RESEARCH ARTICLE

Enzymatic Amplification of ,-GlobinGenomic Sequences and Restriction Site

Analysis for Diagnosis of Sickle Cell Anemia

Randall K. Saiki, Stephen Scharf, Fred Faloona, Kary B. Mullis

Glenn T. Horn, Henry A. Erlich, Norman Arnheim

Recent advances in recombinant DNAtechnology have made possible the mo-lecular analysis and prenatal diagnosis ofseveral human genetic diseases. FetalDNA obtained by aminocentesis or cho-rionic villus sampling can be analyzed byrestriction enzyme digestion, with subse-quent electrophoresis, Southern trans-fer, and specific hybridization to clonedgene or oligonucleotide probes. With

This disease results from homozygosityof the sickle-cell allele (PS) at the 3-globin gene locus. The S allele differsfrom the wild-type allele (pA) by substi-tution of an A in the wild-type to a T atthe second position of the sixth codon ofthe 1B chain gene, resulting in the replace-mert of a glutamic acid by a valine in theexpressed protein. For the prenatal diag-nosis of sickle cell anemia, DNA ob-

polymorphic DNA markers linked ge-netically to a specific disease locus, seg-regation analysis must be carried outwith restriction fragment length poly-morphisms (RFLP's) found to be infor-mative by examining DNA from familymembers (1, 2).Many of the hemoglobinopathies,

however, can be detected by more directmethods in which analysis of the fetusalone is sufficient for diagnosis. For ex-

ample, the diagnosis of hydrops fetalis(homozygous a-thalassemia) can bemade by documenting the absence of anya-globin genes by hybridization with ana-globin probe (3-5). Homozygosity forcertain ,B-thalassemia alleles can be de-termined in Southern transfer experi-ments by using oligonucleotide probesthat form stable duplexes with the nor-

mal 3-globin gene sequence but formunstable hybrids with specific mutants(6, 7).

Sickle cell anemia can also be diag-nosed by direct analysis of fetal DNA.

1350

tained by amniocentesis or chorionic vil-lus sampling can be treated with a re-

striction endonuclease (for example,Dde I and Mst II) that recognizes a

sequence altered by the PS mutation (8-11). This generates pA- and Ps-specificrestriction fragments that can be re-solved by Southern transfer and hybrid-ization with a ,B-globin probe.We have developed a procedure for

the detection of the sickle cell mutationthat is very rapid and is at least twoorders of magnitude more sensitive thanstandard Southern blotting. There are

two special features to this protocol. Thefirst is a method for amplifying specific3-globin DNA sequences with the use of

oligonucleotide primers and DNA poly-merase (12). The second is the analysisof the ,B-globin genotype by solution hy-bridization of the amplified DNA with a

specific oligonucleotide probe and sub-sequent digestion with a restriction en-

donuclease (13). These two techniquesincrease the speed and sensitivity, and

lessen the complexity of prenatal diagno-sis for sickle cell anemia; they may alsobe generally applicable to the diagnosisof other genetic diseases and in the useof DNA probes for infectious diseasediagnosis.

Sequence amplification by polymerasechain reaction. We use a two-step proce-dure for determining the ,B-globin geno-type of human genomic DNA samples.First, a small portion of the P-globingene sequence spanning the polymorphicDde I restriction site diagnostic of the fAallele is amplified. Next, the presence orabsence of the Dde I restriction site inthe amplified DNA sample is determinedby solution hybridization with an end-labeled complementary oligomer fol-lowed by restriction endonuclease diges-tion, electrophoresis, and autoradiogra-phy.The ,-globin gene segment was ampli-

fied by the polymerase chain reaction(PCR) procedure of Mullis and Faloona(12) in which we used two 20-base oligo-nucleotide primers that flank the regionto be amplified. One primer, PC04, iscomplementary to the (+)-strand and theother, PCO3, is complementary to the(-)-strand (Fig. 1). The annealing ofPC04 to the (+)-strand of denatured ge-nomic DNA followed by extension withthe Klenow fragment of Escherichia coliDNA polymerase I and deoxynucleotidetriphosphates results in the synthesis of a(-)-strand fragment containing the targetsequence. At the same time, a similarreaction occurs with PC03, creating anew (+)-strand. Since these newly syn-thesized DNA strands are themselvestemplate for the PCR primers, repeatedcycles of denaturation, primer annealing,and extension result in the exponentialaccumulation of the 110-base pair regiondefined by the primers.An example of the degree of specific

