexes, while linear ubiquitin chains are formed following LUBAC recruitment to the TNFR complexes leading to modification of NEMO and subsequent activation on NF-κB. Dissection of dynamic changes in ubiquitin networks that control the NF-κB pathway are important for better understanding of numerous cellular processes as well as pathogenesis of human diseases including autoimmunity, cancer and inflammation.

REFERENCES

1. Wertz, I. E., and Dixit, V. M. (2010) Cold Spring Harb Perspect Biol 2, a003350 2. Hayden, M. S., and Ghosh, S. (2008) Cell 132, 344-362 3. Hacker, H., and Karin, M. (2006) Sci STKE 2006, re13 4. Yamaoka, S., Courtois, G., Bessia, C., Whiteside, S. T., Weil, R., Agou, F., Kirk, H. E., Kay,

R. J., and Israel, A. (1998) Cell 93, 1231-1240 5. Schmidt-Supprian, M., Bloch, W., Courtois, G., Addicks, K., Israel, A., Rajewsky, K., and

Pasparakis, M. (2000) Mol Cell 5, 981-992 6. Grabbe, C., Husnjak, K., and Dikic, I. Nat Rev Mol Cell Biol 12, 295-307 7. Dikic, I., Wakatsuki, S., and Walters, K. J. (2009) Nat Rev Mol Cell Biol 10, 659-671 8. Haas, T. L., Emmerich, C. H., Gerlach, B., Schmukle, A. C., Cordier, S. M., Rieser, E.,

Feltham, R., Vince, J., Warnken, U., Wenger, T., Koschny, R., Komander, D., Silke, J., and Walczak, H. (2009) Mol Cell 36, 831-844

9. Varfolomeev, E., Goncharov, T., Fedorova, A. V., Dynek, J. N., Zobel, K., Deshayes, K., Fairbrother, W. J., and Vucic, D. (2008) J Biol Chem 283, 24295-24299

10. Dynek, J. N., Goncharov, T., Dueber, E. C., Fedorova, A. V., Izrael-Tomasevic, A., Phu, L., Helgason, E., Fairbrother, W. J., Deshayes, K., Kirkpatrick, D. S., and Vucic, D. (2010) EMBO J 29, 4198-4209

11. Gerlach, B., Cordier, S. M., Schmukle, A. C., Emmerich, C. H., Rieser, E., Haas, T. L., Webb, A. I., Rickard, J. A., Anderton, H., Wong, W. W., Nachbur, U., Gangoda, L., Warnken, U., Purcell, A. W., Silke, J., and Walczak, H. (2011) Nature 471, 591-596


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


9

12. Ikeda, F., Deribe, Y. L., Skanland, S. S., Stieglitz, B., Grabbe, C., Franz-Wachtel, M., van Wijk, S. J., Goswami, P., Nagy, V., Terzic, J., Tokunaga, F., Androulidaki, A., Nakagawa, T., Pasparakis, M., Iwai, K., Sundberg, J. P., Schaefer, L., Rittinger, K., Macek, B., and Dikic, I. (2011) Nature 471, 637-641

13. Tokunaga, F., Nakagawa, T., Nakahara, M., Saeki, Y., Taniguchi, M., Sakata, S., Tanaka, K., Nakano, H., and Iwai, K. (2011) Nature 471, 633-636

14. Rahighi, S., Ikeda, F., Kawasaki, M., Akutsu, M., Suzuki, N., Kato, R., Kensche, T., Uejima, T., Bloor, S., Komander, D., Randow, F., Wakatsuki, S., and Dikic, I. (2009) Cell 136, 1098-1109

15. Hadian, K., Griesbach, R. A., Dornauer, S., Wanger, T. M., Nagel, D., Metlitzky, M., Beisker, W., Schmidt-Supprian, M., and Krappmann, D. J Biol Chem

16. Ivins, F. J., Montgomery, M. G., Smith, S. J., Morris-Davies, A. C., Taylor, I. A., and Rittinger, K. (2009) Biochem J 421, 243-251

17. Lo, Y. C., Lin, S. C., Rospigliosi, C. C., Conze, D. B., Wu, C. J., Ashwell, J. D., Eliezer, D., and Wu, H. (2009) Mol Cell 33, 602-615

