ancylostoma ceylanicum a. caninum,toxocara cati ,trichuris vulpis ,dipylidium caninum ,isospora...

Research ArticleA Multiplex PCR for Simultaneous Detection of ThreeZoonotic Parasites Ancylostoma ceylanicum A caninumand Giardia lamblia Assemblage A

Wei Hu Sheng Wu Xingang Yu Auwalu Yusuf Abullahi Meiran SongLiping Tan Zhen Wang Biao Jiang and Guoqing Li

Guangdong Provincial Zoonosis Prevention and Control Key Laboratory College of Veterinary MedicineSouth China Agricultural University Guangzhou Guangdong 510642 China

Correspondence should be addressed to Guoqing Li gqliscaueducn

Received 17 June 2015 Accepted 19 August 2015

Academic Editor Roberto Amerigo Papini

Copyright copy 2015 Wei Hu et al This is an open access article distributed under the Creative Commons Attribution License whichpermits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Ancylostoma ceylanicum A caninum and Giardia lamblia assemblage A are common intestinal parasites of dogs and cats theycan also infect humans causing parasitic zoonoses In this study a multiplex PCR method was developed for simultaneousidentification and detection of those three zoonotic parasites Three pairs of specific primers were designed based on ITS sequenceof A ceylanicum and A caninum and TPI gene of G lamblia available in the GenBank The multiplex PCR reaction system wasestablished by optimizing the reaction condition and a series of tests on the sensitivity specificity and clinical application werealso conducted Results showed that three target fragments were amplified specifically the detection limit was 10 eggs for both Aceylanicum and A caninum 72 pg DNA for G lamblia Of 112 clinical fecal samples 348 and 178 samples were positive for Acaninum and A ceylanicum respectively while only 27 samples were positive for G lamblia assemblage A It is concluded thatthe established multiplex PCR assay is a convenient rapid cost-effective and high-efficiency method for molecular detection andepidemiological investigation of three zoonotic parasites

1 Introduction

Hookworms are blood-feeding parasitic intestinal nema-todes which infect humans dogs cats and other mam-mals throughout the world The common canine and felinehookworms are A ceylanicum A caninum A brazilienseA tubaeforme and Uncinaria stenocephala [1] Of thosespecies only A ceylanicum can readily develop to adults inthe intestine of humans resulting in iron-deficiency anemia[2] Recently hookworm infection in human caused by Aceylanicum has been reported in Thailand Laos Malaysiaand Cambodia [3ndash7] The larvae L3 of A caninum areimportant causative agents not only of eosinophilic enteri-tis [8] but also of cutaneous larva migrans in humansOther manifestations in humans include unilateral subacuteneuroretinitis eosinophilic pneumonitis localized myositisfolliculitis erythema multiforme or ophthalmological man-ifestations [1]

G lamblia is also a serious zoonotic parasite that infectsmanymammals including dogs and cats Infection in humancan lead to abdominal cramps acute or chronic diarrhea andmalabsorption [9] To date among the eight assemblages ofG lamblia found only assemblages A and B are associatedwith human infections but are also recovered from a broadrange of hosts including dogs and cats [10] Recent epidemi-ological surveys in China show that the G lamblia zoonoticassemblage infected dogs and cats was assemblage A andassemblage B was not found [11 12] while the aetiologicalagents of hookworm infections were A ceylanicum and Acaninum [13 14] Dogs and cats (pet animals) are ofteninfected with these three zoonotic parasites thus posing greatpotential risk to public health Accurate and rapid diagnosisis essential for the formulation of effective control measures

The benefits of conventional microscopy are mainly dueto technical simplicity and low cost However neither thespecies of hookworms nor the assemblage of G lamblia

Hindawi Publishing CorporationBioMed Research InternationalVolume 2015 Article ID 406168 6 pageshttpdxdoiorg1011552015406168

2 BioMed Research International

Table 1 Primers for the simultaneous detection of Ancylostoma ceylanicum A caninum and Giardia lamblia assemblage A by multiplexPCR

Target parasite Primer name Amplicon size (bp) Sequences (51015840-31015840)