gene amplification achieved by the PCRmethod is shown in Fig. 2A. Samples ofDNA (1 ,ug) were amplified for 20 cyclesand a fraction of each sample, equivalentto 36 ng of the original DNA, was sub-jected to alkaline gel electrophoresis andtransferred to a nylon filter. The filterwas then hybridized with a 32P-labeled40-base oligonucleotide probe, RS06,which is complementary to the targetsequence (Fig. IA) but not to the PCRprimers. The results, after a 2-hour auto-radiographic exposure, show that a frag-ment hybridizing with the RS06 probe

The authors are in the Department of HumanGenetics, Cetus Corporation, 1400 Fifty-ThirdStreet, Emeryville, California 94608. The presentaddress for N.A. is Department of Biological Sci-ences, University of Southern California, Los Ange-les 90089-0371.

SCIENCE, VOL. 230

Abstract. Two new methods were used to establish a rapid and highly sensitiveprenatal diagnostic testfor sickle cell anemia. Thefirst involves the primer-mediatedenzymatic amplification of specific P-globin target sequences in genomic DNA,resulting in the exponential increase (220,000 times) of target DNA copies. In thesecond technique, the presence of the pA and Ps alleles is determined by restrictionendonuclease digestion of an end-labeled oligonucleotide probe hybridized insolution to the amplified P-globin sequences. The 3-globin genotype can bedetermined in less than I day on samples containing significantly less than Imicrogram of genomic DNA.

on

June

24,

201

2w

ww

.sci

ence

mag

.org

Dow

nloa

ded

from

migrates at the position expected of theamplified target DNA segment (110bases) (lanes 1 and 2). No hybridizationwith the RS06 probe could be detected inunamplified DNA (lane 4). When PCRamplification was performed on a DNAsample derived from an individual withhereditary persistence of fetal hemoglo-bin in which both the 8- and ,-globingenes are deleted (14), again no 110-basefragment was detected (lane 3). To esti-mate the yield and efficiency of 20 cyclesof PCR amplification, we prepared aSouthern blot that contained 36 ng of anamplified genomic DNA sample and adilution series consisting of variousamounts of cloned 3-globin sequence.The efficiency was calculated accordingto the formula: (1 + XlY = Y, where X isthe mean efficiency per cycle, n is thenumber of PCR cycles, and Y is theextent of amplification (yield) after ncycles (for example, a 200,000-fold in-crease after 20 cycles). The amounts ofcloned P-globin sequences used in thisexperiment were calculated to representefficiencies of 70 to 100 percent.The reconstructions were prepared

by digesting the 3-globin plasmid,pBR328: : pA, with the restriction en-zymes Hae III and Mae I. Both of theseenzymes cleave the P-globin gene withinor very near to the 20 base regions thathybridize to the PCR primers, generatinga 103-base pair (bp) fragment that isalmost identical in size and compositionto the 110-bp segment created by PCRamplification. After hybridization withthe RS06 probe and autoradiography, theamplified genomic sample was comparedwith the known standards, and the resultindicated an overall efficiency of approx-imately 85 percent (Fig. 2B), represent-ing an amplification of about 220,000times (1.8520).

Distinguishing the pA and Ps alleles bythe oligomer restriction method. We havepreviously described a rapid solution hy-bridization method that can indicatewhether a genomic DNA sample con-tains a specific restriction enzyme siteat, in principle, any chromosomal loca-tion (13). This method, called oligomerrestriction (OR), involves the stringenthybridization of a 32P end-labeled oligo-nucleotide probe to the specific segmentof the denatured genomic DNA whichspans the target restriction site. The abil-ity of a mismatch within the restrictionsite to prevent cleavage of the duplexformed between the probe and the targetgenomic sequence is the basis for detect-ing allelic variants. The presence of therestriction site in the target DNA is re-vealed by the appearance of a specific20 DECEMBER 1985

A * + +RS06: 5' CTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGG 3'RS1O: 3' GACAGAGGTCACCTCTTCAGACGGCAATGACGGGACACCC 5'PC03: 5' ACACAACTGTGTTCACTAGC 3'

PC04: 3' CCACTTGCACCTACTTCAAC 5'

B5' TCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACCATGGT.

