anesthesia analgesia september 2009

Spend Time on Patients and Familiesor on Documentation?

Armand R. J. Girbes, MD, PhD*

Jan G. Zijlstra, MD, PhD†

Although it seems quite obvious that every aspect of medical care andtreatment needs good documentation, we all probably believe that ourdocumentation is insufficient from time to time. In daily practice, weobserve much more than we could ever document. Medical care of apatient is the result of interaction between the patient, the doctor, and themedical team, including nurses. This is clearly the most important anddecisive factor for the patient, yet it is a process that cannot be documentedeasily in round figures. A patient can receive perfect medical care, whereasthe documentation may have flaws.1

In this issue, Spronk et al.2 report on their review of charts of 347patients who died during intensive care unit (ICU) admission or shortlyafter discharge from the ICU. The authors focus on documentation aroundwithdrawal and withholding of treatment in two ICUs. A minority of 77patients died while receiving full life-support, and for 4 patients, arestriction in life-support order was already present on admission. For 206of the 266 patients who died after a change in life-support order, thepatient’s wishes regarding life support were not documented. In one thirdof the cases, it was not documented which staff physician was involved inthe end-of-life decision. However, although the involvement of the seniorstaff is not documented, it does not mean that, in reality, they were notinvolved (personal communication). The structure in both hospitals, withtraining of medical specialists, is such that in practice the staff is involvedin such decisions, provided that supervision of junior doctors is adequate.There is no evidence in the Spronk et al. report that data were insufficientto ensure patient care, although this was not investigated. The authorsdeserve much credit for their willingness to report a practice in theirhospital, which at first glance is not favorable.

Documentation is probably poor in many other (teaching) hospitals.However, in view of the importance of the subject, end-of-life decisions,one would not dispute that good quality documentation is required. Thechallenge is, of course, to find a solution. Because documentation is timeconsuming and in general doctors are under time pressure when perform-ing their clinical work, there is a constant competition between “write anddocument” and “treat the patient and talk to the patient and family.”Therefore, we should not document for the sake of documentation but firstdefine the purpose and then create the documentation system.

Documentation has several purposes. First, for immediate patient care,it helps in physician-to-physician communication, with transfer of medi-cally relevant information. This generally takes place during rounds in theICU, when every patient is discussed.3 Because of the fact that a range ofprofessionals are present at rounds simultaneously, different kinds ofcontributions are received. In addition to written information, oral infor-mation is supplied, which by nature can be more extensive. A system thatensures transfer of information is of paramount importance in intensivecare medicine. The goal of documentation is of course to improvecontinuity of care and to prevent loss of information. When a doctor handsover the care of a patient to another doctor, it is clear that to some extentinformation will be lost, no matter how good the documentation is. Inintensive care medicine, continuity of care is crucial, and an important

From the *Department of Intensive Care,University Hospital VU Medical Centre,Amsterdam; and †Department of IntensiveCare, University Medical Center Groningen,University of Groningen, Groningen, TheNetherlands.

Accepted for publication May 19, 2009.Address correspondence and reprint re-

quests to Armand R. J. Girbes, MD, PhD,Department of Intensive Care, VU MedicalCentre, P.O. Box 7057, 1007 MB Amsterdam,The Netherlands. Address e-mail to [email protected] or [email protected].

Copyright © 2009 International Anesthe-sia Research SocietyDOI: 10.1213/ane.0b013e3181af802c

Vol. 109, No. 3, September 2009 691

Editorial

aspect of this is transfer and thereby documentation ofpatient data, including considerations to institute orchange certain treatments, performance of diagnostictests, differential diagnostic considerations, provisionof information to the patient and family, and socialand ethical issues.

A second reason for documentation is to providehard data, mainly for surveillance and diagnosticpurposes. Nowadays, in the ICU, automated patientdata management systems make storage of manypatient data easy, and, for example, circulatory andrespiratory functions data are generated and docu-mented automatically. This is also true for treatmentsgiven, ventilator settings, perfusors for vasoactivedrugs, laboratory values, etc. However, even withautomated data collection, the physician must stillwrite down diagnostic and therapeutic considerations,discussions with the patient, and findings of physicalexaminations. One might expect important data re-garding the care of the patient to be recorded in thepatient record (electronic). The paper by Spronk et al.2

in this issue of Anesthesia & Analgesia demonstratesthat this is not the case. Whether the patient wasincapacitated at the moment of the end-of-life deci-sion, and which staff member was involved, waspoorly documented. Clearly, patient data manage-ment systems do not improve documentation of morecomplicated processes.

The third reason we record data is for qualityassurance. We want to evaluate whether processes are

performed in accordance with our standards. Andfourth, in an environment where legal issues andnotably legal blame plays a major role, written docu-mentation may also be collected for potential legaldefense against charges.

To determine whether documentation is insuffi-cient, we need to define which data, considerations,and (motivated) decisions are important enough to bedocumented. It would also be helpful then to define aminimum dataset. Once defined, action can be takento improve a possibly failing documentation system.

Lack of data does not mean that the process of careis of poor quality or is not performed according to thestandard but, to find that out, further research isrequired. To prevent lawsuits through documentationis an almost unreachable target. Documentation isimportant but should be performed without losingsight of the purpose.

REFERENCES

1. Kripalani S, LeFevre F, Phillips CO, Williams MV, Basaviah P,Baker DW. Deficits in communication and information transferbetween hospital-based and primary care physicians: implica-tions for patient safety and continuity of care. JAMA 2007;297:831–41

2. Spronk PE, Kuiper AV, Rommes JH, Korevaar JC, Schultz MJ.Practice of and documentation on withholding and withdrawinglife support: a retrospective study in two Dutch intensive careunits. Anesth Analg 2009;109:841–6

3. Pronovost P, Berenholtz S, Dorman T, Lipsett PA, Simmonds T,Haraden C. Improving communication in the ICU using dailygoals. J Crit Care 2003;18:71–5

692 Editorial ANESTHESIA & ANALGESIA

Not All Strikes Are Easy to Call

Michael G. Fitzsimons, MD, FCCP

Keith H. Baker, MD, PhD

The decision to enter the field of anesthesia after recovery from substanceabuse has been a controversy in the anesthesiology community. Theincidence of abuse has been estimated at 1% of faculty members and 1.6%of residents in training programs.1 This incidence is similar to that reportedby Ward et al.2 for the decade between 1970 and 1980. Unfortunately, deathor near-death is often the event which identifies the physician as asubstance abuser.1

The traditional view has been that recovery from substance abuse byanesthesiologists, particularly those who abuse opioids, is poor. Menk etal.3 demonstrated that only one third of residents who abuse opioidssuccessfully reenter the specialty of anesthesia. Collins et al.4 reported thatonly 46% of residents who returned to training ultimately completed theprogram. Fry5 reported that only 15% of residents were successful in theireffort to reenter the specialty of anesthesia. All of these studies areaccompanied by frequent death during relapse that range from 9% to 31%.These dismal statistics have led many in the anesthesia community to callfor either redirection of rehabilitated residents into lower-risk specialtiesor, more drastically, for the anesthesia leadership to adopt a “one strike,you’re out” policy.6

Drs. Skipper, Campbell, and DuPont7 are to be congratulated onproviding a major ray of hope with their article in this issue of the journal.They offer encouraging evidence in an area where the literature is highlypessimistic for the impaired anesthesiologist. Their 70% success rate forphysicians treated at state Physician’s Health Programs (PHPs) demon-strates that recovery is possible and even likely. Despite this finding,several aspects of their paper must be addressed.

The article reveals that only 16 of 42 PHPs participated in the study. Theprimary reasons for nonparticipation were lack of resources and/orregulatory impediments. The outcome rate for programs not participatingis unknown, but it is unlikely that programs which declined to participatebased on “lack of resources” would have outcomes as good as those thathave more resources. In 2007, the California State Auditor evaluated theMedical Board of California’s Physician Diversion Program and deter-mined that standards were not being met. On July 26, 2007, the MedicalBoard voted to close the program. There are no universal or federal standardsfor all programs and thus outcomes may vary by state. In all likelihood, wellfunded and organized programs have the resources to produce better results.

The American Medical Association Council on Mental Health recog-nized that treatment rather than discipline should be the goal for theimpaired physician. By 1980, nearly all state medical societies had autho-rized or implemented a physician treatment program. Well funded andorganized programs have developed better treatment models over theyears. The Oregon experience revealed that 75% of those who were treatedwere either stable or improved during an 8-yr follow-up.8 The Massachu-setts Medical Society’s Physician Health Service reported a 75% successrate as defined as “continuous or complete abstinence from any use ofalcohol or drugs for a minimum of 3 years.”9 The prior surveys by Menket al. and Collins et al. that document poor outcomes do not address whatwould have happened if the individuals had been referred to a physician’shealth service. They did not report whether a contract had been signed orwhether the physician was compliant with a monitoring program, all keys

From the Department of Anesthesia andCritical Care, Massachusetts General Hospi-tal, Boston, Massachusetts.

Accepted for publication April 23, 2009.Address correspondence and reprint re-

quests to Michael G. Fitzsimons, MD, FCCP,Department of Anesthesia and Critical Care,Massachusetts General Hospital, 55 FruitSt., Boston, MA 02114. Address e-mail [email protected].

Copyright © 2009 International Anesthe-sia Research SocietyDOI: 10.1213/ane.0b013e3181adc826


Editorial

to successful recovery. The major flaw in comparingthe data from Menk et al. and Collins et al. to thecurrent data is that residents were the primary sub-jects in the earlier papers, and yet this very populationwas appropriately excluded from the current reportbecause of small numbers. Extreme caution must betaken when generalizing the current results usingboard-certified anesthesiologists and applying thoseresults to residents. A resident must still negotiate thestressful period of training. After residency, the nas-cent graduate then has many more years of actualanesthesia practice and exposure to the same substancesto which he or she became addicted. Finally, the traineemay not have developed the professional support sys-tem that an older anesthesiologist has.

Anesthesiologists are frequently described as beingoverrepresented in PHPs.9,10 The assumption is oftenmade that this is due to a higher rate of substance abusedisorders among anesthesiologists. There is clearly afrequent incidence of death among substance-abusinganesthesiologists likely because of the high potency andlow therapeutic windows of such drugs, including opi-oids, propofol, and volatile anesthetics.11,12 We mayclassify any use of occupational drugs as substanceabuse or misuse because of our fear of death to theindividual. Nearly 20% of training programs have re-ported a pretreatment fatality.4

The authors compare multiple variables betweenanesthesiologists and other physicians in an attemptto find differences. They found that anesthesiologistsin treatment programs are more likely to abuse opi-oids and have a higher incidence of IV drug abuse, yetthey have a lower incidence of a positive drug screenwhile undergoing treatment. When a large number ofvariables is compared among groups, it becomesincreasingly likely that some difference will occurbecause of chance alone. In particular, with a signifi-cance value set to P � 0.05, we expect about 1 in 20 testitems to be “abnormal” even when there is no truedifference between groups. Fortunately, the mainfindings just mentioned were significant with P values�0.01 and thus likely represent trustworthy findings.Importantly, some of the measured variables maycovary. Take, for example, the finding that anesthesi-ologists are more likely to use narcotics and that theyare also more likely to use IV drugs. These findings areunlikely to be independent of each other and thus mayrepresent a single difference between anesthesiolo-gists and nonanesthesia physicians.

Questions remain as to the overall likelihood ofrecovery for an anesthesiologist who has engaged in

substance abuse. It is clear that trained anesthesiolo-gists who enter well-funded and supported PHPs andsign a contract including intensive monitoring have ahigh likelihood of recovery and return to successfulpractice. We are indebted to Skipper et al.7 for show-ing that a positive outcome can be obtained. Moreresearch is needed regarding the success of treatmentof residents and fellows who develop such disorders.

A simple “one strike, you’re out” policy whenapplied to all providers does not take into accountthese new data by Skipper et al. Their data focusedonly on anesthesiologists in practice. If addicted anes-thesia residents are referred to the same types ofphysician health service programs as studied by Skip-per et al. and complete a full course of treatment, theymay enjoy the same positive outcomes. We believethat residents in anesthesia without coexisting psychi-atric disorders, polysubstance abuse, and a familyhistory of substance abuse and who complete a PHPshould be considered for reentry into the specialty inconsultation with the resident’s addictionologist andpsychiatrist.

REFERENCES

1. Booth JV, Grossman D, Moore J, Lineberger C, Reynolds JD,Reves JG, Sheffield D. Substance abuse among physicians: asurvey of academic anesthesiology programs. Anesth Analg2002;95:1024–30

2. Ward CF, Ward CG, Saidman LJ. Drug abuse in anesthesiatraining programs: a survey—1970–1980. JAMA 1983;250:922–5

3. Menk EJ, Baumgarten K, Kingsley CP, Culling RD, Middaugh R.Success of reentry into anesthesiology training programs by resi-dents with a history of substance abuse. JAMA 1990;263:3060–2

4. Collins GB, McAlister MS, Jensen M, Gooden TA. Chemicaldependency treatment outcomes of residents in anesthesiology:results of a survey. Anesth Analg 2005;101:1457–62

5. Fry RA. Chemical dependency treatment outcomes of residents.Anesth Analg 2006;103:1588

6. Berge KH, Seppala MD, Lanier WL. The anesthesiology com-munity’s approach to opioid- and anesthetic-abusing personnel.Anesthesiology 2008;109:762–4

7. Skipper GE, Campbell MD, DuPont RL. Anesthesiologists withsubstance use disorders: a 5-year outcome study from 16 statePhysician Health Programs. Anesth Analg 2009;109:891–6

8. Shore JH. The Oregon experience with impaired physicians onprobation. JAMA 1987;257:2931–4

9. Knight JR, Sanchez LT, Sherritt L, Bresnahan LR, Fromson JA.Outcomes of a monitoring program for physicians with mentaland behavioral health problems. J Psychiatr Pract 2007;13:25–32

10. Talbot GD, Gallegos KV, Wilson PO, Porter TL. The MedicalAssociation of Georgis’s Impaired Physicians Program Reviewof the first 1000 physician: analysis of specialty. JAMA 1987;257:2927–30

11. Wischmeyer PE, Johnson BR, Wilson JE, Dingmann C, BachmanHM, Roller E, Tran ZV, Henthorn TK. A survey of propofol abusein academic anesthesia programs. Anesth Analg 2007;105:1066–71

12. Wilson JE, Kiselanova N, Stevens Q, Lutz R, Mandler T, Tran ZV,Wischmeyer PE. A survey of inhalational anaesthetic abuse inanaesthesia training programmes. Anaesthesia 2008;63:616–20


Barbarians at the Gate

Warren S. Sandberg, MD, PhD Anesthesiology is at a crossroads. In some settings compensationoutstrips revenue, supported by stipends to anesthesia groups fromhospitals. At the same time, the number of anesthesiologists relative todemand seems to be declining. According to a draft report by the RANDcorporation, there is an imminent shortage of anesthesiologists,1 and thiswill certainly exert further upward pressure on compensation. Meanwhile,government payers are signaling that reimbursements must decline. Whatwill be the outcome of this developing conflict?

In this issue of Anesthesia & Analgesia, Kheterpal et al.2 report the resultsof their most recent survey of workforce and finances in academicanesthesiology programs. Their notable findings are a continuing desire tohire more anesthesiologists into academic practice and another increase inthe subsidy from hospitals to anesthesia groups (now $109,000/year perfaculty full-time equivalent [FTE]) simply to maintain the status quo interms of filled faculty positions. The figure represents the differencebetween revenue per faculty FTE generated by the department and the costper faculty FTE borne by these same academic departments. One mightworry that this subsidy represents the salary support required to keep thedepartments staffed, although the data of Kheterpal et al. do not provecausation. However, this dismal state of affairs is distressing for obviousreasons; academic departments train the residents who are our future.Academic anesthesia departments do virtually all of the research inanesthesiology, and they provide much of the care for complex cases. Inthe continuing gap between compensation and revenue, one can discern aconcealed but fundamental challenge to anesthesiology, namely a disrup-tive change that could upend the foundational expectations about howanesthesia care is provided in the United States and perhaps elsewhere.

To understand this potential threat, one must understand the notion ofthe disruptive innovation.

Disruptive innovation was described in terms of products and thecompanies that make and buy them by Clayton Christensen in “TheInnovator’s Dilemma.”3 However, the construct also applies to medicalspecialties and the services they provide. Generally stated, any product hasa range of users who need differing degrees of performance from theproduct. This is certainly true in anesthesiology, where cardiac surgeons,for example, need more capabilities from their anesthesiologists thansurgeons who specialize in minor outpatient procedures. Companies thatmake the most capable, reliable (i.e., high performance) products meet theneeds of the high-end users who demand the most from such products.Such high-end customers are willing to pay high margins for performance,and thus are the company’s best customers. Successful companies improvetheir products by responding to the needs of their high-end customers andseeking the most profitable opportunities.

Figure 1 demonstrates, in graphic terms, the general relationshipbetween the performance demanded from products by high-end users andthe capabilities achieved by the makers of such products. Requiredperformance of a product, technology (or medical specialty) is shown astwo parallel lines on Figure 1. The upper line indicates the capability andperformance required to meet the needs of the most demanding users. Thelower line represents the capabilities required to meet the most basic needsof the users of a given product. The shaded zone between the lines

From the Department of Anaesthesia,Harvard Medical School; and Department ofAnesthesia and Critical Care, MassachusettsGeneral Hospital, Boston, Massachusetts.

Accepted for publication May 18, 2009.Supported by department funds of the

Department of Anesthesia and Critical Care,Massachusetts General Hospital.

Address correspondence and reprint re-quests to Warren S. Sandberg, MD, PhD,Department of Anesthesia and Critical Care,Massachusetts General Hospital, 55 FruitSt., Jackson 4, Boston, MA 02114. Addresse-mail to [email protected].

Copyright © 2009 International Anesthe-sia Research SocietyDOI: 10.1213/ane.0b013e3181af803e


Editorial

represents the continuum between the minimum nec-essary and the highest required performance.

Through diligence in attending to customer needsand investment in research, products almost alwaysevolve as fast as or a little faster than the needs of themost demanding customers. Or, from a different per-spective, there will always emerge a customer whocan use all of the available capability in the bestexample of a product and will be willing to pay highmargins. Companies aggressively pursue improvedcapabilities in their products to meet the needs of theirbest customers, illustrated by the top pointed line inFigure 1. They do this by pursuing a course ofsustaining innovation, wherein the product’s capabili-ties steadily improve, but still the core product itselfcontinues to resemble the original on the dimensionsof performance that the vast majority of users careabout. Reflection on the history of technological, edu-cational, and scientific development in anesthesiologyindicates that the specialty has been on a steady courseof sustaining innovation since its inception.

At the other end of the continuum, low-end usersare often problematic for makers of high-end prod-ucts. If there is more than one potential supplier ofproducts who meet low-end customers’ needs, then allof the suppliers must compete on price, and profitmargins must be low. In other words, for theselow-end users, the product is simply a commodity forwhich the key distinction is price, rather than perfor-mance. Certainly, commodity users are not willing topay a premium for increased capabilities that they donot need. Protecting their own financial interests,commodity customers are always on the lookout for away to get their needs met for a lower cost.

Occasionally, a new, different technology appearsin the market that just meets the needs of the com-modity users of the original technology. If the price isright, the low-end users will switch to the new, lesscapable technology. Initially, everyone is happy, in-cluding the purveyors of the original product. The

new technology cannot compete at the high or eventhe middle end of the market, so it is not an obviousthreat. Getting rid of the low-end commodity customersfrees the industry leaders to focus on best meeting theneeds of its high margin, high-end user customers.

Over time, performance of new technology im-proves as it follows its own path of sustaining inno-vation, illustrated by the lower pointed solid line inFigure 1. If the price continues to be right, the newtechnology or product begins to take customers fromthe industry leader as its own capabilities inevitablyimprove. Eventually, the new technology captures theentire market.

To see how this analogy might apply to anesthesi-ology, consider the two curves in Figure 1 to be theskills and knowledge required to give anesthesia forliver transplantation (top curve) and laparoscopiccholecystectomy (bottom curve). I chose these ex-amples because they happen to be the two proceduresthat I do frequently, and so considering these maylessen the offense that could be given by presuming toestablish more general hierarchies of difficulty inanesthesia practice. Through improved technology,training, and education, including subspecialty fel-lowships, the field of anesthesiology readily producesgraduates who, as a group, are more than capable ofhandling the toughest liver transplant cases and forwhom the laparoscopic cholecystectomy is merechild’s play.

What do we have to worry about? In advisingwould-be disruptive innovators where to look foropportunities, Christenson suggests looking for “jobsto be done” that are not currently well covered bycurrent solutions. The Kodak FunSaver Camera isgiven as an example: at a time when film photographywas being replaced by increasingly capable digitalcameras, no one expected these buy-at-the-drugstoredisposable cameras to be very successful. However,they provided a cheap way to take snapshots at amoment’s notice, after which the user just dropped the

Figure 1. Relationship between theperformance demanded from prod-ucts by high-end users and the capa-bilities achieved by the makers ofsuch products. Adapted from Ref. 3,with permission from Harper CollinsHarvard Business School Press.


whole thing off to be developed. The job to be donewas on-demand photography. The FunSaver was astep on the pathway to the true disruptive innovationthat allows on-demand, anytime snapshots: the digitalcamera that is ubiquitously present in the equallyubiquitous mobile phone. Analogously, there are nu-merous “jobs to be done” wherein patients haveprocedures entailing some form of discomfort orphysiologic perturbation, for which anesthesiologistsare not a perfect fit. This is not to say that anesthesi-ologists cannot do these cases, but rather that themultispecialty, fellowship-trained anesthesiologist isnot analogous to the FunSaver or the phone camera.We are completely capable of performing these cases,but we bring too large a “tail” of complexity, equip-ment, expectations, and, above all, cost. Low-end con-sumers of anesthesia services regard the ability to safelyproduce a deeply sedated or anesthetized patient who ishappy at the end of the procedure as a commodity,where the key differentiators—compensation and fitwith the procedure area workflow—boil down to cost.

The current commodity users of anesthesia servicesare ready for a solution that better meets their needs, andthe products, technologies, and services that could pro-vide this solution are already visible, albeit faintly.

Consider the case of fospropofol. The initial mar-keting plan for this drug was as an alternative topropofol that could be administered by nonanesthesi-ologists for use during uncomfortable diagnostic andtherapeutic procedures. Reasoning that the activeagent would have the same risk profile as IV propofol,the American Society of Anesthesiologists encouragedthe Food and Drug Administration to apply the samewarning requiring administration by clinicians withexpertise in airway management (i.e., anesthesiolo-gists) as is found on the label for propofol.* This wasprobably the right position to take in the currentenvironment, given the capabilities of alternativepractitioners, devices, etc., for managing the airway inaccidentally oversedated patients. But the importantlesson is that proceduralists want to have a drug suchas fospropofol that they could use without an anes-thesiologist. Some aspect of current anesthesiologypractice and management of the procedural suite isnot meeting the needs of the proceduralists. There areunmet needs for anesthesia care in the segments of themarket that are not commonly regarded as centralcustomers of anesthesia services.

Other potentially disruptive technologies havebeen demonstrated. For example, Bispectral Index-mediated closed loop control of isoflurane4 or propo-fol5–7 provides better performance on some metricsthan human operators. Similar demonstrations ofclosed loop control for muscle relaxants have beenpublished.8 Web searching the term “McSleepy”

reveals some eye-opening text, images, and video.Others are developing automated methods to alertclinicians of developing hemodynamic perturbations.9

None of the developers of these technologies is pro-posing that they replace the anesthesiologist in theoperating room (OR). That suggestion will come fromthe financial stakeholders in anesthesia care.

Anesthesiologists are expensive. The total annualcost of an academic anesthesiologist reported byKheterpal et al. is $605,000. Academic programs areunable to generate enough revenue to cover thiscompensation, in part because academic surgical casesare long and ORs are not optimally utilized.10,11 Anincrease in the number of anesthetizing locations overthe past decade means that the relative number ofavailable providers decreases, and compensation mustincrease to ensure service. Of course, this scenario alsomotivates a search for less expensive alternatives.

Current trends in anesthesiology employment andeducation do not bode well for efforts to control costs.Because of the down economy with less hiring bypractices, recent graduates are flocking to fellowships,furthering the process of subspecialization. This in-creases the trainees’ capabilities, with an attendantincrease in the compensation they can command as abenefit of subspecialty certification. If the RANDforecasts prove accurate, these highly qualified indi-viduals will be negotiating compensation amid ascarcity of providers. The field of anesthesiology isaggressively moving upmarket. Although this seemsfinancially exciting for anesthesiologists, it amplifiesthe pressure for the users of more basic (or “commod-ity”) anesthesia services to find an alternative sourceof anesthesia care for their patients.

If a less expensive, albeit less capable but stillsufficient, alternative becomes available, will com-modity users of anesthesia care pay extra for thesuper-capable product? Experiences from other indus-tries say no. Ongoing rising cost of the availablehigh-end product will motivate the search for lowercost alternatives and whet the payers’ appetites forimplementation. “Less expensive” does not mean cer-tified registered nurse anesthetists, who are compa-rable with anesthesiologists in many ways, includingcost, but rather a nonanesthesiologist alternative wayto provide what is essentially anesthesia care. Onedoes not need to look very far to see potential replace-ments. Critical care nurses are essentially providinganesthesia when they transport an intubated, venti-lated, sedated, and pressor-dependent patient fromthe intensive care unit for a diagnostic procedure, forexample. There are also the technological develop-ments mentioned earlier.

The very number of such emerging new technolo-gies, pharmaceuticals, and proposed alternatives toanesthesiologists as providers should sound the alarmthat there is something wrong with the way thespecialty currently serves its commodity users. In-stead, all parties appear happy to find ways for

*Available at: http://www.asahq.org/Washington/ASAfospropofolcomments4-23-08.pdf for full text of the written comments tothe FDA. Accessed May 13, 2009.

Vol. 109, No. 3, September 2009 © 2009 International Anesthesia Research Society 697

anesthesiologists to get out of the commodity end ofthe market. This is a big mistake for anesthesiologists.Business history has countless examples of companiesthat abandoned a low-yield market sector to a disrup-tive technology only to be knocked off completelysome years later by the very same “low-end” innova-tion. The problem is that the seemingly limited perfor-mance technology, product or service will inevitablybecome more capable. It will only be a matter of timebefore McSleepy can handle maintenance for basicgeneral anesthetics and then more complex ones. Thecontinuing move upmarket is painting anesthesiologyinto a corner. If an alternative care model or technol-ogy that allows nonanesthesiologists to produce anes-thetized patients gains acceptance, the specialty ofanesthesiology will face a choice: contract the bound-aries of our practice, leaving behind the simpler cases,or find ways to compete more effectively for the lowerend of the anesthesia market. This is an opportunity toleverage technology to become more efficient in ouruse of personnel and their intellect. Seizing this op-portunity implies that we should regard technologies,such as anesthesia information management systems,decision support tools, closed-loop control for drugadministration, as well as new care team models as thetopics of enthusiastic research and development.Choosing this course moves OR and procedure roomanesthesiology closer to the model used in intensivecare units, where anesthesiologists assure that care isprovided, but only personally provide care when theirunique skills cannot be replaced.

It is tempting to raise the objection that the practiceof medicine is not subject to the same kinds of marketforces and disruption that sent silver-halide film tojoin the dinosaurs, and this is to a limited degree true.State regulations, the label warnings on anestheticdrugs, liability risk, and hospital policies all provideinertia that slows the rate of change in who and whatcan provide anesthesia to the point that change isalmost imperceptible. However, with sufficient incen-tive to alter the status quo plus a little luck, anesthe-siologists’ protected status can be altered by the strokeof a pen, as evidenced by the gubernatorial opt-outprovision from physician supervision of nurse anes-thetists, published in 2001. Cost, protectionism, andunmet needs provide the incentive for change. Theconsidered position taken by the specialty over inno-vations such as fospropofol could be seen as protec-tionist or obstructive. Embracing new technologies assomething that enables anesthesiologists to do morewith fewer people sends a completely different mes-sage than does opposing technological development.

Kheterpal et al.2 publish a simple observation, butone that should trouble us. Compensation and hospi-tal support to anesthesiology departments cannot con-tinue to increase forever in the face of determination to

reduce health care costs. But there is not much historyof high-end producers voluntarily decreasing theprice of their flagship product. Instead, the product isreplaced by an upstart. How to avoid this fate is notcompletely clear. Anesthesiologists should strive to befacilitators of patient care and patient flow in allenvironments. When departments receive supportfrom hospitals, the reasons for giving the supportshould be explicitly agreed upon, and the work to bedone specified so that the value in exchange to cost iswidely understood.12 Anesthesiologists can performmany nonclinical value-added activities that benefitthe hospital and its patients. Just as it is appropriatefor these to be compensated, so too should depart-ments that receive subsidies be visible throughout thefacility performing these important nonclinical orga-nizational and leadership functions.

Figure 1 should always be in our minds. Newtechnologies, some of them disruptive, will alwayscontinue to appear and challenge our status quo.Occasionally, these can apparently be beaten back. In2005, a robot called Penelope worked as the scrubtechnician during a live surgery on a patient at NewYork Presbyterian Hospital.† The robot functionedwithout an operator, recognizing the instruments op-tically and responding to voice commands. This eventprovoked one trade publication to run the headline“Controversial robotic arm tested” on its front page.13

The new technology was received rather coolly by ORpersonnel. Fast forward to 2009 and one finds thedevice now positioned for use in the central steriliza-tion area, where its optical instrument recognition,counting accuracy, speed, and unbeatable duty cycleare to be used in instrument picking, counting, and kitpacking. This clever strategy gives the robot a place inthe workflow to grow and develop along its sustain-ing pathway. Eventually it will make it into the OR.

REFERENCES

1. Byrd J, Peterson MD. The ghost of study past: new RANDstudy shows shortage of anesthesiologists. ASA Newsl2009;73:39 – 40

2. Kheterpal S, Tremper KK, Shanks A, Morris M. Seventh andeighth year follow-up on work force and finances of the UnitedStates anesthesiology training programs: 2007 and 2008. AnesthAnalg. In press

3. Christensen CM. The innovator’s dilemma. New York: HarperCollins, 1997

4. Locher S, Stadler KS, Boehlen T, Bouillon T, Leibundgut D,Schumacher PM, Wymann R, Zbinden AM. A new closed-loopcontrol system for isoflurane using bispectral index outperformsmanual control. Anesthesiology 2004;101:591–602

5. Absalom AR, Kenny GN. Closed-loop control of propofolanaesthesia using bispectral index: performance assessment inpatients receiving computer-controlled propofol and manuallycontrolled remifentanil infusions for minor surgery. Br J An-aesth 2003;90:737–41

6. De Smet T, Struys MM, Neckebroek MM, Van den Hauwe K,Bonte S, Mortier EP. The accuracy and clinical feasibility of anew bayesian-based closed-loop control system for propofoladministration using the bispectral index as a controlled vari-able. Anesth Analg 2008;107:1200–10

†For reference, see http://www.nsf.gov/news/news_summ.jsp?cntn_id�104259. Accessed May 13, 2009.


7. Struys MM, De Smet T, Versichelen LF, Van De Velde S, Vanden Broecke R, Mortier EP. Comparison of closed-loop con-trolled administration of propofol using Bispectral Index as thecontrolled variable versus “standard practice” controlled ad-ministration. Anesthesiology 2001;95:6–17

8. Edwards ND, Mason DG, Ross JJ. A portable self-learning fuzzylogic control system for muscle relaxation. Anaesthesia 1998;53:136–9

9. Ansermino JM, Daniels JP, Hewgill RT, Lim J, Yang P, BrouseCJ, Dumont GA, Bowering JB. An evaluation of a novel softwaretool for detecting changes in physiological monitoring. AnesthAnalg 2009;108:873–80

10. Abouleish AE, Dexter F, Epstein RH, Lubarsky DA, WhittenCW, Prough DS. Labor costs incurred by anesthesiology groupsbecause of operating rooms not being allocated and cases notbeing scheduled to maximize operating room efficiency. AnesthAnalg 2003;96:1109–13; table of contents

11. McIntosh C, Dexter F, Epstein RH. The impact of service-specific staffing, case scheduling, turnovers, and first-case startson anesthesia group and operating room productivity: a tutorialusing data from an Australian hospital. Anesth Analg 2006;103:1499–516

12. Dexter F, Epstein RH. Calculating institutional support thatbenefits both the anesthesia group and hospital. Anesth Analg2008;106:544–53; table of contents

13. Dunbar C. Controversial robotic arm tested: device responds tosurgeon’s voice commands for instruments. AORN Connections2005;3:1,4


Cardiovascular AnesthesiologySection Editor: Charles W. Hogue, Jr.