A ceylanicum Acey-F 191 CCCCGTTACAGCCCTACGAGAcey-R TCCTGACAGACAAGTGCCGAACT

G lambliaassemblage A

5C1-P21-F 303 ATGCTAGCCGTAGTTAATAAGG5C1-P21-R ACCGGCCTTATCTACCAGC

A caninum Acan-F 427 AGCATTAGGCTAACGCCCGAAcan-R AACGAGTTTGCTGTCATTCAGTCC

could be identified through the microscopy of eggs orcysts PCR-based methods have key implication to addressthis question and several techniques have been developedfor the identification and detection of hookworms or Glamblia at molecular level such as PCR-restriction fragmentlength polymorphism (RFLP) [15] single-strand conforma-tion polymorphism (SSCP) [16] and real-time PCR [17]Even though these approaches are very useful and sensitivethe number of steps to detect these pathogens can be timeconsuming and quite expensive Furthermore the higher thestep number the higher the risk of contamination

Multiplex PCR assay enables the identification and detec-tion of mixed infection in a single reaction that containsmultiple primer pairs it is a convenient rapid cost-effectiveand high-efficiency method So far several multiplex PCRassays have been documented for the identification anddetection of various parasite species [18ndash20] Prior to thepresent study there have been no reports of multiplexPCR assay for simultaneous detection of A ceylanicum Acaninum and G lamblia assemblage A For the first timewe developed here a multiplex PCR assay for the detectionof these three zoonotic parasites providing a convenientrapid and efficient technique for the clinical detection andepidemiological investigation

2 Materials and Methods

21 Samples G lambliaWBtrophozoites were obtained fromprofessor Zhao-Rong Lun (Center for Parasitic OrganismsState Key Laboratory of Biocontrol School of Life SciencesSun Yat-Sen University Guangzhou China) adult hook-worms were collected from dog carcasses supplied by veteri-nary hospital of South China Agricultural University Aftercleaning with saline solution A ceylanicum and A caninumwere morphologically identified to species level accordingto existing keys and descriptions [21] fixed in 70 (vv)ethanol and stored at minus20∘C until use Control DNA sampleof A braziliense was kindly provided by Stephen E Bienhoff(Novartis Animal Health USA) control DNA samples ofToxocara cati Trichuris vulpis Dipylidium caninum Isosporafelis and Giardia lamblia Assemblages C D and F were keptin our laboratory

22 Genomic DNA Extraction The extraction of genomicDNA from A ceylanicum A caninum and G lamblia WB

was performed by using proteinase K treatment followedby spin-column purification (Wizard SV Genomic DNAPurification System Promega) For isolation of genomicDNA from fecal samples the QIAmp DNA stool kit (QiagenHilden Germany) was used according to the manufacturerrsquosinstructions with the exception that all samples were washedthree times with distilled water and then pretreated with 5cycles of heating at 100∘C for 5 minutes and freezing at minus80∘Cfor 5 minutes The extracted DNA was stored at minus20∘C untiluse

23 Specific Primers Design Based on the polymorphic sitesof ITS1-58S rRNA-ITS2 A ceylanicum and A caninumspecific primers were designed by Primer Premier 50 andcombined with the previously published specific primers forG duodenalis assemblage A [22] to generate target fragmentsof different sizes The three pairs of specific primers sharedsimilar annealing temperatures and were predicted to formno secondary structures or primer-dimers their sequencesand expected sizes of amplicons are listed in Table 1

24 Simplex PCR Specific PCRs were initially tested foreach pair of primers All PCRs were performed in 25120583Lvolume containing 2 120583L DNA sample 02 120583L Taq polymerase(TaKaRa Dalian China) 25 120583L 10x Taq buffer (TaKaRa)2 120583L diethyl-nitrophenyl thiophosphate (dNTP TaKaRa)mixture 04 120583L primers (50mM) and 175 120583L of distilledwaterThe thermocycler program consisted of 94∘C for 5minfollowed by 35 cycles of 94∘C for 30 s 59∘C for 30 s 72∘C for30 s and a final extension step at 72∘C for 7min For eachPCR negative control (H

2O)was run together PCR products

were analyzed by electrophoresis on 15 agarose gels stainedwith 02 gmL of ethidium bromide and visualized on aUV transilluminator All three PCR conditions were thenoptimized by changing a range of parameters includingannealing temperatures the concentration of each specificprimer set and Mg2+ to determine the optimum range of allparameters