5' PCO3 3'

H D

s--X - GCACCTGACTCCTGAGGAGAAGTCTGCCGTTACTGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGTGG 3'

RS06 3 ' 3 ' PC04 5 'Fig. 1. Sequence of synthetic oligonucleotide primers and probe and their relation to the target,B-globin region. (A) The primer PCO3 is complementary to the (-)-strand and the primer PCO4is complementary to the (+)-strand of the ,-globin gene. The probe RS06 is complementary tothe (-)-strand of the wild-type (PA) sequence of ,B-globin. RS1O is the "blocking oligomer", anoligomer complementary to the RS06 probe except for three nucleotides, indicated by thedownward arrows. It is added before enzyme digestion to the OR reaction to anneal to theexcess RS06 oligomer and prevent nonspecific cleavage products due to hybridization of RS06to nontarget DNA (13). Because of the mismatches within the Dde I and Hinf I restriction sites,the RSO6/RS1O duplex is not cleaved by Dde I and Hinf I digestion. (B) The relation between theprimers, the probe, and the target 3-globin sequence. The upward arrow indicates the ,B-globininitiation codon. The downward arrows indicate nucleotide differences between ,B- and 8-globin.The polymorphic Dde I site (CTCAG) is represented by a single horizontal dashed line (D), andthe invariant Hinf I (GACTC) site is represented by double horizontal dashed lines (H).

1 2 3 4 1 2 3 4 5 6 7 8 Fig. 2. Southern analysis of PCR amplified genomicDNA with the RS06 probe. (A) Samples (1 JLg) of

Y1>~zK~~Y>i genomic DNA were dispensed in microcentrifuge:&8K%~Y~>< <tubes and adjusted to 100 X.l in a buffer containing 10

mm tris, pH 7.5, 50 mM NaCl, 10 MM MgCl2, 1.5mM deoxynucleotide trisphosphate [(dNTP) each ofall four was used], 1 FLM PCO3, and 1 p.M PCO4.After heating for 5 minutes at 950C (to denature thegenomic DNA), the tubes were centrifuged for lQseconds in a microcentrifuge to remove the conden-sation. The samples were immediately transferred toa 30°C heat block for 2 minutes to allow the PCO3 andPCO4 primers to anneal to their target sequences. Atthe end of this period, 2 ,ul of the Klenow fragment ofE. coli DNA polymerase I (Biolabs, 0.5 unit/p.l in 10mM tris, pH 7.5, 50 mM NaCI, 10 mM MgCl2) was

added, and the incubation was allowed to proceed for an additional 2 minutes at 30°C. Thiscycle-denaturation, centrifugation, hybridization, and extension-was repeated 19 moretimes, except that subsequent denaturations were done for 2 instead of 5 minutes. (The finalvolume after 20 cycles was 140 ,ul.) Thirty-six nanograms of the amplified genomic DNA (5 ,u)were applied to a 4 percent Nusieve (FMC) alkaline agarose minigel and subjected toelectrophoresis (50 V), for 2 hours until the bromcresol green dye front reached 4 cm. Afterneutralization and transfer to Genetrans nylon membrane (Plasco), the filter was "prehybri-dized" in 10 ml 3x SSPE (I x SSPE is 0.18M NaCl, 10 mM NaH2PO4, 1 mM EDTA, pH 7.4),5x DET (Ix DET is 0.02 percent each polyvinylpyrrolidone, Ficoll, and bovine serumalbumin; 0.2 mM tris, 0.2 mM EDTA, pH 8.0), 0.5 percent SDS, and 30 percent formamide for 4hours at 42°C. Hybridization with 1.0 pmol of phosphorylated (with [y-32P]ATP) RS06 (-5 p.Ci/pmol) in 10 ml of the same buffer was carried out for 18 hours at 42°C. The filter was washedtwice in 2x SSPE, 0.1 percent sodium dodecyl sulfate (SDS) at room temperature for 30minutes, and autoradiographed at -70°C for 2 hours with a single intensification screen. (Lanes1 to 3) DNA's isolated from the cell lines Molt4, SCOI, and GM2064, respectively. Molt4 ishomozygous for the normal, wild-type allele of P-globin (pApA), SC-I is homozygous for thesickle cell allele (pSpS), and GM2064 is a cell line in which the P- and 8-globin genes have beendeleted (AA) (13). (Lane 4) Contains 36 ng of Molt4 DNA that was not PCR amplified. Thehorizontal arrow indicates the position of a 114-base marker fragment obtained by digestion ofpBR328 with Nar I. (B) Thirty-six nanograms of 20-cycle amplified Molt4 DNA (see above) wasloaded onto a Nusieve gel along with measured amounts of Hae III-Mae I digested pBR328: : A(13) calculated to represent the molar increase in p-globin target sequences at PCR efficienciesof 70, 75, 80, 85, 90, 95, and 100 percent (lanes 2 to 8, respectively). DNA was transferred toGenetrans and hybridized with the labeled RS06 probe as described above. (Lane 1) Molt4DNA (36 ng); (lanes 2 to 8) 7.3 x 10-4 pmol, 1.3 x 10-3 pmol, 2.3 x 10-3 pmol, 4.0 x 10-3pmol, 6.8 x 10-3 pmol, 1.1 x 10-2 pmol, and 1.9 x 10-2 pmol of pBR328::pA, respectively(20).