Perioperative Echocardiography andCardiovascular EducationSection Editor: Martin J. London

Hemostasis and Transfusion MedicineSection Editor: Jerrold H. Levy

Lipopolysaccharide Evokes Resistance to ErythropoiesisInduced by the Long-Acting Erythropoietin AnalogueDarbepoetin Alfa in Rats

Peter Brendt, MD*

Ariane Horwat*

Simon T. Schafer, MD*

Sven C. Dreyer, MD*

Joachim Gothert, MD†

Jurgen Peters, MD*

BACKGROUND: Anemia is common in patients with sepsis but its mechanism isunknown. We tested the hypothesis that effects on erythropoiesis evoked bydarbepoetin alfa (DA), a long-acting erythropoietin analog, are diminished bylipopolysaccharide (LPS).METHODS: We performed a prospective, controlled, randomized animal study (maleLewis rats n � 44). The interventions we used were intraperitoneal injection ofEscherichia coli LPS (10 mg/kg) or vehicle followed by either DA (25 �g/kg) orvehicle (four experimental groups). Blood and reticulocyte counts and variables ofiron metabolism were measured at baseline and 3 and 14 days after interventions.RESULTS: Animals treated with DA alone showed an eightfold increase in reticulo-cyte count from baseline on Day 3, whereas no increase was seen in animalsadministered LPS or LPS/DA. On Day 14, the red blood cell count and hemoglobinconcentration had increased by approximately 10% from baseline (P � 0.001) in theDA group but had decreased after LPS on Days 3 and 14 (P � 0.05) and in animalsadministered LPS/DA. Consumption of iron was seen on Day 3 in the DA groupbut not after LPS or LPS/DA combined. Values of ferritin and transferrin did notchange between groups.CONCLUSION: LPS abolishes erythropoiesis and iron use evoked by DA and this isaccompanied by a decrease in hemoglobin concentration and red blood cellconcentration. Accordingly, endotoxin suppresses DAs ability to increaseerythropoiesis.(Anesth Analg 2009;109:705–11)

Ninety-five percent of intensive care patients sufferfrom anemia within 3 days of their intensive care unit(ICU) admission and 44% receive packed red bloodcells.1 Although mechanisms of anemia vary and includethe primary disease (e.g., bleeding) and blood loss due tophlebotomy,2 anemia can be a risk factor for morbidityand mortality, especially in patients with cardiac dis-ease.3 Of interest, patients with sepsis usually have ahemoglobin concentration lower than other patientsadmitted to the ICU and its concentration continues todecrease,4 so that septic patients are more likely torequire packed red blood cell transfusion.4

Production of red blood cells in the bone marrow isgenerated by pluripotent stem cells and is tightly

regulated by erythropoietin (EPO), the main hemato-poietic growth factor. EPOs interaction with red bloodcell precursors is mediated by the cellular EPO recep-tor resulting by up-regulation of the antiapoptoticprotein Bcl-xL in progenitor cells in an increase in thenumber of peripheral red blood cells.5,6 The signaltransduction cascade distal to the EPO receptor in-cludes signal transducer and activator of transcrip-tion 5, Ras/mitogen-activated protein kinase, andphosphoinositide-3 kinase/Akt pathways, which hasbeen studied in depth.7,8

Since its introduction into clinical practice nearlytwo decades ago, EPO has rapidly become a principledrug to treat anemia. Darbepoetin alfa (DA), an EPOanalog with modified glycosylation and a threefoldlonger circulating half-life than pharmacologic EPO,stimulates erythropoiesis in the same manner asendogenous EPO.9,10 Lipopolysaccharide (LPS) stimu-lation decreases erythropoiesis in rats because of re-duced EPO synthesis.11 However, in patients withseptic shock, the endogenous serum EPO concentra-tion is increased,12,13 apparently independent of thehemoglobin concentration.13 No relationship or anegative relationship was observed between serumEPO levels and blood hemoglobin concentrations inseptic patients.14 This raises the question whether

From the *Klinik fur Anasthesiologie und Intensivmedizin;Universitat Duisburg-Essen; and †Klinik fur Hamatologie, Univer-sitatsklinikum Essen, Universitat Duisburg-Essen, Essen, Germany.

Accepted for publication March 29, 2009.This work is attributed to the Klinik fur Anasthesiologie und

Intensivmedizin, Universitat Duisburg-Essen, UniversitatsklinikumEssen, Essen, Germany.

Address correspondence to Dr. Peter Brendt, Klinik fur Anasthesi-ologie und Intensivmedizin, Universitatsklinikum Essen, Hufelandstr.55, Essen D-45122, Germany. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181adc80f


sepsis/endotoxinemia per se can interfere with eryth-ropoiesis and alter the response to erythropoietic growsfactors. Because relevant information is not available, wetested the hypothesis that LPS alters the erythropoieticeffects of DA in an animal model.

METHODSThis study was conducted in accordance with Ger-

man governmental regulations complying with the Eu-ropean Community guidelines for the use of experimentalanimals. The experimental protocol was approved by thelocal animal care committee, and animals were treated inaccordance with the guidelines of the American Physio-logical Society and the Guide for the Care and Use ofLaboratory Animals (National Institute of Health publi-cation 85–23, revised 1996). Male Lewis rats weighing300–480 g (Harlan-Winkelmann, Borken, Germany)were kept in accordance with animal welfare guidelinesand supplied ad libitum with commercial rat chow andtap water.

Experimental PreparationIn this randomized study including four experi-

mental groups, we examined the effect on erythropoi-esis of DA or vehicle in a sepsis-like condition asinduced by Escherichia coli LPS (serotype O127:B8,Sigma-Aldrich, Taufkirchen, Germany). At baseline,orbital sinus blood (approximately 0.8 mL) wassampled from every rat during a brief isofluraneanesthetic. After this procedure, the animals wererandomized to the four treatment groups. Animalsreceived either LPS (10 mg/kg in 500 �L of saline) or500 �L pyrogen-free saline (IP). Immediately after LPSor saline injection, either DA 25 �g/kg or 500 �Lpyrogen-free saline was injected IP. Seventy-six hoursand 14 days later blood samples were drawn again, aspreviously described.

MeasurementsBlood Count and Reticulocyte CountImmediately after blood withdrawal values of hema-

tological variables (hemoglobin concentration, hemato-crit, erythrocyte, leukocyte, and platelet counts, meancorpuscular hemoglobin, mean corpuscular volume[MCV], mean corpuscular hemoglobin concentration)were measured using a dedicated animal hematologyautoanalyzer (Scil Vet abc HamatologieTM, Scil AnimalCare Company GmbH, Viernheim, Germany).

For measurements of reticulocyte count, blood wasstained with brilliant cresyl blue (Merck, Darmstadt,Germany) mixing 25 �L of blood and 25 �L of brilliantcresyl blue solution. After 20 min of incubation, a thinsmear was prepared on a microscope slide and al-lowed to dry in air for 30 min. Reticulocytes were thencounted by two examiners (blind to allocation of theanimals to experimental groups) using oil immersionand a 1000-fold magnification (H600 Hund GmbH,Wetzlar, Germany), results averaged, and reticulocyte

count was expressed in relation to 1000 counted redblood cells.

Free iron concentration was measured by spectro-photometry in heparinized plasma after reduction tothe ferrous form and complexation with ferrozine(ADVIA 1650 colorimetric test apparatus, Bayer AG,Leverkusen, Germany). In addition, ferritin and trans-ferrin plasma concentrations were measured in heparin-ized plasma using a nephelometer (BN2, Dade Behring,Marburg, Germany) and a commercially available stan-dard kits (Dade Behring, Marburg, Germany).

Statistical Design and AnalysisData are expressed as means � sd and statistical analy-

ses were performed with SPSS13.0 (SPSS, Chicago, IL).An a priori power analysis was performed with the

software G*Power 3.0.10. We determined the groupsize required to detect differences in reticulocytecounts in response to interventions after 3 days (effectsize: 1; �-error: 0.05; power: 0.95). The mean of thecontrol group for reticulocyte concentration was set as11.6‰, based on values in the literature,15 with astandard deviation of 3.6. We looked for an increase inreticulocyte concentration with DA to at least 15.Using these data, the calculated sample size was 24(4 � 6). To improve our margin of safety, we increasedthe number of animals.

We expected that 30%–40% of the rats treated withLPS or LPS/DA would die but none of the animalsreceiving DA or placebo. To account for these losses,we therefore a priori increased the number of animalsin the two former groups. Accordingly, we designedand started the experiments with 44 animals (vehiclen � 8, DA n � 8, LPS n � 14, LPS/DA n � 14) pergroup in a randomized fashion. Specifically, rats wereselected at random from cages by an animal caretechnician not otherwise involved in the experimentsand later randomly assigned to prefilled syringescontaining drugs for treatment.

As expected, animals in the groups treated withLPS or LPS/DA died (n � 5 in both groups). This leftnine surviving rats in these groups (mortality 36%),one more than the presumed required group size. Inthe vehicle group, one rat showed baseline values ofreticulocyte count and hemoglobin above the twofoldSD of the other animals and hence was not used in thedata analysis. Changes of values of variables frombaseline over time (within group) were tested with thegeneral linear model for repeated measurements andpairwise comparisons. Differences in mean values ofchanges from baseline among groups were deter-mined using the general linear model (SPSS) usingunivariate analysis, analysis of covariance, and pair-wise comparisons, with factors for treatment andbaseline values as covariate (analysis of covariance).The following a priori null hypotheses were tested:there are no differences in values of variables (1)among groups after 3 days of treatments, (2) withintreatment groups between baseline and after 14 days

706 Endotoxin Suppresses Erythropoiesis ANESTHESIA & ANALGESIA

(recovery) of treatments, and (3) over time betweenthe control (vehicle) group and treatment groups.Statistical significance was assumed with an �-errorP of �0.05.

RESULTSGeneral Effects of LPS and DA

Rats receiving LPS, combined with DA or vehicleadministration, developed signs of sepsis, such asdiarrhea, piloerection, and lethargy, whereas animalsadministered vehicle or DA did not. Furthermore, 3days after the application of LPS, the platelet count haddecreased by approximately 70% (P � 0.0001) in both theLPS/vehicle and the LPS/DA groups. This sepsis-likecondition persisted for 5 to 7 days, and surviving ani-mals thereafter returned to normal conditions.

None of the animal died as a consequence of DA orvehicle administration during the observation period.In contrast, in the LPS/DA and the LPS/vehiclegroups five rats died in each group leaving nine ratsfor data analysis in the LPS/DA and LPS/vehiclegroups. All animals in the LPS/DA group died beforeblood withdrawal on Day 3 (on Days 3, 2, 3, 2, 2). Inthe LPS/vehicle group, three rats died before Day 3

(on Days 2, 2, 3), one rat during blood withdrawal onDay 3, and another rat died on Day 9. These rats wereparticularly lethargic and showed diffuse internalbleeding on gross postmortem examination.

Effects on Erythropoiesis of LPS, LPS/DA, DA,and Vehicle

Rats that received DA alone showed a markedincrease in reticulocyte count (Fig. 1), both whencompared with the other groups on Day 3 and whencompared with baseline (P � 0.001). This profoundeightfold increase in reticulocyte count after DA wascompletely abolished by the administration of LPS inthe LPS and the LPS/DA groups. Consequently, after14 days, the red blood cell concentration increased by11.9% in the DA group (P � 0.05, Fig. 2). In contrast, inthe LPS and the LPS/DA groups, red blood cellconcentration slightly decreased on Day 3 and after 14days compared with the vehicle group (P � 0.05).

The hemoglobin concentration in the LPS and theLPS/DA groups decreased by 13.8% � 9.8% and 8.2%% 7.3% within 3 days, respectively and remainedlower than the vehicle and DA groups (P � 0.05). Thehemoglobin concentration remained unchanged over

Figure 1. Effect of darbepoetin alfa (DA), lipopolysaccharide (LPS), LPS/DA combined, and vehicle on reticulocyte count atbaseline and on days 3 and 14. DA markedly increased the reticulocyte count on Day 3 and this effect had vanished on Day14. This effect on erythropoiesis by DA was abolished by LPS. Data represent individual values and means. *P � 0.05compared with vehicle and to baseline.


the observation period in vehicle-treated rats. In con-trast, in the DA group the hemoglobin concentrationhad increased by 8.8% � 5% on Day 14 (P � 0.005,Table 1).

Red blood cells in LPS and LPS/DA-treated ani-mals had an increased (P � 0.006) volume (meandifference: �3.5 fL and � 3.1 fL for LPS and LPS/DA,respectively) compared with vehicle on Day 14. Ani-mals treated with DA alone showed an increase inMCV versus baseline and the other groups (meandifference: �5 fL) on Day 3 (P � 0.05). For all groupsduring the observation period, MCV and mean cor-puscular hemoglobin are shown in Table 1.

Effect on Iron Metabolism of LPS, LPS/DA, Vehicle,and DA

The iron concentration on Day 3 was lower in theDA group than in the other groups (P � 0.001) and86% � 15% lower when compared with its baseline(P � 0.001). In contrast, iron did not decrease afteradministration of LPS alone or LPS in combinationwith DA when compared with the baseline values.

There were no differences in values of ferritin andtransferrin among vehicle, LPS, and LPS/DA groupson Days 3 and 14. However, the ferritin values in LPS,

LPS/DA, and DA-treated rats increased in each groupover time (P � 0.05).

DISCUSSIONOur findings demonstrate that LPS abolishes eryth-

ropoiesis and iron utilization evoked by DA and this isaccompanied by a decrease in hemoglobin concentra-tion and red blood cell concentration after LPS admin-istration. Accordingly, endotoxin suppresses DAsaction with an inability to evoke erythropoiesis. Thesedata suggest that endotoxin mediates suppression ofthe erythropoietic activity of endogenous EPO.

An advantage of using IP LPS injection as anexperimental model is that many effects of LPS arewell known, the model is standardized, and for ap-proximately 6 days LPS injection results in a diseasestate similar to human sepsis. Conversely, sepsis islikely not confined to LPS alone and findings might bedifferent in humans with prolonged sepsis or forms ofsepsis not involving endotoxin. Furthermore, the tim-ing and characteristics of cytokine secretion after LPSadministration may differ among different species aswell as among patients with sepsis.16,17 The mortalityrate (36%) seen in our experimental setting closely

Figure 2. Effect on red blood cell concentration of darbepoetin alfa (DA), lipopolysaccharide (LPS), LPS/DA combined, and vehicleat baseline, and on Days 3 and 14. Although DA had increased red blood cell concentration on Day 14, both LPS and LPS/DAgroups showed a decreased red blood cell concentration on Days 3 and 14. Data represent individual values and means. *P � 0.05compared with vehicle. #P � 0.05 compared with baseline.


mirrors the outcome of septic shock in humans.18 Inany case, LPS affects and disrupts numerous physi-ologic pathways and cytokine production. Therefore,the effect seen in our study could be a result of thesemanifold changes and potential mechanisms need tobe explored on a cellular and molecular level. Never-theless, our animal model proved useful for demon-strating LPS-mediated interference with activity of DAand could be used for further investigations into themechanisms of anemia accompanying sepsis.

After LPS administration, we found abolition of DAserythropoietic effect despite treatment with a DA dose of25 �g/kg, i.e., a dose resulting in an eightfold increase inreticulocyte count in the DA alone group. However, wedid not establish a dose-effect relationship and this verylarge dose of DA used could still have been too small toalter LPS-evoked suppression of erythropoiesis.

There are several general explanations for the de-crease in hemoglobin concentration seen after LPSadministration in our experiments. On one hand, LPScould decrease red blood cell and hemoglobin concen-tration by shortening red blood cell survival. On theother hand, LPS could directly interfere with erythro-poiesis. Although we are not aware of data showingdecreased red blood cell survival in LPS-evoked septicstates, LPS is able to bind to human erythrocytes andreduce their deformability,19 which could shorten redblood cell survival.

Our data, however, strongly suggest decreasederythropoiesis as the major cause, because DA, spark-ing erythropoiesis in vehicle animals, was unable to

initiate erythropoiesis and increase reticulocyte con-centration when given together with LPS. This arguesfor LPS to inhibit erythropoiesis at some stage. This isfurther supported by the observation that the ironconcentration decreased after DA administrationassociated with an increased reticulocyte count indica-tive of erythropoiesis but did not change after admin-istration of either LPS or LPS/DA. Thus, after LPSadministration, the bone marrow was unable to pickup iron and use iron when stimulated by this largedose of DA.

Several mechanisms, alone or in combination, couldbe responsible for this, such as impaired proliferationof erythroid precursor cells due to changes in thecomplex balance among apoptosis, transcriptional,and epigenetic controls over the differentiation state,decreased expression of EPO receptors, perturbedDA/EPO signal transduction, decreased release of cellsinto the circulation, or cytotoxic effects on hematopoieticcells of LPS or cytokines.

Anemia, often seen in sepsis, may result from adisturbed iron homeostasis. Decreased serum iron andtransferrin concentration are the hallmark of anemiaof chronic disease and the ferritin concentration isnormal or increased.20 In volunteers, however, injec-tion of a tiny dose of LPS (2 ng/kg) evoked a decreasein serum iron concentration for 22 h, whereas theferritin concentration remained unchanged.21 In ourexperiments, we saw significant changes of iron-related metabolism. First, we found increased ironconsumption after administration of DA alone but not

Table 1. Effect of DA, LPS, LPS/DA Combined, and Vehicle on Hematological and Iron Metabolism Variables at Baseline and onDays 3 and 14

Vehicle (n � 7) LPS (n � 9) DA (n � 8) LPS/DA (n � 9)Hemoglobin (g/dL)

Baseline 15.3 � 1.5 15.9 � 0.8 15.9 � 0.5 15.7 � 1.0Day 3 15.3 � 0.4 13.6 � 1.4*† 16.0 � 0.6 14.4 � 0.7*†Day 14 15.2 � 0.9 14.8 � 0.5*† 17.3 � 1.0*† 14.7 � 0.8*†

Mean corpuscular hemoglobin (pg)Baseline 16.2 � 1.7 17.3 � 0.5 17.1 � 0.4 17.1 � 1.1Day 3 17.2 � 1.1 17.5 � 0.9 18.1 � 1.1 17.2 � 0.8Day 14 16. � 0.8 17.3 � 0.7* 16.6 � 0.5 16.7 � 0.6

Mean corpuscular volume (fL)Baseline 48.6 � 2.3 50.3 � 0.9 50 � 1.2 49.3 � 1.8Day 3 48.1 � 2.4 49.8 � 1.1 53.1 � 1*† 48.9 � 1.6Day 14 47.1 � 1.1 50.7 � 2.1* 49.1 � 0.6 50.2 � 2.1*

Free iron plasma concentration (ug/dL)Baseline 193 � 26 260 � 62 234 � 33 261 � 56Day 3 223 � 44 238 � 45 61 � 42*† 169 � 48Day 14 221 � 33 250 � 33 269 � 62 266 � 55

Transferrin plasma concentration (g/L)Baseline 0.92 � 0.32 0.71 � 0.29 0.79 � 0.266 0,88 � 0.30Day 3 0.96 � 0.35 0.60 � 0.21 0.83 � 0.32 0.97 � 0.28Day 14 0.91 � 0.44 0.78 � 0.38 0.77 � 0.32 0.72 � 0.37

Ferritin plasma concentration (ug/L)Baseline 96 � 93 54 � 41 37 � 11 30 � 12Day 3 48 � 14 53 � 29 59 � 20† 68 � 33†Day 14 67 � 24 125 � 72† 97 � 7† 110 � 58†

DA � darbepoetin alfa; LPS � lipopolysaccharide.* P � 0.05 compared with vehicle on the same experimental day.† P � 0.05 compared with baseline value within group.


in the LPS and the LPS/DA groups. Therefore, dis-turbed iron metabolism as a mechanism for the im-paired ability of DA to increase the reticulocyte countafter LPS administration is possible but seems to bedifferent from the typical anemia of chronic diseasewith decreased iron and transferrin concentrations.

Furthermore, we saw an increase over time in theferritin concentration after administration of LPS,LPS/DA, and DA alone. This is in line with data fromseptic patients who showed an increase in ferritinlevels.22 The increase in ferritin in the DA group wasinterpreted due to increased intestinal iron absorption,which would be in line with data after EPO treatmentin rats23 and humans.24

Of interest, the observation of suppression of DAseffects after administration of LPS in our experimentscontrasts with the effects of DA or EPO in inflamma-tory diseases other than sepsis, which respond toexogenously administered EPO.25 Among intensive carepatients, trauma patients with multiple organ failurerespond to EPO (600 U/kg 3 times weekly).26 However,ICU patients in general appear to show a bluntedresponse to EPO but they still respond.27 In ICU patients,EPO increased the hemoglobin concentration and thismay decrease the need for transfusions.28,29

Anemia related to inflammatory disorders likerheumatoid arthritis has been explained by in-creased apoptosis of the erythroid lineage and hasbeen linked to tumor necrosis factor �.30 In a rodentmodel, this could be mitigated by DA.31 Indeed,tumor necrosis factor � is overexpressed in the acutephase of severe sepsis and this could be one mecha-nism leading to suppression of DA’s effects. Fur-thermore, interferon-�, an important mediator inGram-negative sepsis,32 downregulates mRNA ex-pression of the EPO receptor, indicating that thenumber of EPO receptors can influence apoptosis oferythroid precursor cells.33 In hematopoietic pro-genitor cells of patients with myelodysplastic syn-dromes, LPS induces apoptosis via the toll-likereceptor-434 and this could be another link to theeffects of LPS on bone marrow in sepsis. Regardlessof these speculations, our data clearly show that LPSsuppresses DA’s ability to evoke erythropoiesis.

Our findings demonstrate that LPS abolishes eryth-ropoiesis and iron utilization evoked by DA and this isaccompanied by a decrease in hemoglobin and redblood cell concentration. Accordingly, endotoxin in-duces resistance to DA with an inability to increaseerythropoiesis and this could be a link to general EPO“resistance” in sepsis.

REFERENCES

1. Corwin HL, Gettinger A, Pearl RG, Fink MP, Levy MM,Abraham E, MacIntyre NR, Shabot MM, Duh MS, Shapiro MJ.The CRIT Study: anemia and blood transfusion in the criticallyill—current clinical practice in the United States. Crit Care Med2004;32:39–52

2. Smoller BR, Kruskall MS. Phlebotomy for diagnostic laboratorytests in adults. Pattern of use and effect on transfusion require-ments. N Engl J Med 1986;314:1233–5

3. Hebert PC, Wells G, Tweeddale M, Martin C, Marshall J, PhamB, Blajchman M, Schweitzer I, Pagliarello G. Does transfusionpractice affect mortality in critically ill patients? TransfusionRequirements in Critical Care (TRICC) Investigators and theCan Critical Care Trials Group. Am J Respir Crit Care Med1997;155:1618–23

4. Nguyen BV, Bota DP, Melot C, Vincent JL. Time course ofhemoglobin concentrations in nonbleeding intensive care unitpatients. Crit Care Med 2003;31:406–10

5. Orkin SH, Weiss MJ. Apoptosis. Cutting red-cell production.Nature 1999;401:433, 435–6

6. Silva M, Benito A, Sanz C, Prosper F, Ekhterae D, Nunez G,Fernandez-Luna JL. Erythropoietin can induce the expression ofBcl-x(L) through Stat5 in erythropoietin-dependent progenitorcell lines. J Biol Chem 1999;274:22165–9

7. Socolovsky M, Constantinescu SN, Bergelson S, Sirotkin A,Lodish HF. Cytokines in hematopoiesis: specificity and re-dundancy in receptor function. Adv Protein Chem 1998;52:141–98

8. Wojchowski DM, Gregory RC, Miller CP, Pandit AK, Pircher TJ.Signal transduction in the erythropoietin receptor system. ExpCell Res 1999;253:143–56

9. Joy MS. Darbepoetin alfa: a novel erythropoiesis-stimulatingprotein. Ann Pharmacother 2002;36:1183–92

10. Elliott S, Lorenzini T, Asher S, Aoki K, Brankow D, Buck L,Busse L, Chang D, Fuller J, Grant J, Hernday N, Hokum M, HuS, Knudten A, Levin N, Komorowski R, Martin F, Navarro R,Osslund T, Rogers G, Rogers N, Trail G, Egrie J. Enhancement oftherapeutic protein in vivo activities through glycoengineering.Nat Biotechnol 2003;21:414–21

11. Frede S, Fandrey J, Pagel H, Hellwig T, Jelkmann W. Erythro-poietin gene expression is suppressed after lipopolysaccharideor interleukin-1 beta injections in rats. Am J Physiol 1997;273:R1067–71

12. Krafte-Jacobs B, Bock GH. Circulating erythropoietin andinterleukin-6 concentrations increase in critically ill childrenwith sepsis and septic shock. Crit Care Med 1996;24:1455–9

13. Abel J, Spannbrucker N, Fandrey J, Jelkmann W. Serum eryth-ropoietin levels in patients with sepsis and septic shock. Eur JHaematol 1996;57:359–63

14. Tamion F, Le Cam-Duchez V, Menard JF, Girault C, Coquerel A,Bonmarchand G. Erythropoietin and renin as biological markersin critically ill patients. Crit Care 2004;8:R328–R335

15. R’Zik S, Beguin Y. Serum soluble transferrin receptor concen-tration is an accurate estimate of the mass of tissue receptors.Exp Hematol 2001;29:677–85

16. Tiao G, Rafferty J, Ogle C, Fischer JE, Hasselgren PO. Detrimen-tal effect of nitric oxide synthase inhibition during endotoxemiamay be caused by high levels of tumor necrosis factor andinterleukin-6. Surgery 1994;116:332–7; discussion 337–8

17. Deitch EA. Animal models of sepsis and shock: a review andlessons learned. Shock 1998;9:1–11

18. Laterre PF, Levy H, Clermont G, Ball DE, Garg R, Nelson DR,Dhainaut JF, Angus DC. Hospital mortality and resource use insubgroups of the Recombinant Human Activated Protein CWorldwide Evaluation in Severe Sepsis (PROWESS) trial. CritCare Med 2004;32:2207–18

19. Poschl JM, Leray C, Ruef P, Cazenave JP, Linderkamp O.Endotoxin binding to erythrocyte membrane and erythrocytedeformability in human sepsis and in vitro. Crit Care Med2003;31:924–8

20. Weiss G, Goodnough LT. Anemia of chronic disease. N EnglJ Med 2005;352:1011–23

21. Kemna E, Pickkers P, Nemeth E, van der Hoeven H, Swinkels D.Time-course analysis of hepcidin, serum iron, and plasmacytokine levels in humans injected with LPS. Blood 2005;106:1864–6

22. Garcia PC, Longhi F, Branco RG, Piva JP, Lacks D, Tasker RC.Ferritin levels in children with severe sepsis and septic shock.Acta Paediatr 2007;96:1829–31

23. Kong WN, Chang YZ, Wang SM, Zhai XL, Shang JX, Li LX,Duan XL. Effect of erythropoietin on hepcidin, DMT1 with IRE,and hephaestin gene expression in duodenum of rats. J Gastro-enterol 2008;43:136–43

24. Skikne BS, Cook JD. Effect of enhanced erythropoiesis on ironabsorption. J Lab Clin Med 1992;120:746–51


25. Means RT Jr, Krantz SB. Progress in understanding the patho-genesis of the anemia of chronic disease. Blood 1992;80:1639–47

26. Gabriel A, Kozek S, Chiari A, Fitzgerald R, Grabner C, GeisslerK, Zimpfer M, Stockenhuber F, Bircher NG. High-dose recom-binant human erythropoietin stimulates reticulocyte productionin patients with multiple organ dysfunction syndrome. J Trauma1998;44:361–7

27. van Iperen CE, Gaillard CA, Kraaijenhagen RJ, Braam BG, MarxJJ, van de Wiel A. Response of erythropoiesis and iron metab-olism to recombinant human erythropoietin in intensive careunit patients. Crit Care Med 2000;28:2773–8

28. Silver M, Corwin MJ, Bazan A, Gettinger A, Enny C, CorwinHL. Efficacy of recombinant human erythropoietin in criticallyill patients admitted to a long-term acute care facility: a ran-domized, double-blind, placebo-controlled trial. Crit Care Med2006;34:2310–6

29. Corwin HL, Gettinger A, Pearl RG, Fink MP, Levy MM, ShapiroMJ, Corwin MJ, Colton T. Efficacy of recombinant humanerythropoietin in critically ill patients: a randomized controlledtrial. JAMA 2002;288:2827–35

30. Papadaki HA, Kritikos HD, Valatas V, Boumpas DT, EliopoulosGD. Anemia of chronic disease in rheumatoid arthritis isassociated with increased apoptosis of bone marrow erythroidcells: improvement following anti-tumor necrosis factor-alphaantibody therapy. Blood 2002;100:474–82

31. Coccia MA, Cooke K, Stoney G, Pistillo J, Del Castillo J, DuryeaD, Tarpley JE, Molineux G. Novel erythropoiesis stimulatingprotein (darbepoetin alfa) alleviates anemia associated withchronic inflammatory disease in a rodent model. Exp Hematol2001;29:1201–9

32. Silva AT, Cohen J. Role of interferon-gamma in experimentalgram-negative sepsis. J Infect Dis 1992;166:331–5

33. Taniguchi S, Dai CH, Price JO, Krantz SB. Interferon gammadownregulates stem cell factor and erythropoietin receptors butnot insulin-like growth factor-I receptors in human erythroidcolony-forming cells. Blood 1997;90:2244–52

34. Maratheftis CI, Andreakos E, Moutsopoulos HM, VoulgarelisM. Toll-like receptor-4 is up-regulated in hematopoietic pro-genitor cells and contributes to increased apoptosis in myelo-dysplastic syndromes. Clin Cancer Res 2007;13:1154–60


The Reduced Anticoagulant Effect of Fondaparinux atLow Antithrombin Levels

Carl-Erik Dempfle, Prof Dr med*

Julia Eichner*

Nenad Suvajac*

Parviz Ahmad-Nejad, Dr med†

Michael Neumaier, Prof Dr med†

Martin Borggrefe, Prof Dr med*

BACKGROUND: Low antithrombin levels may compromise the anticoagulant effect ofheparin and heparin-related compounds, such as fondaparinux.METHODS: We compared the anticoagulant effect of 10 concentrations of fondapa-rinux added to plasma samples with normal range (n � 25, antithrombin 95.4% �9.2%) and low antithrombin (n � 22, antithrombin 45.5% � 13.2%) levels, using theHeptest coagulation assay.RESULTS: Heptest clotting time was shorter at any given fondaparinux concentrationin the antithrombin-deficient samples, indicating less anticoagulant effect than inthe group with normal antithrombin levels. At a high fondaparinux concentration,a saturation effect is observed with no further increase in Heptest clotting time.Addition of antithrombin concentrates results in a shift of the dose-response curve.When antithrombin concentrate was added, Heptest clotting time increased up toa fondaparinux concentration of 10 �g/mL.CONCLUSIONS: In the conventional prophylactic and therapeutic dose range, not onlytreatment with antithrombin concentrates but also an increase in fondaparinuxdose normalizes the anticoagulant effect. A saturation effect is observed at highfondaparinux concentrations. Higher levels of antithrombin lead to an exaggeratedeffect of fondaparinux on Heptest.(Anesth Analg 2009;109:712–6)

Heparins cause a conformational change in anti-thrombin, increasing the inhibitory potency of thisserine protease inhibitor approximately 1000-fold.1

Intensive care patients often display a diminishedanticoagulant response if standard doses of heparinare used.2,3 Unfractionated heparin binds avidly to alarge number of plasma proteins, some of whichbehave as acute phase proteins,4,5 resulting in a de-creased anticoagulant response in many intensive carepatients. Low antithrombin levels are a frequent find-ing in critically ill patients and also may result in areduced anticoagulant effect of heparin and heparin-likecompounds.6,7 This reduced heparin sensitivity hasmainly been discussed concerning the use of unfraction-ated heparin in the context of extracorporeal circulationand renal replacement therapy, but it may also berelevant concerning treatment with fractionated hepa-rins or heparin pentasaccharides, and for prevention ofvenous thromboembolism in critically ill patients.

Fondaparinux is a synthetic heparin pentasaccha-ride with a plasma half-life of 13–21 h, and minimal

intra- and intersubject variability in dose-responses.8

Fondaparinux binds nearly exclusively to antithrom-bin8 and targets the inhibitory activity of antithrombinto factor Xa.9 Fondaparinux is eliminated by the kid-neys.10 Conventional therapeutic plasma levels are in therange of 0.5–2 �g/mL.8 Fondaparinux has little or noeffect on activated partial thromboplastin time (aPTT)and activated clotting time (ACT), but the inhibitoryeffect of the fondaparinux-antithrombin complex caneasily be determined by antifactor Xa assays.

Fondaparinux has been approved for prophylaxisand treatment of venous thrombosis and pulmonaryembolism, and various other indications. In patientpopulations with high risk for thrombosis, fondapa-rinux significantly reduces the incidence of venousthrombosis, and this reduction is not associated withan increase in bleeding complications.11,12 To ourknowledge, there are no published data concerningthe effect of low antithrombin levels on the anticoagu-lant effect of fondaparinux.

Therefore, we designed in vitro experiments todetermine how low antithrombin levels affect theanticoagulant activity of fondaparinux measured byHeptest. We also evaluated the effects of antithrom-bin supplementation on the effect of fondaparinux.Supraphysiological levels of antithrombin havebeen administered to septic patients for its potentialantiinflammatory effect.13

We chose the Heptest coagulation assay14 as atarget parameter, because this assay is sensitive to lowlevels of fondaparinux. In addition, Heptest can also

From the *I. Department of Medicine, and †Institute for ClinicalChemistry, University Medical Centre Mannheim, Mannheim,Germany.

Accepted for publication April 17, 2009.Address correspondence and reprint requests to Carl-Erik

Dempfle, I. Department of Medicine, University Medical CentreMannheim, Theodor Kutzer Ufer 1-3, D-68167 Mannheim, Ger-many. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181ae94b0

Vol. 109, No. 3, September 2009712

be performed easily on small laboratory coagulationanalyzers, which are used in intensive care units. Aspecial version of the Heptest, the Heptest Hi, is usedfor measurement of high levels of fondaparinux up to10 �g/mL.

METHODSPlasma Samples

Residual citrated plasma from clinical routine diag-nostics was used anonymously and samples wereidentified according to the results table from thecoagulation analyzer. No patient-related data wererecorded. According to the local ethics committee, noinformed consent is required for this approach. Crite-ria for selection of samples were absence of unfrac-tionated or low molecular weight heparin therapyindicated on the electronic laboratory request form,normal range antifactor Xa assay, indicating absenceof unfractionated heparin, low molecular weight hep-arin and fondaparinux, normal range prothrombintime and aPTT, and normal fibrinogen level. Sampleswere grouped according to the antithrombin leveldetermined by the routine chromogenic assay fromDadeBehring Diagnostics, Marburg, Germany. Thelow antithrombin group consisted of plasma sampleswith an antithrombin level �60%. The normal rangegroup consisted of 25 plasma samples and the lowantithrombin group consisted of 22 plasma samples.

Assay ProceduresHeptest and Heptest HI assay kits were purchased

from Kappes Laborservice, Munich, Germany. Resultsare given as clotting time (s). The Heptest assay kitconsists of a factor Xa reagent to be added to thecitrated plasma sample first, and a calcium reagentalso containing phospholipids and coagulation factorV, which initiates clot formation. Heptest was mea-sured using a ball coagulometer device from Behnk,Norderstedt, Germany. Heptest HI is a modified ver-sion of the assay optimized for high heparin concen-tration, as used in cardiac surgery.

Antithrombin was measured by chromogenic assayfrom DadeBehring Diagnostics. Other coagulation as-says, including prothrombin time, aPTT, and fibrino-gen, were measured using reagents and methods fromDadeBehring Diagnostics.

All of the following experiments were performedwith the 25 plasma samples with normal antithrombinconcentration and the 22 plasma samples with lowantithrombin concentration.

Plasma (950 �L) was mixed with 50 �L buffer (0.05M Tris, 0.1 M NaCl, pH 7.4) (Sample A), or 25 �Lbuffer and 25 �L antithrombin concentrate (Kybernin,CLS Behring, Marburg, Germany, dissolved in bufferat a concentration of 50 U/mL) (Sample B), or with 50�L of antithrombin concentrate (Sample C).