25 Multiplex PCR Based on the optimization results ofsimplex PCR multiplex PCR reaction parameters were opti-mized Firstly all three pairs of primers were added to the onePCR reaction mixture in equal volumes (08120583L) to test theinteraction effect of the primers Then the concentrations of

BioMed Research International 3

Table 2 Optimization results of simplex PCR

ParasitePrimers

concentration(120583M)

Mg2+concentration

(mM)

Annealingtemperature

(∘C)A ceylanicum 04ndash12 10ndash40 51ndash65A caninum 04ndash12 10ndash40 51ndash65G lambliaassemblage A 02ndash12 10ndash40 51ndash65

primers andMg2+ and annealing temperatures were adjustedto get the optimal conditions

26 Specificity and Sensitivity Test The multiplex PCR wasevaluated for specificity using DNA samples representingthe common intestinal parasites of dogs and cats such asToxocara cati Trichuris vulpis Dipylidium caninum Isosporafelis andG lamblia (Assemblages C D and F) To determinethe minimum number of A ceylanicumA caninum eggs infecal samples detectable by the established multiplex PCRserial dilution samples with 50 40 30 20 10 5 and 1 egg(s)were pipetted out from purified eggs The genomic DNA wasextracted using the QIAmp DNA stool kit (Qiagen HildenGermany)Then 2mLDNA samples mixed with 1mL 10-foldserial dilutions of genomic DNA (72 ng120583L) extracted fromG lamblia assemblage A were amplified by the establishedmultiplex PCR

27 Applications of the Multiplex PCR Assay To test theavailability of multiplex PCR 112 fecal samples collectedthrough an epidemiologic survey of hookworm infectionsin cats [23] were used in this study Data collection on catage gender and neuteringwere provided by humane sheltersPrevalence () was calculated as percentage of positivenumber in number of cats examined All data were analyzedusing SPSS programme for window version 115 (SPSS IncChicago USA) Chi-square was used to investigate the degreeof association between variables and considered 119875 lt 005 aslevel of significance

3 Results

31 Specificity and Optimization of Simplex PCR Specificitytest of simplex PCR showed that three different-sized ampli-cons were amplified 191 bp for A ceylanicum 303 bp forG lamblia assemblage A and 427 bp for A caninum Theoptimal parameters in the simplex PCR are shown in Table 2

32 Development of aMultiplex PCRAssay All three targetedbands were amplified in one tube simultaneously (Figure 1)and G lamblia assemblage A specific primers showed loweramplification efficiency compared to A ceylanicum andA caninum Optimal amplification results were obtainedwith 12120583M of G lamblia assemblage A specific primersat 588∘C of annealing temperature and 20mM of MgCl

2

(Figures 2ndash4)Then themultiplex PCRwas established wherereaction mixture consisted of 2 120583L DNA template 02 120583L Taq

(bp)

1M

500

400

300

200

150

100

50

Figure 1 Interaction effect of multiplex PCR primers M DL2000DNA Marker 1 target fragments amplified simultaneously withthree pairs of primers in equal volume

(bp)

500

400

300

200

150

100

50

1M 2 3 4 5 6 7

Figure 2 Optimization of Giardia lamblia assemblage A primersconcentration M DL2000 DNAMarker 1ndash7 09 10 11 12 13 14and 15120583M respectively

(bp)

500

400

300

200

150

100

50

1M 2 3 4 5 6 7

Figure 3 Optimization of annealing temperatureM DL2000DNAMarker 1ndash7 538 555 572 588 622 637 and 65∘C respectively

polymerase 25 120583L 10x Taq buffer (Mg2+ free) 2 120583L dNTPmixture 2 120583L MgCl

2 08 120583L primer Acey-FR and Acan-

FR (50 120583M) (Acey-FR for A ceylanicum Acan-FR for Acaninum) 12 120583L primer 5C1-P21-FR (50120583M) (5C1-P21-FRfor G lamblia assemblage A) and 107 120583L of distilled waterPCR conditions consisted of an initial denaturation at 94∘Cfor 5min followed by 35 cycles of 94∘C for 30 s 588∘C for30 s and 72∘C for 35 s A final elongation was performed at72∘C for 10min


(bp)