1351

on

June

24,

201

2w

ww

.sci

ence

mag

.org

Dow

nloa

ded

from

labeled fragment generated by cleavageof the probe.For the diagnosis of sickle cell anemia,

the probe was designed to be comple-mentary to a region of the P-globin genelocus surrounding the sixth codon. In thepA allele, the nucleotide (nt) sequence atthis position contains a Dde I restrictionsite, but due to the single base mutation,this site is absent in the Ps allele. Ourstrategy for generating specific probecleavage products for each allele isshown in Fig. 3. It is based on thepresence of an invariant Hinf I restric-tion enzyme site immediately adjacent tothe polymorphic Dde I restriction site.Resolution of the labeled oligomer cleav-age products produced by sequential di-gestion with Dde I and Hinf I allows usto distinguish between the two alleles. Inan individual homozygous for the wild-type ,B-globin allele AA, Dde I digestionwill produce a labeled octamer (8 nt)from the probe. Because of its shortlength, the 8-nt cleavage product willdissociate from the genomic target DNAand the subsequent digestion with Hinf Ihas no effect. In the case of SS homozy-gotes, however, Dde I digestion does notcleave the probe since a base pair mis-match exists in the recognition sequenceformed between the probe and targetDNA. The invariant Hinf I site will thenbe cleaved during Hinf I digestion, re-leasing a labeled trimer (3 nt). In an ASheterozygote, both a trimer and an oc-

tamer would be detected. The resolutionof the intact 40-base probe, the 8-nt andthe 3-nt cleavage products is achieved bypolyacrylamide gel electrophoresis. Ex-periments testing the sequential diges-tion strategy with plasmids carrying thepA and Ps alleles show that, in each case,the expected probe cleavage productswere produced (Fig. 4).

Analysis of genomic DNA samples byPCR and OR. Eleven DNA samples de-rived from lymphoblastoid cell lines orwhite blood cells were analyzed for theirP-globin genotype by standard Southernblotting and hybridization of the Mst IIRFLP (10), identifying the genotypes ofthe samples as either AA, AS, or SS. Sixof these samples (and one additional one)were then amplified by PCR for 20 cyclesstarting with 1 ,ug of DNA each. Analiquot of the amplified DNA sample(one-fourteenth of the original l-,ug sam-ple) was hybridized to the RS06 probeand digested with Dde I and then Hinf I.A portion (one-tenth) of this oligomerrestriction reaction was analyzed on apolyacrylamide gel to resolve the cleav-age products, and the results obtainedafter 6 hours of autoradiography areshown Fig. 5. The high sensitivityachieved with the PCR and OR methodis demonstrated by the strength of theautoradiographic signal derived fromonly 1/140 of the original l-p.g sample (7ng). Each sample determined to be AAby RFLP analysis showed a strong 8-nt

fragment while those typed as SSshowed a strong 3-nt fragment. Analysisof the known AS samples revealed bothcleavage products.