Serial dilutions of fondaparinux were preparedusing the same buffer by sequentially mixing equalvolumes of fondaparinux solution with buffer.

Fondaparinux dilution 5 �L was mixed with 45 �Lof plasma Samples A, B, or C in coagulometer tubes.Concentrations of fondaparinux given in the Resultssection, Table, and Figures are final concentrations inthis mixture. After 2 min of incubation at 37°C, 50 �Lof Heptest factor Xa reagent was added. After anadditional 2 min (Heptest) or 30 s (Heptest HI), 50 �Lof Recalmix regent from the Heptest assay kit, con-taining phospholipids, calcium, and coagulation factorV, was added and the coagulometer started. Thecoagulometer device detected clotting automaticallywhen the motion of the steel ball immersed in the testsolution was impaired by clot formation.

Statistical AnalysisMean, standard deviation, median values, and in-

terquartile ranges were calculated for all groups. Wil-coxon’s signed rank test was used for comparison offondaparinux effects because of unequal variances. Alevel of P � 0.05 was considered statistically signifi-cant. For comparison of the fondaparinux effect atdifferent antithrombin concentrations, the Tukey-Kramer honestly significant difference test for mul-tiple comparisons was used. An � level of �0.05 wasconsidered statistically significant.

RESULTSThe normal range antithrombin plasma samples

had a mean antithrombin level of 95.4% � 9.2%(mean � sd) (range, 75.2%–115.8%). The antithrombindeficiency group had a mean antithrombin plasmalevel of 45.5% � 13.2% (range, 15.6%–60.0%). Thenormal range of Heptest without addition of fondapa-rinux was 18 � 7 s (mean � sd) and the normal rangeof Heptest HI was 8 � 2 s.

Increasing concentrations of fondaparinux resultedin increasing clotting time in the Heptest assay, asexpected (Table 1). Heptest clotting time, though, wasshorter at any given fondaparinux concentration in theantithrombin-deficient samples. Roughly identicalclotting times compared with samples with normalantithrombin levels were attained by doubling thefondaparinux concentration. Differences between nor-mal range and low range antithrombin samples weresignificant in the entire range of fondaparinux concen-trations. A scatterplot of the slopes of log (fondapa-rinux concentration) versus Heptest clotting time isshown in Figure 1. The dose-response to fondaparinux(increase in Heptest clotting time per fondaparinuxconcentration) correlates with the antithrombin con-centration (regression coefficient r � 0.54815).

In the low range of fondaparinux concentration,addition of antithrombin concentrate results in a shiftof the dose-response curve (Fig. 2, Panels A and B),with prolongation of clotting time at higher anti-thrombin levels. Differences between samples withoutantithrombin addition and 1.25 �g/mL added anti-thrombin (final concentration), and between 1.25 and


2.5 �g/mL added antithrombin (final concentration)were significant for most dilutions of fondaparinuxwhen using normal plasma (Fig. 2, Panel A), and forsome of the fondaparinux dilutions when usingantithrombin-deficient plasma (Fig. 2, Panel B).

In the high range of fondaparinux concentrations(Fig. 2, Panels C and D), the shift of dose-responsecaused by addition of the antithrombin concentrate isalso visible. Depending on the available antithrombinconcentration, a “ceiling effect” indicates saturation ofthe antithrombin with fondaparinux with no signifi-cant increase in Heptest clotting time with increasingfondaparinux concentration. When antithrombin con-centrate is added, more binding sites for fondaparinuxbecome available, resulting in increasing Heptest HIclotting time up to a fondaparinux concentration

of 10 �g/mL. Differences between neighboringfondaparinux concentrations are statistically signifi-cant at the highest antithrombin concentration for 10vs 5 �g/mL and 5 vs 2.5 �g/mL in the normalplasma, and for 10 vs 5 �g/mL in the antithrombindeficient plasma.

DISCUSSIONSimilar to unfractionated heparin, fondaparinux is

dependent upon antithrombin for its anticoagulantactivity. These results indicate that low antithrombinlevels influence the effect of fondaparinux measuredby Heptest. The anticoagulant effect can be restoredeither by increasing fondaparinux concentration or byadding antithrombin. These observations are relevantfor fondaparinux therapy in patients with hereditaryantithrombin deficiency or in intensive care patientswith low antithrombin levels.

Clinical trials with in vivo application of fondapa-rinux are needed to establish a therapeutic range forfondaparinux in Heptest and to investigate if theanticoagulant effect of fondaparinux decreases be-low the therapeutic range at low antithrombinconcentrations.

Another important observation was that in the highconcentration range, increasing the fondaparinux con-centration caused only a small increase in Heptestclotting time. This is related to the saturation ofbinding of fondaparinux to antithrombin. Increasingantithrombin to supraphysiological levels results in anextension of the linear increase in Heptest clottingtime caused by addition of fondaparinux. In thisrespect, fondaparinux behaves similar to unfraction-ated heparin. Levy et al.15 found that unfractionatedheparin �4.1 U/mL failed to further increase ACTvalues in plasma from cardiac surgery patients. Inthese experiments, similar to our results with fondapa-rinux, antithrombin supplementation led to a furtherprolongation of ACT at high heparin doses.

Figure 1. Correlation between the slopes of the regressionbetween fondaparinux concentration and Heptest coagula-tion time and the antithrombin levels (low range samples,0.02–0.31 �g/mL final concentration). The dose-response tofondaparinux (increase in Heptest clotting time caused byincreasing concentration of Fondaparinux) is dependentupon the antithrombin concentration of the plasma. At lowantithrombin concentration, a lower slope value indicatingreduced anticoagulant effect is observed.

Table 1. Effect of Fondaparinux on Heptest Coagulation Assay Results in Plasma Samples with Normal (AT �70%) and Low (AT�60%) Antithrombin Level

AT �70% (mean � sd) AT �60% (mean � sd) PAT concentration (%) 95.4 � 9.2 45.5 � 13.2 �0.0001Heptest� (s)Fondaparinux 0.02 �g/mL 19.9 � 9.2 24.0 � 12.1 0.8947Fondaparinux 0.04 �g/mL 43.5 � 6.4 38.7 � 8.9 0.0402Fondaparinux 0.08 �g/mL 51.5 � 5.2 45.7 � 6.8 0.0014Fondaparinux 0.16 �g/mL 62.5 � 5.6 54.7 � 6.8 0.0003Fondaparinux 0.32 �g/mL 75.7 � 9.6 63.0 � 6.8 �0.0001Heptest� HI (s)Fondaparinux 0.63 �g/mL 18.4 � 1.6 16.9 � 1.3 0.0008Fondaparinux 1.25 �g/mL 20.6 � 2.1 18.5 � 1.3 0.0001Fondaparinux 2.50 �g/mL 22.7 � 2.3 19.5 � 1.8 �0.0001Fondaparinux 5.00 �g/mL 24.2 � 3.9 20.4 � 2.9 �0.0001Fondaparinux 10.00 �g/mL 25.2 � 5.5 21.3 � 5.0 �0.0001The P values refer to differences between samples with normal and low antithrombin level. Heptest HI is a version of the Heptest assay optimized for high heparin concentration.AT � antithrombin.

714 Fondaparinux and Antithrombin Level ANESTHESIA & ANALGESIA

In the Kybersept trial of antithrombin concentratesin patients with severe sepsis, treatment with high-dose antithrombin nearly doubled the rate of bleedingcomplications.13 The present results indicate that, byincreasing antithrombin to supernormal levels, theeffect of fondaparinux concerning the prolongation ofHeptest clotting time increases. A similar effect mightbe the reason for the increased rate of bleeding com-plications in patients treated with high-dose anti-thrombin and conventional unfractionated or lowmolecular weight heparin in the Kybersept trial. Theexperiences from the Kybersept trial led to the recom-mendation not to combine high-dose antithrombintherapy with heparin.16,17

Compared with unfractionated heparin, fondapa-rinux has a much more predictable bioavailability.10

However, its long half-life that is prolonged with renalfailure is an important limitation. Laboratory monitoringis thought to be unnecessary in most patients receivingprophylactic and therapeutic dose fondaparinux, butmay be important in patients with antithrombin defi-ciency as well as in patients receiving antithrombinconcentrates in combination with fondaparinux andin patients with impaired renal function. Determi-nation of antithrombin levels during treatment withfondaparinux may identify patients with an ex-pected lower response, who might benefit from

antithrombin supplementation or dose adjustmentof fondaparinux.

REFERENCES

1. Olson ST, Chuang YJ. Heparin activates antithrombin antico-agulant function by generating new interaction sites (ex-osites) for blood clotting proteinases. Trends Cardiovasc Med2002;12:331– 8

2. Mayr AJ, Dunser M, Jochberger S, Fries D, Klingler A,Joannidis M, Hasibeder W, Schobersberger W. Antifactor Xaactivity in intensive care patients receiving thromboembolicprophylaxis with standard doses of enoxaparin. Thromb Res2002;105:201– 4

3. Jochberger S, Mayr V, Luckner G, Fries DR, Mayr AJ,Friesenecker BE, Lorenz I, Hasibeder WR, Ulmer H, Schober-sberger W, Dunser MW. Antifactor Xa activity in critically illpatients receiving antithrombotic prophylaxis with standarddosages of certoparin: a prospective, clinical study. Crit Care2005;9:R541– 8

4. Young E, Podor TJ, Venner T, Hirsh J. Induction of the acute-phase reaction increases heparin-binding proteins in plasma.Arterioscler Thromb Vasc Biol 1997;17:1568–74

5. Manson L, Weitz JI, Podor TJ, Hirsh J, Young E. The variableanticoagulant response to unfractionated heparin in vivo re-flects binding to plasma proteins rather than clearance. J LabClin Med 1997;130:649–55

6. Avidan MS, Levy JH, Scholz J, Delphin E, Rosseel PM, HowieMB, Gratz I, Bush CR, Skubas N, Aldea GS, Licina M,Bonfiglio LJ, Kajdasz DK, Ott E, Despotis GJ. A phase III,double-blind, placebo-controlled, multicenter study on theefficacy of recombinant human antithrombin in heparin-resistant patients scheduled to undergo cardiac surgery ne-cessitating cardiopulmonary bypass. Anesthesiology 2005;102:276 – 84

Figure 2. Correlation between fondapa-rinux final concentration and Heptestcoagulation time. The conventionalHeptest assay was used for the lowrange, Heptest HI, a modified versionoptimized for determination of highheparin concentration for the high con-centration range. Clotting time of Hep-test HI is shorter than in the conventionalHeptest at similar heparin concentration.Panel A: normal plasma, fondaparinux0.02–0.31 �g/mL, Heptest. Panel B:antithrombin-deficient plasma, fondapa-rinux 0.02–0.31 �g/mL, Heptest. PanelC: normal plasma, fondaparinux0.625–10 �g/mL, Heptest HI. PanelD: antithrombin-deficient plasma,fondaparinux 0.625–10 �g/mL, Hep-test HI. Stars indicate statistically sig-nificant differences between high andintermediate and intermediate and noantithrombin addition, using Tukey-Kramer analysis. An � value of �0.05was considered to be significant.


7. Avidan MS, Levy JH, van Aken H, Feneck RO, Latimer RD, OttE, Martin E, Birnbaum DE, Bonfiglio LJ, Kajdasz DK, DespotisGJ. Recombinant human antithrombin III restores heparin re-sponsiveness and decreases activation of coagulation inheparin-resistant patients during cardiopulmonary bypass.J Thorac Cardiovasc Surg 2005;130:107–13

8. Bauer KA, Hawkins DW, Peters PC, Petitou M, Herbert JM, vanBoeckel CA, Meuleman DG. Fondaparinux, a synthetic pen-tasaccharide: the first in a new class of antithromboticagents—the selective factor Xa inhibitors. Cardiovasc Drug Rev2002;20:37–52

9. Choay J, Petitou M, Lormeau JC, Sinay P, Casu B, Gatti G.Structure-activity relationship in heparin: a synthetic pentasac-charide with high affinity for antithrombin III and eliciting highanti-factor Xa activity. Biochem Biophys Res Commun1983;116:492–9

10. Samama MM, Gerotziafas GT. Evaluation of the pharmacolog-ical properties and clinical results of the synthetic pentasaccha-ride (fondaparinux). Thromb Res 2003;109:1–11

11. Bauer KA, Eriksson BI, Lassen MR, Turpie AG. Fondaparinuxcompared with enoxaparin for the prevention of venous throm-boembolism after elective major knee surgery. N Engl J Med2001;345:1305–10

12. Eriksson BI, Bauer KA, Lassen MR, Turpie AG. Fondaparinuxcompared with enoxaparin for the prevention of venous throm-boembolism after hip-fracture surgery. N Engl J Med 2001;345:1298–304

13. Warren BL, Eid A, Singer P, Pillay SS, Carl P, Novak I, ChalupaP, Atherstone A, Penzes I, Kubler A, Knaub S, Keinecke HO,Heinrichs H, Schindel F, Juers M, Bone RC, Opal SM. Caring forthe critically ill patient. High-dose antithrombin III in severesepsis: a randomized controlled trial. JAMA 2001;286:1869–78

14. Yin ET, Wessler S, Butler JV. Plasma heparin: a unique, practi-cal, submicrogram-sensitive assay. J Lab Clin Med 1973;81:298–310

15. Levy JH, Montes F, Szlam F, Hillyer CD. The in vitro effects ofantithrombin III on the activated coagulation time in patients onheparin therapy. Anesth Analg 2000;90:1076–9

16. Hoffmann JN, Wiedermann CJ, Juers M, Ostermann H, KienastJ, Briegel J, Strauss R, Warren BL, Opal SM. Benefit/risk profileof high-dose antithrombin in patients with severe sepsis treatedwith and without concomitant heparin. Thromb Haemost2006;95:850–6

17. Kienast J, Juers M, Wiedermann CJ, Hoffmann JN, OstermannH, Strauss R, Keinecke HO, Warren BL, Opal SM. Treatmenteffects of high-dose antithrombin without concomitant heparinin patients with severe sepsis with or without disseminatedintravascular coagulation. J Thromb Haemost 2006;4:90–7

716 Fondaparinux and Antithrombin Level ANESTHESIA & ANALGESIA

Echo Rounds

Aorto-Pericardial Filling Without Tamponade: An UnusualLate Bentall Complication

Paula Carmona, MD

Richard Bowry, MB, BS, FRCA

Robert Chen, MD, FRCPC

Claude Tousignant, MD, FRCPC

After Research Ethics Board approval, we present thecase of a 61-yr-old woman who was transferred to ourhospital 2 yr after a Bentall procedure and with adiagnosis of right ventricular (RV) infarction and severeRV dysfunction. She presented 10 days earlier at thereferring center with progressive shortness of breath,severe weakness, nausea, and vomiting. A transthoracicechocardiogram was performed that demonstrated hy-pokinesis of the basal and inferior walls with RV dila-tion. Her serum Troponin I was elevated. The initialdifferential diagnosis included viral myocarditis andnon-ST elevation myocardial infarction possibly becauseof right coronary artery (RCA) pathology. The patientsubsequently developed cardiogenic shock, hepato-renalfailure, and disseminated intravascular coagulation. Shewas tracheally intubated, given inotropes, and dialyzed.At this time she was transferred to our hospital formanagement and further cardiothoracic opinion.

On arrival, a transesophageal echocardiogram (TEE)was performed. In the upper esophageal view at 0° usingcolor flow Doppler, a high velocity jet was seen; itappeared to originate from the anterior aspect of theaortic graft and created a large anterior collection mea-suring approximately 6 � 8 cm (Fig. 1) (see Video 1,Supplemental Digital Content 1, showing upper esoph-ageal, long-axis view of the ascending aortic prosthesis; ahigh velocity jet is seen to fill the pseudoaneurysm;http://links.lww.com/A1367). The right atrium (RA)

and RV were both dilated and no significant RV com-pression was seen. In the transgastric view, there wasdiastolic septal flattening (see Video 2, SupplementalDigital Video 2, showing transgastric short-axis view ofthe left and right ventricles [RV]; The RV appears dilatedwith a flattened septum; http://links.lww.com/A1368) asa result of right-sided volume overload. There wasalso severe tricuspid regurgitation (Fig. 2). The patientwas transferred to the operating room with a diagno-sis of RCA button dehiscence and large anteriorcollection. Femoral-femoral bypass and cooling wereinstituted before chest opening. Intraoperative TEE(midesophageal RV outflow 24° scan angle) demon-strated blood flow between the collection and the RVoutflow tract (RVOT) (Fig. 3) (see Video 3, Supple-mental Digital Content, showing midesophageal4-chamber view with scan angle of 24°; a communica-tion is seen between the pericardium and the rightventricle [RV] in the region of the RV outflow tract[RVOT]; http://links.lww.com/A1369). The operativefindings were complex and included large pseudoan-eurysm formed by surgical adhesions, detachment ofthe proximal RCA graft from the synthetic aorticprosthesis, a leak at the distal graft anastomosis, afistula between the pseudoaneurysm and the RVOT,and a second, previously unrecognized, fistula be-tween the pseudoaneurysm and the RA. The follow-ing procedures were performed: primary repair of thedistal aortic leak and dehisced RCA, debridement andover-sewing of the RA fistula, debridement and apericardial patch to close the fistula to the RVOT.After a protracted postoperative course, the patientwas discharged home on Day 31.

Bentall’s procedure is a surgical option for thetreatment of ascending aortic aneurysm. The overallmortality for this procedure is �5% and approaches1.5% in elective operations. Complications includethromboembolism, endocarditis, and pseudoaneu-rysm particularly at the coronary ostia and distalaortic suture lines. Modifications to the originalprocedure have occurred to reduce tension on the

From the Department of Anesthesia, Saint Michael’s Hospital,University of Toronto, Ontario, Canada.

Accepted for publication April 9, 2009.Supplemental digital content is available for this article. Direct

URL citations appear in the printed text and are provided in theHTML and PDF versions of this article on the journal’s Web site(www.anesthesia-analgesia.org).

Address correspondence and reprint requests to Richard Bowry,MB, BS, FRCA, Department of Anesthesia, St. Michael’s Hospital, 30Bond St., Toronto, ON, Canada M5B 1W8. Address e-mail [email protected].

Copyright © 2009 International Anesthesia Research Society

DOI: 10.1213/ane.0b013e3181adc939


coronary anastamosis. Of particular interest is theCabrol procedure that includes over-sewing the na-tive aorta around the prosthesis and creating a shunt intothe RA to drain anastomotic leakage from the peripros-thetic space.1 This prevents the formation of a tensehematoma and pseudoaneurysm formation. The shuntwould close spontaneously but there have been reportsof persistent Cabrol shunts.2,3

To our knowledge, this is the first report of a patientsurviving a significant periprosthetic pseudoaneu-rysm with detachment of the RCA and a distal aorticgraft leak after a Bentall’s procedure without a Cabrolshunt. Sakano et al. reported a similar case afterBentall’s procedure with a Cabrol shunt in which thepseudoaneurysm created a fistula to the RA. TheCabrol shunt was found to be completely throm-bosed.4 Hoffman et al.5 reported a similar case with afistula from the ascending aorta entering the main

pulmonary artery. Late coronary graft avulsion is anunusual complication after Bentall’s procedure. Intra-operative biopsies in our patient were sterile invokingthe possibility of an inflammatory process.

Preoperative TEE was able to outline the pathology inthis case. TEE also proposed an anatomic mechanism forright-sided filling in the setting of a high-pressure pseu-doaneurysm. Our patient’s unusual presentation of anaortic pseudoaneurysm without compression of the RVor RA suggests that the pressures in the pericardium,RV, and pseudoaneurysm were very similar. An in-flammatory process likely resulted in a small dehis-cence at the RCA button. The resulting jet of bloodcreated both the pseudoaneurysm and fistula to theadjacent RVOT. It is likely that this leak increaseduntil the RCA detached completely resulting in RVdysfunction. Fortuitously, a fistula allowed consider-able return of blood to the right side of the circulation.Our images lead us to suspect that the fistula to theRVOT was the primary reentry point. This wouldexplain the dilation of the RV and the resultingtricuspid regurgitation. A second fistula to the RAfound by the surgeon had not been previously iden-tified by TEE.

The identification of a large pericardial collection inthe presence of hemodynamic compromise wouldnormally trigger a diagnosis of pericardial tampon-ade. Routine surgical management in this case wouldlikely have resulted in an adverse outcome. Use of TEEidentified the unusual features of RCA dehiscence, RA,and RV dilation requiring closer investigation and acautious approach to the subsequent anesthetic andsurgical management.

REFERENCES

1. Leverich A, Johnston C, Stiles B, Girardi L, Hartman G, SkubasNJ. Cabrol composite graft for aortic root replacement: echocar-diographic imaging. Anesth Analg 2009;108:1107–9

Figure 1. Upper esophageal, short-axis view of the ascendingaorta (Ao). There is a high velocity jet (arrow) resulting fromthe dehiscence of the right coronary artery (RCA) anastomo-sis, which communicates with a large collection (*) anteriorto the ascending aorta.

Figure 2. Midesophageal four-chamber view at 0° with right-ward probe rotation. A pericardial fluid collection (*) with flowwithin on color flow Doppler is seen lateral to the rightventricle (RV). The right atrium (RA) is grossly enlarged. Thereis severe tricuspid regurgitation (TR).

Figure 3. Midesophageal four-chamber view with a scanangle of 24° showing a communication (arrow) between thepericardium (*) and the right ventricle (RV) near the rightventricular outflow tract (RVOT). The left ventricle (LV) andright atrium (RA) are also demonstrated.

718 Echo Rounds ANESTHESIA & ANALGESIA

2. Rosero H, Nathan PE, Rodney E, Vasavada B, Sacchi TJ. Aorta toright atrium fistula with congestive heart failure resulting from apatent Cabrol shunt after repair of aortic dissection. Am Heart J1994;128:608–9

3. Malcolm ID. Surgical aortic perigraft to right atrial shunt: trans-esophageal echocardiography findings. J Am Soc Echocardiogr1996;9:877–9

4. Sakano Y, Misawa Y, Kaminishi Y, Fuse K. Aorto-right atriumfistula caused by detachment after Bentall’s operation: report ofa case. Surg Today 2007;37:234–6

5. Hoffman P, Lusawa T, Rozanski J. Detachment of the rightcoronary artery resulting in subsequent aneurysm of the ascend-ing aorta and pulmonary artery fistula 7 years after a Bentallprocedure. J Am Soc Echocardiogr 2005;18:e4

Clinician’s Key Teaching Points By Drs. Nikolaos Skubas, Roman Sniecinski, andMartin J. London

• The Bentall procedure involves replacement of the aortic valve, ascending aorta, and reimplantation of theright and left main coronary arteries.

• This case illustrates a late complication of the Bentall procedure, namely coronary graft dehiscence, detectedby a high velocity jet on color flow Doppler imaging in the midesophageal ascending aorta short-axis view, thatled to a large pericardial fluid collection.

• Coronary artery dehiscence would normally lead to cardiac tamponade with collapse of low-pressurechambers (right atrium and ventricle) expected on transesophageal echocardiogram (TEE) imaging.

• In this unusual case, tamponade was prevented by an unsuspected fistula between the right ventricle andpericardium of uncertain etiology.

• The TEE findings of the blood entering into the right ventricle from outside the heart helped guide the surgicalapproach.


Case Report

Perioperative Management of a Child with von WillebrandDisease Undergoing Surgical Repair of Craniosynostosis:Looking at Unusual Targets

Isabelle Maquoi, MD*

Vincent Bonhomme, MD, PhD*

Jacques Daniel Born, MD, PhD†

Marie-Francoise Dresse, MD,PhD‡§

Elisabeth Ronge-Collard, MD§�

Jean-Marc Minon, MD, PhD§�

Pol Hans, MD, PhD*

We report the successful management of a craniosynostosis repair in a child withsevere Type I von Willebrand disease diagnosed during the preoperative assess-ment and treated by coagulation factor VIII and ristocetin cofactor. Collaborationamong the anesthesiologist, the neurosurgeon, the clinical pathologist, and thepediatric hematologist is important for successful management.(Anesth Analg 2009;109:720–4)

The perioperative management of patients undergo-ing surgical repair of craniosynostosis is a challengefor anesthesiologists because of the risk of extensivebleeding.1,2 We report a pediatric patient with vonWillebrand disease (vWD) admitted for surgical cor-rection of craniosynostosis.

CASE DESCRIPTIONPermission was obtained from the parents to report our

observations. A 10-mo, 9-kg male child was admitted to theneurosurgical department for remodeling of sagittal cranio-synostosis. At 1 mo, he had undergone an uneventful repairof an inguinal hernia. He had also been anesthetized 1 wkbefore admission for a computed tomography scan withthree-dimensional reconstruction of his malformation. Ex-cept for the dolichocephalic aspect of the skull, the physicalexamination was normal. During the preoperative visit, thechild’s father mentioned a history of vWD in his own familyalthough he himself had no coagulation disorder. Themother reported that the child had had recurrent knee

hematomas since he began to walk. The anesthesiologistordered a coagulation and hemostasis profile, whichshowed the following results: a platelet count at 353 � 103

mm�3, a closure time of Collagen/adenosine diphosphatePFA-100� test (Siemens, see Appendix for details) at 289 s(normal range [NR]: 71–111 s), a closure time ofCollagen/Epinephrine PFA-100 test at 223 s (NR: 74–116 s),an activated partial thromboplastin time (aPTT) at 37 s (NR:28–43 s), a prothrombin time (PT) at 13.4 s with an interna-tional normalized ratio at 1.0 (NR: 1.0–1.2), a coagulationfactor VIII (FVIII) at 53% (NR: 50%–150%), a von Willebrandfactor antigen (vWF:Ag) at 17% (NR: 60%–150%), a ristocetincofactor activity (vWF:RCo) at 9% (NR: 70%–132%), and anA positive blood type. As laboratory results were consistentwith a severe Type I vWD, we confirmed the diagnosis byordering a plasma vWF multimers assay. Neurosurgery wasdelayed to develop a perioperative care strategy with thepediatric hematologist and the clinical pathologist. Based onour plan, the patient received 250 IU of FVIII and 550 IU ofvWF:RCo (Hemate� P) IV 1 h before induction of anesthesia.The same dose was repeated twice daily for the first 48 hafter surgery and then modified to keep the FVIII plasmalevel in the 80%–100% range during the first postoperativeweek. Premedication consisted of intrarectal midazolam (0.4mg/kg) and atropine (0.125 mg). In the operating room, twovenous catheters, an arterial catheter, and standard monitoringwere placed. Anesthesia was induced IV with a bolus of 0.2�g/kg sufentanil and 5 mg/kg thiopental. Tracheal intubationwas facilitated by rocuronium (0.5 mg/kg). Maintenance ofanesthesia was achieved with sevoflurane (2.5%–3% end-tidal)vaporized in an oxygen/nitrous oxide mixture (Fio2: 0.5).The patient received 10 mg/kg tranexamic acid IV at thebeginning of surgery. Baseline fluid requirement was ensuredby continuous infusion of a crystalloid (Plasmalyte-A�) at a4 mL � kg�1 � h�1 rate.

The surgical intervention was uneventful and lasted 21⁄2h. At the beginning of surgery, the hematocrit value was27.7%. The estimated blood loss was isovolumically re-placed by a colloid (third generation hydroxyethyl starch,

From the *University Department of Anesthesia and ICM,†Department of Neurosurgery, ‡University Department of Pediat-rics, §Liege Hemophilia Treatment Center, and �Department ofLaboratory Medicine, Hemostasis and Thrombosis Unit, CHR Cita-delle, Liege, Belgium.

Accepted for publication April 15, 2009.Supported by Department of Anesthesia and ICM of Liege

University Hospital, Department of Neurosurgery of CHR Cita-delle, and Department of Laboratory Medicine of CHR Citadelle.

Reprints will not be available from the author.Address correspondence to Pol Hans, MD, PhD, University

Department of Anesthesia and ICM, Bd du 12eme de Ligne, 1, 4000Liege, Belgium. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181aedbf9


HAES 130/0.4, Voluven�). After 2 h of surgery, at the timeof skin closure, the hematocrit value was 18% and thepatient received a 100 mL transfusion of homologous blood.The overall estimated total blood loss during the 2 h ofsurgery was 250 mL. This value was calculated according tothe following formula: estimated blood loss � estimatedblood volume � (Hts � Hte)/Hts, where Hts and Hterepresent the hematocrit value measured immediately after thearterial line insertion and at the end of this 2-h period,respectively. After tracheal extubation in the operating room,the patient was transferred to the intensive care unit for a 24-hobservation period. On admission to the intensive care unit,FVIII, vWF:Ag, and vWF:RCo values were 96.2%, 62%, and63%, respectively. A hematocrit value of 20.3% without lacticacidosis led to a further 100 mL transfusion of red blood cellsfrom the same donor. The day after surgery, the hematocritvalue was 25.8% and the child was transferred to a pediatricward. Administration of Hemate P produced acceptable FVIII,vWF:Ag, and vWF:RCo values during the first postoperativedays (Fig. 1) and was repeated once daily at half the initial dose(250 IU of FVIII and 550 IU of vWF:RCo) for 8 days. Tranex-amic acid was given IV (10 mg � kg�1 � 8h�1) for 24 h and thenorally (20 mg � kg�1 � 8h�1) for 3 wk. No antiinflammatorydrugs or acetylsalicylic acid were administered. The postop-erative course was unremarkable. The child was dischargedfrom the hospital on postoperative day 6. He was reviewed bythe neurosurgeon 2 wk after hospital discharge and didperfectly well.

DISCUSSIONvWD is caused by deficiency or dysfunction of

vWF, which stabilizes blood coagulation FVIII andmediates platelet plug formation through the promo-tion of platelet-to-platelet and platelet-to-vessel walladhesion.3 This inherited disorder has an estimatedprevalence of 0.6%–1.3%3 and is classified into threecategories: partial quantitative deficiency (Type 1),qualitative deficiency (Type 2), and total deficiency(Type 3).4 Classification, diagnosis approach, and

therapeutic recommendations of vWD are summa-rized in Figure 2. Beside inherited disorders, there arerare acquired von Willebrand syndromes associatedwith pathological states that include lymphoprolifera-tive and autoimmune diseases, essential thrombocy-themia, cancer, and valvular heart disease.

Symptoms in patients and families with vWD mayvary from minimal to severe. In addition, initial co-agulation tests, such as PT and aPTT, may be normal.The aPTT is sensitive to deficiencies or defects inFVIII. Because the FVIII level is not always low inindividuals with vWD, the aPTT has only little screen-ing value for that pathology. Routine coagulationtests, which should be performed in cases of clinicalsuspicion, vary among surgical teams. They mayconsist in PT, aPTT, PFA-100, or bleeding time, andeventually FVIII, vWF:Ag, and vWF:RCo. The vW-F:RCo assay is a functional assay that measures theability of vWF to interact with normal platelets. Theantibiotic ristocetin allows vWF to bind to plateletmembrane glycoprotein Ib�, resulting in plateletclumps.5 The time required for platelet aggregationcorresponds to the amount and function of vWF in thepatient’s plasma.

Our patient exhibited severe decreases in vWF:Ag(17%) and vWF:RCo activity (9%) as well as mildlylow FVIII activity (53%), which characterize Type 1vWD. Before receiving the results of the von Wille-brand multimers assay, Type 2A, B, or M could not bestrictly excluded. Even though these are autosomaldominant disorders, there can be a significant degreeof phenotypic variability within families. The multi-mer profile of our patient was normal, thereforeconfirming the Type 1 vWD.

Figure 1. Perioperative factor VIII (FVIII), von Willebrand factor antigen (vWF:Ag), and ristocetin cofactor (vWF:RCo) activitymeasured preoperatively and during the first postoperative days. Arrows represent times of IV administration of combinedFVIII and ristocetin cofactor (Hemate� P). Preop � preoperative; D � 1, 2, 3, and 6 � postoperative days 1, 2, 3, and 6,respectively.


Individuals who have blood of type O constitu-tively have vWF concentrations approximately 25%less than carriers of other blood types and usually arenot symptomatic. However, in case of even lower vWFlevels, such patients are at high risk of having a vWD,with vWF gene mutations, significant bleeding symp-toms, and a strongly positive family history. Ourpatient was blood type A.

Strategies to prevent or control bleeding in patientswith vWD include the administration of desmopressin,which stimulates the release of vWF by endothelial cells,the replacement of vWF by human plasma-derivedconcentrates,6 and the use of hemostatic drugs which donot modify the plasma vWF:Ag.3,7,8 Transfusion of plate-let concentrates is only indicated when bleeding occursdespite normal plasma values of FVIII or as an alterna-tive therapy in Type 3 vWD. The management of pa-tients undergoing neurosurgery with vWD is not welldocumented. In general surgery, studies suggest thatappropriate administration of the FVIII/vWF:RCo con-centrates prevents excessive bleeding in more than 90%

of patients, even in severe vWD and without any seriousadverse events.7,9,10 Although desmopressin is recom-mended as the treatment of choice for patients with Type1 vWD, it was not administered to our patient because offrequently reported tachyphylaxis,7,11,12 risk of hypona-tremia, and lower response rate in children younger than2-yr-of-age.13–15 Tranexamic acid was administered as anadjunct to FVIII/vWF:RCo concentrates. This antifi-brinolytic drug inhibits the conversion of plasmin-ogen into plasmin and stabilizes clots that have beenformed.3,7,8,12

The PFA-100 device, which measures in vitro plate-let adhesion and aggregation, was not used for treat-ment follow-up because desmopressin or FVIII/vWFfactor concentrates are not only dependent on thevWF plasma concentration but also on the profileof vWF multimers, as well as on platelet vWF. Insevere vWD, PFA-100 may not normalize with vWFreplacement, possibly because of abnormalities inconcentrate multimer profile and/or lack of in-traplatelet vWF. The PFA-100 is also prolonged by

Figure 2. Diagnostic and therapeutic approach of von Willebrand disease. All Type 2s vWD are qualitative vWF deficiencies.Type 2A is associated with decreased platelet-dependent vWF functions and a deficiency in large multimers. Type 2B ischaracterized by an increased vWF affinity for platelet Ib glycoproteins and a deficiency in large multimers. Type 2Mcorresponds to defective platelet-dependent vWF functions that are not associated with multimer defects. In Type 2N, thebinding affinity of vWF for FVIII is markedly decreased. CBC � count of blood cells; aPTT � activated partial thromboplastintime; PT � prothrombin time; TT � thrombin time; vWD � von Willebrand disease; vWF:Ag � von Willebrand factorantigen; vWF:RCo � ristocetin cofactor; RIPA test � Ristocetin-induced platelet agglutination; PFA-100� � platelet functionassay; FVIII � coagulation factor VIII.