500

400

300

200

150

100

50

1M 2 3 4 5

Figure 4 Optimization of Mg2+ concentration M DL2000 DNAMarker 1ndash5 20 25 30 35 and 40 120583M respectively

(bp)

500

400

300

200

150

100

50

1M 2 3 4 5 6 7 8 9 10 11 12 13 14

Figure 5 Specificity of multiplex PCR M DL2000 DNAMarker 1Ancylostoma ceylanicum A caninum and G lamblia assemblage A2 A caninum and G lamblia assemblage A 3 A ceylanicum andA caninum 4 A ceylanicum and G lamblia assemblage A 5 Aceylanicum 6 G lamblia assemblage A 7 A caninum 8 Toxocaracati 9 Trichuris vulpis 10 A braziliense 11 Dipylidium caninum12 Isospora felis 13 G lamblia assemblages C D and F 14 SterileddH2O

33 Specificity and Sensitivity of Multiplex PCR The multi-plex PCRwas found to specifically amplify the genomic DNAfromA ceylanicumA caninum andG lamblia assemblageA(any combination) No amplification was observed when themultiplex PCR was performed on genomic DNA of Toxocaracati Trichuris vulpis Dipylidium caninum Isospora felisGiardia lamblia assemblages C D and F and sterile ddH

2O

(Figure 5)The sensitivity test revealed that the detection limitwas 10 eggs forA ceylanicum andA caninum in fecal sampleand 72 pg DNA for G lamblia assemblage A (Figure 6)

34 Validation of Multiplex PCR Of 112 fecal samples 178were infected with A ceylanicum and 348 were infectedwith A caninum while only 27 were infected with Glamblia assemblage A Data analysis showed that the preva-lence of A caninum was significantly higher in young catsthan in adults while no statistically significant differencewas observed in gender and neutering group In additionthere were no significant differences in the prevalence of Aceylanicum and G lamblia with respect to age gender andneutering groups (Table 3)

4 Discussion

It is known that A ceylanicum A caninum and G lambliaassemblage A are common parasites that infect dogs andcats throughout the world In addition to the veterinaryimportance those parasites can also cause zoonotic diseases

(bp)

500

400

300

200

150

100

50

1M 2 3 4 5 6 7

Figure 6 Sensitivity of multiplex PCR M DL2000 DNA Marker1ndash7 tenfold serial dilutions of G lamblia assemblage A DNA from100 to 106 and 50 40 30 20 10 5 and 1 egg(s) of A ceylanicum orA caninum

in human To date many methods have been developed forthe identification and detection of those parasites such as thehigh-resolutionmelting (HRM) assay established by Zhang etal which could identify the G lamblia assemblages A and B[24] the PCR-RFLP developed by Liu et al could effectivelydistinguish A ceylanicum and A caninum [14] the PCR-RFLP established by Bertrand et al was an effective tool todetectG lamblia assemblages A and B [25] However prior tothe present study there had been no report on the utilizationof multiplex PCR approaches for detection of hookworm andG lamblia

This work describes the development of a multiplex PCRmethod for simultaneous detection of A ceylanicum Acaninum and G lamblia assemblage A In the process ofestablishing multiple PCR detection methods the primerdesign is a key point Firstly the selected primer design regionmust be highly specific to avoid competitive amplificationamong target fragments In this study highly variable ITSsequence of hookworms and TPI gene of G lamblia werechosen and results showed that three pairs of primers couldspecifically amplify the target fragments Secondly the size ofamplified fragments was between 191 bp and 427 bp and thedifference between any two fragments surpassed 100 bp notonly reducing the amplification efficiency imbalance problem[26] but also making the bands easy to distinguish onthe electrophoretogram In addition annealing temperatureof those primers was relatively close making successfulamplification of all fragments under the same temperature

Regarding specificity this method was specific to amplifythe three target fragments and no cross-reaction with thecommon intestinal parasites such as Toxocara cati Trichurisvulpis Dipylidium caninum Isospora felis and Giardia lam-blia assemblages C D and F of dogs and cats was observedAs for sensitivity test of A ceylanicum or A caninum thenumber of eggs detectable was chosen as criterion of evalu-ation Unfortunately the small size of G lamblia hamperedits spiking with fecal sample precisely Our results showedthat the detection limit was 10 eggs for A ceylanicum orA caninum in fecal samples 72 pg genomic DNA for Glamblia assemblage A thus implying the high specificity andsensitivity of this assay