In the analysis of the AA samples, afaint 3-nt could be detected in addition tothe primary 8-nt signal. The reasons forthis band remain unclear, although in-complete Dde I cleavage or the occasion-al failure of the 8-nt fragment to disasso-ciate from the target DNA may contrib-ute to the nonspecific 3-nt product gener-ated by Hinf I digestion. In the analysisof the SS samples, a very faint 8-nt bandwas also observed in addition to theexpected 3-nt signal. We have deter-mined that the background 8-nt productdetected in SS samples can be attributedto the 8-globin gene, which is highlyhomologous to 3-globin. The nucleotidesequence of the two P-globin primersused for amplification is shown in Fig. 1.The downward pointing arrows indicatethe differences between the P- and 8-globin genes. We hypothesized that thefaint 8-nt signal observed in the SS sam-ples was due to some amplification of theb-globin gene by these primers and thesubsequent cross-hybridization of theamplified 8 sequences with the RS06probe used in the OR procedure. b-Glo-bin has the same Dde I site as normal P-globin, and the duplex formed betweenan amplified 8 gene segment and theRS06 probe would be expected to yieldan 8-nt fragment on Dde I digestion even

(#A)GACTCCTGAGCTGAGGACTC

Denature and annealwith probe

*-GACTCCTGAG (RS06)CTGAGGACTC

(8 nt) *-GACTGCCTGAGGACT

*-GACTCC

CTGAGGACT

lI

Digest with Dde

TGAG

B (OS)GACTCCTGTGCTGAGGACAC

Denature and annealwith probe

*-GACTCCTGAG (RS06)CTGAGGACAC

4 Digest with Dde

*-GACTCCTGAGCTGAGGACAC

Digest with Hinf I

TGAG

Digest with Hinf I

(3 nt) *-GC--rTGA

ACTCCTGAGGC.AC C

Fig. 3. Schematic diagram of oligomer restriction by sequential digestion to identify pA_ and Ps-specific cleavage products. The DNA sequencesshown are the regions of the P-globin genomic DNA and the RS06 hybridization probe containing the invariant Hinf I site (GANTC, where Nrepresents any nucleotide) and the polymorphic Dde I site (CTNAG). The remaining DNA sequences are represented as solid horizontal lines.The asterisk indicates the position of the radioactive 32P label attached to the 5'-end of the RS06 probe with polynucleotide kinase. (A) Outline ofthe procedure and expected results when RS06 anneals to the normal 3-globin gene (1A). After denaturation of the genomic DNA andhybridization of the labeled RS06 probe to the complementary target sequence in the pA gene, digestion of the probe-target hybrid with Dde Icauses the release of a labeled (8-nt) cleavage product. Because of the relatively stringent conditions during Dde I digestion, the 8-nt cleavageproduct dissociates from the genomic DNA and the subsequent digestion with Hinf I has no effect. (B) Outline of Dde I and Hinf I digestion afterhybridization of the RS06 probe to the sickle cell allele (I3S). As a consequence of the Ps mutation, the probe-target hybrid contains an A-Amismatch within the Dde I site and is not cleaved by the Dde I endonuclease. The Hinf I site, however, remains intact and digestion with that en-zyme generates a labeled 3-nt product. Thus, the presence of the pA allele is revealed by the release of a labeled 8-nt fragment, while the presenceof P3s is indicated by a labeled 3-nt fragment.

A

1352 SCIENCE, VOL. 230

on

June

24,

201

2w

ww

.sci

ence

mag

.org

Dow

nloa

ded

from

though there are sequence differences(four mismatch out of 40 bases) betweenRS06 and 8-globin. It is likely that b-globin sequences may be amplified tosome extent and detected weakly withthe RS06 probe in all DNA samples, butthat its contribution to the total signal isvery small and detectable only when thesample is SS and no 8-nt fragment fromthe 3-globin gene is expected. We testedthis hypothesis by treating an SS DNAsample before amplification with the en-zyme Mbo I. Since there is a recognitionsite for this enzyme in the target DNA ofthe b- but not the P-globin gene, cleavageof the 8 gene between the regions thathybridize to the PCR primers shouldprevent its subsequent amplification (butnot of P-globin). Our results showed thatan SS DNA sample, first digested withMbo I, gave only the 3-nt product but notthe 8-nt product, this is consistent withthe hypothesis of 8-globin amplification.