18. Wu, C. J., Conze, D. B., Li, T., Srinivasula, S. M., and Ashwell, J. D. (2006) Nat Cell Biol 8, 398-406

19. Ikeda, F., Crosetto, N., and Dikic, I. Cell 143, 677-681 20. Tokunaga, F., Sakata, S., Saeki, Y., Satomi, Y., Kirisako, T., Kamei, K., Nakagawa, T., Kato,

M., Murata, S., Yamaoka, S., Yamamoto, M., Akira, S., Takao, T., Tanaka, K., and Iwai, K. (2009) Nat Cell Biol 11, 123-132

21. Saito, N., Courtois, G., Chiba, A., Yamamoto, N., Nitta, T., Hironaka, N., Rowe, M., and Yamaoka, S. (2003) J Biol Chem 278, 46565-46575

22. Komander, D., Lord, C. J., Scheel, H., Swift, S., Hofmann, K., Ashworth, A., and Barford, D. (2008) Mol Cell 29, 451-464

23. Hershko, A., Heller, H., Elias, S., and Ciechanover, A. (1983) J Biol Chem 258, 8206-8214 24. Wagner, S., Carpentier, I., Rogov, V., Kreike, M., Ikeda, F., Lohr, F., Wu, C. J., Ashwell, J.

D., Dotsch, V., Dikic, I., and Beyaert, R. (2008) Oncogene 27, 3739-3745 25. Laplantine, E., Fontan, E., Chiaravalli, J., Lopez, T., Lakisic, G., Veron, M., Agou, F., and

Israel, A. (2009) EMBO J 28, 2885-2895 26. Sato, Y., Yoshikawa, A., Mimura, H., Yamashita, M., Yamagata, A., and Fukai, S. (2009)

EMBO J 28, 2461-2468 27. Kirisako, T., Kamei, K., Murata, S., Kato, M., Fukumoto, H., Kanie, M., Sano, S., Tokunaga,

F., Tanaka, K., and Iwai, K. (2006) EMBO J 25, 4877-4887 28. Ea, C. K., Deng, L., Xia, Z. P., Pineda, G., and Chen, Z. J. (2006) Mol Cell 22, 245-257 29. Kulathu, Y., Akutsu, M., Bremm, A., Hofmann, K., and Komander, D. (2009) Nat Struct Mol

Biol 16, 1328-1330 30. Bianchi, K., and Meier, P. (2009) Mol Cell 36, 736-742 Acknowledgements−We are thankful to Koraljka Husnjak and Jaime Lopez for critically reading the manuscript and also thank the members of the Dikic Lab for discussions and comments. We thank David Komander and Axel Knebel for help with ubiquitin chain purification. FOOTNOTES

* This work was partly supported by Grants-in-Aid for Scientific Research on Priority Areas from the Ministry of Education, Culture, Sports, Science, and Technology, Japan and Targeted Proteins ResearchProgram (TPRP) to K. I. 1Indicates equal contribution to this work 2Current address: Institute of Molecular Biotechnology (IMBA), Dr. Bohr-Gasse 3, 1030 Vienna, Austria