722 Case Report ANESTHESIA & ANALGESIA

significant reductions in platelet count or hematocrit.The normalization of the PFA-100 test after administer-ing desmopressin in Type 1 vWD can be used for testingthe efficacy of desmopressin administration. The utilityof this desmopressin test in other types of the disease isquestionable.16 As far as our patient received factorconcentrates, measuring plasma levels of those factorswas obviously the best therapeutic monitoring.

FVIII activity is the main predictor of surgicalhemostasis. Measuring it helps avoiding supranormallevels and hence limiting the risk of venous thrombo-embolism.3 The initial loading and maintenance dosesof vWF concentrates used in our patient are similar tothose proposed by Nichols et al.3,7,17 and others for theprevention or management of bleeding in major sur-gery. The replacement therapy aimed at achievingplasma activity of deficient factors between 80% and100% for the first postoperative days and higher than50% thereafter, for a 5–10-day period. These recom-mendations are not applicable in minor surgery. Inthat case, one single daily infusion is recommendedfor 1–5 days to obtain target levels higher than 50%during surgery and 30% thereafter.

Venous thromboembolism has been reported inassociation with high levels of FVIII. This is why it isadvisable to measure plasma FVIII daily to avoidlevels over 100%. Antithrombotic prophylaxis withlow molecular weight heparin should be consideredduring treatment with FVIII-vWF concentrates if thereare concomitant risk factors.7 Keeping vWF:RCo levelsand FVIII activity below 200% should be considered.Our patient received no prophylaxis; he had no riskfactor and the levels of vWF:RCo and FVIII neverexceeded acceptable limits.

In this report, the estimated blood loss averagedabout one third of the total blood volume and wassimilar to published data.2,18,19 Intravascular volumereplacement was achieved using a third-generationhydroxyethyl starch (Voluven), which has less impacton hemostasis than older starches. The total volumeinfused in our patient was 150 mL or 16.7 mL/kg. Thisis far below 50 mL/kg, which is considered to besafe.20

Factor VIII level is the most important determinantof surgical bleeding in vWD patients.7,21 In our pa-tient, FVIII activity was close to normal values duringsurgery and the first postoperative days. Managingthese patients perioperatively requires therapy toachieve acceptable plasma concentration targets ofdeficient coagulation and hemostasis factors. Thisconcept is supported by previous reports on neuro-surgical interventions in hemophilic patients.22,23

In conclusion, we report the successful manage-ment of a craniosynostosis repair in a child withsevere Type I vWD diagnosed during the preoperativeassessment. The success of the procedure basicallyrelied on careful communication among the differentphysicians managing the patient and developing aperioperative strategy based on close monitoring

and appropriate replacement of deficient hemostasisfactors.

APPENDIXThe PFA-100 device (platelet function analyzer,

Siemens) measures platelet adhesion and aggregation(primary hemostasis) in vitro. This test is clearly supe-rior to bleeding time to assess hemostasis disturbancesassociated with anomalies of von Willebrand disease.It mimics an artificial vessel consisting of a samplereservoir, a capillary, and a biologically active mem-brane with a central aperture. The aperture is coatedwith collagen and adenosine diphosphate or collagenand epinephrine. The application of a constant nega-tive pressure aspirates an anticoagulated bloodsample from the reservoir through the capillary,which simulates the resistance of a small artery, andthrough the aperture, which simulates the injured partof the vessel wall. A platelet plug forms that graduallyoccludes the aperture. As a consequence, the bloodflow through the aperture gradually decreases and,finally, stops. The time needed for blood flow inter-ruption (the “closure time”) is recorded in seconds.

REFERENCES

1. Duncan C, Richardson D, May P, Thiruchelvam J, Shong DC,Potter F, Grogan J, Caswell M. Reducing blood loss in synostosissurgery: the liverpool experience. J Craniofac Surg 2008;19:1424–30

2. Haas T, Fries D, Velik-Salchner C, Oswald E, Innerhofer P.Fibrinogen in craniosynostosis surgery. Anesth Analg 2008;106:725–31

3. Nichols WL, Hultin MB, James AH, Manco-Johnson MJ, Mont-gomery RR, Ortel TL, Rick ME, Sadler JE, Weinstein M, YawnBP. von Willebrand disease (VWD): evidence-based diagnosisand management guidelines, the National Heart, Lung, andBlood Institute (NHLBI) Expert Panel report (USA). Haemo-philia 2008;14:171–232

4. Budde U. Diagnosis of von Willebrand disease subtypes: impli-cations for treatment. Haemophilia 2008;14(suppl 5):27–38

5. Macfarlane DE, Stibbe J, Kirby EP, Zucker MB, Grant RA,McPherson J. A method for assaying von Willebrand factor(ristocetin cofactor). Thromb Diath Haemorrh 1975;34:306–8

6. Groner A. Pathogen safety of plasma-derived products—Haemate P/Humate-P. Haemophilia 2008;14(suppl 5):54–71

7. Mannucci PM. Treatment of von Willebrand’s disease. N EnglJ Med 2004;351:683–94

8. Kreuz W. von Willebrand’s disease: from discovery to therapy—milestones in the last 25 years. Haemophilia 2008;14(suppl 5):1–2

9. Michiels JJ, Berneman ZN, van der PM, Schroyens W, Budde U,van Vliet HH. Bleeding prophylaxis for major surgery inpatients with type 2 von Willebrand disease with an intermedi-ate purity factor VIII-von Willebrand factor concentrate(Haemate-P). Blood Coagul Fibrinolysis 2004;15:323–30

10. Thompson AR, Gill JC, Ewenstein BM, Mueller-Velten G,Schwartz BA. Successful treatment for patients with von Wille-brand disease undergoing urgent surgery using factorVIII/VWF concentrate (Humate-P). Haemophilia 2004;10:42–51

11. Mannucci PM, Bettega D, Cattaneo M. Patterns of developmentof tachyphylaxis in patients with haemophilia and von Wille-brand disease after repeated doses of desmopressin (DDAVP).Br J Haematol 1992;82:87–93

12. Mahdy AM, Webster NR. Perioperative systemic haemostaticagents. Br J Anaesth 2004;93:842–58

13. Auerswald G, Kreuz W. Haemate P/Humate-P for the treat-ment of von Willebrand disease: considerations for use andclinical experience. Haemophilia 2008;14(suppl 5):39–46

14. Revel-Vilk S, Schmugge M, Carcao MD, Blanchette P, Rand ML,Blanchette VS. Desmopressin (DDAVP) responsiveness in chil-dren with von Willebrand disease. J Pediatr Hematol Oncol2003;25:874–9


15. Sutor AH. DDAVP is not a panacea for children with bleedingdisorders. Br J Haematol 2000;108:217–27

16. van Vliet HH, Kappers-Klunne MC, Leebeek FW, Michiels JJ.PFA-100 monitoring of von Willebrand factor (VWF) responsesto desmopressin (DDAVP) and factor VIII/VWF concentratesubstitution in von Willebrand disease type 1 and 2. ThrombHaemost 2008;100:462–8

17. Berntorp E. Prophylaxis in von Willebrand disease. Haemo-philia 2008;14(suppl 5):47–53

18. Hans P, Collin V, Bonhomme V, Damas F, Born JD, Lamy M.Evaluation of acute normovolemic hemodilution for surgical re-pair of craniosynostosis. J Neurosurg Anesthesiol 2000;12:33–6

19. Williams GD, Ellenbogen RG, Gruss JS. Abnormal coagulationduring pediatric craniofacial surgery. Pediatr Neurosurg 2001;35:5–12

20. Kozek-Langenecker SA, Jungheinrich C, Sauermann W, Van derLP. The effects of hydroxyethyl starch 130/0.4 (6%) on blood lossand use of blood products in major surgery: a pooled analysis ofrandomized clinical trials. Anesth Analg 2008;107:382–90

21. Borel-Derlon A, Federici AB, Roussel-Robert V, Goudemand J,Lee CA, Scharrer I, Rothschild C, Berntorp E, Henriet C, TellierZ, Bridey F, Mannucci PM. Treatment of severe von Willebranddisease with a high-purity von Willebrand factor concentrate(Wilfactin): a prospective study of 50 patients. J Thromb Hae-most 2007;5:1115–24

22. Walker JA, Dixon N, Gururangan S, Thornburg C. Perioperativefactor IX replacement for surgical resection of a suprasellarastrocytoma in a child with severe haemophilia B. Haemophilia2008;14:387–9

23. Cermelj M, Negro F, Schijman E, Ferro AM, Acerenza M, PollolaJ. Neurosurgical intervention in a haemophilic child with a sub-dural and intracerebral haematoma. Haemophilia 2004;10:405–7


Pediatric AnesthesiologySection Editor: Peter J. Davis

Overweight/Obesity and Gastric Fluid Characteristics inPediatric Day Surgery: Implications for FastingGuidelines and Pulmonary Aspiration Risk

Scott D. Cook-Sather, MD*

Paul R. Gallagher, MA†

Lydia E. Kruge, BA*

Jonathan M. Beus, BSE*

Brian P. Ciampa, BS*

Kevin Conor Welch, MA*

Sina Shah-Hosseini, MSE*

Jieun S. Choi, MD*

Reshma Pachikara, BS*

Kim Minger, BSN, CNOR‡

Ronald S. Litman, DO*

Mark S. Schreiner, MD*

BACKGROUND: The safety of 2-h preoperative clear liquid fasts has not been established foroverweight/obese pediatric day surgical patients. Healthy children and obese adults whofasted 2 h have small residual gastric fluid volumes (GFVs), which are thought toreflect low pulmonary aspiration risk. We sought to measure the prevalence ofoverweight/obesity in our day surgery population. We hypothesized that neither bodymass index (BMI) percentile nor fasting duration would significantly affect GFV or gastricfluid pH. In children who were allowed clear liquids up until 2 h before surgery, wehypothesized that overweight/obese subjects would not have increased GFV overlean/normal subjects and that emesis/pulmonary aspiration events would be rare.METHODS: Demographics, medical history, height, and weight were recorded for1000 consecutive day surgery patients aged 2–12 yr. In addition, 1000 day surgerypatients (age 2–12 yr) undergoing general endotracheal anesthesia were enrolled.After tracheal intubation, a 14–18F orogastric tube was inserted and gastriccontents evacuated. Medications, fasting interval, GFV, pH, and emetic episodeswere documented. Age- and gender-specific Center for Disease Control andPrevention growth charts (2000) were used to determine ideal body weight (IBW �50th percentile) and to classify patients as lean/normal (BMI 25th–75th percentile),overweight (BMI �85th to �95th percentile), or obese (BMI � 95th percentile).RESULTS: Of all day surgery patients, 14.0% were overweight and 13.3% were obese. Obesechildren had lower GFV per total body weight (P � 0.001). When corrected for IBW,however, volumes GFV(IBW) were identical across all BMI categories (mean 0.96 mL/kg,sd 0.71; median 0.86 mL/kg, IQR 0.96). Preoperative acetaminophen and midazolamcontributed to increased GFV(IBW) (P � 0.025 and P � 0.001). Lower GFV(IBW) wasassociated with ASA physical status III (P � 0.024), male gender (P � 0.012), gastroesoph-ageal reflux disease (P � 0.049), and proton pump inhibitor administration (P � 0.018).GFV(IBW) did not correlate with fasting duration or age. Decreased gastric fluid aciditywas associated with younger age (P � 0.005), increased BMI percentile (P � 0.036), andAfrican American race (P � 0.033). Emesis on induction occurred in eight patients (50% ofwhom were obese, P � 0.052, and 75% of whom had obstructive sleep apnea, P � 0.061).Emesis was associated with increased ASA physical status (P � 0.006) but not with fastingduration. There were no pulmonary aspiration events.CONCLUSIONS: Twenty-seven percent of pediatric day surgery patients areoverweight/obese. These children may be allowed clear liquids 2 h before surgeryas GFV(IBW) averages 1 mL/kg regardless of BMI and fasting interval. Rare emeticepisodes were not associated with shortened fasting intervals in this population.(Anesth Analg 2009;109:727–36)

The prevalence of pediatric obesity and overweightin the United States has increased from 5% in the 1960sto 16% in the early 2000s.1–3 Obesity affects an increas-ingly large proportion of adult surgical populations

worldwide4,5 and, with a similar trend in pediatricpopulations, nearly one third of children presentingfor surgery are overweight or obese.6,7 There has beenconcern that obesity places adults at increased risk ofperioperative pulmonary aspiration.8 Overweight andobese children may also be at risk, although the natureand degree of risk have not been established.9 Becausepulmonary aspiration is rare,10,11 residual gastric fluidvolume (GFV) has been used as a surrogate marker forpulmonary aspiration risk in studies evaluating fast-ing protocol safety.12–14 Studies in obese adults dem-onstrate acceptably low GFV after 8- to 10-h fasts,15,16

and, most recently, 2 h after ingestion of clear liquid.17

Even in obese parturients, gastric emptying of 300 mLwater is not delayed beyond that of normal subjects,with gastric antral volume returning to baseline in

From the Departments of *Anesthesiology and Critical CareMedicine, †Biostatistics and Epidemiology, and ‡Nursing, TheChildren’s Hospital of Philadelphia, The University of PennsylvaniaSchool of Medicine, Philadelphia, Pennsylvania.

Accepted for publication May 8, 2009.Supported by Children’s Anesthesia Associates, Ltd.Address correspondence and reprint requests to Scott D. Cook-

Sather, MD, Department of Anesthesiology and Critical Care Medi-cine, The Children’s Hospital of Philadelphia, 34th St. and CivicCenter Blvd., Philadelphia, PA 19104-4399. Address e-mail [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181b085ff


1 h.18 However, perioperative GFV after a standard2-h clear liquid fast has not been investigated inoverweight/obese pediatric populations.

In this study, we sought to determine the preva-lences of overweight and obesity in our pediatric daysurgery population and to document subject demo-graphics and coexisting diseases. We examined asubset of patients requiring tracheal intubation to testour hypotheses that GFV and gastric fluid pH do notchange with body mass index (BMI), fasting interval,or demographics. Finally, by studying a large pediatricpopulation with significant proportions of overweight/obese subjects, we sought to determine the incidencesof and the risk factors for emesis and pulmonaryaspiration on induction of anesthesia.

METHODSIRB approval was obtained for this two-part pro-

spective study.

Part A: EpidemiologyWe examined the prevalences of overweight and

obesity in our day surgery population. Subjects’records were reviewed with IRB waiver of the require-ment for informed consent. We screened the operatingroom schedule at The Children’s Hospital of Philadel-phia (CHOP) using OR Manager (Picis, Wakefield,MA) for 1000 consecutive day surgery patients aged2–12 yr presenting from October to November 2005 atthe main hospital (Philadelphia, PA) and all CHOPambulatory surgery facilities (Chalfont, PA; Exton,PA; Voorhees, NJ). Wheelchair-bound patients andothers whose height could not be measured wereexcluded. Patient height, weight, age, gender, race,ethnicity, medical history, and planned surgical pro-cedure were recorded. BMI in kg/m2 was calculatedfor each patient, and the 2000 Center for DiseaseControl and Prevention (CDC) growth charts* wereused to determine BMI percentiles. For categoricalcomparisons, subjects were divided into lean/normal(BMI � 25th–75th percentiles), overweight (BMI �85th to �95th percentiles), and obese (BMI �95thpercentile) groups. The interquartile lean/normalgroup was defined with the intention of creating arobust normative subject cohort with BMIs neitheradversely affected by chronic illness and/or otherunknown factors limiting growth and developmentnor, in balance, skewed by slightly heavier subjectswith BMIs between the 75th and 85th percentiles.

ChartMaxx� (MedPlus, Mason, OH) and Com-puRecord� (Phillips Medical Systems, Bothell, WA)databases were used to obtain and verify patientinformation. Significant medical conditions were ab-stracted and prevalences calculated. Reactive airwaydisease (RAD) had been documented in a Com-puRecord checkbox with a section for supporting

narrative, and young children with bronchiolitisand/or breathing problems only with upper respira-tory infections were excluded. Patients with a historyof gastroesophageal reflux disease (GERD) and takingmedication within 1 mo before surgery were defined ashaving current disease. Patients with obstructive sleepapnea (OSA) had a broad range of disease, from mod-erate apneic pauses to severe obstruction with arterialoxyhemoglobin desaturation documented by sleepstudy. Data were analyzed to determine associationsbetween BMI categories and age, gender, race, ethnicity,and common coexisting diseases and conditions.

Part B: Gastric Fluid CharacteristicsFrom October 2005 to May 2007, 1000 evaluable day

surgery subjects were enrolled, who in addition tosatisfying Part A inclusion criteria also had plannedtracheal intubations. Exclusion criteria were childrenin whom placement of an orogastric tube could inter-fere with the scheduled surgery (e.g., upper endos-copy), preoperative presence of an oro/nasogastrictube, contraindication to patient repositioning or toorogastric tube placement, and preoperative use ofopioids or other drugs known to slow gastrointestinaltransit. Verbal permission was obtained fromparents/legal guardians of the participants. Childrenaged �7 yr provided assent. The day before surgery,patients were instructed to follow standard fastingguidelines: no solids after midnight and clear liquidsup until 2 h before hospital arrival. Recent medica-tions and clear liquid fasting intervals were recordedas well as demographic data required for Part A. As isinstitutional standard of practice, oral preoperativemedications were administered 15–30 min before in-duction of anesthesia: midazolam syrup (Roxane Lab-oratories, Columbus, OH, 2 mg/mL) 0.5 mg/kg to amaximum of 10 mg � 5 mL and concentrated acet-aminophen infants’ drops (McNeil PPC, Fort Wash-ington, PA, 100 mg/mL) 10–15 mg/kg to a maximumof 650 mg � 6.5 mL, followed by 5–10 mL of applejuice.

After induction of anesthesia and tracheal intuba-tion, a 14–18F multiorificed orogastric tube (Vygon,Ecouen, France) was placed and gastric fluid wasaspirated using a 60-mL catheter-tip syringe (BectonDickinson, Franklin Lakes, NJ) while the patient wasplaced in the supine and left and right lateral decubi-tus positions. GFV was measured using the graduatedsyringe markings and pH was measured using color-imetric paper (Micro Essential Laboratory, Brooklyn,NY). Episodes of emesis on induction were recorded,along with contextual details regarding timing, airwaydifficulty, and other potentially contributing factors.The attending anesthesiologist of record made anestimate of emetic volume immediately after patientintubation and then further evacuated residual stom-ach contents as above. To document pulmonary aspi-ration, we looked for evidence of bilious secretionssuctioned from the tracheal tube, particulate matter at

*Available at: http://www.cdc.gov/nchs/about/major/nhanes/growthcharts/clinical_charts.htm. Accessed December 4, 2008.

728 Gastric Fluid in Obese Children ANESTHESIA & ANALGESIA

or below the vocal chords, bronchospasm, and/orpersistent increased supplemental oxygen require-ment. BMI and BMI category were determined as inPart A, and the 2000 CDC growth charts were used tocalculate ideal body weight (IBW � the 50th percentilebased on gender and age) in kilograms.

Sample Size Considerations and Statistical MethodsFor Part A, 1000 cases were chosen to provide

reliable prevalence estimates. When the sample size is1000, a two-sided 95% confidence interval (CI) for asingle proportion using the large sample normal ap-proximation will extend �0.019 from either side of theobserved proportion (range, 0.038), when the expectedproportion is 10%. If the expected proportion is 15%,then the total range of 95% CI would be 0.044. Associa-tion between categorical variables and lean/normal,overweight, and obese cohorts were examined using �2

tests. Differences in continuous variables (e.g., age andBMI) among various groupings were examined usingMann–Whitney or Kruskal–Wallis tests.

For Part B, 1000 patients were recruited to deter-mine the influence of BMI on GFV. With regard toGFV (in mL) and pH and how they vary with weightand BMI, we used a 0.01 two-sided Fisher’s z-test ofthe null hypothesis that the Pearson correlation coef-ficient is 0.00 and had 80% power to detect a correla-tion of 0.11 with this sample size. Within a group of150 obese patients, there was 80% power to detect acorrelation coefficient of 0.28. The Kruskal–Wallis testwas used to explore whether GFV (in mL and mL/kgIBW) and pH are similar in lean/normal, overweight,and obese subjects who fasted 2–4 h for clear liquids.Based on pairwise comparisons between groups, asample size of 150 in each group had 80% power todetect a probability of 0.62 that an observation in, forexample, the lean/normal group was less than anobservation in the obese group using a Wilcoxon(Mann–Whitney) rank-sum test with a 0.01 two-sidedsignificance level. The null hypothesis was that thisprobability was 0.50. For a multiple linear regressionmodel which included four covariates (fasting dura-tion, medications, medical conditions, and surgicalprocedure) with a squared multiple correlation R2 of0.05, a sample size of 1000 gave 80% power to detect atthe 0.01 level of significance an increase in R2 of 0.014because of the inclusion of two additional covariates(age and BMI).

Both GFV (in mL) and gastric pH were plottedagainst absolute body weight (ABW) and BMI, andcorrelation coefficients were calculated to examine therelationships between these gastric fluid characteristicsand ABW and BMI. A series of univariate analyses,including Spearman correlations and Mann–Whitneyand Kruskal–Wallis tests, were used to examine fac-tors associated with GFV normalized to IBW,GFV(IBW), and gastric fluid pH. Following univariateprocedures, linear regression models were used toexplore potential predictors of GFV(IBW) and pH.

Among the pool of potential predictors were ASAphysical status; age; BMI; gender; race/ethnicity; fast-ing duration; midazolam, acetaminophen, and albuteroladministration; and coexisting diseases/disorders suchas attention deficit disorder, GERD, RAD, and OSA.Variables related to medications, medical conditions,and surgical procedures were used in the regressionmodels by creating dichotomous variables and/or bydummy coding. Finally, patients with emetic episodeson induction of anesthesia were compared with patientswho had no emesis across a series of potential riskfactors, using Mann–Whitney tests, �2 test, and Fisher’sexact tests. All data analysis was conducted usingSPSS for Windows, Release 15.0, 2006 (SPSS,Chicago, IL).

RESULTSPart A

Because of exclusion criteria (most commonly, iden-tification of wheelchair-bound patients or subject’s ageolder than 12 yr on day of surgery), rescheduling,booking duplication, and/or incomplete data, 1177 pa-tients were screened to enroll 1000 evaluable subjects. Avariety of surgical services were represented: otolaryn-gology (46.6%), general surgery (10.5%), urology(10.1%), and plastic surgery (8.3%), with combined ser-vices rendered in 2.2%. Of the evaluable subjects, 42.4%were categorized as lean/normal, 14.0% as overweight,and 13.3% as obese. Table 1 displays demographicfeatures of the day surgery population overall. Althoughthere were more males (59.3%) than females (40.7%),there were no gender differences across BMI categories.Racial/ethnic representation was consistent with that ofPhiladelphia and the surrounding Delaware Valley:Caucasian (68.5%), African American (19.1%), Hispanic(2.9%), Asian (2.0%), and other race (7.4%). Subjectsidentified in the latter group were often of mixed racialbackgrounds. Obesity appeared with more than ex-pected frequency in Hispanic subjects (46% vs 19%overall, P � 0.048). Obese children were more likely to beolder (7.1 � 2.8 yr) than their overweight (6.7 � 3.1 yr)and lean/normal (6.2 � 3.1 yr) counterparts (P � 0.002).There were no differences in weight category distribu-tions among the four CHOP sites.

There was a significant association between ASAphysical status and weight category, with subjectsassigned ASA physical status III more likely to beoverweight or obese (P � 0.030). Common coexistingdiseases and conditions across the entire populationsample included RAD (22.2%), history of prematurity(15.5%), OSA (13.1%), heart disease (9.9%), and GERD(7.2%). Less common significant medical conditionsclassified as “other” (i.e., cancer, autism, renal disease,and genetic disorders) were found in 16% of thepatients. Patients with RAD were significantly older(P � 0.004) and had higher BMI percentiles (P � 0.035)than patients without RAD, although there were nodifferences across BMI categories. Patients with GERD


and OSA were younger (P � 0.004 and P � 0.050,respectively) but were not more likely to be over-weight or obese. Neither heart disease nor a history ofprematurity was associated with BMI percentile.However, patients with “other” medical conditionswere more likely to be obese (P � 0.001), and therewas a trend for patients with diabetes (0.4%) to beoverweight or obese (P � 0.067).

Part BTo enroll 1000 evaluable subjects, 1201 day surgery

patients were approached, with 136 families decliningparticipation. Sixty-five subjects were withdrawn afterenrollment, most commonly after the planned intra-operative airway management changed from trachealintubation to laryngeal mask placement. Table 2 con-tains descriptive statistics for the Part B cohort. Aver-age GFV in mL/kg of ABW, GFV(ABW), was lowerfor the obese cohort (0.66 � 0.49 mL/kg) than for boththe lean/normal (0.97 � 0.67 mL/kg) and overweight(0.92 � 0.66 mL/kg) cohorts (P � 0.001) (Fig. 1).However, when GFV was corrected for IBW,GFV(IBW), there was no difference between BMIcategories: obese (1.03 � 0.75 mL/kg), overweight(1.08 � 0.78 mL/kg), and lean/normal (0.97 � 0.69mL/kg). GFV(IBW) across all subjects averaged 0.96 �0.71 mL/kg, with a median of 0.86 mL/kg and an IQRof 0.96. Of 1000 patients, only 106 (10.6%) ingestedclear liquids 2–4 h before surgery. In these patients,GFV(ABW) was also lower in the obese group (0.63 �0.35 mL/kg) compared with that in the lean/normal(1.07 � 0.63 mL/kg) and overweight (0.87 � 0.77mL/kg) groups (P � 0.011). Once again, when cor-rected for IBW, GFV did not differ among weightcategories: obese (1.00 � 0.58 mL/kg), overweight(1.05 � 0.90 mL/kg), lean/normal (1.06 � 0.65

mL/kg). There was no difference in GFV(IBW) for thissubset of patients who fasted 2–4 h (1.04 � 0.68mL/kg) when compared with all study patients(1.01 � 0.72 mL/kg) who fasted for up to 24 h.Including all subjects, the average fasting durationwas 9.7 � 5.0 h with a median of 11.5 h and an IQR of9.5. Fasting duration did not affect gastric pH. As BMIpercentile increased, however, pH increased slightly(r � 0.068, P � 0.036).

Table 3 displays univariate analyses results involvingGFV(IBW) and gastric pH. Three medications (acetamin-ophen, midazolam, and lansoprazole), ASA physicalstatus III, active GERD, and gender were significantpredictors of GFV(IBW). African Americans had highergastric pH (P � 0.033), and increased pH was associatedwith younger age (P � 0.005). Notably, OSA, RAD, andthe category of “other significant medical conditions”were not associated with GFV(IBW) or gastric pH differ-ences. Patients who took lansoprazole (Prevacid�)within 12 h of anesthetic induction had dramaticallylower GFV(IBW) (r � �0.89, P � 0.005). Gastric pH,however, was not significantly affected by the adminis-tration of any preoperative medication recorded within12 h of surgery.

Multivariable linear regression models were exam-ined for GFV(IBW) and gastric pH, and the resultingunstandardized regression coefficients are presentedin Table 4. These regression models confirmed theassociations of midazolam, lansoprazole, and genderwith GFV(IBW) and the associations of African Ameri-can race and age with gastric pH found in univariateanalysis. In addition, BMI characteristics were foundto correlate with both GFV(IBW) and gastric fluid pH,though to limited degrees. Increasing BMI percentile(noncategorical) was associated with increasing

Table 1. Day Surgery Demographics

Total n Lean/normal Overweight ObesePart A cohort 1000 424 (42%) 140 (14%) 133 (13%)Agea (yr) 6.4 � 3.0 6.2 � 3.1 6.7 � 3.1 7.1 � 2.8Heighta (cm) 116.6 � 20.3 114.9 � 20.0 120.8 � 21.4 123.5 � 19.8Weighta (kg) 24.9 � 12.5 22.2 � 9.0 29.5 � 13.4 37.3 � 17.2BMIa (kg/m2) 17.3 � 3.3 16.1 � 1.0 19.0 � 2.1 23.0 � 4.3

n (%) n (%) n (%) n (%)

GenderMale 593 (59.3) 251 (59.2) 90 (64.3) 78 (58.7)Female 407 (40.7) 173 (40.8) 50 (35.7) 55 (41.4)

Race/ethnicityCaucasian 685 (68.5) 287 (67.7) 96 (68.6) 84 (63.2)African American 191 (19.1) 81 (19.1) 25 (17.9) 30 (22.6)Hispanic 29 (2.9) 9 (2.1) 4 (2.9) 11 (8.3)Asian 20 (2.0) 12 (2.8) 3 (2.1) 1 (0.8)Other 74 (7.4) 34 (8.0) 12 (8.6) 7 (5.3)

ASA physical statusI 374 (37.4) 165 (38.9) 60 (42.9) 38 (28.6)II 489 (48.9) 215 (50.7) 58 (41.4) 75 (56.4)III 136 (13.6) 44 (10.4) 22 (15.7) 20 (15.0)

a Age, height, weight, and body mass index (BMI) displayed by mean � SD.


GFV(IBW) (coefficient � 0.167, P � 0.018) and BMIitself was positively correlated with pH (coefficient �0.019, P � 0.001).

Of the patients enrolled in Part B, eight (0.8%; CI,3.5–15.7/1000) vomited during induction of anesthe-sia (Table 5). None had evidence of pulmonary aspi-ration. Emesis was statistically associated with ASAphysical status II or III (P � 0.006) only (Table 6).Emesis was not associated with gender, age, race, orpreoperative medication. Mean fasting duration wasnot significantly different for patients who vomitedcompared with those who did not: 11.2 � 5.9 h vs9.7 � 5.0 h, respectively. Composite volume, based onclinical estimate and subsequent GFV recovery, werewithin the 95% CI for average GFV(IBW). There wereassociative trends between emetic episodes and OSA(6 of 8 subjects, P � 0.061) and between emesis and

BMI category, when comparing the lean/normal orobese groups with the overweight group (P � 0.052).Six patients (75%) who had an episode of emesis werescheduled for tonsillectomy and/or adenoidectomy.Specific airway difficulties preceded emesis in threecases. Three patients experienced emetic episodesshortly after exposure to N2O for IV catheter place-ment or very early in the induction sequence, beforeloss of consciousness. Two children weighing 96 and142 kg had planned rapid sequence inductions thatincluded propofol (200–250 mg) and succinylcholine(100 mg), and the rest had inhaled induction ofanesthesia.

DISCUSSIONFollowing an unequivocal trend of increasing pedi-

atric overweight and obesity in the United States1–3

and other developed nations,19,20 27% of our currentday surgery population has a BMI �85th percentilebased on year 2000 CDC growth charts. That is, morethan one quarter of our day surgery caseload has aBMI at or above what was the upper 15th percentile ofthe pediatric population less than a decade ago. This isconsistent with recent work by Nafiu et al.6 and Tait etal.7 who found 32% of two Midwestern pediatricsurgical populations to be overweight/obese. Although

Figure 1. Gastric fluid volume and body mass index. Box-plots of gastric fluid volume levels by categories based onbody mass index. Sample sizes: n � 386; n � 146; n � 178.The box represents the interquartile range containing 50% ofvalues. The whiskers are lines that extend from the box tothe highest and lowest values, excluding outliers. A lineacross the box indicates the median. Outliers (o) are definedas cases with values between 1.5 and 3 box lengths fromeither end of the box. Extreme outliers (*) are cases withvalues more than three box lengths from either end of thebox. GFV � gastric fluid volume; ABW � absolute bodyweight; IBW � ideal body weight.

Table 2. Part B Cohort Descriptives (N � 1000)

Mean � sdAge (yr) 5.8 � 2.8Height (cm) 114.0 � 19.2Weight (kg) 24.4 � 14.2BMI (kg/m2) 17.6 � 4.2BMI percentile (%) 61.0 � 31.7GFV(ABW) (mL/kg) 0.88 � 0.65GFV(IBW) (mL/kg) 0.96 � 0.71Gastric fluid pH 2.1 � 0.7

n (%)

GenderMale 578 (57.8)Female 422 (42.2)

Race/ethnicityAfrican American 304 (30.4)Caucasian 574 (57.4)Other 122 (12.2)

BMI percentile groupLean/normal 386 (38.6)Overweight 146 (14.6)Obese 178 (17.8)

ASA physical statusI 291 (29.1)II 665 (66.5)III 44 (4.4)

Medical conditionsOSA 384 (38.4)RAD 237 (23.7)GERD 25 (2.5)Diabetes 1 (0.1)Other disease 108 (10.8)

MedicationsAcetaminophen 967 (96.7)

No acetaminophen 33 (3.3)Midazolam 975 (97.5)

No midazolam 25 (2.5)Lansoprazole 4 (0.4)Metoclopramide 2 (0.2)Omeprazole 6 (0.6)Ranitidine 2 (0.2)Other medications 125 (12.5)

BMI � body mass index; GFV(ABW) � gastric fluid volume in mL/kg of absolute bodyweight; GFV(IBW) � gastric fluid volume in mL/kg of ideal body weight; OSA �obstructive sleep apnea; RAD � reactive airways disease; GERD � gastroesophagealreflux disease.


overweight/obesity prevalence may be lower in somerural areas when compared with that in urban areas,19

nearly uniform BMI distributions at our main hospital

downtown and at each of the three suburban surgicalcenters suggest that the pediatric obesity epidemicdoes not spare suburbia.