By using the establishedmultiplex PCR detectionmethodin present study 348 of fecal samples were discovered tobe positive for A caninum which is higher than the positiverate of A ceylanicum (178) This is in agreement with the


Table 3 The prevalence () of A ceylanicum A caninum and G lamblia assemblage A in 112 cat fecal samples from Guangzhou

Characteristics 119873 A ceylanicum A caninum G lamblia assemblage AAge (year)lt1 42 238 (119899 = 10) 524 (119899 = 22)lowast 71 (119899 = 3)gt1 70 143 (119899 = 10) 243 (119899 = 17)lowast mdash

GenderFemale 73 178 (119899 = 13) 411 (119899 = 30) 411 (119899 = 3)Male 39 180 (119899 = 7) 231 (119899 = 9) mdash

NeuteringNeutered 34 147 (119899 = 5) 294 (119899 = 10) 29 (119899 = 1)Not neutered 78 192 (119899 = 15) 371 (119899 = 29) 26 (119899 = 2)

Total 112 178 (119899 = 20) 348 (119899 = 39) 27 (119899 = 3)119873 number of cats examined lowaststatistically significant difference 119875 lt 005

previous results detected by the PCR-RFLP method [23]Thus it supports the correctness of our previous study orvice versa as well as the suggestion that the predominantspecies of hookworms in cats was A caninum in China andthat the prevalence of this species of hookworm in differentsusceptible hostsmay depend on its geographical distribution[13] In addition 27 of fecal samples were positive for Glamblia assemblage A Even though it was lower comparedwith the reported value of 88 in 2013 [12] it still poses apotential risk to public health

In conclusion this work presents the first report on thedevelopment of a multiplex PCR for simultaneous detectionof three important zoonotic parasites A ceylanicum Acaninum and G lamblia assemblage A The results indicatethat this method was a rapid and effective method for theidentification and detection of those zoonotic parasites Theclinical detection results are in line with those previouslydetected by PCR-RFLP method and show that the catsin Guangzhou harbor all these three zoonotic parasitesBriefly humans can become infected by these three zoonoticparasites through oral ingestion and percutaneous migrationof infective L3 larvae (A ceylanicum A caninum) or oralingestion of cysts (G duodenalis) from the environmentTherefore controlmeasures are recommended to prevent andreduce the infection risk from cats to humans

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

This work was funded by the National Natural ScienceFoundation of China (Grant no 31272551) and Science andTechnology Planning Project of Guangdong Province China(Grant no 2014A020214005)The authors would like to thankthe humane shelterrsquos personnel for helping in collecting thesamples

References

[1] D D Bowman S P Montgomery A M Zajac M L Eberhardand K R Kazacos ldquoHookworms of dogs and cats as agents ofcutaneous larva migransrdquo Trends in Parasitology vol 26 no 4pp 162ndash167 2010

[2] R J Traub ldquoAncylostoma ceylanicum a re-emerging butneglected parasitic zoonosisrdquo International Journal for Para-sitology vol 43 no 12-13 pp 1009ndash1015 2013

[3] R J Traub T Inpankaew C Sutthikornchai Y Sukthanaand R C A Thompson ldquoPCR-based coprodiagnostic toolsreveal dogs as reservoirs of zoonotic ancylostomiasis caused byAncylostoma ceylanicum in temple communities in BangkokrdquoVeterinary Parasitology vol 155 no 1-2 pp 67ndash73 2008

[4] V Jiraanankul W Aphijirawat M Mungthin et al ldquoIncidenceand risk factors of hookworm infection in a rural communityof central ThailandrdquoThe American Journal of Tropical Medicineand Hygiene vol 84 no 4 pp 594ndash598 2011

[5] R Ngui Y A L Lim R Traub R Mahmud and M SMistam ldquoEpidemiological and genetic data supporting thetransmission of Ancylostoma ceylanicum among human anddomestic animalsrdquo PLoS Neglected Tropical Diseases vol 6 no2 Article ID e1522 2012