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


10

3 Current address: Department of Molecular and Cellular Physiology, Graduate School of Medicine, Kyoto University. Sakyo-ku, Kyoto 606-8501, Japan 4To whom correspondence should be addressed 5Abbreviations used are: MBP, Maltose Binding Protein; MEF, mouse embryonic fibroblasts; ZnF, zinc finger; wt, wild type; TAK1, TGFβ activated kinase 1; Ub, ubiquitin FIGURE LEGENDS FIGURE 1. Full-length NEMO preferentially binds linear ubiquitin chains in competition with other chain types. (A) Full-length NEMO preferentially binds to linear tri-ubiquitin in competition with Lys-11- and Lys-63- linked tri-ubiquitin. MBP-NEMO was incubated with 1 µg of indicated ubiquitin chains and the pull downs, together with 2 % of total input were separated by SDS-PAGE and analyzed by Western blot with an anti-ubiquitin antibody. (B) Full-length NEMO preferentially binds to linear tetra-ubiquitin in competition with Lys-63-linked tetra-ubiquitin. MBP-NEMO was incubated with 1 µg of indicated ubiquitin chains and pull downs and Western blot analysis were performed as in (A). (C) RAP80 preferentially binds to Lys-63-linked tetra-ubiquitin in competition with linear tetra-ubiquitin. GST-full-length-RAP80 was incubated with 1 µg of indicated ubiquitin chains and pull downs and Western blot analysis were performed as in (A). (D) NEMO preferentially binds to linear tetra-ubiquitin in competition with Lys-63-linked hexa- and hepta-ubiquitin. Pull downs and Western blot analysis were performed as in (A). (E) NEMO preferentially binds to linear tetra-ubiquitin in competition with Lys-63-linked ubiquitin chains of different length. Pull downs and Western blot analysis were performed as in (A). (F) Binding of small amounts of linear ubiquitin chains to full-length NEMO competes out binding to K63-linked ubiquitin chains. MBP-NEMO was incubated with the indicated amounts of linear and K63-linked ubiquitin chains and pull downs and Western blot analysis were performed as in (A). FIGURE 2. The E3-ligase LUBAC activates the IKK-complex and NF-κB in a NEMO-ubiquitin binding dependent manner (A) Ubiquitin ligase activity of LUBAC enhances IκBα phosphorylation. E1, UbcH5c, LUBAC, ubiquitin and HeLa S-100 fraction II were incubated with MBP-IκBα-Wt or MBP-IκBα-AA as described in Methods. Phosphorylation of exogenous and endogenous IκBα was detected by immunoblotting. (B) Ubiquitin binding of NEMO is crucial for NF-κB activation by LUBAC. NEMO deficient N-1 cells were transfected with plasmids with NF-κB luciferase reporter and with wt-NEMO or NEMO-F312A and either LUBAC or treated with TNFα as indicated, and the luciferase activity was measured 24 h after transfection. FIGURE 3. Linear di-ubiquitin is essential and sufficient to activate the IKK-complex and NF-κB (A) Linear di-ubiquitin and IKK complex induce phosphorylation of IκBα in vitro. Recombinant IKKα/β and NEMO (IKKγ) complex, MBP-IκBα-Wt or MBP-IκBα-AA, and linearly, Lys-63-, or Lys-48-linked di-ubiquitin were incubated as described in Methods. Phosphorylation of MBP-IκBα by IKK was detected by immunoblotting. (B) Linear di-ubiquitin fused NEMO induces sufficient NF-κB activity. HEK293T cells were transfected with increasing amounts (0.01, 0.03, 0.1, 0.3 and 1.0 µg) of FLAG-NEMO-[Ub]0-7 plasmids with NF-κB luciferase reporter, and the luciferase activity was measured 24 h after transfection. (C) Endogenous IKKα/β bound to linear di-ubiquitin fused NEMO were phosphorylated. HEK293T cells, transfected with indicated plasmids, were lysed and immunoprecipitated with anti-FLAG antibody. Immunoprecipitates were separated by SDS-gels and immunoblotted with anti-phospho-IKKα/β and anti-IKKα/β antibodies. (D) Linear ubiquitin fused NEMO-F312A mutant doesn’t induce sufficient NF-κB activity. HEK293T cells were transfected with increasing amounts (0.01, 0.03, 0.1, 0.3 and 1.0 µg) of FLAG-NEMO-[Ub]0-4 plasmids with NF-κB luciferase reporter, and the luciferase activity was measured 24 h after transfection. FIGURE 4. TAB2-NZF-containing NEMO chimeras with UBAN-mutation selectively bind Lys-63-linked ubiquitin chains. (A) Domain structure of wild type and different NEMO-mutant