Table 3. Part B Cohort, Univariate Analysis Results for GFV(IBW) and pH

GFV(IBW) pH

Spearman r P Spearman r PAge (yr) 0.035 0.26 �0.090 0.005Height (cm) 0.066 0.036 �0.080 0.013Weight (kg) 0.075 0.017 �0.048 0.14BMI (kg/m2) 0.044 0.16 0.063 0.053BMI percentile 0.061 0.053 0.068 0.036

Mean � SD P* Mean � SD P*

Gender 0.012 0.35Male 0.92 � 0.71 2.1 � 0.7Female 1.02 � 0.71 2.1 � 0.7

Race/ethnicity 0.54 0.033African American 0.96 � 0.74 2.2 � 0.8Caucasian 0.99 � 0.72 2.1 � 0.7Other 0.89 � 0.61 2.1 � 0.6

BMI percentile group 0.38 0.20Lean/normal 0.97 � 0.69 2.1 � 0.7Overweight 1.08 � 0.78 2.2 � 0.8Obese 1.03 � 0.75 2.2 � 0.7

ASA physical status 0.024 0.15I 0.99 � 0.66 2.1 � 0.6II 0.97 � 0.74 2.1 � 0.7III 0.72 � 0.63 2.1 � 0.8

Medical conditionsOSA 0.94 � 0.72 0.18 2.2 � 0.7 0.056RAD 0.99 � 0.74 0.58 2.1 � 0.6 0.66GERD 0.67 � 0.46 0.049 2.3 � 0.8 0.18Diabetes 0.84 0.96 2.0 0.98Other disease 0.86 � 0.61 0.20 2.1 � 0.8 0.87

MedicationsAcetaminophen 0.97 � 0.71 0.025 2.1 � 0.7 0.31

No acetaminophen 0.73 � 0.71 2.0 � 0.6Midazolam 0.97 � 0.71 0.001 2.1 � 0.7 0.20

No midazolam 0.57 � 0.64 1.9 � 0.5Lansoprazole 0.14 � 0.12 0.005 2.0 � 0.0 0.97Metoclopramide 0.81 � 0.77 0.82 3.5 � 2.1 0.17Omeprazole 0.82 � 0.51 0.78 2.6 � 1.3 0.40Ranitidine 1.34 � 0.13 0.24 2.0 � 0.0 0.98Other 1.01 � 0.74 0.53 2.1 � 0.7 0.86

GFV(IBW) � gastric fluid volume in mL/kg of ideal body weight; BMI � body mass index; OSA � obstructive sleep apnea; RAD � reactive airways disease; GERD � gastroesophageal reflux disease.* P values are based on Mann–Whitney or Kruskal–Wallis tests.

Table 4. Part B Cohort, Regression Analysis Results for GFV(IBW) and pH

GFV (IBW) pH

C SE P C SE PAge (yr) �0.040 0.009 �0.0005BMI (kg/m2) 0.019 0.006 0.001BMI percentile 0.167 0.071 0.018Gendera 0.089 0.045 0.049African Americanb 0.135 0.049 0.006Midazolamc 0.379 0.143 0.008Lansoprazolec �0.837 0.353 0.018GFV(IBW) � gastric fluid volume in mL/kg of ideal body weight; C � unstandardized regression coefficient; BMI � body mass index.a Gender: 0 � male, 1 � female.b Race: 0 � all others, 1 � African American.c Medication: 0 � no, 1 � yes.


Obesity is associated with several demographic fac-tors and coexisting conditions. Racial/ethnic back-grounds have been linked to an increased prevalence ofoverweight/obesity, as seen in our small subset ofchildren with Hispanic ancestry, but with a complexinterplay among genetics, culture, and socioeconomicstatus.21,22 We found RAD to be more common withincreasing BMI, though not in the categoricaloverweight/obese groups. This may be a result of ourrestrictive definition of RAD (excluding younger chil-dren who wheeze only with upper respiratory tractinfections), the observed cumulative nature of obesity,and the high prevalence of RAD in our study popula-tion. That we were unable to demonstrate increased

prevalences of specific coexisting diseases, such as RAD,hypertension, OSA, and Type II diabetes in the obesesubpopulation as observed by Tait et al.,7 may be aconsequence of our younger age cohort (mean 6,range, 2–12 yr versus mean 9, range, 2–18 yr) withmedical conditions that have yet to develop or haveyet to be definitively diagnosed.

Independent of subject background and coexistingconditions, we found that the average age of over-weight children was older than that of lean/normalsubjects, and that of obese children older still, portray-ing obesity as a cumulative disease beginning in earlychildhood, with, as Salsberry and Reagan note,22 aclear persistence across time. With overweight/obesechildren comprising a significant, and still growing,proportion of surgical caseloads, anesthesiologists mustrevisit the fundamental assumptions informing theirpractice and determine whether overweight/obese sub-populations deserve special precautions.

Guidelines for fasting have been liberalized acrossseveral surgical populations over the last 3 decades.However, an American Society of Anesthesiologiststask force cautioned that recommended fasting guide-lines, such as those for clear liquids, may not apply ormay need to be modified for obese subjects.11

Vaughan et al.8 suggested that obesity increased GFV(in mL) and acidity, raising concern that obese subjectswere at increased risk of pulmonary aspiration. Accu-mulating evidence in adults15–18 suggests otherwise,and our data support this evolving viewpoint as itapplies to pediatrics.

Growth and development complicate GFV com-parisons in children. Past studies have corrected GFV(mL/kg) using ABW, but GFV must also be consid-ered in relation to IBW. Some dimensions of gastricsize, such as fasting antral area, increase with BMI,23,24

Table 5. Emesis on Induction of Anesthesia: Case Synopses

Generaldemographic

BMI, kg/m2

(percentile) Medical history SurgeryFast(h)

EV(mL)

GFV(mL)

CV(mL/kg IBW) pH

Anesthetic issues surroundingemetic event

9 yr, 48 kg,PS 2, F, C

23.9 (97) OSA, frequent gagging/vomiting

T&A 11.5 10 56 2.2 2 Moderately difficult ventilationduring inhalation inductiondespite oral airway

11 yr, 142 kg,PS 3, M, C

54.0 (100) Craniopharyngioma,hypothalamic obesity,OSA

T&A 21 50 13 1.5 2 Vomited while awake afterexposure to 70% N2O forIV catheter placement

4 yr, 14.4 kg,PS 2, M, AA

15.0 (31) Prematurity, RAD Urethralmeatoplasty

4 ND 20 ND 2 During inhalation induction

8 yr, 24.5 kg,PS 2, M, AA

14.7 (19) OSA T&A 12 ND 0 ND ND During inhalation induction

4 yr, 16.9 kg,PS 2, F, AA

16.1 (73) OSA T&A, BMT 15.5 25 7 2.0 3 Crying on induction with O2/N2O and sevoflurane

Emesis before loss ofconsciousness

4 yr, 12.5 kg,PS 3, F, H

13.7 (7) Cerebral palsy,seizure, OSA

T&A 14.5 8 2 0.6 2 Multiple intubation attemptsby novice

12 yr, 96 kg,PS 2, F, C

33.7 (99) Prematurity, RAD Tympanoplasty 7 120 0 2.7 ND N2O for IV catheter placementVomited while awake at the

start of subsequent IVinduction

4 yr, 19.8 kg,PS 2, F, C/AA

18.3 (96) OSA Adenoidectomy,BMT

4.5 20 2 1.3 2 Airway manipulation underlight plane of anesthesia

Laryngospasm

Fast is the time interval between last clear liquid and induction of anesthesia. Residual gastric fluid volume (GFV) measured with standard gastric suction technique following emetic episode.All children had received preoperative oral acetaminophen and midazolam and are presented chronologically.C � Caucasian; AA � African American; H � Hispanic; F� female; M � male; PS � American Society of Anesthesiologists’ physical status; BMI � body mass index; T&A � tonsillectomyand adenoidectomy; BMT � bilateral myringotomy tube placement; OSA � obstructive sleep apnea; RAD � reactive airways disease; IV � intravenous; ND � no data; EV � clinician-estimatedvolume of vomitus; CV � composite volume, estimated vomitus plus GFV expressed in mL/kg ideal body weight (IBW).

Table 6. Emesis on Induction of Anesthesia: Analyses

Emesis(n � 8)

No emesis(n � 992)

Agea (yr) 7.5 � 3.6 5.8 � 2.8Heighta (cm) 125.2 � 29.6 113.9 � 19.1Weighta (kg) 46.8 � 47.5 24.3 � 13.5BMIa (kg/m2) 23.7 � 13.9 17.6 � 4.1

n (%) n (%) P

BMI percentile 0.052Lean/normal 2 (25.0) 384 (38.7)Overweight 0 146 (14.7)Obese 4 (50.0) 174 (17.5)

ASA physical status 0.006I 0 291 (29.2)II 6 (75.0) 659 (66.4)III 2 (25.0) 42 (4.2)

Medical conditionsOSA 6 (75.0) 379 (38.2) 0.061RAD 2 (25.0) 235 (23.5) NS

OSA � obstructive sleep apnea; RAD � reactive airways disease.a Age, height, weight, and body mass index (BMI) displayed by mean � SD.


but overall gastric volumes may not correlate withBMI.25 Stomach capacity in obesity would seem to bevariable at best, subject to both measurement tech-nique and additional patient factors.26 Under theconservative assumptions that obese children haveneither disproportionately larger lung mass (the tissueat risk in the event of aspiration) nor stomach volume(the organ of fluid containment), but might variablyingest more clear liquids than do lean/normal subjectsof the same age and gender, we corrected GFV forIBW. We then make the worst case for the presence ofany GFV-associated pulmonary aspiration risk inoverweight and obese subjects because GFV(IBW) ismagnified with increasing BMI. Although GFV(IBW)and BMI percentile were correlated to a small degree(r � 0.17, P � 0.018), we found a consistent average of1 mL/kg GFV(IBW) across all weight categories, sug-gesting that the absolute volumes of ingested material,accompanying oropharyngeal/esophageal/gastric se-cretions, and gastric emptying together correlate bet-ter with age and gender (hence IBW) than with ABWand the variable contribution of body fat.

With detailed medical histories available in theelectronic medical records, we searched beyondoverweight/obese categories to determine whethercoexisting diseases/disorders contributed to uniquesubpopulations affecting GFV or gastric pH. Univari-ate regression analysis (Table 3) revealed GERD to bestrongly associated with GFV, very likely due, in part,to its medical therapy. Corroborating earlier work byNishina et al.27 and Mikawa et al.,28 we found thatdecreased GFV was most dramatic in patients receiv-ing proton pump inhibitor therapy, especially in thosetaking lansoprazole (Prevacid). Proton pump inhibi-tors decrease osmotically active H� and concomitantfree water entering the gastric lumen, thereby poten-tially reducing GFV.

In the final regression analysis (Table 4), fourdemographic factors were found to be minimallyassociated with gastric fluid characteristics: gender,age, race, and BMI. Differing hormonal effects on thegastrointestinal tract may play some role in femaleshaving higher GFV(IBW) than males, but the 0.1mL/kg average difference is not of clinical impor-tance. Younger children and African American sub-jects were more likely to have increased pH, andwhether developmental, diet, and/or genetic factorscontribute, 95% of all subjects had pH �3, suggestingminimal clinical significance. The use of pH paper asopposed to a pH meter limited the sensitivity withwhich we could detect differences in gastric fluidacidity. Finally, although GFV(IBW) was positivelycorrelated with BMI percentile and gastric pH withabsolute BMI, the correlations were exceedingly smalland not likely useful to the clinician assessing thepotential risk of aspiration.

The absence of either preoperative oral acetamino-phen or midazolam administration was associatedwith decreased GFV. Withholding midazolam reduced

GFV(IBW) more on average than withholding acetamin-ophen (Table 3) and, of the two, only midazolam wassignificant in multiple regression analysis (Table 4). Thismay be the simple consequence of larger administeredvolume of midazolam (0.25 mL/kg) versus acetamino-phen (0.1–0.15 mL/kg) contributing differentially toGFV when children are in a weight range requiringsubmaximum doses. Earlier studies have shown averageGFV(ABW) (not corrected for IBW) to be �0.5 mL/kgafter 2- to 3-h clear liquid fasts.12–14 However, thesestudies predated the addition of preoperative oral acet-aminophen and reformulated midazolam, which incombination are standard components of our currentcare. These medications may increase GFV from histori-cal averages of �0.5 to now 1 mL/kg (IBW) by addingabsolute volume, by providing an osmotically activegastric load, and by stimulating salivary and gastricsecretions.

Several patients vomited on induction of anesthesia(Table 5), but, consistent with the known rarity ofpulmonary aspiration of gastric contents in the peri-operative period,11,29 none had evidence of aspiration.We found only one factor that was statistically asso-ciated with risk of emesis, ASA physical status II or III(Table 6). Although 50% (4/8) of subjects who vom-ited on induction were in the obese group, obesity asa risk factor did not reach statistical significance (P �0.052) in our series. Although this finding in a smallcohort may be prone to Type II error, it is consistentwith the recent results of Tait et al.7 in which, in 2025patients, one obese versus six nonobese subjects vom-ited during induction. We found that OSA was morelikely in those who vomited (75%) than those who didnot (38.2%), but with the high prevalence of OSA inour surgical population, this did not reach statisticalsignificance (P � 0.061). In evaluating risk factors byunivariate analysis for a variety of critical periopera-tive adverse respiratory events, Tait et al.7 demon-strated that OSA was most significant, with an oddsratio of 3.54. However, a much larger study popula-tion would be required to find any association be-tween OSA and pulmonary aspiration, a rare adverserespiratory event. Historical arguments of GERD andincompetent lower esophageal sphincters being riskfactors for vomiting were not borne out in our series asno patient who vomited had current or previousGERD.

Three of the eight subjects who vomited did soshortly after exposure to N2O, consistent with itsknown emetogenic properties. Large adult clinicaltrials conclusively link N2O administration and post-operative emesis,30 but there are also smaller pediatriccase series that document vomiting at the outset ofprocedures done under N2O.31,32 The mechanismsmay include direct stimulation of the vomiting center,distention of airspaces in the middle ear affecting thevestibular system, or distention of the gastrointestinaltract and concomitant visceral input to the vomitingcenter. Given the acute time course, however, it would


appear unlikely that increased gaseous distention ofthe stomach and small bowel would be significantenough to overcome lower gastroesophageal sphinc-ter tone and result in mechanical regurgitation. Fur-thermore, patient anxiety and/or pain on IV catheterplacement may play a role in emetic episodes duringthis time. From our limited data it is unclear whetherobesity poses an additive risk factor for vomiting withadministration of N2O.

Warner et al.11 found that pulmonary aspirationwas more likely to occur in patients who had airwaydifficulties or in patients under light planes of anes-thesia. Similarly, in our study, the majority of thepatients with an episode of emesis during inductionhad a history of OSA, were about to undergo airwaysurgery, and several had documented airway difficul-ties immediately before the event. Obese pediatricpatients are more likely to have OSA33 and anatomythat may make airway management more difficultduring anesthesia.6,7,34 Should OSA itself contribute toaspiration risk, however, our data demonstrate that itdoes not do so through increased GFV. Obese subjectsmay have longer induction times as anesthetic induc-tion drugs require more time to enter and achievesufficient concentrations in effect compartments. Thismay be due to airways narrowed by redundant softtissue and hindered anesthetic gas flow and/or largercompartments to be filled. Underdosing inductiondrugs, such as propofol and succinylcholine, the latterof which should be dosed on the basis of actual bodyweight, not IBW,35 may contribute risk in some cases.

Most significantly, there was no difference in fast-ing duration between those who vomited and thosewho did not, suggesting that as long as patients followthe recommended 2- to 4-h clear liquid fast, their riskfor emesis and pulmonary aspiration is not increased.Prolonged fasting does not completely mitigate risk:one subject in the emesis cohort fasted 21 h beforesurgery.

CONCLUSIONSOverweight and obese children are more than one

quarter of our elective day surgery caseload. Becausethe preoperative GFV(IBW) approximates 1 mL/kgindependent of BMI category and fasting interval �2h, we support extending the 2 h clear liquid AmericanSociety of Anesthesiologists fasting guideline to in-clude overweight and obese children who present forday surgery. Vomiting on induction of anesthesia inthis setting is uncommon and pulmonary aspiration israre. Emetic episodes during induction may be morecommon in obese patients and those with OSA, how-ever. There is no evidence to suggest that vomiting atthe beginning of elective pediatric day surgery isrelated to clear liquid fasting intervals beyond 2 h or toincreased GFVs in obesity.

ACKNOWLEDGMENTSThe authors thank several staff who helped with this

project: Lynda K. Anderson, RN; A. Michael Broennle, MD;Patricia M. Browne, MD; Sabaa Dam; Lisa M. Fazi-Diedrich, MD; Travis C. Foster, PhD; Elynor Furlan, RN;Michael Garafolo, RN; Linda Greim, RN; Patricia Haupt,RN; Ellen C. Jantzen, MD; George Karopovich, RN; ChristinaLiro, MS; Marcie Peyser-Friedman, CRNP; Leslie Plona,CRNP; Liban Rodol, MD; Linda L. Thomas, RN. The authorsalso thank many other house staff, anesthesiologists, nurseanesthetists, surgeons, and operating room personnel whoassisted us.

REFERENCES

1. Ogden CL, Flegal KM, Carroll MD, Johnson CL. Prevalence andtrends in overweight among US children and adolescents,1999–2000. JAMA 2002;288:1728–32

2. Hedley AA, Ogden CL, Johnson CL, Carroll MD, Curtin LR,Flegal KM. Prevalence of overweight and obesity among USchildren, adolescents, and adults, 1999–2002. JAMA 2004;291:2847–50

3. Ogden CL, Carroll MD, Curtin LR, McDowell MA, Tabak CJ,Flegal KM. Prevalence of overweight and obesity in the UnitedStates, 1999–2004. JAMA 2006;295:1549–55

4. Dindo D, Muller MK, Weber M, Clavien PA. Obesity in generalelective surgery. Lancet 2003;361:2032–5

5. Atkins M, White J, Ahmed K. Day surgery and body massindex: results of a national survey. Anaesthesia 2002;57:169–82

6. Nafiu OO, Ndao-Brumlay KS, Bamgbade OA, Morris M, Kasa-Vubu JZ. Prevalence of overweight and obesity in a US pediatricsurgical population. J Natl Med Assoc 2007;99:46–51

7. Tait AR, Voepel-Lewis T, Burke C, Kostrzema, Lewis I. Inci-dence and risk factors for perioperative adverse respiratoryevents in children who are obese. Anesthesiology 2008;108:375–80

8. Vaughan RW, Bauer S, Wise L. Volume and pH of gastric juicein obese patients. Anesthesiology 1975;43:686–9

9. Setzer N, Saade E. Childhood obesity and anesthetic morbidity.Paediatr Anesth 2007;17:321–6

10. Warner MA, Warner ME, Weber JG. Clinical significance ofpulmonary aspiration during the perioperative period. Anes-thesiology 1993;78:56–62

11. Warner MA, Warner ME, Warner DO, Warner LO, Warner EJ.Perioperative pulmonary aspiration in infants and children.Anesthesiology 1999;90:66–71

12. Splinter WM, Stewart JA, Muir JG. Large volumes of apple juicepreoperatively do not affect gastric pH and volume in children.Can J Anaesth 1990;37:36–9

13. Schreiner MS, Triebwasser A, Keon TP. Ingestion of liquidscompared with preoperative fasting in pediatric outpatients.Anesthesiology 1990;72:593–7

14. Cook-Sather SD, Liacouras CA, Previte JP, Markakis DA, Schre-iner MS. Gastric fluid measurement by blind aspiration inpaediatric patients: a gastroscopic evaluation. Can J Anaesth1997;44:168–72

15. Harter RL, Kelly WB, Kramer MG, Perez CE, Dzwonczyk RR. Acomparison of the volume and pH of gastric contents of obeseand lean surgical patients. Anesth Analg 1998;86:147–52

16. Jurvin P, Fevre G, Merouche M, Vallot T, Desmonts JM. Gastricresidue is not more copious in obese patients. Anesth Analg2001;93:1621–2

17. Maltby JR, Pytka S, Watson NC, McTaggart Cowan RA, FickGH. Drinking 300 mL of clear fluid two hours before surgeryhas no effect on gastric fluid volume and pH in fasting andnon-fasting obese patients. Can J Anaesth 2004;51:111–5

18. Wong CA, McCarthy RJ, Fitzgerald PC, Raikoff K, Avram MJ.Gastric emptying of water in obese pregnant women at term.Anesth Analg 2007;105:751–5

19. Wang Y, Lobstein T. Worldwide trends in childhood over-weight and obesity. Int J Pediatr Obes 2006;1:11–25

20. Kipping RR, Jago R, Lawlor DA. Obesity in children. Part 1:epidemiology, measurement, risk factors, and screening. BrMed J 2008;337:922–7


21. Parsons TJ, Power C, Logan S, Summerbell CD. Childhoodpredictors of adult obesity: a systematic review. Int J Obes RelatMetab Disord 1999;23:S1–S107

22. Salsberry PJ, Reagan PB. Dynamics of early childhood over-weight. Pediatrics 2005;116:1329–38

23. Chiloiro M, Caroli M, Guerra V, Lodadea Piepoli A, Riezzo G.Gastric emptying in normal weight and obese children—anultrasound study. Int J Obes 1999;23:1303–6

24. Kim DY, Camilleri M, Murray JA, Stephens DA, Levine JA,Burton DD. Is there a role for gastric accommodation and satietyin asymptomatic obese people? Obes Res 2001;9:655–61

25. Delgado-Aros S, Cremonini F, Castillo JE, Chial HJ, Burton DD,Ferber I, Camilleri M. Independent influences of body mass andgastric volumes on satiation in humans. Gastroenterology2004;126:432–40

26. Geliebter A. Stomach capacity in obese individuals. Obes Res2001;9:727–8

27. Nishina K, Mikawa K, Maekawa N, Tamada M, Obara H.Omeprazole reduces preoperative gastric fluid acidity andvolume in children. Can J Anaesth 1994;41:925–9

28. Mikawa K, Nishina K, Maekawa N, Asano M, Obara H.Lansoprazole reduces preoperative gastric fluid acidity andvolume in children. Can J Anaesth 1995;42:467–72

29. Borland LM, Sereika SM, Woelfel SK, Saitz EW, Carrillo PA,Lupin JL, Motoyama EK. Pulmonary aspiration in pediatricpatients during general anesthesia: incidence and outcome.J Clin Anesth 1998;10:95–102

30. Myles PS, Leslie K, Chan MTV, Forbes A, Paech MJ, Peyton P,Silbert BS, Pascoe E; the ENIGMA Trial Group. Avoidance ofnitrous oxide for patients undergoing major surgery. Anesthe-siology 2007;107:221–31

31. Babl FE, Puspitadewi A, Barnett P, Oakley E, Spicer M. Prepro-cedural fasting state and adverse events in children receivingnitrous oxide for procedural sedation and analgesia. PediatrEmerg Care 2005;21:736–43

32. Denman WT, Tuason PM, Ahmed MI, Brennen LM, Cepeda MS,Carr DB. The PediSedate� device, a novel approach to pediatricsedation that provides distraction and inhaled nitrous oxide:clinical evaluation in a large case series. Paediatr Anesth2007;17:162–6

33. Slyper AH. Childhood obesity, adipose tissue distribution, andthe pediatric practitioner. Pediatrics 1998;102:e4

34. Smith HL, Meldrum DJ, Brennan LJ. Childhood obesity: achallenge for the anaesthetist? Paediatr Anaesth 2002;12:750–61

35. Rose JB, Theroux MC, Katz MS. The potency of succinylcholinein obese adolescents. Anesth Analg 2000;90:576–8


The Perioperative Validity of the Visual Analog AnxietyScale in Children: A Discriminant and Useful Instrumentin Routine Clinical Practice to Optimize PostoperativePain Management

Sophie Bringuier, PharmD, PhD*†

Christophe Dadure, MD, MSc*

Olivier Raux, MD, MSc*

Amandine Dubois, MSc‡

Marie-Christine Picot, MD, PhD†

Xavier Capdevila, MD, PhD§

BACKGROUND: Because children’s anxiety influences pain perception, perioperativeanxiety should be evaluated in clinical practice with a unique, useful, and valid toolto optimize pain management. In this study, we evaluated psychometric propertiesof the visual analog scale (VAS)-anxiety for children and to study its perioperativerelevance in clinical practice.METHODS: One hundred children scheduled for elective surgery and general anesthesiawere included. VAS-anxiety was measured at four timepoints and compared with bothversions of State Spielbergers’ questionnaires (State-Trait Anxiety Inventory for Youth[STAIY] and State-Trait Anxiety Inventory for Children �STAIC�) and the modifiedYale Preoperative Anxiety Scale. Children’s pain, parents’ anxiety, and parents’ proxyreport of children’s anxiety were evaluated using VAS.RESULTS: The correlation between STAIC and VAS-anxiety was significant on theday of discharge. Moreover, changes over time were not significant with STAIC,whereas VAS-anxiety was significantly sensitive to changes over time in the twogroups of age (7–11 yr and 12–16 yr). A receiver operating characteristic curve,using modified Yale Preoperative Anxiety Scale as reference, determined aVAS-anxiety cutoff at 30 to identify high-anxiety groups. Pain levels were signifi-cantly higher when children were anxious (VAS �30) in the postoperative period.Moreover, children’s anxiety and pain were higher when parents were anxious.CONCLUSION: VAS-anxiety is a useful and valid tool to assess perioperative anxiety inchildren aged 7–16 yr. The influence of children’s and parents’ anxiety on children’spostoperative pain suggests that VAS-anxiety should be recommended routinely forpostoperative clinical practice to optimize anxiety and pain management.(Anesth Analg 2009;109:737–44)

Perioperative anxiety is a complex combination offear, apprehension, and worry often accompaniedby physical sensations.1 Even minor surgery can bea frightening experience for children.2– 4 Anxietyinfluences patients’ subjective perceptions,1 andpreoperative anxiety is associated with higher levelof postoperative pain.5–7

Interest in children’s anxiety has increased in recentyears, and trials have investigated the best way tomeasure children’s anxiety. The standard SpielbergerState-trait Anxiety Inventory (STAI)8 is used mostfrequently in the literature. Because, this gold stan-dard tool is not appropriate for evaluating anxiety in abusy operating room setting,9 the modified Yale Pre-operative Anxiety Scale (m-YPAS) has been developedto assess anxiety for children aged 2–12 yr undergoingsurgery. In the postoperative period, the Post-HospitalBehavioral Questionnaire10,11 has been proven to be avalid and robust instrument for the assessment ofbehavioral change in children, but it is not recognizedas a measure of anxiety.

Anxiety evaluation is essential for the clinical peri-operative follow-up of children, but the multiplicity ofinstruments depending on the age of the child or onthe period of the evaluation is limited in clinicalpractice. A useful and unique anxiety instrument mayhave multiple benefits in following anxiety through-out the hospital stay.

Furthermore, in the early postoperative period,pain can be a confusion factor for a scale based on

From the *Department of Anesthesiology and Critical CareMedicine, Lapeyronie University Hospital; †Epidemiology andClinical Research Department, Arnaud de Villeneuve UniversityHospital; ‡Developmental Psychology Department, Montpellier IIIUniversity; and §Department of Anesthesiology and Critical CareMedicine, University Montpellier 1 and Lapeyronie UniversityHospital, Montpellier, France.

Accepted for publication March 17, 2009.Supported by a grant from the University Hospital Center for

Clinical Research, Program 2003, Montpellier, France.Address correspondence and reprint requests to Sophie Brin-

guier, PharmD, PhD, Department of Anesthesiology, Acute Painand Critical Care Medicine, Lapeyronie University Hospital, Av-enue du Doyen G Giraud, Montpellier 34925, France. Addresse-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181af00e4


behavioral aspects. Self-report measurements could bea more effective solution. Crandall et al.12 havedemonstrated the validity of numeric 0–10 anxietyself-report scale to measure preoperative anxiety inchildren 7–13 yr. Because anxiety evaluation is alsoimportant postoperatively to optimize children’s painmanagement, the aims of this study were to evaluatethe perioperative validity of the visual analog scale(VAS)-anxiety in children and evaluate its clinicalrelevance for pain management.

METHODSThis was a longitudinal observational study. Ap-

proval was obtained from the Montpellier Institu-tional Review Board. Children were selected from theChildren’s Hospital Surgery Center, Montpellier Uni-versity Hospital (France). Children of ASA status I, II,or III, aged 7–16 yr who were undergoing electivesurgery and general anesthesia were enrolled fromSeptember 2005 to June 2006. Patients were excluded ifthey had a diagnosis of mental retardation or chronicpain. Outpatient surgery was not included in thestudy.

Study information was given the day before sur-gery on arrival at the hospital. Parents’ written andchildren’s oral consents were obtained, and demo-graphic information was collected. Anxiety was self-reported using a VAS at four timepoints (Table 1): theevening before surgery (D-1), the day of surgerybefore anesthesia (D0), postoperative day one (POD1),and the day of discharge (DD). Parents blinded totheir child’s responses evaluated the child’s anxietyand their own anxiety using VAS. The VAS-anxietyconsists of a 100-mm horizontal line with the two endpoints labeled “no anxiety or fear” and “worst pos-sible anxiety or fear.” The patient is required to showthe point that corresponds to their level of anxiety atthat moment. VAS has been validated for adults in aprevious study.13 It is a pertinent tool to assess par-ents’ anxiety.14,15

Pain intensity was also self-reported on a 100-mmVAS (VAS-pain).16 Children also completed the stateversion of the STAI8,17 adapted for age. This instru-ment is a self-administered questionnaire with twoseparate 20-question rating scales to evaluate “trait”

and “state” anxiety. Only the state items were used.The pediatric version (State-Trait Anxiety Inventoryfor Children �STAIC�) was administered to childrenyounger than 12 yr. The youth version (State-TraitAnxiety Inventory for Youth �STAIY�) was adminis-tered to the older children. The scores for all itemswere summed to create the total score. Researchassistants were told to read the STAI questionnaire toyoung children and explain items that the childrenfound difficult to understand. It was not adminis-trated in the operating room before induction (D0)because it takes more than 5 min to answer. At thistime, observational state anxiety was assessed usingthe modified m-YPAS, which is a behavioral scaledeveloped for assessing state preoperative anxiety inchildren aged 7–12 yr.9 It consists of 27 items in fivedimensions (activity, emotional, expressivity, state ofarousal, vocalization, and use of parents). The item“Use of parents” was not included in the total scorebecause the parents do not enter the operating room.The score is based on the sum of partial weights foreach category. The psychologist who completed them-YPAS was trained in a previous study using video-tapes of children before anesthesia. The reliabilitylevels were excellent. This research did not modify themanagement of the patient in any way and did notimpose a protocol of sedative premedication and/oranesthesia.

Children aged 7–11 yr were in the youngest group,and children aged 12 yr and older were in the oldestgroup. The sample size was based on the correlationbetween children’s anxiety assessed by the m-YPASbefore induction in the youngest group. Given acorrelation r � 0.50 between VAS-anxiety and m-YPAS,a power of 90% and a two-sided � level of 0.05, 37subjects were needed. This study also included chil-dren aged 12 years and older, so we decided toincrease the total number of subjects: 100 childrenwere needed to complete this study.

Continuous data are expressed as mean � sd ormedian for non-Gaussian variables. Categorical dataare expressed as frequencies (%). Continuous vari-ables were compared with Student’s t-test or theMann–Whitney U-test for the non-Gaussian variables.Categorical variables were compared with the �2 test.

Table 1. Children’s and Parents’ Perioperative Scales

PatientsThe day beforesurgery (D-1)

Beforeinduction (D0)

The day aftersurgery (POD1)

The day ofdischarge (DD)

Younger (n � 43) VAS-anxiety VAS-anxiety VAS-anxiety VAS-anxietyVAS-pain VAS-pain VAS-pain VAS-painSTAIC (state) m-YPAS STAIC (state) STAIC (state)

Older (n �57) VAS-anxiety VAS-anxiety VAS-anxiety VAS-anxietyVAS-pain VAS-pain VAS-pain VAS-painSTAIY (state) STAIY (state) STAIY (state)

Parents VAS-anxiety VAS-anxiety VAS-anxiety(self and proxy) (self and proxy) (self and proxy)

VAS � visual analog scale; STAIC � State-Trait Anxiety Inventory for Children; STAIY � State-Trait Anxiety Inventory for Youth; m-YPAS � modified Yale Preoperative Anxiety Scale; D-1 � theevening before surgery; DO � the day of surgery before anesthesia; POD � postoperative day one; DD � day of discharge.

738 Perioperative Validity of VAS-Anxiety ANESTHESIA & ANALGESIA

Changes over time in the two age groups wereanalyzed by time � group interaction in a repeated-measures analysis of variance. The convergent valid-ity was evaluated by the analysis of the association ofVAS-anxiety with other validated measures of thesame construct (m-YPAS, STAIC, and STAIY). Thediscriminant validity measures that association withmeasures of different constructs (VAS-pain). Conver-gent and discriminant validity were evaluated byPearson correlations.

Because m-YPAS is a valid tool to assess preopera-tive anxiety in children, sensitivity, specificity, andpositive and negative predictive values were exam-ined for different cutoff points of VAS-anxiety. Areceiver operating characteristic (ROC) determinedVAS-anxiety cutoff using m-YPAS with 30 as thereference point of high-level anxiety.9 This cutoff hasbeen used to differentiate groups of high anxiety(�30/100) of children and parents.

Pearson correlation was used to investigatethe relationship among parents’ VAS-anxiety andboth self and proxy reports of children’s anxiety.The median differences were tested by a pairedcomparison.

To study the influence of both children’s and par-ents’ anxiety on children’s postoperative pain, groupsof anxiety were determined in each period using thecutoff resulting from the ROC analysis. Postoperativepain differences between groups of anxiety weretested using Student’s t-test.

Data were analyzed using the SAS package Version9 software (Carry, CA).

RESULTSOne hundred children were enrolled in this study.

Children’s characteristics are reported in Table 2 . Nostatistically significant differences were reported be-tween the age groups. All children were able to use

VAS-anxiety. In the preoperative period, VAS-anxietydid not differ significantly among history of previoussurgery, gender, age, ASA status, and type of surgery.Postoperatively, VAS-anxiety did not differ with thetype of surgery (POD1: P � 0.42; DD: P60).

The VAS-anxiety scale changed over time from thefirst day of hospital stay to the DD (P � 0.001) (Fig. 1).The highest anxiety level was on the day of surgerybefore induction when 50% of the children scoredhigher than 30 for their anxiety. Children’s anxietydecreased in the postoperative period but was stillpresent. The difference between VAS before inductionand the day after surgery was significant (P � 0.003)(Fig. 1). The analysis by time � group interactionreported that VAS-anxiety did not differ significantlybetween the two age groups (P � 0.24) from the firstday of hospitalization to the DD (Fig. 2). VAS-anxietychanged over time in the two age groups (P � 0.04)(Fig. 2)

Table 3 describes the concurrent validity of VAS-anxiety. Before induction, VAS-anxiety correlated sig-nificantly with m-YPAS (r � 0.67, P � 0.001) inchildren younger than 12 yr. We found significantcorrelations between VAS and STAIY on the first dayof hospitalization, on the POD1, and on the DD (r �0.67, P � 0.001; r � 0.63, P � 0.001; r � 0.62, P � 0.002).The correlation between VAS and STAIC was onlysignificant on the DD (r � 0.66, P � 0.001). For eachperiod, the intercept between VAS-anxiety and twoversions of STAI differed significantly from 0. Thesesignificant intercepts seem to be due from the range ofSTAI. Moreover, changes over time were not signifi-cant in the youngest age group using STAIC (P � 0.05)(Fig. 3a), whereas it was significant in the oldest groupusing STAIY (P � 0.001) (Fig. 3b).