Effect of PCR cycle number on detec-tion threshold. The strength of the auto-radiograph signal detected by OR as afunction of PCR cycle number and auto-radiographic exposure was examined.The signal intensity after 20 cycles is atleast 20 times as strong as that for 15cycles and the determination of the 1B-globin genotype can be made with anautoradiographic exposure for only 2hours (Fig. 6). The observed increase of.20-fold is consistent with our estimatesof 85 percent efficiency per cycle, calcu-lated from the data in Fig. 2B(1.855 = 21.7). Coupled with the timethat it takes to actually carry out thePCR and OR procedures, a 20-cycle PCRallows a diagnosis to be made in less than10 hours with a DNA sample of 1 ,ug.Since all of the previous PCR experi-

ments were done with 1 ,ug of genomicDNA, we explored the effect of usingsignificantly smaller amounts ofDNA astemplate for PCR amplification. The re-sults obtained with 20 cycles of PCRamplification on 500, 100, 20, and 4 ng ofDNA from an AS individual are shown inFig. 7. After analysis of 1/40 of eachsample by the OR procedure and a 20-hour autoradiographic exposure, the 1B-globin genotype could be easily deter-mined on DNA samples of 20 ng or about100 times less than is needed for a typicalSouthern transfer and hybridization ex-periment. In this experiment, only asmall fraction (1/40) of the starting mate-rial was placed on the gel; therefore itshould be possible to analyze samples ofless than 20 ng of genomic DNA (20 ng isequivalent to approximately 6000 hap-loid genomes) if a larger proportion ofthe material was utilized in the OR andgel electrophoresis steps.20 DECEMBER 1985

Diagnostic applications of the PCR-ORsystem. When currently available meth-ods are used, the completion of a prena-tal diagnosis for sickle cell anemia takesa period of several days after the DNA isisolated. With 1 ,ug of genomic DNA, the,B-globin genotype can be determined bythe PCR-OR method in less than 10hours; 20 cycles of amplification requiresabout 2 hours (each full cycle takes 6 to 7minutes in our protocol), the oligomerrestriction procedure involving liquid hy-bridization and enzyme digestions re-quire an additional 2 hours, and theelectrophoresis takes about an hour.Autoradiographic exposure for 4 hours issufficient to generate a strong signal.

Because this method includes a liquidhybridization protocol and involves theserial addition of reagents to a singletube, it is simpler to perform than thestandard Southern transfer and hybrid-ization procedure. Prior to electrophore-sis, all of the reactions can be done intwo small microcentrifuge tubes andcould readily be automated.The sensitivity, as well as the speed

and simplicity, of this procedure is alsoimportant for clinical applications.Twenty nanograms of starting materialcan provide an easily detectable result inan overnight autoradiographic exposure.This sensitivity makes the PCR-ORmethod particularly valuable in cases

2 3 Fig. 4. Demonstration of OR sequential digestion withcloned 1-globin genes. The sequential digestion strategywas demonstrated by annealing the RS06 probe to the 1-globin plasmids pJ3R328::PA and pBR328::Ps (13). Themethods were similar to those described (13). Cloned ,B-globin DNA (45 ng; 0.01 pmol) was placed in a microcentri-fuge tube, adjusted to 30 RlI with TE buffer (10 mM tris, 0.1mM EDTA, pH 8.0), overlaid with 0.1 ml of mineral oil.The DNA was denatured by heating for 5 to 10 minutes at

-8 nt 95°C. Ten microliters of 0.6M NaCl containing 0.02 pmol ofphosphorylated (with [-y-32P]ATP) RS06 probe oligomer (-5,uCi/pmol) was added and annealed for 60 minutes at 56°C.Unlabeled RS1O blocking oligomer (4 RI; 200 pmol/ml) (Fig.