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/


11

constructs. Different NEMO constructs with indicated ubiquitin binding selectivity were used to analyze ubiquitin binding and reconstitute NEMO deficient MEFs. (B) NEMO with intact UBAN has high affinity to linear ubiquitin chains and NEMO-chimeras with NZF-domain have high affinity to Lys-63-linked ubiquitin chains. Purified GST-tagged NEMO-mutants were incubated with either Lys-63- or linearly linked ubiquitin chains and pull downs and Western blot analysis were performed as in Figure 1A.Wt-NEMO potently bound linear ubiquitin chains. A mutation in the UBAN (F305A) totally abolishes the binding to ubiquitin. The NZFΔUBAN-K63 mutant and the F305A-NZFΔZnF-K63 mutant only bind to Lys-63-linked ubiquitin chains and NZFΔZnF-K63/M1-mutant binds to linearly- and Lys-63-linked ubiquitin chains. (C) NZF- and UBAN-containing chimeras bind Lys-63- or linearly linked ubiquitin chains with similar strength, while UBAN-only containing wt-NEMO selectively binds linear- and NZF- but UBAN-mutant NEMO-proteins selectively bind Lys-63 ubiquitin chains when exposed to both chain types. Purified GST-wt- and mutant- NEMO proteins were incubated with 1 µg of indicated ubiquitin chains and pull downs and Western blot analysis were performed as in Figure 1A. FIGURE 5. Selective Lys-63-linked ubiquitin chain binding NEMO chimeras are impaired in NF-κB activation. (A) NEMO deficient MEFs, reconstituted with linear chain binding deficient and Lys-63-binding selective NEMO-mutants are impaired in IκBα degradation upon TNFα stimulation. NEMO deficient MEFs stably reconstituted with different NEMO-mutants were untreated or treated with TNFα (20 ng/ml) for the indicated times. The lysates were separated by SDS-PAGE and protein content was analyzed by Western blot. (B) NEMO deficient MEFs reconstituted with linear chain-binding deficient and Lys-63-binding selective NEMO-mutants are hampered in nuclear translocation of p65 upon TNFα stimulation. NEMO deficient MEFs stably reconstituted with wt-NEMO or different NEMO-mutants were treated with TNFα (20 ng/ml) for the indicated time. Nuclear and the cytoplasmic fractions were separated by SDS-PAGE and the presence of p65 in the nuclear fraction was analyzed by Western blot. Densitometrical quantification of p65 in the nuclear fraction in the shown Western blot is indicated in the graphs, where the intensity for vector (Mock) containing cells was set to 1 and the intensity of the other cell lines was related to mock. P65 signal was measured using the software ImageJ and normalized by PARP-level. (C) NEMO deficient MEFs, reconstituted with linear ubiquitin chain binding deficient but Lys-63-binding selective NEMO-mutants are impaired in the induction of NF-κB target gene expression. NEMO deficient MEFs stably reconstituted with different NEMO-mutants were treated with TNFα (20 ng/ml) for the indicated times and mRNA was extracted. qPCR was performed as described in methods. Ct-values of target gene A20 were normalized to Ct-values of beta-actin. Induction of gene expression in a cell line was determined by comparison to the expression level of the untreated sample of the same cell line. Values shown are means ± S.E.M of at least three individual experiments. *P< 0.05 shows significant difference between wt-NEMO expressing and NEMO deficient MEFs or NEMO mutants expressing MEFs.


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

�-MBP

�-Ub

B

4x Ub K63

4x Ub linear

4x Ub linear

6x Ub K63

4x Ub linear

Coomassie

7x Ub K63

4x Ub linear

D

�-Ub

3x Ub K63

�-Ub

�-MBP

3x Ub K11

3x Ub linear

A

4x Ub linear/

mixed K63

Coomassie

4x Ub

linear

�-Ub

4x Ub K63

E

4x Ub linear

6x Ub K63

8x Ub K63

10x Ub K63

4x Ub linear

4x Ub K63

4x Ub linear �-Ub

C

Figure 1

12

F

4x Ub K63

(1 �g input)

4x Ub linear

- Input of linear 4x Ub -

Input MBP-NEMO

Pull down

MB

P

�-Ub

NEMO-binding to linear di-ubiquitin is sufficient and essential for NF-�B activation

�-Ub


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

�-pI�B�

�-MBP

MBP-I�B�

endogenous I�B�

HeLa S100 Fr. II

MBP-I�B�-AA

MBP-I�B�-WT LUBAC

UbcH5c E1

A

Figure 2

13

B


+ + + � � + + � � � � + + + + + � � � �

+ + + + �

+ + + + + 0

5

10

15

O� � + � � + + � � � � � � � �

+ � � + � � + � � + � � + � � � + + + + � LUBAC

TNF-�

NEMO-F312A

Wt-NEMO

NF

-�B

(fo

ld a

ctivation)