[6] J V Conlan B Khamlome K Vongxay et al ldquoSoil-transmittedhelminthiasis in Laos a community-wide cross-sectional studyof humans and dogs in a mass drug administration environ-mentrdquoThe American Journal of Tropical Medicine and Hygienevol 86 no 4 pp 624ndash634 2012

[7] T Inpankaew F Schar A Dalsgaard et al ldquoHigh prevalenceof Ancylostoma ceylanicum hookworm infections in humansCambodia 2012rdquo Emerging Infectious Diseases vol 20 no 6 pp976ndash982 2014

[8] J K Landmann and P Prociv ldquoExperimental human infectionwith the dog hookworm Ancylostoma caninumrdquoMedical Jour-nal of Australia vol 178 no 2 pp 69ndash71 2003

[9] S M Caccio and U Ryan ldquoMolecular epidemiology of giardia-sisrdquoMolecular and Biochemical Parasitology vol 160 no 2 pp75ndash80 2008

[10] Y Feng and L Xiao ldquoZoonotic potential and molecular epi-demiology of Giardia species and giardiasisrdquo Clinical Microbi-ology Reviews vol 24 no 1 pp 110ndash140 2011

[11] G Zheng M Alsarakibi Y Liu et al ldquoGenotyping of Giardiaduodenalis isolates from dogs in Guangdong China based on


multi-locus sequencerdquo Korean Journal of Parasitology vol 52no 3 pp 299ndash304 2014

[12] G Zheng W Hu Y Liu Q Luo L Tan and G Li ldquoOccurrenceand molecular identification of Giardia duodenalis from StrayCats in Guangzhou Southern Chinardquo The Korean Journal ofParasitology vol 53 no 1 pp 119ndash124 2015

[13] Y J Liu G C Zheng M Alsarakibi et al ldquoMolecular identifi-cation of Ancylostoma caninum isolated from cats in southernchina based on complete ITS sequencerdquo BioMed ResearchInternational vol 2013 Article ID 868050 6 pages 2013

[14] Y J LiuGC Zheng P Zhang et al ldquoMolecular identification ofhookworms in stray and shelter dogs from Guangzhou cityChina using ITS sequencesrdquo Journal of Helminthology vol 89no 2 pp 196ndash202 2015

[15] D Dado A Montoya M A Blanco et al ldquoPrevalence andgenotypes of Giardia duodenalis from dogs in Spain possiblezoonotic transmission and public health importancerdquo Parasitol-ogy Research vol 111 no 6 pp 2419ndash2422 2012

[16] MHuN B Chilton XQ Zhu andR B Gasser ldquoSingle-strandconformation polymorphism-based analysis of mitochondrialcytochrome c oxidase subunit 1 reveals significant substructur-ing in hookworm populationsrdquo Electrophoresis vol 23 no 1 pp27ndash34 2002

[17] J-XWang C-S Pan and L-W Cui ldquoApplication of a real-timePCR method for detecting and monitoring hookworm Necatoramericanus infections in Southern ChinardquoAsian Pacific Journalof Tropical Biomedicine vol 2 no 12 pp 925ndash929 2012

[18] S Fernandez A H Pagotto M M Furtado A M KatsuyamaA M B N Madeira and A Gruber ldquoAmultiplex PCR assay forthe simultaneous detection and discrimination of the sevenEimeria species that infect domestic fowlrdquo Parasitology vol 127no 4 pp 317ndash325 2003

[19] D S Zarlenga M B Chute L C Gasbarre and P C Boyd ldquoAmultiplex PCR assay for differentiating economically importantgastrointestinal nematodes of cattlerdquo Veterinary Parasitologyvol 97 no 3 pp 199ndash209 2001

[20] W YanWWang TWang et al ldquoSimultaneous identification ofthree highly pathogenic Eimeria species in rabbits using amultiplex PCR diagnostic assay based on ITS1-58S rRNA-ITS2fragmentsrdquo Veterinary Parasitology vol 193 no 1ndash3 pp 284ndash288 2013

[21] R J Traub R P Hobbs P J Adams J M Behnke P DHarris and R C A Thompson ldquoA case of mistaken identitymdashreappraisal of the species of canid and felid hookworms (Ancy-lostoma) present in Australia and Indiardquo Parasitology vol 134no 1 pp 113ndash119 2007