-3 nt 1) (13) was then added, and the hybridization was continuedfor 5 to 10 minutes. Next, 5 ,u of 100 mM MgCl2 and 1 RI ofDde I (Biolabs, 10 units) was added and incubated for 20minutes at 56°C; 1 ,l of Hinf I (Biolabs, 10 units) was addedand digestion was continued for 20 minutes at the sametemperature. The reaction was terminated by the additionof 4 ,ul of 100 mM EDTA and 6 ,ul of tracking dye to a finalvolume of 61 ,ul; a portion (8 RI) (6 ng, 0.0013 pmol) wasapplied to a 0.75-mm thick, 30 percent polyacrylamide

minigel (19 acrylamide: 1 bis) in a Hoefer SE200 apparatus and subjected to electrophoresis (300V) for 1 hour until the bromphenol blue dye front reached 3 cm. The top 1.5 cm of the gel,containing intact RS06, was cut off and discarded. The remaining gel was autoradiographed witha single intensification screen for 18 hours at -70°C. (Lane 1) six nanograms of pBR328:: PA;(lane 2) 3 ng of pBR28::3A plus 3 ng of pBR328:: Ps; and (lane 3) 6 ng of pBR328:: Ps.

1 2 3 4 5 6 7 8 9 10 11 15 cycles

1 2 3

-8 nt

-3 nt

20 cycles4 5 6

-8 nt

-3 nt

Fig. 5 (left). Determination of the 3-globin genotype in human genomic DNA with PCR-OR.Samples (1 ,ug) of human genomic DNA were amplified for 20 cycles (as described in Fig. 2A).The amplified DNA's (71 ng) were hybridized to the RS06 probe and serially digested with Dde Iand Hinf I (as described in Fig. 4). Each sample (6 >1.) was analyzed by 30 percentpolyacrylamide gel electrophoresis and autoradiographed for 6 hours at -70°C with oneintensification screen. Each lane contains 7 ng of genomic DNA. (Lane 1) Unamplified Molt4DNA (negative control); (lane 2) amplified Molt4 (pA1A); (lane 3) SC-I (Is3s); (lane 4) GM2064(A4); (lanes 5 to 11) clinical samples CHI (pApA), CH2 (pApA), CH3 (pSps), CH4 (pSps), CH7(pApS), CH8 (sp55s), and CH12 (pApS), respectively. Fig. 6 (right). Effect of cycle numberon signal strength. Genomic DNA (1 ,ug) from the clinical samples CH2 (pAPA), CH12 (pApS),and CH5 (pWV35) were amplifed for 15 and 20 cycles and equivalent amounts of genomic DNA(80 ng) were analyzed by oligomer restriction. (Lanes I to 3) DNA (20 ng) from CH2, CH12, andCH5, respectively, amplified for 15 cycles; (lanes 4 to 6) DNA (20 ng) from CH2, CH12, andCH5, respectively, amplified for 20 cycles. Autoradiographic exposure was for 2.5 hours at-70°C with one intensification screen.

1353

on

June

24,

201

2w

ww

.sci

ence

mag

.org

Dow

nloa

ded

from

where poor DNA yields are obtainedfrom prenatal samples. In addition, DNAsamples of poor quality (very low aver-age molecular weight) can give excellentresults in the PCR-OR protocol.The PCR method is likely to be gener-

ally applicable for specific gene amplifi-cation since a fragment encoding a por-tion of the HLA-DQa locus has recentlybeen amplified with this procedure (15).We have carried out PCR amplificationon a 110-bp P-globin sequence with anoverall efficiency per cycle of about 85percent. We have also amplified longer,-globin fragments (up to 267 bp), butthe yield was lower under our standardconditions. Efficient amnplification of a267-bp fragment required some variationin the PCR procedure. In principle, in-creasing the number of PCR cyclesshould yield even greater amplificationthan that reported here (-220,000-foldafter 20 cycles).Our method for the diagnosis of sickle

cell anemia involves the coupling of thePCR procedure with that of oligomerrestriction. It was designed to distinguishbetween two alleles that differ by a poly-morphic restriction site. The PCR-ORmethod is applicable as well to the diag-nosis of other diseases where the lesiondirectly affects a restriction enzyme siteor where the polymorphic site is instrong linkage disequilibrium with thedisease causing locus. If the polymor-phism is in linkage equilibrium with thedisease, PCR-OR requires family studiesto follow the inheritance of the diseaselocus.