IB: NEMO

IB: tubulin


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

�-pIKK�/�

�-IKK�/�

IP: FLAG

Figure 3

14

0

5

10

15

20

25

30

NEMO

NEMO-Ub1

NEMO-Ub2NEMO-Ub3NEMO-Ub4NEMO-Ub5NEMO-Ub6NEMO-Ub7

0

5

10

15

20

25

30

F312A

F312A-Ub2F312A-Ub1F312A-Ub4

A B

C

– + + + + + + + + + + + +

– – – – – – – – – – – – – – – – – – – – – – – – – – – – –

– + – – – – + – – – – – –

+ – + + + + – + + + + + +

2x Ub K48

2x Ub K63 2x Ub linear

IKK�/�/� MBP-I�B�-AA

MBP-I�B�-WT

�-pI�B�

�-MBP

�-Ub

D


NF

-�B

(fo

ld a

ctiva

tio

n)

NF

-�B

(fo

ld a

ctiva

tio

n)

transfected DNA (�g)

transfected DNA (�g)


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

4x Ub K63

�-Ub

Ponceau S

4x Ub linear B

C

�-Ub

Ponceau S

4x Ub linear/ 4x Ub K63

4x Ub K63

4x Ub linear

A

Ub-binding preference

NZF-�UBAN-K63

412

Wild type NEMO

F305A

NEMO constructs

Linear

None

K63

250 339 390

NZF ZnF

UBAN

UBAN

NZF-�ZnF-K63/M1 K63/linear UBAN NZF

F305A NZF-�ZnF-K63 K63 UBAN NZF

ZnF

ZnF

Figure 4

15



http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

Figure 5

C TNF�-induced A20 expression

0

10

20

30

0,5h

* *

* *

Rela

tive tra

nscription induction

upon T

NF

� tre

atm

ent

�-I�B�

�-actin

Reconstituted NEMO knock-out MEFs

Mock NEMO NEMO-F305A-

NZF-�ZnF-K63 NEMO-NZF-

�ZnF-K63/M1

NEMO-NZF-

�UBAN-K63

TNF� (min)

A

- 5 15 30

16


- 5 15 30 - 5 15 30 - 5 15 30 - 5 15 30

�-p65

�-GAPDH

�-PARP

Nucle

ar

fraction

Cyto

pla

sm

ic

fraction

TNF� (min)

�-p65

�-GAPDH

�-PARP

30

B

mo

ck

NE

MO

NE

MO

-F3

05

A

NE

MO

-NZ

F-�

UB

AN

-K6

3

NE

MO

-F3

05

-NZ

F-�

Zn

F-K

63

NE

MO

-NZ

F-�

Zn

F-K

63

/M1

Rela

tive inte

nsity 20

15 10

5 0

mo

ck

NE

MO

NE

MO

-F3

05

A

NE

MO

-NZ

F-�

UB

AN

-K6

3

NE

MO

-F3

05

-NZ

F-�

Zn

F-K

63

NE

MO

-NZ

F-�

Zn

F-K

63

/M1

20

15 10

5 0

15 0


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/

DikicTobias Kensche, Fuminori Tokunaga, Fumiyo Ikeda, Eiji Goto, Kazuhiro Iwai and Ivan

Bκubiquitin chains and its role in the activation of NF-B essential modulator (NEMO) binding to linear and lysine-linkedκAnalysis of NF-

published online May 17, 2012J. Biol. Chem.

10.1074/jbc.M112.347195Access the most updated version of this article at doi:

Alerts:

When a correction for this article is posted•

When this article is cited•

to choose from all of JBC's e-mail alertsClick here

Supplemental material:

http://www.jbc.org/content/suppl/2012/05/17/M112.347195.DC1


http://ww

w.jbc.org/

Dow

nloaded from

http://www.jbc.org/lookup/doi/10.1074/jbc.M112.347195

http://www.jbc.org/cgi/alerts?alertType=citedby&addAlert=cited_by&cited_by_criteria_resid=jbc;M112.347195v1&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2012/05/17/jbc.M112.347195

http://www.jbc.org/cgi/alerts?alertType=correction&addAlert=correction&correction_criteria_value=early/2012/05/17/jbc&saveAlert=no&return-type=article&return_url=http://www.jbc.org/content/early/2012/05/17/jbc.M112.347195

http://www.jbc.org/cgi/alerts/etoc

http://www.jbc.org/content/suppl/2012/05/17/M112.347195.DC1

http://www.jbc.org/

analysis of nf-κb essential modulator (nemo) binding to linear and

Documents