[22] I Vanni S M Caccio L van Lith et al ldquoDetection of Giardiaduodenalis assemblages A and B in human feces by simpleassemblage-specific PCR assaysrdquo PLoS Neglected Tropical Dis-eases vol 6 no 8 Article ID e1776 2012

[23] W Hu X G Yu S Wu et al ldquoLevels of Ancylostoma infectionsand phylogenetic analysis of cox 1 gene of A ceylanicum instray cat faecal samples from Guangzhou Chinardquo Journal ofHelminthology 2015

[24] P Zhang Y J Liu M Alsarakibi et al ldquoApplication of HRMassays with EvaGreen dye for genotyping Giardia duodenaliszoonotic assemblagesrdquo Parasitology Research vol 111 no 5 pp2157ndash2163 2012

[25] I Bertrand L Albertini and J Schwartzbrod ldquoComparison oftwo target genes for detection and genotyping of Giardialamblia in human feces by PCR and PCR-restriction fragment

length polymorphismrdquo Journal of Clinical Microbiology vol 43no 12 pp 5940ndash5944 2005

[26] S J Cui Y P Quan X Li F Fu Y L Jiang and L Zhang ldquoTheestablishment of amultiplex PCRof porcine circovirusrdquoChineseJournal of Preventive VeterinaryMedicine vol 28 no 5 pp 581ndash584 2006 (Chinese)

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology


Molecular Biology International

GenomicsInternational Journal of


The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014


BioinformaticsAdvances in

Marine BiologyJournal of



Signal TransductionJournal of


BioMed Research International

Evolutionary BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014


Genetics Research International


Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational



Enzyme Research



Microbiology


Table 1 Primers for the simultaneous detection of Ancylostoma ceylanicum A caninum and Giardia lamblia assemblage A by multiplexPCR

Target parasite Primer name Amplicon size (bp) Sequences (51015840-31015840)

A ceylanicum Acey-F 191 CCCCGTTACAGCCCTACGAGAcey-R TCCTGACAGACAAGTGCCGAACT

G lambliaassemblage A

5C1-P21-F 303 ATGCTAGCCGTAGTTAATAAGG5C1-P21-R ACCGGCCTTATCTACCAGC

A caninum Acan-F 427 AGCATTAGGCTAACGCCCGAAcan-R AACGAGTTTGCTGTCATTCAGTCC

could be identified through the microscopy of eggs orcysts PCR-based methods have key implication to addressthis question and several techniques have been developedfor the identification and detection of hookworms or Glamblia at molecular level such as PCR-restriction fragmentlength polymorphism (RFLP) [15] single-strand conforma-tion polymorphism (SSCP) [16] and real-time PCR [17]Even though these approaches are very useful and sensitivethe number of steps to detect these pathogens can be timeconsuming and quite expensive Furthermore the higher thestep number the higher the risk of contamination

Multiplex PCR assay enables the identification and detec-tion of mixed infection in a single reaction that containsmultiple primer pairs it is a convenient rapid cost-effectiveand high-efficiency method So far several multiplex PCRassays have been documented for the identification anddetection of various parasite species [18ndash20] Prior to thepresent study there have been no reports of multiplexPCR assay for simultaneous detection of A ceylanicum Acaninum and G lamblia assemblage A For the first timewe developed here a multiplex PCR assay for the detectionof these three zoonotic parasites providing a convenientrapid and efficient technique for the clinical detection andepidemiological investigation

2 Materials and Methods

21 Samples G lambliaWBtrophozoites were obtained fromprofessor Zhao-Rong Lun (Center for Parasitic OrganismsState Key Laboratory of Biocontrol School of Life SciencesSun Yat-Sen University Guangzhou China) adult hook-worms were collected from dog carcasses supplied by veteri-nary hospital of South China Agricultural University Aftercleaning with saline solution A ceylanicum and A caninumwere morphologically identified to species level accordingto existing keys and descriptions [21] fixed in 70 (vv)ethanol and stored at minus20∘C until use Control DNA sampleof A braziliense was kindly provided by Stephen E Bienhoff(Novartis Animal Health USA) control DNA samples ofToxocara cati Trichuris vulpis Dipylidium caninum Isosporafelis and Giardia lamblia Assemblages C D and F were keptin our laboratory