Table 4 shows the sensitivity, specificity, and positiveand negative predictive values for different cutoff points

Table 2. Children’s Characteristics

7–11 years old(n � 43)

12–16 years old(n � 57)

All subjects(n � 100)

Boys/girls (n) 24/19 34/23 58/42Mean age (years � sd) 9.18 (1.32)* 13.97 (1.42)* 11.8 (2.7)ASA, % (n)

1 67.44 (29) 77.19 (44) 73 (73)2 32.55 (14) 19.29 (11) 25 (25)3 0 (0) 3.50 (2) 2 (2)

Number of surgical proceduresbefore inclusion, % (n)

0 34.88 (15) 35.09 (20) 35 (35)1 27.91 (12) 36.84 (21) 33 (33)�2 37.21 (16) 28.07 (16) 32 (32)

Type of surgery, % (n)Orthopedic 60.46 (26) 75.43 (43) 69 (69)Plastic 11.62 (5) 10.52 (6) 11 (11)Abdominal 23.25 (10) 12.28 (7) 17 (17)Other 4.65 (2) 1.75 (1) 3 (3)

Hospital stay (days � sd) 4 (1.5) 3.77 (1.76) 3.9 (1.6)* P � 0.05 age differs significantly.


of VAS-anxiety. A ROC curve was generated to deter-mine the cutoff of VAS-anxiety (Fig. 4). The area underthe curve was 0.80 (CI: 0.69–0.91, P � 0.001). A score of

30 maximized the sum of the sensitivity and specific-ity and was considered clinically relevant. A VAS-anxiety score of 30 or more was used to identify the

Figure 1. Perioperative visual analogscale (VAS)-anxiety: values of VAS-anxiety in all patients in the periop-erative period; the center of the boxis the median, and the box representsthe 25th–75th percentiles. The ex-tended bars represent the 10th–90thpercentiles. The points represent val-ues higher than the 10th–90th per-centiles. D-1 � the day before thesurgery; D0 � in the operating roombefore induction; D1 � the day aftersurgery; and DD � the day of dis-charge. Changes over time *P � 0.05.

Figure 2. Perioperative visual ana-log scale (VAS)-anxiety by group ofage: VAS-anxiety in the periopera-tive period by age group; the centerof the box is the median, and thebox represents the 25th–75th per-centiles. The extended bars representthe 10th–90th percentiles. The pointsrepresent values higher than the10th–90th percentiles. D-1 � the daybefore the surgery; D0 � in the oper-ating room before induction; D1 � theday after surgery; and DD � the dayof discharge. Changes over time bygroup of age, *P � 0.05; NS, P � 0.05,not clinically significant of VAS-anxiety by age group.

Table 3. Concurrent Validity of VAS-Anxiety

Pearson correlation coefficients (r) and (R2)

VAS-anxiety theday before surgery

VAS-anxiety beforesurgery

The day aftersurgery (POD1)

The day ofdischarge

STAIC (n � 43) r � 0.38 r � 0.27 r � 0.66*R2 � 0.15 R2 � 0.07 R2 � 0.44

STAIY (n � 57) r � 0.67* r � 0.63* r � 0.62*R2 � 0.46 R2 � 0.34 R2 � 0.37

m-YPAS (n � 43) r � 0.67*R2 � 0.46

VAS � visual analog scale; STAIC � State-Trait Anxiety Inventory for Children; STAIY � State-Trait Anxiety Inventory for Youth; m-YPAS � modified Yale Preoperative Anxiety Scale.* P � 0.05 clinically significant correlations.


high-anxiety groups of children and parents. The studyof parental assessment showed a significant correlationbetween the children’s self-report and the parents’ proxyreport (r � 0.72, P � �0.001; r � 0.67, P � �0.001; r �0.84, P � �0.001). Intercepts when parents versus chil-dren assess the children’s anxiety differed significantlyfrom 0 on the day before surgery (P � 0.0005) and theday after surgery (P � 0.0284). The difference (d � 1.04;P � 0.002) between the self-reports and the proxy reportsis significant (Fig. 5) on the day before surgery. Therewas no significant correlation between parents’ pre-operative anxiety and child’s preinduction anxiety.Nevertheless, the proxy report was significantlyhigher when the parents were anxious (VAS �30) inthe three periods (P � 0.008; P � 0.001; and P �0.0005) (Fig. 6). The coefficient of correlation betweenself-reports of children’s anxiety and self-reports ofparents’ anxiety is not significant on the day beforesurgery (r � 0.18, P � 0.19). In the postoperativeperiod, the coefficient of correlation is significant butlow (POD1: r � 0.44, P � 0.002; DD: r � 0.53, P �0.001). The mean differences are significant in thethree periods (P � 0.00001; P � 0.04; and P � 0.03)(Fig. 5). Moreover, the children’s anxiety levels weresignificantly higher when the parents were anxious inthe postoperative period (POD1: P � 0.002; DD: P �0.002) (Fig. 6).

A significant but moderate correlation coefficientwas found between pain and anxiety levels in thePOD1 (r � 0.37, P � 0.0015) and the DD (r � 0.52, P �0.001). A significant difference was found betweenVAS-pain and VAS-anxiety (P � 0.05).

Postoperative pain did not differ significantly in thepreoperative anxiety groups (POD1: P � 0.47; DD: P �0.61). Nevertheless, simultaneous assessment of both

pain and anxiety showed that the group of anxiouschildren had a significantly higher level of pain in thepostoperative period (POD1: P � 0.04; DD: P � 0.01)(Fig. 7a). The children’s pain was significantly higherin the group with anxious parents on the day aftersurgery (POD1: P � 0.02) (Fig. 7b).

DISCUSSIONThis study clearly demonstrates that VAS-anxiety is

a useful method and has good psychometric proper-ties to assess children’s anxiety in perioperative peri-ods. Although VAS-pain is the universal tool to assesspain in older children, the choice of children’s anxietyscales was limited by the period of assessment orchildren’s age. Today, following up children’s anxietyfrom the first day of hospital stay to the DD has beendifficult with a unique scale. In addition, children’sanxiety studies suffered from a reduced age span. Thisstudy shows that VAS-anxiety is a valid tool andsensitive to change over time, pain, and parents’anxiety.

Because anxiety influences pain levels, children’sanxiety must be assessed in clinical practice.5–7 Opti-mal anxiety management requires a statistically validperioperative scale. The first step of our validationstudy was to compare VAS-anxiety with the fullyrecognized scales. Our results provide the concurrentvalidity of VAS-anxiety. Most importantly, we havedemonstrated that the level of anxiety is dependent onthe scale but not on age. In medical literature, STAI isa self-report instrument widely used to measure anxi-ety. The correlations between VAS-anxiety and STAIare significant in older children but only significant inchildren younger than 12 yr on the DD. These resultsmight suggest that this difference is due to the chil-dren’s age. However, VAS-anxiety is able to detectstatistically important changes over time in two agegroups, whereas STAIC is not sensitive enough withthe youngest children. Finally, the lower correlationbetween STAIC and VAS-anxiety did not limit the useof VAS-anxiety but demonstrated the difficulty ofusing STAIC in young children.

0

10

20

30

40

50

60

D-1 POD1 DD

EVASTAIC State

0

10

20

30

40

50

60

D-1 POD1 DD

EVASTAIY State

anxietyscore

anxietyscore

NS

*

*

**

a b

Figure 3. Changes over time of anxiety is scaledependent. a, Younger children (n � 43):children’s self-reported anxiety by visual ana-log scale (VAS)-anxiety and by State-TraitAnxiety Inventory for Children (STAIC) in theperioperative period. *P � 0.05, significantchanges over time of VAS-anxiety; NS. P �0.05, not significant changes over time ofSTAIC. b, Older children (n � 57): children’sself-reported anxiety by VAS-anxiety and byState-Trait Anxiety Inventory for Youth(STAIY) in the perioperative period. *P � 0.05significant changes over time of both VAS-anxiety and STAIY.

Table 4. Characteristics of Visual Analog Scale (VAS)-Anxietyat Different Cutoff Points

VAS cutoff 20 30 40Sensitivity (%) 88 78 62Specificity (%) 51 67 75Positive predictive values (%) 60 67 68Negative predictive values (%) 85 79 71


This result is consistent with the study of Poma etal.,18 which showed that VAS changed significantlybut the Spileberger’questionnaire did not. Kain et al.9

also showed in their validation study that STAIC,which requires at least 5–10 min to complete, is not aneasy tool in a busy operating room setting. Schisler etal.19 found that young children’s vocabularies may betoo limited to easily understand some items of theSTAIC. Furthermore, understanding the items is moredifficult with premedication or after general anesthe-sia. The youngest age at which to use a VAS scale isalso controversial. McGrath et al.20 have shown thatVAS is reliable for use by children aged 5 yr and older.However, the conceptual complexity of the VAS re-quires the user to translate a subjective sensory expe-rience into a linear format. Berk21 found that the

ability to seriate does not appear until 7-years old. Inour study, all children were able to use VAS-anxietyfrom the first day of hospitalization to the DD.

Although m-YPAS9 cannot be used easily in clinicalpractice, its use is now frequently described in themedical literature to assess young children’s anxietybefore anesthetic induction. This scale has the advan-tage of being used from the age of 5 yr and assessingmultimodal aspects of anxious behavior.

The good correlation between VAS-anxiety andm-YPAS in our study confirms the validity of VAS todetect anxiety levels before surgery. The m-YPAS

Figure 4. Receiver operating charac-teristic (ROC) curve for diagnosis ofhigh-anxiety group.

0

10

20

30

40

50

60

D-1 POD1 DD

VA

S a

nxie

ty

children self report

parents proxyreportparents self report

*

Figure 5. Discordance between self-reports and proxy re-ports: perioperative median values of visual analog scale(VAS)-anxiety: child’s self-report, parents’ proxy report, andparents’ self-report. *P � 0.05 the day before the surgery(D-1).

0

10

20

30

40

50

60

70

80

self

report

proxy

report

self

report

proxy

report

self

report

proxy

report

DDPOD1D-1

Chi

ldre

n VA

S-an

xiet

y

Anxious Parents

Non anxious Parents

*

**

*

*

Figure 6. Influence of state parents anxiety on child’s self-report and parent’s proxy report. Perioperative medianvalues and 75th percentiles of visual analog scale (VAS)-anxiety from children’s self-reports and parents’ proxyreports. *P � 0.05, anxious parents versus nonanxiousparents.


scale has been chosen to study the sensitivity, speci-ficity, and positive and negative predictive values ofVAS-anxiety. The maximal sum of specificity andsensitivity showed a cutoff at 30 with 78% sensitivityand 67% specificity. In an adult study, Kindler et al.13

showed a lower sensitivity at this cutoff and preferreda low-cutoff point of VAS but accepted a highernumber of false-positive scores (35.1%). We chose 30as a threshold to detect high levels of anxiety in bothchildren and their parents.

The last point of the analysis of the concurrentvalidity of VAS-anxiety is the comparison betweenself-report and proxy report. The statistical test mostfrequently used to validate a new method of assess-ment is Pearson correlation coefficient. The majority ofstudies, which compare different groups of patients, islimited by this test. However, a high correlationbetween scores does not systematically indicate highagreement.22,23 When using the VAS scale for bothchildren and their parents, the difference can betested. Although children’s anxiety and parents’ anxi-ety are significantly correlated, the paired comparisonindicates that parents are more anxious than childrenin the preoperative period. Furthermore, our resultsshow that parents overestimate the children’s ownassessment. In addition, proxy-reporting scores arehigher when parents are anxious. These results provethe difficulties in everyday clinical practice of percep-tion of anxiety and demonstrate the importance ofself-reporting to assess subjective measurements. Al-though parents’ proxy reports may be a usefulalternative, children’s self-reporting is preferredwhenever possible. This study proves that the VAS-anxiety detects differences between self-reportingand proxy reporting and that the self-report scale isalso preferred for young children. In addition, be-cause pain may induce bias on behavioral assess-ment, self-reporting of anxiety should be the pri-mary method in the postoperative period.

An important property to validate in a new scale isalso the responsiveness to change.24 Our results showthat VAS-anxiety is a sensible instrument to detectchanges over time for the two age groups we studied.

In addition, in agreement with Caumo et al.,4 wereported that the anxiety level is significantly moreimportant before surgery than after. This result canbe explained simply by the definition of anxiety,which is a future-oriented emotion characterized byan apprehensive anticipation threat.25 The surgicalact or the anesthesia constitutes a real threat forchildren.

Postoperative anxiety is reduced, but its assessmentis still important because postoperative pain interferesin this experience. The significant correlation betweenVAS-pain and VAS-anxiety shows the relationshipbetween these anxiety and pain, but the moderatecorrelation and the significant difference proved thatchildren are able to differently assess anxiety andpain. Because cries and agitation in the postopera-tive period are common behavior of pain and anxi-ety, the main difficulty with proxy reporting ofpostoperative pain is to discriminate between painand anxiety.26 Using VAS, children were able todifferently assess pain and anxiety. This result high-lights the importance of self-reporting, especiallypostoperatively.

Our study did not prove that a high score forVAS-anxiety in the preoperative period constitutes apredictor for postoperative symptoms. However, si-multaneous assessment of both pain and anxietyshowed that children with a high level of anxiety hada significantly higher level of pain. This result con-firms that VAS-anxiety assesses state and not traitanxiety and the relevance of anxiety measures in thepostoperative period.

Some authors have studied the presence of theparents to facilitate induction of anesthesia. Becauseparents could transfer anxiety to the child, their pres-ence rarely seems beneficial.27 Kain et al.28 clearlyreported the superiority of midazolam premedicationover untrained parents. In the postoperative period,we reported that the children of the anxious parents’group were significantly more anxious and that thosechildren had the highest pain levels. In agreementwith Kotiniemi et al.,11 our study indicates that chil-dren’s and their parents’ problems are not over when

0

10

20

30

40

50

60

POD1 DD

VAS

Pain

Anxious ChildrenNon Anxious Children

0

10

20

30

40

50

60

POD1 DD

VAS

Pain

Anxious ParentsNon Anxious Parents

*

*

*

a b

Figure 7. a, Impact of children state anxiety onpostoperative pain: median values and 75thpercentiles of visual analog scale (VAS)-painof children: anxious children versus nonanx-ious children, *P � 0.05 on postoperative day1 (POD1) and the day of discharge (DD). b,Impact of parents state anxiety on postopera-tive pain: median values and 75th percentilesof VAS-pain of children: anxious parents ver-sus nonanxious parents, *P � 0.05 on POD1and DD.


they leave the hospital. We demonstrate that anxiety isalmost always present on the DD and that the optimalmanagement of postoperative symptoms cannot bereduced to pain assessment. Our validation of VAS-anxiety constitutes an opportunity to optimize chil-dren’s pain management, and this useful instrumentshould be recommended for clinical practice.

Several limitations should be noted in our study.First, it would be interesting to evaluate the concur-rent validity of VAS-anxiety in postanesthesia careunit, but there is no gold standard to assess anxiety inthe postanesthesia care unit, and it was impossible toadminister 20 items in this period. The second concernis the lack of use of the test–retest reliability coeffi-cients. This important test shows the temporal stabil-ity property of a scale. Because anxiety level canchange rapidly,29 this test would not be appropriate inthis context. Further, randomized trials are needed totest whether VAS-anxiety is sensitive to postoperativetreatment and to analyze its clinical pertinence usingconfounding variables. Furthermore, further studiesshould include outpatient surgery.

In conclusion, VAS-anxiety is a useful and validtool to assess perioperative anxiety in children 7 yrand older. Furthermore, our study demonstrated thatVAS-anxiety should also be measured in the postop-erative period in routine clinical practice to optimizeanxiety and pain management.

REFERENCES

1. Spielberger C. Anxiety as an emotional state. Anxiety: currenttrends in theory and research. Vol. 1. New York: AcademicPress, 1972

2. Wollin SR, Plummer JL, Owen H, Hawkins RM, Materazzo F,Morrison V. Anxiety in children having elective surgery. J Pe-diatr Nurs 2004;19:128–32

3. Ben-Amitay G, Kosov I, Reiss A, Toren P, Yoran-Hegesh R,Kotler M, Mozes T. Is elective surgery traumatic for childrenand their parents? J Paediatr Child Health 2006;42:618–24

4. Caumo W, Broenstrub JC, Fialho L, Petry SM, Brathwait O,Bandeira D, Loguercio A, Ferreira MB. Risk factors for postopera-tive anxiety in children. Acta Anaesthesiol Scand 2000;44:782–9

5. Lamontagne LL, Hepworth JT, Salisbury MH. Anxiety andpostoperative pain in children who undergo major orthopedicsurgery. Appl Nurs Res 2001;14:119–24

6. de Groot KI, Boeke S, van den Berge HJ, Duivenvoorden HJ,Bonke B, Passchier J. The influence of psychological variables onpostoperative anxiety and physical complaints in patients un-dergoing lumbar surgery. Pain 1997;69:19–25

7. Kain ZN, Mayes LC, Caldwell-Andrews AA, Karas DE, Mc-Clain BC. Preoperative anxiety, postoperative pain, and behav-ioral recovery in young children undergoing surgery. Pediatrics2006;118:651–8

8. Spielberger C. Manual for the state-trait anxiety inventory (formY). Palo Alto, CA: Consulting Psychologists Press, 1983

9. Kain ZN, Mayes LC, Cicchetti DV, Bagnall AL, Finley JD,Hofstadter MB. The yale preoperative anxiety scale: how does itcompare with a “gold standard”? Anesth Analg 1997;85:783–8

10. Vernon DT, Schulman JL, Foley JM. Changes in children’sbehavior after hospitalization. Some dimensions of responseand their correlates. Am J Dis Child 1966;111:581–93

11. Kotiniemi LH, Ryhanen PT, Moilanen IK. Behavioural changesin children following day-case surgery: a 4-week follow-up of551 children. Anaesthesia 1997;52:970–6

12. Crandall M, Lammers C, Senders C, Savedra M, Braun JV. Initialvalidation of a numeric zero to ten scale to measure children’sstate anxiety. Anesth Analg 2007;105:1250–3, table of contents

13. Kindler CH, Harms C, Amsler F, Ihde-Scholl T, Scheidegger D.The visual analog scale allows effective measurement of preop-erative anxiety and detection of patients’ anesthetic concerns.Anesth Analg 2000;90:706–12

14. Chlan LL. Relationship between two anxiety instruments inpatients receiving mechanical ventilatory support. J Adv Nurs2004;48:493–9

15. Davey HM, Barratt AL, Butow PN, Deeks JJ. A one-itemquestion with a Likert or Visual Analog Scale adequatelymeasured current anxiety. J Clin Epidemiol 2007;60:356–60

16. Huskisson E. Measurement of pain. Lancet 1974;2:1127–3117. Spielberger C. Manual for the state-trait anxiety inventory for

children. Palo Alto, CA: Consulting Psychologists Press, 197318. Poma SZ, Milleri S, Squassante L, Nucci G, Bani M, Perini GI,

Merlo-Pich E. Characterization of a 7% carbon dioxide(CO2ation paradigm to evoke anxiety symptoms in healthysubjects. J Psychopharmacol 2005;19:494–503

19. Schisler T, Lander J, Fowler-Kerry S. Assessing children’s stateanxiety. J Pain Symptom Manage 1998;16:80–6

20. McGrath P, de Veber L, Hearn M. Multidimensional painassessment in children. Adv Pain Res Ther 1985;9:387–93

21. Berk L. Child development. 3rd ed. Needham Heights, MA:Allyn and Bacon, 1994

22. Theunissen NC, Vogels TG, Koopman HM, Verrips GH, Zwin-derman KA, Verloove-Vanhorick SP, Wit JM. The proxy prob-lem: child report versus parent report in health-related qualityof life research. Qual Life Res 1998;7:387–97

23. Cremeens J, Eiser C, Blades M. Factors influencing agreementbetween child self-report and parent proxy-reports on thePediatric Quality of Life Inventory 4.0 (PedsQL) generic corescales. Health Qual Life Outcomes 2006;4:58

24. Hays RD, Hadorn D. Responsiveness to change: an aspect ofvalidity, not a separate dimension. Qual Life Res 1992;1:73–5

25. Rhudy JL, Meagher MW. Negative affect: effects on an evalua-tive measure of human pain. Pain 2003;104:617–26

26. von Baeyer CL, Spagrud LJ. Systematic review of observational(behavioral) measures of pain for children and adolescents aged3 to 18 years. Pain 2007;127:140–50

27. Lerman J. Anxiolysis–by the parent or for the parent? Anesthe-siology 2000;92:925–7

28. Kain ZN, Mayes LC, Wang SM, Caramico LA, Hofstadter MB.Parental presence during induction of anesthesia versus seda-tive premedication: which intervention is more effective? Anes-thesiology 1998;89:1147–56

29. Kain ZN, Caldwell-Andrews AA, Mayes LC, Weinberg ME,Wang SM, MacLaren JE, Blount RL. Family-centered prepara-tion for surgery improves perioperative outcomes in children: arandomized controlled trial. Anesthesiology 2007;106:65–74


A Comparison of Dexmedetomidine with Propofol forMagnetic Resonance Imaging Sleep Studies in Children

Mohamed Mahmoud, MD*

Joel Gunter, MD*

Lane F. Donnelly, MD†

Yu Wang, MS‡

Todd G. Nick, PhD‡

Senthilkumar Sadhasivam, MD,MPH*

BACKGROUND: Magnetic resonance imaging (MRI) sleep studies can be used to guidemanagement of children with obstructive sleep apnea (OSA) refractory to conservativetherapy. Because children with OSA are sensitive to the respiratory-depressant effectsof sedatives and anesthetics, provision of anesthesia for imaging studies in this patientpopulation can be challenging. Dexmedetomidine has been shown to have pharma-cological properties simulating natural sleep with minimal respiratory depression. Wehypothesized that, compared with propofol, dexmedetomidine would have less effecton upper airway tone and airway collapsibility, provide more favorable conditionsduring dynamic MRI airway imaging in children with OSA, have fewer scaninterruptions, and require less aggressive airway interventions.METHODS: In this retrospective descriptive study, we reviewed the records of 52children receiving dexmedetomidine and 30 children receiving propofol foranesthesia during MRI sleep studies between July 2006 and March 2008. Documen-tation of the severity of OSA by overnight polysomnography was available for 67of the 82 subjects, who were analyzed separately. Data analyzed included demo-graphics, severity of OSA, comorbidities, hemodynamic changes, use of artificialairways, additional airway maneuvers, and successful completion of the MRI scan.RESULTS: Demographics, OSA severity by polysomnography, anesthetic induction,and baseline hemodynamics were comparable in both groups. An interpretableMRI sleep study was obtained for 98% of children in the dexmedetomidine groupand 100% in the propofol group. Of 82 children, MRI sleep studies weresuccessfully completed without the use of artificial airways in 46 children (88.5%)in the dexmedetomidine group versus 21 children (70%) in the propofol group (P �0.03). An artificial airway was required to complete the study in five children (12%)in the dexmedetomidine group versus nine children (35%) in the propofol group(P � 0.06). Additional airway maneuvers (chin lift and shoulder roll) were requiredto complete the study in one child (2%) in the dexmedetomidine group and threechildren (10%) in the propofol group (P � 0.14). Children in the dexmedetomidinegroup experienced reductions in heart rate, whereas those in the propofol groupexperienced reductions in arterial blood pressure; these reductions were statisti-cally, but not clinically, significant.CONCLUSIONS: Dexmedetomidine provided an acceptable level of anesthesia for MRIsleep studies in children with OSA, producing a high yield of interpretable studies ofthe patient’s native airway. The need for artificial airway support during the MRI sleepstudy was significantly less with dexmedetomidine than with propofol. Dexmedeto-midine may be the preferred drug for anesthesia during MRI sleep studies in childrenwith a history of severe OSA and may offer benefits to children with sleep-disorderedbreathing requiring anesthesia or anesthesia for other diagnostic imaging studies.(Anesth Analg 2009;109:745–53)

Upper airway obstruction can result from de-creased airway muscle tone during anesthesia orphysiologic sleep. Examination of patterns of dy-namic airway collapse in children with obstructivesleep apnea (OSA) during sleep permits identifica-tion of underlying anatomic causes of airway ob-struction and facilitates planning for medical and

surgical treatments required to relieve airway ob-struction. Magnetic resonance imaging (MRI) sleepstudies have been reported to successfully depictairway motion abnormalities that are related toOSA.1–9 The ideal MRI sleep study would be of thesleeping patient’s native airway free of artificialairways during spontaneous ventilation.

From the Departments of *Anesthesiology and †Radiology; and‡Division of Biostatistics and Epidemiology, Cincinnati Children’sHospital Medical Center, Cincinnati, Ohio.

Accepted for publication April 3, 2009.Supplemental digital content is available for this article. Direct


Address correspondence and reprint requests to MohamedMahmoud, MD, Department of Clinical Anesthesia and Pediatrics,Cincinnati Children’s Hospital Medical Center, 3333 Burnet Ave.,MLC 2001, Cincinnati, OH 45229. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181adc506


Children with OSA are sensitive to the respiratory-depressant effects of sedative and hypnotic drugs andare especially vulnerable to the development of upperairway obstruction during anesthesia and sedation.10

Providing anesthesia that mimics physiologic sleepwithout the use of an artificial airway in children withOSA is a challenge but is critical for accurate interpre-tation of the resulting scans. In contrast to othersedative drugs, dexmedetomidine has been shown tohave sedative properties that parallel natural sleep,without significant respiratory depression.11–13 Thesetwo advantages make dexmedetomidine an attractivedrug for sedating children with OSA for MRI sleepstudies. In this report, we review our clinical experi-ences with dexmedetomidine as the primary sedativein a series of children with OSA undergoing MRI sleepstudies and compare the results with a contempora-neous series of children sedated with propofol.

METHODSAfter institutional review board approval, the

medical records of 82 consecutive children receivingdexmedetomidine (52 children) or propofol (30 chil-dren) anesthesia during a MRI sleep study at Cincin-nati Children’s Hospital Medical Center between July2006 and March 2008 were reviewed retrospectively.Candidate patients for review were identified fromdepartmental anesthesia records by procedure code.Indications for MRI sleep study included persistentOSA despite surgical intervention (including previoustonsillectomy and adenoidectomy), OSA in conjunc-tion with an underlying syndrome predisposing thepatient to multilevel obstruction (such as craniofacialanomaly or trisomy 21), evaluation of supraglotticanatomy for children with OSA before anticipatedcomplex airway surgery, and OSA associated withobesity.1,8,14

Documentation of OSA by overnight polysomnog-raphy performed at Cincinnati Children’s HospitalMedical Center was available for 41 of 52 children inthe dexmedetomidine group and 26 of 30 children inthe propofol group. The remaining children had eitherfailed surgical management for OSA by clinical crite-ria or had polysomnography performed at anotherinstitution. Polysomnography reports were reviewedfor the minimum oxygen saturation during the study,the respiratory disturbance index (the number ofapneas with both central and obstructive [reduction ofairflow of 90% or more] components) and hypoapneicepisodes (reduction of airflow of 50% or more associ-ated with an arousal or decrease in oxygen saturationper hour of sleep) and the obstructive index (numberof obstructive apneas per hour of sleep) and for theseverity of OSA (normal � obstructive index �1; mildOSA � obstructive index 1–5; moderate OSA � ob-structive index �5–10; and severe OSA � obstructiveindex �10).

All cine MRI studies were performed on a 1.5 TeslaMRI scanner (General Electric Medical Systems, Mil-waukee, WI) according to our current standard proto-cols. The airway was imaged from above the level ofthe adenoids to the level of the mid-trachea using ahead–neck vascular coil and 3-dimensional localiza-tion. Sagittal and axial T1-weighted spin echo images(TR 400, TE minimal, field of view 22 cm, slicethickness 4 mm, gap 1 mm, matrix 256 � 192, numberof excitations 2), as well as axial and sagittal fast spinecho inversion recovery (TR 5000, TE 34, echo trainlength 12, field of view 22 cm, slice thickness 6 mm,gap 2 mm, matrix 256 � 192, number of excitations 2)images were obtained. MRI cine sequences, generatedusing a fast gradient echo sequence, were obtained inthe midline sagittal location and in the axial plane atthe level of the mid-portion of the tongue (flip angle 80degrees, TR 8.2 S, TE 3.6 S, slice thickness 12 mm).Cine images were acquired from a single locationapproximately at 1 s intervals (about 128 consecutiveimages obtained during the nominal 2-min imagingtime). The sagittal or axial images were then dis-played in cine format, forming a real-time “movie”of airway motion (see Video 1, Supplemental DigitalContent 1: midline sagittal cine image shows inter-mittent and repetitive collapse of the retroglossalairway, http://links.lww.com/A1370). An inter-pretable MRI sleep study was defined as a study inwhich all image sequences in protocol were ob-tained without motion artifact, and sagittal andaxial cine MRIs were obtained without any artificialairway.

In a majority of children in both groups, insertion ofan IV catheter was facilitated by inhalation of sevoflu-rane and/or nitrous oxide. In the dexmedetomidinegroup, four patients received IM ketamine and an-other three children received topical EMLA to facili-tate IV insertion. Three children in the propofol groupreceived EMLA to facilitate IV insertion. Anesthesiawas initiated by a bolus dose followed by an infusionof dexmedetomidine or propofol. Once an adequatelevel of anesthesia was achieved, nasal cannulae witha sample port for end-tidal carbon dioxide analysiswere applied and the children were positioned supinein the head-and-neck vascular coil with the cervicalspine in the neutral position and permitted to breathespontaneously. With the exception of temperature,standard physiologic variables (electrocardiogram, ar-terial oxygen saturation, capnography, and arterialblood pressure) were monitored throughout the scan-ning procedure and recorded at 5-min interval on theanesthetic record. If patients moved during thestudy, an additional bolus dose of dexmedetomi-dine or propofol was administered; infusion ratesfor dexmedetomidine and propofol were adjusted atthe discretion of the attending anesthesiologistbased on subject’s response.

All anesthetic records were handwritten. All airwaymaneuvers recorded are standard practice for these

746 Dexmedetomidine Versus Propofol for Pediatric Sleep Studies ANESTHESIA & ANALGESIA

specialized MRI sleep studies in our institution. Wedid confirm the presence of an artificial airway fromtwo sources, the anesthesia record and the MRI sleepstudy report (in their report radiologists consistentlycomment on the presence or absence of artificialairway and the reason for placement). To minimizeselection bias and the impact of other changes inmanagement on the outcome variables and to com-pensate for the retrospective, nonrandomized natureof our study, the dexmedetomidine and propofolgroups included all children presenting for MRI sleepstudies during a defined and relatively short interval.

Supplemental oxygen was administered via thenasal cannula to maintain adequate arterial oxygensaturation. Insertion of an artificial airway (either anoral airway or a nasal trumpet), placement of shoulderroll, or taping the chin to manage airway obstructionand oxygen desaturation was performed at the discre-tion of the attending anesthesiologist. Artificial air-ways were removed during the 2-min period whenthe sagittal cine images were acquired. Studies wereterminated if the child was unable to maintain ad-equate arterial oxygen saturation, as determined bythe clinical judgment of the attending anesthesiologistafter removal of the artificial airway. At the comple-tion of imaging, the dexmedetomidine or propofolinfusion was discontinued and patients were trans-ferred to the recovery room. Patients were dischargedafter meeting standard discharge criteria, includinglevel of consciousness (awake or easy arousal withverbal commands), core temperature �36°C, ability toswallow (taking oral fluids), adequacy of musclestrength (strong and close to baseline movements ofextremities and head), and status consistent with thepatient’s preoperative baseline level of function.

The following data were recorded: age, weight,gender, relevant comorbidities (such as trisomy 21),

ASA physical status, severity of OSA on polysomnog-raphy (normal, mild moderate, or severe), lowestarterial oxygen saturation recorded during polysom-nography, anesthetic induction drug, total dexme-detomidine or propofol bolus dose, and infusion ratesof dexmedetomidine and propofol. The primary out-comes were successful completion of the MRI scanwith or without an artificial airway or other airwayintervention and need for an artificial airway or otherairway intervention. Children requiring airway inter-ventions (shoulder roll or chin lift) were still classifiedas native airways with successful completion of theMRI because radiologists comment on the presence orabsence of artificial airway. This information wasdocumented only in the anesthesia record. Secondaryoutcomes were hemodynamic changes during anes-thesia, recovery time, and complications related toanesthesia.

Continuous data are presented as mean (sd) ormedian (interquartile range [IQR]), depending onwhether or not the data were normally distributed;categorical data are presented by frequency. Continu-ous measures were analyzed by two-sample t-tests orWilcoxon’s ranked sum test as appropriate; categoricalmeasures were analyzed by �2 tests or Fisher’s exacttests as appropriate. Changes in heart rate and arterialblood pressure were analyzed with paired t-tests.Results were considered statistically significant forP � 0.05.

RESULTSPolysomnographic sleep studies documenting the

severity of OSA were available for 67 of the 82 childrenin the sample. Demographic characteristics includingage, weight, gender, ASA physical status, comorbidities,and severity of OSA by polysomnography were compa-rable between the groups, both overall and for the

Table 1. Demographic Characteristics

Characteristic

All subjectsaSubjects with polysomnography

study available

Dexmedetomidine(N � 52)

Propofol(N � 30)


Propofol(N � 26)

Age (yr) 11.0 (6.0, 15.0) 9.5 (5.0, 14.0) 10.0 (6.0, 13.0) 9.5 (5.0, 14.0)Weight (kg) 37.0 (23.0, 60.0) 30.5 (20.0, 49.3) 36.0 (23.0, 59.0) 26.0 (20.0, 47.0)Male, N (%) 34 (65) 23 (77) 30 (73) 20 (77)ASA physical status, N (%)

I or II 39 (75) 24 (80) 31 (76) 20 (77)III 13 (25) 6 (20) 10 (24) 6 (23)

Comorbidity, N (%) 39 (75) 28 (93) 31 (76) 24 (92)Trisomy 21, N (%) 23 (44) 17 (57) 19 (46) 14 (54)OSA severity, N (%)

Mild 16 (31) 10 (33) 16 (39) 8 (31)Moderate 11 (21) 8 (27) 11 (27) 9 (35)Severe 14 (27) 8 (27) 14 (34) 9 (35)

Room air Spo2 nadir (%) 87 (84, 91) 88 (84, 93) 87 (84, 91) 88 (84, 93)For continuous measures, 50% (25%, 75%) percentiles are reported.For categorical measures, frequencies (%) are reported.OSA � obstructive sleep apnea.a Of all 82 patients, 15 subjects did not have documentation of OSA grade by polysomnography: 11 subjects were in the dexmedetomidine group, 4 subjects were in the propofol group.


subgroups with available polysomnographic sleep stud-ies (Table 1). The most frequent comorbidity in bothgroups was trisomy 21. Additional comorbidities in thedexmedetomidine group included hypothyroidism (n �3), tracheomalacia (n � 3), obesity (n � 2), pulmonaryhypertension (n � 2), scoliosis (n � 1), Angelman,Stickler, or Barnes syndrome (n � 1 each), and PierreRobin sequence (n � 1). Additional comorbidities in thepropofol group included obesity (n � 1), scoliosis (n �1), Pierre Robin sequence (n � 2), hypothyroidism (n �1), achondroplasia (n � 1), Moyamoya disease (n � 1),and Rubinstein-Taybi syndrome (n � 1). All subjects inboth groups had undergone previous adenotonsillec-tomy in an attempt to address OSA. Additional previousairway surgical procedures in the dexmedetomidinegroup included genioglossus advancement (n � 2),palatoplasty (n � 3), and supraglottoplasty (n � 1).Additional previous airway surgical procedures in thepropofol group included uvulopalatoplasty (n � 1),lingual tonsillectomy (n � 1), pharyngeal flap (n � 3),cleft palate repair (n � 2), and tongue base reduction(n � 1).