In the case of the P-globin locus, thepresence of the invariant Hinf I restric-tion site adjacent to the polymorphicDde I site allows a sequential digestionprocedure to identify both the 13A and s

1 2 3 4

Fig. 7. Detection threshold for IFivefold serial dilutions of genom(500, 100, 20, and 4 ng) from thesample CH12 (pAS) were amplifecycles of PCR and one-tenth each(50, 10, 2, and 0.4 ng) was analyzecThe gel continued (lane 1) genomic Dng); (lane 2) 2.5 ng; (lane 3) 0.5 ng; (lang; (lane 5) 12.5 ng genomic DNAglobin deletion cell line GM2064. Aigraphic exposure was for 20 hourswith an intensification screen.

alleles. In principle, this approanot require that the two sites beately adjacent but only that theproduct generated by digestiolpolymorphic site dissociate fromget to prevent cutting at the isite. Since the restriction enzymtion conditions used here are faiigent for hybridization, we estirrthe polymorphic and invariaicould perhaps be separated byas 20 bp.The application of the PCR m

prenatal diagnosis does not necdepend on a polymorphic restricor on the use of radioactive prfact, the significant amplificatioiget sequences achieved by timethod allows the use of nonisollabeled probes (16). Amplified t.quences could also be analyzc

number of other procedures includingthose involving the hybridization ofsmall labeled oligomers which will formstable duplexes only if perfectly matched

-8 nt (6, 7, 17, 18) and the recently reportedmethod based on the electrophoreticshifts of duplexes with base pair mis-

-3 nt matches (19). The ability of the PCRprocedure to amplify a target DNA seg-ment in genomic DNA raises the possi-bility that its use may extend beyond that

PCR-OR of prenatal diagnosis to other areas ofLic DNA molecular biology.-.clinical-d by 20reaction References and Notes

I by OR. 1. Y. W. Kan and A. M. Dozy, Proc. Natl. Acad.iNA (12.5 U.S.A. 75, 5631 (1978).ane 4) 0.1 2. K. E. Davies and D. P. Ellis, Biochem. J. 226, 1from the (1985).utoradio- 3. Y. W. Kan, M. S. Golbus, A. M. Dozy, N. Eng.1. Med. 295, 1165 (1976).at -70°C 4. A. M. Dozy et al., J. Am. Med. Assoc. 241, 1610

(1979).5. E. M. Rubin and Y. W. Kan, Lancet 1985-I, 75

(1985).6. M. Pirastu et al., N. Engi. J. Med. 309, 284

(1983).Lch does 7. S. H. Orkin, A. F. Markham, H. H. Kazazian,immedi- Jr., J. Clin. Invest. 71, 775 (1983).

8. R. F. Geever et al., Proc. Natl. Acad. Sci.cleavage U.S.A. 78, 5081 (1981).

9. J. C. Chang and Y. W. Kan, N. Eng. J. Med.n at the 307, 30 (1982).i the tar- 10. s. H. Orkin et al., ibid., p. 32.

11. J. T. Wilson et al., Proc. Natl. Acad. Sci.invariant U.S.A. 79, 3628 (1982).ie diges- 12. F. Faloona and K. Mullis, in preparation.ie diges- 13. R. Saiki, N. Arnheim, H. Erlich, Biotechnology

rly strin- 3, 1008 (1985).atethat 14. D. Tuan et al., Proc. Natl. Acad. Sci. U.S.A.nate that 80, 6937 (1983).

nt sites 15. s. Scharf, unpublished data.16. R. Saiki et al., unpublished data.

as much 17. B. J. Conner et al., Proc. Natl. Acad. Sci.U.S.A. 80, 278 (1983).

18. V. J. Kidd, R. B. Wallace, K. Itakura, S. L. C.rethod to Woo, Nature (London) 304, 230 (1983).ea 19. R. M. Myers, N. Lumelsky, L. S. Lerman, T.cessanly Maniatis, ibid. 313, 495 (1985).

Stion site 20. Calculation of the amounts of BR328:PA need-'obes.In ed as standards to estimate PCR efficiency wasobes. done in the following way. If we assume that a

n of tar- human haploid genome size is 3 x 109 bp, 36 ngof DNA is equivalent to 1.8 x l0-8 pmol. The

he PCR extent of amplification after 20 cycles at, fortopically example, 85 percent efficiency is obtained withtoPicayY 0(1.8 x 1o-8) (1.8520) or 4.0 x 10-3 pmol of plas-arget se- mid DNA (Fig. 2B, lane 5).ed by a 20 September 1985; accepted 15 November 1985

SCIENCE, VOL. 230

5

1354

on

June

24,

201

2w

ww

.sci

ence

mag

.org

Dow

nloa

ded

from