22 Genomic DNA Extraction The extraction of genomicDNA from A ceylanicum A caninum and G lamblia WB

was performed by using proteinase K treatment followedby spin-column purification (Wizard SV Genomic DNAPurification System Promega) For isolation of genomicDNA from fecal samples the QIAmp DNA stool kit (QiagenHilden Germany) was used according to the manufacturerrsquosinstructions with the exception that all samples were washedthree times with distilled water and then pretreated with 5cycles of heating at 100∘C for 5 minutes and freezing at minus80∘Cfor 5 minutes The extracted DNA was stored at minus20∘C untiluse

23 Specific Primers Design Based on the polymorphic sitesof ITS1-58S rRNA-ITS2 A ceylanicum and A caninumspecific primers were designed by Primer Premier 50 andcombined with the previously published specific primers forG duodenalis assemblage A [22] to generate target fragmentsof different sizes The three pairs of specific primers sharedsimilar annealing temperatures and were predicted to formno secondary structures or primer-dimers their sequencesand expected sizes of amplicons are listed in Table 1

24 Simplex PCR Specific PCRs were initially tested foreach pair of primers All PCRs were performed in 25120583Lvolume containing 2 120583L DNA sample 02 120583L Taq polymerase(TaKaRa Dalian China) 25 120583L 10x Taq buffer (TaKaRa)2 120583L diethyl-nitrophenyl thiophosphate (dNTP TaKaRa)mixture 04 120583L primers (50mM) and 175 120583L of distilledwaterThe thermocycler program consisted of 94∘C for 5minfollowed by 35 cycles of 94∘C for 30 s 59∘C for 30 s 72∘C for30 s and a final extension step at 72∘C for 7min For eachPCR negative control (H

2O)was run together PCR products

were analyzed by electrophoresis on 15 agarose gels stainedwith 02 gmL of ethidium bromide and visualized on aUV transilluminator All three PCR conditions were thenoptimized by changing a range of parameters includingannealing temperatures the concentration of each specificprimer set and Mg2+ to determine the optimum range of allparameters

25 Multiplex PCR Based on the optimization results ofsimplex PCR multiplex PCR reaction parameters were opti-mized Firstly all three pairs of primers were added to the onePCR reaction mixture in equal volumes (08120583L) to test theinteraction effect of the primers Then the concentrations of



ParasitePrimers


Mg2+concentration

(mM)






3 Results



2


(bp)

1M

500

400

300

200

150

100

50


(bp)

500

400

300

200

150

100

50

1M 2 3 4 5 6 7


(bp)

500

400

300

200

150

100

50

1M 2 3 4 5 6 7






(bp)

500

400

300

200

150

100

50

1M 2 3 4 5


(bp)

500

400

300

200

150

100

50

1M 2 3 4 5 6 7 8 9 10 11 12 13 14



2O



4 Discussion


(bp)

500

400

300

200

150

100

50

1M 2 3 4 5 6 7
















Acknowledgments


References





































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology



ParasitePrimers


Mg2+concentration

(mM)






3 Results



2


(bp)

1M

500

400

300

200

150

100

50


(bp)

500

400

300

200

150

100

50

1M 2 3 4 5 6 7


(bp)

500

400

300

200

150

100

50

1M 2 3 4 5 6 7






(bp)

500

400

300

200

150

100

50

1M 2 3 4 5


(bp)

500

400

300

200

150

100

50

1M 2 3 4 5 6 7 8 9 10 11 12 13 14



2O



4 Discussion


(bp)

500

400

300

200

150

100

50

1M 2 3 4 5 6 7
















Acknowledgments


References





































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


(bp)

500

400

300

200

150

100

50

1M 2 3 4 5


(bp)

500

400

300

200

150

100

50

1M 2 3 4 5 6 7 8 9 10 11 12 13 14



2O



4 Discussion


(bp)

500

400

300

200

150

100

50

1M 2 3 4 5 6 7
















Acknowledgments


References





































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology











Acknowledgments


References





































Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology


























Volume 2014

Zoology






















Advances in

Virolog y



Volume 2014




Enzyme Research



Microbiology

ancylostoma ceylanicum a. caninum,toxocara cati ,trichuris vulpis ,dipylidium caninum ,isospora...

Documents