The median (IQR) bolus doses of dexmedetomidineand propofol were 2 (2, 2) �g/kg and 1 (1, 2) mg/kg,respectively. The median (IQR) infusion rates weredexmedetomidine 2 (2, 2) �g � kg�1 � h�1 and propofol200 (150, 200) �g � kg�1 � min�1. Atropine was admin-istered to five patients (12%) in the dexmedetomidinegroup and one patient (4%) in the propofol group(P � 0.39).

Primary outcomes by treatment group are shown inTable 2. Outcomes were similar for the completesample and for the subset with OSA confirmed bypolysomnography; further discussion of primary out-comes will be restricted to the subset of subjects whoseseverity of OSA had been documented on polysom-nography. The MRI study was completed and aninterpretable MRI scan was generated in 40 of 41children in the dexmedetomidine group (98%) and 26of 26 children in the propofol group (100%). A largerproportion of children sedated with dexmedetomi-dine were able to complete the MRI scan without an

artificial airway compared with those sedated withpropofol, although this difference achieved only bor-derline statistical significance (P � 0.06). Childrensedated with propofol were more likely to require anartificial airway during the scan compared with thosesedated with dexmedetomidine (P � 0.04). Overall,almost half of the children receiving propofol requiredan airway intervention of some sort during the MRIscan, compared with only about one sixth of thosereceiving dexmedetomidine (P � 0.01).

Subjects were stratified by the severity of OSA andthe need for an artificial airway was compared bystrata for both treatment groups (Table 3). Measures ofthe severity of OSA were comparable for each treat-ment group within each strata. Significantly morechildren with severe OSA in the propofol group (56%)required an artificial airway during the MRI sleepstudy compared with those in the dexmedetomidinegroup (7%, P � 0.02).

The one subject in the dexmedetomidine groupwho failed to complete the MRI sleep study had ahistory of severe OSA and experienced significantoxygen desaturation despite administration of supple-mental oxygen and use of artificial airways. Twosubjects in the dexmedetomidine group required ad-ditional bolus doses because of movement during theexamination; none of the subjects in the propofolgroup required either a bolus dose or an increase inthe infusion rate during the examination. No compli-cations during recovery were noted in either group.All patients were discharged the day of the examina-tion after they met discharge criteria; no significantcomplications were identified on follow-up telephonecommunications the day after the examination.

Hemodynamic effects were observed with bothdexmedetomidine and propofol (Fig. 1). Comparedwith their baseline heart rate (99 � 22 bpm), childrenreceiving dexmedetomidine experienced a significantreduction in heart rate (78 � 18 bpm) after receivingthe dexmedetomidine bolus (Fig. 1A; P � 0.0001).Subjects in the propofol group did not demonstrateany changes in heart rate after the propofol bolus (Fig.

Table 2. Airway Interventions During MRI Sleep Study

All subjectsSubjects with polysomnography

study available


Propofol(N � 30) P


Propofol(N � 26) P

Artificial airway N (%) 0.03 0.04None 47 (90) 21 (70) 36 (88) 17 (65)Intermittent 5 (10) 9 (30) 5 (12) 9 (35)

Chin lift or shoulder roll, N (%) 1 (2) 3 (10) 0.14 1 (2) 3 (12) 0.29Any airway intervention, N (%) 6 (12) 12 (40) 0.005 6 (15) 12 (46) 0.01Interpretable MRI scan, N (%) 51 (98) 30 (100) 1 40 (98) 26 (100) 1

With native airway, N (%) 46 (88) 21 (70) 0.03 35 (85) 17 (65) 0.06With artificial airway, N (%) 5 (10) 9 (30) 5 (12) 9 (35)

Fisher’s exact test was used to calculate the P values.MRI � magnetic resonance imaging.


1A). There were no significant changes in systolic anddiastolic blood pressures from baseline after dexme-detomidine administration (Fig. 1B and C). In contrast,children in the propofol group experienced significantreductions in both systolic and diastolic blood pres-sure after the propofol bolus; these changes wereparticularly dramatic for diastolic blood pressure(44 � 8 mm Hg after propofol bolus versus 65 � 18mm Hg at baseline; Fig. 1B and C; P � 0.0001). Noneof the hemodynamic changes were considered to be ofsufficient magnitude to necessitate interrupting orterminating the imaging study.

The duration of stay in the recovery room wassignificantly shorter in the propofol group (28 � 12min) compared with the dexmedetomidine group(69 � 37 min, P � 0.0001).

DISCUSSIONIn our series, interpretable sleep study MRI scans

and cines were obtained for virtually all subjects,whether they were sedated with dexmedetomidine orpropofol. However, artificial airway placement orpositioning aids were required in a significantlysmaller proportion of subjects sedated with dexme-detomidine (12%) than with propofol (35%). Thesebenefits were seen primarily in children with severeOSA; there appeared to be no relative advantages foreither drug in children with mild OSA symptoms.Despite the high-risk nature of the OSA population,artificial airways were required by only 12% of pa-tients sedated with dexmedetomidine.

Airway obstruction in childhood OSA can be due toa combination of structural obstruction and dynamicairway collapsibility.15,16 The decrease in airway mus-cular tone associated with natural sleep and sedation,as well as the supine position, lead to changes in the

anatomic positioning of structures that surround theairway.17–19 These changes are more pronounced inchildren with OSA and often they demonstrate in-creased dynamic airway collapse, contributing to theclinical findings in OSA.20 Precise localization of thesites of upper airway occlusion during sleep has beenattempted by a variety of techniques, including pha-ryngoscopy, fluoroscopy, pressure measurements,computed axial tomography, and MRI. MRI with cinesequences has become a useful tool to identify theanatomic and dynamic causes of persistent OSA.1,21–23

MRI sleep studies are noninvasive and allow thewhole airway to be visualized at once with highcontrast resolution, demonstrating both static anddynamic abnormalities that lead to functional collapseof the airway.21,24–31 Identification of the site(s) ofupper airway obstruction in patients with OSA aids insurgical planning,32 and dynamic imaging studies,such as cine MRI, have been shown to affect manage-ment decisions in more than 50% of cases of OSA.21,33

Because symptoms occur only during sleep in chil-dren with OSA, demonstration of airway collapse/obstruction on MRI requires that the child be eitherasleep or sedated. Although it would be ideal to performthese studies during natural sleep, performing the stud-ies during natural sleep is highly impractical, inefficient,and typically unsuccessful; many, perhaps most, chil-dren will not tolerate the MRI environment well enoughto fall asleep and the loud noise of the gradient-echosequences used to create the cine MRI images typicallyawakens those who do fall asleep.14

Upper airway collapsibility is markedly increasedin both sleeping and anesthetized children.17,34 Anes-thesia for children undergoing MRI sleep studies canoften be a challenge because children with significantOSA are sensitive to all sedative and anesthetic drugs,

Table 3. Requirement for Artificial Airway by Severity of OSA as Documented by Polysomnography

OSA severity Dexmedetomidine Propofol PMild N � 16 N � 8

Obstructive index (events/h) 2.7 � 1.9 3.1 � 1.3 0.53*Respiratory disturbance index (events/h) 3.6 � 1.9 4.4 � 1.7 0.30*Needed artificial airway, N (%) 2 (13) 1 (13) 1†Room air Spo2 nadir (%) 91 (89, 94) 92 (88, 96) 0.54‡

Moderate N � 11 N � 9Obstructive index (events/h) 10.2 � 5.8 8.8 � 3.8 0.54*Respiratory disturbance index (events/h) 11.0 � 5.8 10.9 � 4.3 0.96*Needed artificial airway, N (%) 2 (18) 3 (33) 0.62†Room air Spo2 nadir (%) 86 (85, 87) 86 (84, 89) 0.91‡

Severe N � 14 N � 9Obstructive index (events/h) 21.8 � 11.3 23.6 � 13.5 0.74*Respiratory disturbance index (events/h) 23.8 � 11.2 24.9 � 13.1 0.83*Needed artificial airway, N (%) 1 (7) 5 (56) 0.02†Room air Spo2 nadir (%) 84 (77, 88) 86 (82, 92) 0.45‡

The obstructive index is the number of obstructive apneas per hour of sleep. The respiratory disturbance index is the number of apneas including both central and obstructive components andhypoapneic episodes per hour of sleep. The severity of OSA was defined as follows normal � obstructive index �1; mild OSA � obstructive index 1–5; moderate OSA � obstructive index �5–10;and severe OSA � obstructive index �10. The obstructive index and the respiratory disturbance index values were reported as mean � SD. Need for artificial airway and successful MRIcompletions were reported by N (percentages). Room air SpO2 nadir from preprocedure polysomnography was reported as 50% (25%, 75%) percentiles.OSA � obstructive sleep apnea; MRI � magnetic resonance imaging.* Two-sample t-test was used.† Fisher’s exact test was used.‡ Wilcoxon’s rank sum test was used. P � 0.05 was considered statistically significant.


and upper airway obstruction or respiratory depres-sion can occur even at minimal levels of sedation.10

Sedatives and anesthetics commonly used in childrenfor MRI sleep studies include pentobarbital, propofol,and benzodiazepines. Propofol and barbiturates canexacerbate upper airway obstruction and increase therisk of respiratory depression and/or apnea.10 Benzo-diazepines have relaxant effects on the pharyngealmusculature, causing a reduction of the pharyngealspace.35 In contrast to the previously mentioned drugs,ketamine has been shown to preserve the hypopharyn-geal size in adults.36 In an anecdotal report, a combina-tion of ketamine 1 mg/kg and dexmedetomidine 1

�g/kg followed by a dexmedetomidine infusion of 1�g � kg�1 � h�1 was effective in providing anesthesiawithout exacerbating respiratory problems during MRIin three children with trisomy 21 and OSA.37

The ideal anesthetic for MRI sleep studies wouldprovide reliable anesthesia under near-physiologicsleep conditions, avoid airway collapse, obstructionand respiratory depression necessitating the use ofartificial airways, have a predictable duration of ac-tion, and exhibit minimal cardiovascular and otherside effects. Because of its sedative and anxiolyticproperties, dexmedetomidine has been shown to be auseful drug for pediatric procedural sedation.38–44

Figure 1. Baseline and postbolus hemodynamics. Closed circles represent dexmedetomidine group and open circles representpropofol group. In the x axis, the first data point is the mean baseline hemodynamic value and the second data point is themean hemodynamic value after the drug bolus. (A) Comparison of baseline and postdrug heart rates: baseline mean heart ratein beats per minute (bpm) in the dexmedetomidine group (99 � 22 bpm) and the propofol group (95 � 21 bpm) werecomparable (P � 0.47). Compared with baseline, use of propofol did not change mean heart rate significantly but use ofdexmedetomidine decreased mean heart rate (P � 0.0001). Postdrug mean heart rate in the dexmedetomidine group (78 �18 bpm) was significantly lower than in the propofol group (91 � 12 bpm; P � 0.0005). (B) Comparison of baseline andpostdrug systolic blood pressures: baseline mean systolic blood pressure in the dexmedetomidine group (118 � 15 mm Hg)and the propofol group (111 � 30 mm Hg) was comparable (P � 0.28). Compared with baseline, use of propofol (P � 0.03)decreased mean systolic blood pressure and the reduction after dexmedetomidine was not statistically significant (P � 0.06).Postdrug mean systolic blood pressure in the propofol group (96 � 14 mm Hg) was significantly lower than thedexmedetomidine group (107 � 19 mm Hg; P � 0.007). (C) Comparison of baseline and postdrug diastolic blood pressures:baseline mean diastolic blood pressure (in mm Hg) in the dexmedetomidine group (66 � 12 mm Hg) and the propofol group(65 � 18 mm Hg) was comparable (P � 0.83). Compared with baseline, use of propofol (P � 0.0001) significantly decreasedmean diastolic blood pressure. Postdrug mean diastolic blood pressure in the propofol group (44 � 8 mm Hg) wassignificantly lower than the dexmedetomidine group (59 � 15 mm Hg; P � 0.0001).


Sedation with dexmedetomidine has properties thatparallel natural sleep,11–13 and patients clinically se-dated with dexmedetomidine are still easily arous-able, an effect not observed with other availablesedatives.45 It, thus, seemed to us that dexmedetomi-dine had many of the characteristics of an idealsedative for MRI sleep studies. After we began usingdexmedetomidine to provide anesthesia during MRIsleep studies, it was our clinical impression thatpatients experienced fewer episodes of desaturationand airway obstruction than with pentobarbital andpropofol, the drugs we had previously used, enablingus to complete the studies with fewer interruptions,especially in patients with severe OSA. Our studyfinding of reduced need for artificial airways in thedexmedetomidine group compared with the propofolgroup (Tables 2 and 3) supports our hypothesis ofbetter preservation of upper airway tone and minimalairway collapsibility with dexmedetomidine anesthe-sia compared with propofol.

The minimal respiratory depression associatedwith dexmedetomidine alone is probably not suffi-cient to explain the observed improved conditionsduring MRI sleep studies, because spontaneous respi-ration is also maintained in patients sedated withpentobarbital or propofol. We hypothesize that therelaxant effects of dexmedetomidine on upper airwaymuscle tone are similar to those seen with naturalsleep and less than those of other sedatives or anes-thetics for any given level of anesthesia. We areunaware of any systematic investigations of the effectsof dexmedetomidine on upper airway tone or caliberand suggest that this would be an interesting subjectfor future investigations. The configurational changesleading to obstruction in the upper airway duringanesthesia with propofol in children have been stud-ied. Evans et al.46 showed that increasing depth ofpropofol anesthesia in children is associated withupper airway narrowing throughout the entire upperairway, most pronounced in the hypopharynx at thelevel of epiglottis. Litman et al.46,47 concluded that thedimensions of the upper airways of children changeshape significantly on awakening from propofol anes-thesia, and most children had the narrowest point inthe pharynx at the level of the soft palate.

Although the severity of obstructive apnea in chil-dren is greater in the last third of the night comparedwith the first third,48 the mechanisms for this areunclear. Phasic rapid-eye-movement (REM) sleep isassociated with central inhibition of ventilation.49,50

Theoretically, muscle hypotonia and central inhibitionof breathing may be worse during the more intenseportions of REM sleep. Propofol affects REM sleep andmay simulate the worst case scenario for functionalairway studies. Therefore, propofol may be a pre-ferred drug to evaluate the behavior of the pharyngealairway in children with mild to moderate OSASprovided there is no significant accompanying oxygendesaturation. Dexmedetomidine might be the preferred

drug for children with a history of severe OSA as shownby our results. The sedative effect of dexmedetomidine ismediated via stimulation of �-2 adrenoceptors in thelocus coeruleus, whereas propofol acts through the in-hibitory neurotransmitter �-aminobutyric acid. There issome evidence that sedation induced with dexmedeto-midine resembles normal sleep11,13; in rats, the pattern ofc-Fos expression (a marker of activation of neurons) isqualitatively similar to that seen during normal non-REM sleep, suggesting that endogenous sleep pathwaysare causally involved in dexmedetomidine-induced se-dation.11 Our study generates a hypothesis on finding anideal anesthetic technique to evaluate the function of theupper airway in severe OSA. Perhaps an initial evalua-tion under dexmedetomidine simulating non-REM sleepfollowed by an infusion of propofol to simulate REMsleep would yield a comprehensive dynamic evaluationof the airway that would significantly help in surgicalmanagement decisions in these difficult children. Afuture prospective study to develop such a techniquewould address this important issue.

An anesthetic challenge during dynamic MRI air-way imaging is determining when to perform anairway intervention. Overnight polysomnographynoting the severity of desaturations during naturalsleep can be used by the anesthesiologist as a guide todetermine minimal acceptable arterial oxygen satura-tion before intervention. If an artificial airway isrequired, a nasal trumpet is preferred over an oralairway because it interferes less with the evaluation ofthe retroglossal airway, a critical dynamic componentof the MRI airway study.

Despite the high affinity of dexmedetomidine forthe �2 versus �1 adrenergic receptor (1620:1), signifi-cant cardiovascular effects, such as bradycardia, sinusarrest, and hypotension, have been reported.51 In ourseries, hemodynamic changes after dexmedetomidinewere generally mild and self-limited, although thedegree of bradycardia seen after the initial dose wasgreater in children with trisomy 21.

The limitations of our report include its retrospec-tive nature, the lack of prospectively specified thresh-olds for airway and hemodynamic interventions, andexperience from a single center involving an uncom-mon, highly specialized imaging study. Even thoughwe were unable to access an electronic anestheticrecord to identify airway interventions, we feel thatthe use of two independent sources (the writtenanesthetic record and the radiologist’s report) pro-vides an acceptable level of reliability and accuracy forthe data. To control for any possible selection biasrelated to the severity of OSA, we stratified children inboth groups using objective OSA criteria and excludedthose children without a detailed polysomnographicreport from our final analysis. Although it wouldobviously have been preferable to have performed aprospective, randomized study, by the time that we


had gained sufficient experience with dexmedetomi-dine to consider a formal investigation, the advan-tages of dexmedetomidine, especially in children withsignificant OSA, had led to its preference over propo-fol by our group for dynamic airway MRI study,which may explain the unequal numbers of subjects inthis study receiving propofol and dexmedetomidine.Although MRI sleep studies to evaluate refractoryOSA are a highly specialized subset of all MRI exami-nations, our results may have applicability to childrenwith severe sleep-disordered breathing presenting forall types of imaging studies requiring sedation oranesthesia.

In conclusion, both dexmedetomidine and propofolprovided anesthesia leading to interpretable MRIsleep studies in almost all subjects. However, MRIsleep studies were completed without artificial air-ways in a larger proportion of children with OSAreceiving dexmedetomidine than propofol. Dexme-detomidine caused significant reductions in heart rateand propofol caused significant reductions in arterialblood pressure; these hemodynamic changes did notinterrupt or interfere with successful completion of theMRI sleep study. Among currently available anesthet-ics, dexmedetomidine may offer more favorable con-ditions than propofol during MRI sleep studies inchildren with significant OSA and may offer advan-tages for other imaging and diagnostic studies inchildren with significant sleep-disordered breathing.

REFERENCES

1. Donnelly LF, Surdulescu V, Chini BA, Casper KA, Poe SA,Amin RS. Upper airway motion depicted at cine MR imagingperformed during sleep: comparison between young patientswith and those without obstructive sleep apnea. Radiology2003;227:239–45

2. Donnelly LF, Casper KA, Chen B, Koch BL. Defining normalupper airway motion in asymptomatic children during sleep bymeans of cine MR techniques. Radiology 2002;223:176–80

3. Abbott MB, Dardzinski BJ, Donnelly LF. Using volume segmen-tation of cine MR data to evaluate dynamic motion of the airwayin pediatric patients. AJR Am J Roentgenol 2003;181:857–9

4. Donnelly LF, Casper KA, Chen B. Correlation on cine MRimaging of size of adenoid and palatine tonsils with degree ofupper airway motion in asymptomatic sedated children. AJRAm J Roentgenol 2002;179:503–8

5. Suto Y, Matsuo T, Kato T, Hori I, Inoue Y, Ogawa S, Suzuki T,Yamada M, Ohta Y. Evaluation of the pharyngeal airway inpatients with sleep apnea: value of ultrafast MR imaging. AJRAm J Roentgenol 1993;160:311–4

6. Shellock FG, Schatz CJ, Julien P, Steinberg F, Foo TK, Hopp ML,Westbrook PR. Occlusion and narrowing of the pharyngealairway in obstructive sleep apnea: evaluation by ultrafastspoiled GRASS MR imaging. AJR Am J Roentgenol 1992;158:1019–24

7. Jager L, Gunther E, Gauger J, Reiser M. Fluoroscopic MR of thepharynx in patients with obstructive sleep apnea. AJNR Am JNeuroradiol 1998;19:1205–14

8. Abbott MB, Donnelly LF, Dardzinski BJ, Poe SA, Chini BA,Amin RS. Obstructive sleep apnea: MR imaging volume seg-mentation analysis. Radiology 2004;232:889–95

9. Donnelly LF, Shott SR, LaRose CR, Chini BA, Amin RS. Causesof persistent obstructive sleep apnea despite previous tonsillec-tomy and adenoidectomy in children with Down syndrome asdepicted on static and dynamic cine MRI. AJR Am J Roentgenol2004;183:175–81

10. Connolly LA. Anesthetic management of obstructive sleepapnea patients. J Clin Anesth 1991;3:461–9

11. Nelson LE, Lu J, Guo T, Saper CB, Franks NP, Maze M. Thealpha2-adrenoceptor agonist dexmedetomidine converges onan endogenous sleep-promoting pathway to exert its sedativeeffects. Anesthesiology 2003;98:428–36

12. Doze VA, Chen BX, Maze M. Dexmedetomidine produces ahypnotic-anesthetic action in rats via activation of centralalpha-2 adrenoceptors. Anesthesiology 1989;71:75–9

13. Hsu YW, Cortinez LI, Robertson KM, Keifer JC, Sum-Ping ST,Moretti EW, Young CC, Wright DR, Macleod DB, Somma J.Dexmedetomidine pharmacodynamics: part I: crossover com-parison of the respiratory effects of dexmedetomidine andremifentanil in healthy volunteers. Anesthesiology 2004;101:1066–76

14. Donnelly LF. Obstructive sleep apnea in pediatric patients:evaluation with cine MR sleep studies. Radiology 2005;236:768–78

15. Marcus CL, Katz ES, Lutz J, Black CA, Galster P, Carson KA.Upper airway dynamic responses in children with the obstruc-tive sleep apnea syndrome. Pediatr Res 2005;57:99–107

16. Farre R, Rigau J, Montserrat JM, Buscemi L, Ballester E, NavajasD. Static and dynamic upper airway obstruction in sleep apnea:role of the breathing gas properties. Am J Respir Crit Care Med2003;168:659–63

17. Marcus CL, McColley SA, Carroll JL, Loughlin GM, Smith PL,Schwartz AR. Upper airway collapsibility in children with obstruc-tive sleep apnea syndrome. J Appl Physiol 1994;77:918–24

18. Cartwright RD. Effect of sleep position on sleep apnea severity.Sleep 1984;7:110–4

19. Neill AM, Angus SM, Sajkov D, McEvoy RD. Effects of sleepposture on upper airway stability in patients with obstructivesleep apnea. Am J Respir Crit Care Med 1997;155:199–204

20. Isono S, Tanaka A, Nishino T. Dynamic interaction between thetongue and soft palate during obstructive apnea in anesthetizedpatients with sleep-disordered breathing. J Appl Physiol2003;95:2257–64

21. Gibson SE, Myer CM III, Strife JL, O’Connor DM. Sleep fluo-roscopy for localization of upper airway obstruction in children.Ann Otol Rhinol Laryngol 1996;105:678–83

22. Donnelly LF, Strife JL, Myer CM III. Is sedation safe duringdynamic sleep fluoroscopy of children with obstructive sleepapnea? AJR Am J Roentgenol 2001;177:1031–4

23. Donnelly LF, Jones BV, Strife JL. Imaging of pediatric tongueabnormalities. AJR Am J Roentgenol 2000;175:489–93

24. Owen GO, Canter RJ, Robinson A. Snoring, apnoea and ENTsymptoms in the paediatric community. Clin Otolaryngol AlliedSci 1996;21:130–4

25. Guilleminault C, Winkle R, Korobkin R, Simmons B. Childrenand nocturnal snoring: evaluation of the effects of sleep relatedrespiratory resistive load and daytime functioning. Eur J Pediatr1982;139:165–71

26. Ali NJ, Pitson DJ, Stradling JR. Snoring, sleep disturbance, andbehaviour in 4–5 year olds. Arch Dis Child 1993;68:360–6

27. Ali NJ, Pitson D, Stradling JR. Natural history of snoring andrelated behaviour problems between the ages of 4 and 7 years.Arch Dis Child 1994;71:74–6

28. Rosen CL. Clinical features of obstructive sleep apnea hypoven-tilation syndrome in otherwise healthy children. Pediatr Pulmo-nol 1999;27:403–9

29. Marcus CL, Carroll JL, Koerner CB, Hamer A, Lutz J, LoughlinGM. Determinants of growth in children with the obstructivesleep apnea syndrome. J Pediatr 1994;125:556–62

30. Brouillette RT, Fernbach SK, Hunt CE. Obstructive sleep apneain infants and children. J Pediatr 1982;100:31–40

31. Owens J, Opipari L, Nobile C, Spirito A. Sleep and daytimebehavior in children with obstructive sleep apnea and behav-ioral sleep disorders. Pediatrics 1998;102:1178–84

32. Hudgel DW, Harasick T, Katz RL, Witt WJ, Abelson TI. Uvulo-palatopharyngoplasty in obstructive apnea. Value of preopera-tive localization of site of upper airway narrowing during sleep.Am Rev Respir Dis 1991;143:942–6

33. Shott SR, Donnelly LF. Cine magnetic resonance imaging:evaluation of persistent airway obstruction after tonsil andadenoidectomy in children with Down syndrome. Laryngo-scope 2004;114:1724–9

34. Isono S, Shimada A, Utsugi M, Konno A, Nishino T. Compari-son of static mechanical properties of the passive pharynxbetween normal children and children with sleep-disorderedbreathing. Am J Respir Crit Care Med 1998;157:1204–12


35. den Herder C, Schmeck J, Appelboom DJ, de Vries N. Risks ofgeneral anaesthesia in people with obstructive sleep apnoea.BMJ 2004;329:955–9

36. Drummond GB. Comparison of sedation with midazolam andketamine: effects on airway muscle activity. Br J Anaesth1996;76:663–7

37. Luscri N, Tobias JD. Monitored anesthesia care with a combi-nation of ketamine and dexmedetomidine during magneticresonance imaging in three children with trisomy 21 andobstructive sleep apnea. Paediatr Anaesth 2006;16:782–6

38. Mason KP, Zgleszewski SE, Dearden JL, Dumont RS, Pirich MA,Stark CD, D’Angelo P, Macpherson S, Fontaine PJ, Connor L,Zurakowski D. Dexmedetomidine for pediatric sedation forcomputed tomography imaging studies. Anesth Analg 2006;103:57–62

39. Koroglu A, Teksan H, Sagir O, Yucel A, Toprak HI, Ersoy OM.A comparison of the sedative, hemodynamic, and respiratoryeffects of dexmedetomidine and propofol in children undergo-ing magnetic resonance imaging. Anesth Analg 2006;103:63–7

40. Munro HM, Tirotta CF, Felix DE, Lagueruela RG, Madril DR,Zahn EM, Nykanen DG. Initial experience with dexmedetomi-dine for diagnostic and interventional cardiac catheterization inchildren. Paediatr Anaesth 2007;17:109–12

41. Heard CM, Joshi P, Johnson K. Dexmedetomidine for pediatricMRI sedation: a review of a series of cases. Paediatr Anaesth2007;17:888–92

42. Nichols DP, Berkenbosch JW, Tobias JD. Rescue sedation withdexmedetomidine for diagnostic imaging: a preliminary report.Paediatr Anaesth 2005;15:199–203

43. Berkenbosch JW, Wankum PC, Tobias JD. Prospective evalua-tion of dexmedetomidine for noninvasive procedural sedationin children. Pediatr Crit Care Med 2005;6:435–9; quiz 40

44. Mason KP, Zurakowski D, Zgleszewski SE, Robson CD, CarrierM, Hickey PR, Dinardo JA. High dose dexmedetomidine as thesole sedative for pediatric MRI. Paediatr Anaesth 2008;18:403–11

45. Venn RM, Bradshaw CJ, Spencer R, Brealey D, Caudwell E,Naughton C, Vedio A, Singer M, Feneck R, Treacher D, WillattsSM, Grounds RM. Preliminary UK experience of dexmedetomi-dine, a novel agent for postoperative sedation in the intensivecare unit. Anaesthesia 1999;54:1136–42

46. Evans RG, Crawford MW, Noseworthy MD, Yoo SJ. Effect ofincreasing depth of propofol anesthesia on upper airway con-figuration in children. Anesthesiology 2003;99:596–602

47. Litman RS, Weissend EE, Shrier DA, Ward DS. Morphologicchanges in the upper airway of children during awakening frompropofol administration. Anesthesiology 2002;96:607–11

48. Goh DY, Galster P, Marcus CL. Sleep architecture and respira-tory disturbances in children with obstructive sleep apnea. Am JRespir Crit Care Med 2000;162:682–6

49. Millman RP, Knight H, Kline LR, Shore ET, Chung DC, Pack AI.Changes in compartmental ventilation in association with eyemovements during REM sleep. J Appl Physiol 1988;65:1196–202

50. Smith CA, Henderson KS, Xi L, Chow C, Eastwood PR, DempseyJA. Neural-mechanical coupling of breathing in REM sleep. J ApplPhysiol 1997;83:1923–32

51. Bloor BC, Ward DS, Belleville JP, Maze M. Effects of intravenousdexmedetomidine in humans. II. Hemodynamic changes. Anes-thesiology 1992;77:1134–42


A Novel Skin-Traction Method Is Effective for Real-TimeUltrasound-Guided Internal Jugular Vein Catheterizationin Infants and Neonates Weighing Less Than5 Kilograms

Masato Morita, MD

Hiroshi Sasano, PhD, MD

Takafumi Azami, PhD, MD

Nobuko Sasano, PhD, MD

Yoshihito Fujita, PhD, MD

Shoji Ito, PhD, MD

Takeshi Sugiura, PhD, MD

Kazuya Sobue, PhD, MD

BACKGROUND: Internal jugular vein (IJV) catheterization in pediatric patients issometimes difficult because of the small sizes of veins and their collapse duringcatheterization. To facilitate IJV catheterization, we developed a novel skin-tractionmethod (STM), in which the point of puncture of the skin over the IJV is stretchedupward with tape during catheterization. In this study, we examined whether the STMincreases the cross-sectional area of the vein and thus facilitates catheterization.METHODS: This was a prospective study conducted from December 2006 to June2008. We enrolled 28 consecutive infants and neonates weighing �5 kg whounderwent surgery for congenital heart disease. The patients were randomlyassigned to a group in which STM was performed (STM group) or a group in whichit was not performed (non-STM group). The cross-sectional area and diameter ofthe right IJV in the flat position and 10° Trendelenburg position with and withoutapplying STM were measured. We determined time from first skin puncture to thefollowing: (a) first blood back flow, (b) insertion of guidewire, and (c) insertion ofcatheter. Number of punctures, success rate, complications, and degree of IJVcollapse during advancement of the needle (estimated as decrease of anteroposte-rior diameter during advancement of the needle compared with the diameterbefore advancement) were also examined.RESULTS: STM significantly increased the cross-sectional area and the anteroposte-rior diameter of the IJV in both positions. The time required to insert the catheterwas significantly shorter in the STM group, probably mainly due to a shorterguidewire insertion time. The degree of IJV collapse during advancement of theneedle was much lower in the STM group.CONCLUSIONS: STM facilitates IJV catheterization in infants and neonates weighing�5 kg by enlarging the IJV and preventing vein collapse.(Anesth Analg 2009;109:754–9)

Real-time ultrasound guidance is useful for catheter-ization of the internal jugular vein (IJV).1–3 However, IJVcatheterization in pediatric patients is sometimes diffi-cult even for skilled physicians who use ultrasoundguidance. The main reasons for such a difficulty inperforming catheterization are thought to be the smallvein size4 and vein collapse during catheterization.

A significant positive correlation has been foundbetween IJV diameter and the success rate of IJVcatheterization.5 Many reports have shown that theTrendelenburg position is effective for increasing the

diameter of the IJV,6–8 and thereby possibly improv-ing the success rate and decreasing the complicationrate of IJV catheterization.

During real-time ultrasound guidance, IJV col-lapse can occur when the skin is pressed with aprobe or the needle is inserted into the neck.Mallory et al.8 reported that advancement of theneedle decreased IJV cross-sectional area. We haveobserved that IJV collapse may be prevented bystretching the skin over the IJV in both the cephaladand caudad directions.

We have developed a novel skin-traction method(STM), in which the puncture point of the skin overthe IJV is lifted up as a result of stretching the skin inthe cephalad and caudal directions with surgical tape.

We have already reported that the STM couldincrease the cross-sectional area and anteroposteriordiameter of the IJV9 and prevent IJV collapse pro-duced by the ultrasound probe in adult volunteers.10

Thus, we hypothesized that the STM can facilitateIJV catheterization even in small children.

From the Department of Anesthesiology and Medical CrisisManagement, Nagoya City University Graduate School of MedicalSciences, Nagoya City, Aichi, Japan.

Accepted for publication May 2, 2009.Address correspondence and reprint requests to Hiroshi Sasano,

PhD, MD, Department of Anesthesiology and Medical Crisis Manage-ment, Nagoya City University Graduate School of Medical Sciences, 1Azakawasumi, Mizuho-cho, Mizuho-ku, Nagoya City, Aichi 467-8601,Japan. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181b01ae3


The purpose of this study was to examine: 1)whether STM increases the cross-sectional area anddiameter of the IJV and 2) whether it also facilitatesreal-time ultrasound-guided IJV catheterization in in-fants and neonates with congenital heart diseaseweighing �5 kg.

METHODSThis prospective, randomized study was conducted

from December 2006 to June 2008. We enrolled 28consecutive infants and neonates weighing �5 kg(2.40–4.91 median 3.58 kg) who underwent surgeryfor congenital heart disease.

The research protocol was reviewed and approvedby the Ethics Committee of our hospital, and writteninformed consent was obtained from each parent ofthese children.

Using the envelope method, the patients wererandomly assigned to a group in which STM wasperformed (STM group) or a group in which it was notperformed (non-STM group).

STM was performed as follows. The skin over theright IJV (RIJV) was lifted up with several pieces of2.6-cm-wide surgical tape (Transpore™ Surgical Tape,3M, St. Paul, MN) in the cephalad and caudad direc-tions. The skin cephalic to the RIJV was stretchedcephalad, whereas the skin caudal to the RIJV wasstretched caudad. Three pieces of tape were used ineach direction. The other ends of the tape were firmly

attached to the metal edge of the operating table sothat sufficient skin traction could be maintained. Theskin over the RIJV was stretched until a circle drawn onthe skin was changed elliptically about 1.5-fold (Fig. 1).The time needed for taping the skin was �1 min.

Measurement of Size of IJVBefore catheterization, we measured and examined

how STM could increase the cross-sectional area anddiameter of the RIJV in all patients including those ofthe non-STM group.

After the patients were anesthetized, endotrache-ally intubated, and mechanically ventilated, the ven-tilator mode was set to pressure-controlled (peakpressure 20-cm H2O, respiratory rate 20/min withapplication of 5-cm H2O positive end-expiratory pres-sure), and images with ultrasound were recorded.Real-time 2-dimensional (2D) ultrasound imaging(iLOOK25™, SonoSite, Bothell, WA) with videotapingwas used in this study. An ultrasound probe(L25/10–5 MHz) was placed perpendicularly on theskin surface of the neck to identify the RIJV. Care wastaken not to press the neck and compress the RIJV.Patients were placed in the flat position and 10°Trendelenburg position to examine the effects ofTrendelenburg position on the RIJV. A shoulder rollwas placed to extend the neck, which was rotatedabout 30°.11

Figure 1. Differences in surface of theneck when applying (right) and notapplying (left) STM. The skin over theRIJV is stretched up, and the puncturepoint (circle on the skin) is lifted up bySTM (double arrows). Before skin trac-tion was performed, the angle made bytwo lines that between the center of theclavicle (star) and the puncture pointand that between the mandibular angle(triangle) and the puncture point iskept at about 135°, which makes it easyto lift up the skin around the puncturepoint by the STM. The skin over theRIJV is stretched until a circle drawn inthe skin is changed elliptically about1.5-fold. STM � skin-traction method;RIJV � right internal jugular vein.


Measurements when both applying and not apply-ing STM were done in the flat position and then in theTrendelenburg position in all 28 patients of the twogroups (STM groups and non-STM groups). The pointof measurement was the lesser supraclavicular fossa atthe level of the cricoid cartilage.12

The images obtained using 2D ultrasound wererecorded by a video tape recorder and transferred to acomputer, where recorded areas and diameters of theRIJV at the end-inspiratory phase of positive ventila-tion were measured using ImageJ by a person blindedto the patient grouping13 (Image Processing and Anal-ysis in Java, version 1.34 s image analysis software).The cross-sectional area, anteroposterior diameter,and transverse diameter of the RIJV were measuredwith and without STM (Fig. 2).

All results are presented as the mean � sd. Two-way repeated-measures analysis of variance with Bon-ferroni adjustment made for multiple comparisonswas used to test for significance. P values �0.05 wereconsidered significant.

Efficacy of STM for CatheterizationWe examined the efficacy of STM for facilitating

real-time ultrasound-guided IJV catheterization in in-fants and neonates, who were assigned to the STMgroup or the non-STM group.

Nine anesthesiologists, who had more than 3 yrexperience with heart surgery anesthesia and werevery familiar with real-time ultrasound-guided IJVcatheterization, performed the catheterizations. Theywere each assisted by another anesthesiologist. Athird person other than the operator and assistantdrew one of the envelopes. If the patient was assignedto the non-STM group, the person removed severalpieces of tape used to measure IJV size.

An assistant sterilized the skin with povidone-iodine, cleaned off the drawn circle marker, andplaced sterile drapes, while covering the tapes in theSTM group to ensure that the operator was not awareof group assignment. Under general anesthesia and inthe ventilator mode described earlier, catheterizationwas performed with real-time ultrasound 2D imaging.Another video recorder recorded actual catheteriza-tion of the IJV to determine the time taken for theprocedure. With the patient in the 10° Trendelenburg

position, a double lumen, 17-gauge central venouscatheter (Nippon-Sherwood, Tokyo, Japan) was in-serted by the Seldinger technique, using a 24-gaugeindwelling cannula and 0.18-in. guidewire.

The following times were determined: (a) time fromfirst puncture of skin until confirmation of the firstaspiration of blood from the vein (blood back flowtime), (b) time from first puncture of skin until inser-tion of the guidewire (total guidewire time), (c) timefrom first puncture of skin until insertion of thecatheter (total catheter time), with the time of catheterinsertion defined as aspiration of blood from thecatheter, (d) B-A (pure guidewire time), (e) C-A (purecatheter time), and (f) C-B (catheter time alone).

The number of puncture attempts required toachieve successful catheterization was also counted.Ultimate success or failure of catheterization andcomplications, such as hematoma, arterial puncture,and pneumothorax, was recorded. The degree of IJVcollapse (estimated as decrease of anteroposterior di-ameter during advancement of the needle comparedwith the diameter before advancement) was measuredby a person blinded to patient groupings, with the useof 2D ultrasound imaging and videotape recorder.

Figure 2. Differences in the shape ofRIJV on ultrasonography when ap-plying (B) and not applying (A) STM.The cross-sectional area of the RIJVincreased mainly as a result of anincrease of anteroposterior diameterwhen applying STM. RIJV � rightinternal jugular vein; STM � skin-traction method; CCA � common ca-rotid artery.

Table 1. Baseline Demographics of the Study Groups

STM group(n � 14)

Non-STMgroup

(n � 14)Age (mo) 0.64 � 0.74 1.00 � 0.96Body weight (kg) 3.57 � 0.85 3.51 � 0.62Body height (cm) 50.4 � 3.99 50.7 � 5.19Cross-sectional area (cm2) 0.17 � 0.09 0.18 � 0.10Vein depth (mm) 6.45 � 0.97 6.54 � 1.12CVP (mm Hg) 7.92 � 2.61 7.00 � 2.38Heart disease VSD � PH 6 VSD � PH 10

DORV 2 TOF 2TAPVC 2 TA 1TGA 2 TGA 1ECD 1HLHS 1

Values are mean � SD. There were no significant differences between the two groups for allbaseline characteristics (Welch t-test).CVP � central venous pressure; VSD � ventricular septal defect; PH � pulmonaryhypertension; DORV � double outlet right ventricle; TAPVC � total anomalous pulmonaryvenous return; TGA � transposition of the great vessels; ECD � endocardial cushion defect;HLHS � hypoplastic left heart syndrome; TOF � tetralogy of Fallot; TA � tricuspid atresia;STM � skin-traction method.

756 Skin-Traction Method for Catheterization ANESTHESIA & ANALGESIA

Using the results of our pilot study, we assumedthat the expected difference in mean catheter insertiontime would be 150 s with an expected standarddeviation of 130 s. Assuming an � of 0.05 and power0.81, we calculated the required sample size to be 13 ineach group. All results are presented as mean � sd.Welch t-test was used to compare the baseline charac-teristics of the two groups including age, sex, bodyheight, body weight, vein diameter in the flat positionwithout STM, vein depth beneath the skin, and centralvenous pressure before the start of operation. The num-ber of punctures and the degree of IJV collapse duringadvancement of the needle were also analyzed usingWelch t-test. Kaplan-Meier estimates of the times de-scribed earlier (A-F) were compared using the log-ranktest. P values �0.05 were considered significant.

RESULTSOf the 28 patients enrolled in this study, 14 were in

the STM group and 14 were in the non-STM group.The baseline demographics of the subjects in the studyare shown in Table 1, and there were no significantdifferences between the two groups.

Measurement of Size of IJVTable 2 shows the changes in the cross-sectional

area, anteroposterior diameter, and transverse diam-eter of the RIJV at each head tilt position whenapplying and not applying STM in all 28 patients inboth the groups.

When not applying STM, the cross-sectional area ofthe RIJV was significantly larger in the Trendelenburgposition than in the flat position. STM significantlyincreased the cross-sectional area of the RIJV in the flatposition from 17.3 � 9.1 mm2 to 21.1 � 11.5 mm2 andin the Trendelenburg position from 19.6 � 9.9 mm2 to21.6 � 11.9 mm2.

STM significantly increased the anteroposterior di-ameter of the RIJV in both the flat and Trendelenburgpositions.

STM significantly decreased the transverse diam-eter (5.61 � 1.61 mm vs 5.26 � 1.42 mm) in theTrendelenburg position, whereas STM did not changeit in the flat position.

Figure 3. Kaplan-Meier estimates were made for the follow-ing times. A, Total catheterization time (time from start offirst puncture of skin until insertion of the catheter) wassignificantly shorter in the STM group (continuous line) thanin the non-STM group (dotted line). *P � 0.044 (log-rank). B,Pure guidewire time (time from first aspiration of bloodfrom the vein until insertion of guidewire) was shorter in theSTM group (continuous line) than in the non-STM group(dotted line), although not to a significant extent. P � 0.074(log-rank). STM � skin-traction method.

Table 2. Anatomical Measurement of the Right Internal Jugular Vein in 28 Patients of the Two Groups

a, FP without STM b, FP with STM c, TP without STM d, TP with STMCross-sectional area (mm2) 17.3 � 9.1 21.1 � 11.5* 19.6 � 9.9* 21.6 � 11.9†Anteroposterior diameter (mm) 3.88 � 0.91 4.55 � 1.15* 4.03 � 0.89* 4.67 � 1.14†‡Transverse diameter (mm) 5.34 � 1.52 5.35 � 1.47 5.61 � 1.61* 5.26 � 1.42†FP � flat position; TP � Trendelenburg position; STM � skin-traction method.* P � 0.05 (versus a).† P � 0.05 (versus c).‡ P � 0.05 (versus b).

Table 3. Between Group Comparisons of Study End Points

STMgroup

(n � 14)

Non-STMgroup

(n � 14)

P value(log-rank

test)Blood back-flow

time (s)57.9 � 97.5 65.0 � 76.4 0.417

Total guidewiretime (s)

91.5 � 93.7 243.7 � 329.4 0.075

Total cathetertime (s)

165.9 � 98.4 324.6 � 310.4 0.044

Pure guidewiretime (s)

33.6 � 22.6 178.7 � 284.6 0.074

Pure cathetertime (s)

107.9 � 30.4 259.6 � 264.1 0.017

Catheter timealone (s)

74.4 � 25.5 87.1 � 23.4a 0.393

Number ofpunctures

1.29 � 0.61 2.14 � 2.03 0.143*

Success 14/14 13/14Complications 0/14 0/14Degree of

collapse (%)50.4 � 25.4 91.5 � 21.2 �0.01*

Values are mean � SD.STM � skin-traction method.* Welch t-test.a n � 13.


Efficacy of STM for CatheterizationTable 3 shows the blood back flow time, total

guidewire time, total catheter time, pure guidewiretime, pure catheter time, and catheter time alone.Number of puncture attempts, ultimate success orfailure of catheterization, complications, and degree ofIJV collapse during advancement of the needle arealso shown.

Total catheter time was significantly shorter in theSTM group than in the non-STM group (165.9 � 98.4 svs 324.6 � 310.4 s, P � 0.044; Fig. 3A). Pure cathetertime was also significantly shorter in the STM groupthan in the non-STM group (107.9 � 30.4 s vs 259.6 �264.1 s, P � 0.017). Neither blood back flow time norcatheter time alone differed significantly between thegroups. Pure guidewire time was shorter in the STMgroup, although not to a significant extent (33.6 �22.6 s [STM group] vs 178.7 � 284.6 s [non-STMgroup], P � 0.074; Fig. 3B).

The number of puncture attempts to achieve suc-cessful catheterization was less in the STM group,although not to a significant extent. There was onlyone case of catheterization failure in the non-STMgroup, which occurred because the operator could notinsert the guidewire. In this case, we counted both thetotal guidewire time and total catheter time as the timewhen the operator discontinued attempts to performcatheterization. Catheter time alone for this patientwas not included as a data point. Major complicationssuch as hematoma and arterial puncture did not occurin either group. After skin traction, the skin of somepatients became temporarily pink due to the force oftraction applied. However, the pink color quicklydisappeared. The degree of IJV collapse (decrease ofanteroposterior diameter during advancement of theneedle) was less in the STM group than in the non-STM group (50.4% � 25.4% vs 91.5% � 21.2%, P �

0.001). Eleven of 14 patients had the IJV obliterated inthe non-STM group (only one patient experienced IJVobliteration in the STM group; Fig. 4).

DISCUSSIONWe developed a novel STM for catheterization of

the IJV9 and noted that 1) STM increased the cross-sectional area and the anteroposterior diameter of theIJV even in the Trendelenburg position with adminis-tration of positive end-expiratory pressure, 2) the timeto insertion of catheter with real-time ultrasoundguidance was significantly shorter in the STM group,and 3) the degree of IJV collapse during advancementof the needle was much lower in the STM group.These findings indicate that the STM facilitates IJVcatheterization with real-time ultrasound guidance ininfants and neonates.

The mechanism of stretching the IJV in the antero-posterior direction with STM appears to involve liftingup the skin over the IJV and then enlarging the IJV inthe anteroposterior direction. The increase in distancebetween skin and the IJV on ultrasonography withSTM (Fig. 2) shows that this method stretches not onlythe IJV but also tissue, such as muscle over the IJV,releasing pressure on the IJV.

The main reason for the shorter catheter insertiontime is thought to be the shorter time required forguidewire insertion, which has often been areported difficulty and the main reason for theinability to perform catheterization in pediatric pa-tients.14,15 In the non-STM group, pure guidewiretime was more than 120 s in five of 14 patients,whereas it was less for all patients in the STMgroup. It appears that both the increase of theanteroposterior diameter of the IJV and the preven-tion of vein collapse during catheterization with the

Figure 4. Changes in shapes of rightinternal jugular vein (RIJV). One ofthe patients in the STM group ispresented in the upper figures. A,before advancement of the needle.B, during advancement. One of thepatients in the non-STM group ispresented in the lower figures. C,before advancement of the needle.D, during advancement. ApplyingSTM maintained the shape of theRIJV even during advancement ofthe needle (B). STM � skin-tractionmethod.

758 Skin-Traction Method for Catheterization ANESTHESIA & ANALGESIA

STM may facilitate catheterization and guidewireinsertion. We could find no previous report onfacilitation of insertion of guidewires. Thus, STMappears to be a novel, effective method for IJVcatheterization.

The fact that total and pure guidewire time was notsignificant, whereas total and pure catheter time wassignificant may indicate that STM is actually effectivefor the other process of catheterization. For instance,STM may also influence facilitating dilator insertion invery small pediatric patients and prevent guidewirekinking.

Although we found no significant difference ineither complications or number of attempted punc-tures between the two groups, a tendency towardfewer attempts at skin puncture was noted in the STMgroup. Fewer puncture attempts may decrease centralvenous catheter-associated bloodstream infection,which have been correlated with the number of needlepasses.16 Furthermore, increased anteroposterior di-ameter and preventing collapse by applying STM mayreduce the rate of inadvertent punctures of the com-mon carotid artery, which sometimes overlaps the IJVeither partially or completely.5 Further study isneeded to draw appropriate conclusions regardingthese complications.

STM might have three disadvantages. The first isskin injury due to the force of traction applied. Afterskin traction, the skin of some patients temporarilybecame pink. However, there were no cases of skininjury. The second potential disadvantage may be adecrease of the transverse diameter in the Trendelenburgposition when applying STM. The third disadvantagemay be the time required for taping. However, becausethe time involved in taping the skin was �1 min, thisdoes not seem to be an issue.

In conclusion, with real-time ultrasound guidance,STM shortened the time for IJV catheterization signifi-cantly, while increasing cross-sectional area and an-teroposterior diameter and preventing vein collapseduring advancement of the needle.

REFERENCES

1. Verghese ST, McGill WA, Patel RI, Sell JE, Midgley FM,Ruttimann UE. Ultrasound-guided internal jugular venous can-nulation in infants: a prospective comparison with the tradi-tional palpation method. Anesthesiology 1999;91:71–7

2. Hosakawa K, Shime N, Kato Y, Hoshimoto S. A randomizedtrial of ultrasound image-based skin surface marking versusreal-time ultrasound-guided internal jugular vein catheteriza-tion in infants. Anesthesiology 2007;107:720–4

3. Wigmore TJ, Smythe JF, Hacking MB, Raobaikady R, MacCal-lum NS. Effects of the implementation of NICE guidelines forultrasound guidance on the complication rates associated withcentral venous catheter placement in patients presenting forroutine surgery in a tertiary referral center. Br J Anaesth2007;99:662–5

4. Hayashi Y, Uchida O, Takaki O, Ohnishi Y, Nakajima T,Kataoka H, Kuro M. Internal jugular vein catheterization ininfants undergoing cardiovascular surgery: an analysis of thefactors influencing successful catheterization. Anesth Analg1992;74:688–93

5. Gordon AC, Saliken JC, Johns D, Owen R, Gray RR. US-guidedpuncture of the internal jugular vein: complications and ana-tomic considerations. J Vasc Interv Radiol 1998;9:333–8

6. Armstrong PJ, Sutherland R, Scott DH. The effect of positionand different maneuvers on internal jugular vein diameter size.Acta Anaesthesiol Scand 1994;38:229–31

7. Parry G. Trendelenburg position, head elevation and a midlineposition optimize right internal jugular vein diameter. Can JAnaesth 2004;51:379–81

8. Mallory DL, Shawker T, Evans G, Mcgee W, Brenner M, ParkerM, Morrison G, Mohler P, Veremakis C, Parrillo JE. Effects ofclinical maneuvers on sonographically determined internaljugular vein size during venous cannulation. Crit Care Med1990;18:1269–73

9. Morita M, Sasano H, Azami T, Sasano N, Sobue K. Theskin-traction method increases the cross-sectional area of theinternal jugular vein by increasing its anteroposterior diameter.J Anesth 2007;21:461–71

10. Sasano H, Morita M, Azami T, Ito S, Sasano N, Kato R, Hirate H,Ito H, Takeuchi A, Sobue K. Skin-traction method prevents thecollapse of the internal jugular vein caused by an ultrasoundprobe in real-time ultrasound-assisted guidance. J Anesth2009;23:41–5

11. Sulek CA, Gravenstein N, Blackshear RH, Weiss L. Headrotation during internal jugular vein cannulation and risk ofcarotid artery puncture. Anesth Analg 1996;82:125–8

12. Nakayama S, Yamashita M, Osaka Y, Isobe T, Izumi H. Rightinternal jugular vein venography in infants and children.Anesth Analg 2001;93:331–4

13. ImageJ: Image processing and analysis in Java. Available at:http://rsb.info.nih.gov/ij/; accessed July 1, 2008

14. Milling TJ, Rose J, Briggs WM, Birkhahn R, Gaeta TJ, Bove JJ,Melniker LA. Randomized, controlled clinical trial of point-of-care limited ultrasonography assistance of central venous can-nulation: the Third Sonography Outcomes Assesment Program(SOAP-3) Trial. Crit Care Med 2005;33:1764–9

15. Alderson PJ, Burrows FA, Stemp LI, Holtby HM. Use ofultrasound to evaluate internal jugular vein anatomy and tofacilitate central venous cannulation in paediatric patients. Br JAnaesth 1993;70:145–8

16. Karakitsos D, Labropoulos N, Groot ED, Patrianakos AP, KouraklisG, Poularas J, Samonis G, Tsoutsos DA, Konstadoulakis MM,Karabinis A. Real-time ultrasound-guided catheterization of theinternal jugular vein: a prospective comparison with the landmarktechnique in critical care patients. Crit Care 2006;10:R162


Case Report

Cardiac Arrest in the Neonate DuringLaparoscopic Surgery

Kirk Lalwani, MD, FRCA, MCR

Inger Aliason, MD

We describe a case of intraoperative neonatal cardiac arrest during attemptedlaparoscopic surgery. Circulatory collapse occurred before peritoneal insufflation,initially obscuring the diagnosis. Emergent transthoracic echocardiography duringresuscitation demonstrated intracardiac gas bubbles consistent with venous gasembolism. The site of entrainment was probably a bleeding umbilical veintransected by the umbilical trocar. Greater awareness of this complication inneonates will facilitate early diagnosis and encourage preventive measures, such asthe avoidance of umbilical vessels, use of an open instead of closed accesstechnique, and ligation of bleeding vessels after peritoneal access.(Anesth Analg 2009;109:760–2)

Circulatory collapse secondary to carbon dioxide(CO2) embolism during peritoneal insufflation forlaparoscopic procedures is well known. We describe acase of neonatal cardiac arrest secondary to gas em-bolism during attempted laparoscopic surgery. Circu-latory collapse occurred before peritoneal insufflation,initially obscuring the diagnosis. Emergency echocar-diography was performed during the resuscitationand revealed the mechanism of the arrest. This reportwill describe the case and discuss the etiology of theair embolism, with special emphasis on the physiol-ogy of the neonatal population.

CASE REPORTAn ex-36 wk gestation 1-day-old male was scheduled for

laparoscopic repair of duodenal atresia that had been diag-nosed prenatally by ultrasound. He was delivered unevent-fully by cesarean section after a nonreassuring fetal hearttrace. He weighed 2 kg and had physical features of trisomy21. The patient’s history, physical examination, and labora-tory results were otherwise unremarkable.

After standard monitoring and administration of oxygen,he underwent rapid-sequence IV induction with cricoidpressure, propofol, and rocuronium. His trachea was intu-bated uneventfully on the first attempt with a 3.0 endotra-cheal tube, and anesthesia was maintained with sevoflurane

in oxygen and air. A small dose of fentanyl (1 �g/kg) wasadministered IV. A second IV catheter was placed unevent-fully, and the patient was prepared for surgery.

Approximately 3 min after surgical incision and insertionof the umbilical trocar, the end-tidal CO2 suddenly de-creased from 26 to 6 mm Hg. This was accompanied by aloss of the pulse oximetry trace, ST segment depression, anda decrease in the heart rate from 135 to 100/min whilemaintaining normal sinus rhythm. Pulses could not bepalpated, the heart sounds were muffled, and the arterialblood pressure was approximately 40/20 mm Hg, leading toa working diagnosis of pulseless electrical activity. Thedifferential diagnosis at this point was tension pneumotho-rax, venous gas embolism via the insufflator or a peripheralIV site, or hypovolemia secondary to intraabdominal vascu-lar injury by the trocar. The surgeons were immediatelyasked to release the insufflation pressure, but to our sur-prise, they indicated that they had not yet insufflated theperitoneal cavity. Concomitant with this exchange, the sevoflu-rane was discontinued, the patient was hand ventilated with100% oxygen while the integrity of the gas delivery system waschecked, and the patient’s lungs were auscultated to excludetension pneumothorax. All the IV lines and catheters werechecked for sources of air entrainment but nothing obviouswas apparent. The surgeon was asked to inspect the abdo-men for trauma, which he did after partial insufflation, butthere was no sign of intraabdominal trauma. The surgeonsreported discoloration of the abdominal wall, and the drapeswere immediately removed. The child’s skin was profoundlymottled, with large purplish-black patches on the trunk, head,and all extremities. Cardiopulmonary resuscitation (CPR)was immediately commenced with chest compressions, at-ropine, and several epinephrine boluses. In the absence of adiagnosis, the cardiology team was contacted for emergentechocardiography; they arrived �10 min later and transtho-racic echocardiography demonstrated large amounts of airin the right ventricle, pulmonary arteries, aorta, and livertissue, sufficient to obscure cardiac anatomical details (Fig.1) (see Video 1, Supplemental Digital Video 1: transthoracicsuprasternal notch echocardiographic sweep view from leftto right showing numerous air bubbles in the left and mainpulmonary arteries, aortic arch, left and right atria,http://links.lww.com/A1371). Over the next 10 min of CPRwith the patient in Trendelenburg position, gradual im-provement in the end-tidal CO2 level and ST segmentdepression was accompanied by the reappearance of a

From the Departments of Anesthesiology and PerioperativeMedicine, and Pediatrics, Oregon Health and Science University,Portland, Oregon.

Accepted for publication March 12, 2009.Supplemental digital content is available for this article. Direct


Reprints will not be available from the author.Address correspondence to Kirk Lalwani, MD, FRCA, MCR,

Anesthesiology and Perioperative Medicine, BTE-2, Oregon Healthand Science University, 3181 SW Sam Jackson Park Rd., Portland,OR 97239. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181adc6f9


palpable pulse and the pulse oximeter wave form approxi-mately 20 min after commencement of CPR. Ventricularsystolic function was noted to be normal after CPR despitemild right heart dilation. Venous blood gas revealed hypox-emia and a profound metabolic acidosis that was treatedwith boluses of crystalloid and sodium bicarbonate. Thesurgeons, meanwhile, upon withdrawing the umbilical tro-car, noticed a small amount of active bleeding from thestump of the umbilical vein. The vein was ligated and theabdomen closed.

With the absence of an internal jugular venous centralline, the widespread distribution of air in both sides of theheart and circulation, and the reappearance of a stable cardio-vascular output, no attempt was made to place and aspirate airfrom an internal jugular central venous catheter. Afterstabilization of the vital signs with an epinephrine infusionand placement of a femoral central venous catheter, thepatient was transported to the pediatric intensive care unitfor elective mechanical ventilation and further management.Despite the improvement in the mottling of the patient’shead and trunk, all four extremities of his limbs remainedpurplish-black at the time of transfer to the pediatric inten-sive care unit.

The patient had seizure-like activity overnight, but elec-troencephalography was negative for seizures. A brainmagnetic resonance imaging was performed the next dayand was normal. His extremities gradually regained color bythe following morning with no tissue loss. A repeat echo-cardiogram the next morning demonstrated a patent ductusarteriosus with left-to-right flow and no residual air. Heremained intubated and underwent successful open repairof duodenal atresia 2 days later. Karyotyping confirmed thediagnosis of trisomy 21.

After tracheal extubation, the baby had no signs ofneurological impairment and was discharged home un-eventfully 10 days later. At follow-up in clinic 1 mo later,he was developing normally, feeding well, and had noobvious residual effects from the intraoperative cardio-vascular collapse.

DISCUSSIONIn our patient, massive venous air embolism (VAE)

with paradoxical embolism via the foramen ovale and

the ductus arteriosus was responsible for cardiovas-cular collapse. The source of entrainment in this casewas probably the bleeding stump of the umbilical veinnoted at the site of insertion of the umbilical trocar.Typically, the offending gas is more likely to be CO2during insufflation of the peritoneal cavity.

The physiology of the neonate may make themhigher risk for venous gas embolism, paradoxicalembolism, and greater hemodynamic instability in theevent of a gas embolism.1 Often neonates who presentfor surgery are mildly hypovolemic as they are nil peros, and maintenance fluids may not account for insen-sible and third space fluid losses. Decreased centralvenous pressure (and therefore right atrial pressure)can encourage venous air entrainment. In this case,there was no gradient between the surgical site andthe right atrium as the patient was supine and theoperating table was flat.

The foramen ovale and ductus arteriosus are onlyfunctionally (and not anatomically) closed in the neo-natal period, and thereby provide conduits from thevenous circulation to the arterial circulation. Only10%–30% of adults have a patent foramen ovale andare therefore much less likely to have a paradoxical airembolism.2 When a VAE is small or entrainment isslow, the air can be filtered by the pulmonary vessels,which protect the systemic and coronary circulation.3

However, when the lung filter mechanism is over-loaded, air can be trapped in the pulmonary capillarybed, leading to airlock, or continue through the pul-monary circulation to the systemic circulation. Neo-nates are less able to filter air in the pulmonarycirculation because they have a significantly smallernumber of gas exchanging saccules and intraacinarvessels (20 million in a term newborn versus 300million alveoli in adults).4

A 1982 study of air embolism in children undergo-ing suboccipital craniotomy found no difference in theincidence of air embolism between children andadults.1 However, there was a much greater incidenceof hypotension in the children. The proposed mecha-nism was that the volume of air entrained in thepediatric population was larger relative to their car-diac volume, which caused greater hemodynamicinstability. In dogs, the lethal dose (LD100) of rapidlyinjected air is 7.5 mL/kg,5 but in a smaller animal,such as a rabbit, the LD50 is as low as 0.55 mL/kg.6

This study has obviously not been performed inhuman adults or neonates, but perhaps smaller car-diovascular systems are less able to tolerate VAE.

Laparoscopic injury to enlarged paraumbilicalveins as a result of portal hypertension was implicatedas the cause of CO2 embolism after peritoneal insuf-flation in a teenager undergoing a laparoscopic chole-cystectomy.7 We describe a case of intraoperativeneonatal cardiac arrest because of massive gas embo-lism via a bleeding umbilical vein before peritonealinsufflation. The usual trocar or Veress needle place-ment site near the umbilicus may result in umbilical

Figure 1. Echocardiographic image taken during CPR showsseveral large air bubbles (“) in the aorta (AO) and pulmo-nary arteries (PA) (main PA, left PA, right PA).


vessel damage in the neonatal population and increasethe likelihood of gas entrainment before or duringinsufflation of CO2. Therefore, identification and liga-tion of bleeding vessels after Veress needle or laparo-scopic trocar insertion should be performed promptlyto prevent air entrainment before peritoneal insuf-flation. Use of an open technique instead of closedaccess methods may also decrease the likelihood ofvascular injury.8

This report also demonstrates the effectiveness ofearly CPR on outcome. Critical factors that influencesurvival outcomes from cardiac arrest include theenvironment in which it occurs, the duration of “noflow” time, the initial rhythm, the quality of CPRprovided, the duration of CPR, and the preexistingcondition of the child.9 Almost two thirds of in-hospital pediatric cardiac arrest patients have returnof spontaneous circulation, and one quarter survive tohospital discharge, of which three quarters have agood neurologic outcome. Outcomes are better inchildren compared with adults and for in-hospitalarrests versus out-of-hospital arrests in children.9 It isalso likely that operating room cardiac arrests have abetter overall prognosis than in-hospital arrests inother locations as a result of immediately availableexperienced personnel, continuous hemodynamicmonitoring, and preexisting endotracheal intubationin most cases. For pediatric patients in the periopera-tive period, younger children (neonates and infants),sicker children, emergency surgery, and children withcongenital heart disease had a much higher incidenceof cardiac arrest; therefore, when comparing riskfactors and incidence of cardiac arrest in differentpopulations of children, it is important to considerthese factors.10–12

As technology and surgical skills have improved,laparoscopic procedures have become more commonin the neonatal population. Despite the favorableoutcome in this case, it is obvious that devastating

consequences may result from such complications inthe neonate.

Laparoscopic surgery entails significant physiolog-ical derangement and added potential risk in theneonate with a transitional circulation, and physiciansare likely to continue to see similar complicationsduring the perioperative care of these patients.

REFERENCES

1. Cucchiara RF, Bowers B. Air embolism in children undergoingsuboccipital craniotomy. Anesthesiology 1982;57:338–9

2. Fisher DC, Fisher EA, Budd JH, Rosen SE, Goldman ME. Theincidence of patent foramen ovale in 1,000 consecutive patients.A contrast transesophageal echocardiography study. Chest1995;107:1504–9

3. Butler BD, Hills BA. The lung as a filter for microbubbles. J ApplPhysiol 1979;47:537–43

4. Davies G, Reid L. Growth of the alveoli and pulmonary arteriesin childhood. Thorax 1970;25:669–81

5. Oppenheimer MJ, Durant TM, Lynch P. Body position in relationto venous air embolism and the associated cardiovascular-respiratory changes. Am J Med Sci 1953;225:362–73

6. Munson ES, Merrick HC. Effect of nitrous oxide on venous airembolism. Anesthesiology 1966;27:783–7

7. Mattei P, Tyler DC. Carbon dioxide embolism during laparo-scopic cholecystectomy due to a patent paraumbilical vein.J Pediatr Surg 2007;42:570–2

8. Bonjer HJ, Hazebroek EJ, Kazemier G, Giuffrida MC, Meijer WS,Lange JF. Open versus closed establishment of pneumoperito-neum in laparoscopic surgery. Br J Surg 1997;84:599–602

9. Topjian AA, Berg RA, Nadkarni VM. Pediatric cardiopulmo-nary resuscitation: advances in science, techniques, and out-comes. Pediatrics 2008;122:1086–98

10. Gobbo Braz L, Braz JR, Modolo NS, do Nascimento P, BrushiBA, Raquel de Carvalho L. Perioperative cardiac arrest and itsmortality in children. A 9-year survey in a Brazilian tertiaryteaching hospital. Paediatr Anaesth 2006;16:860–6

11. Flick RP, Sprung J, Harrison TE, Gleich SJ, Schroeder DR,Hanson AC, Buenvenida SL, Warner DO. Perioperative car-diac arrests in children between 1988 and 2005 at a tertiaryreferral center: a study of 92,881 patients. Anesthesiology2007;106:226 –37

12. Morray JP, Geiduschek JM, Ramamoorthy C, Haberkern CM,Hackel A, Caplan RA, Domino KB, Posner K, Cheney FW.Anesthesia-related cardiac arrest in children: initial findings ofthe Pediatric Perioperative Cardiac Arrest (POCA) Registry.Anesthesiology 2000;93:6–14


Case Report

Management of the Difficult Infant Airway with the StorzVideo Laryngoscope: A Case Series

Rebecca S. Hackell, AB

Lisa D. Held, DO

Paul A. Stricker, MD

John E. Fiadjoe, MD

The incorporation of video technology into laryngoscopes provides an additionaloption for the management of difficult intubations. We report the successful use ofthe Miller 1 Storz Video Laryngoscope in seven infants with difficult directlaryngoscopy.(Anesth Analg 2009;109:763–6)

The miniaturization of video and fiberoptic technolo-gies has allowed the integration of video cameras intolaryngoscopes of various designs. Video laryngoscopyhas been shown in adults to improve glottic view,facilitate guidance by novice laryngoscopists, and im-prove intubation success in difficult airways.1–6 Therecent availability of pediatric-sized blades has allowedthe use of these laryngoscopes in pediatric patients.7–14

The Storz Direct Coupled Interface Video Laryngoscope(SVL) (Karl Storz GmbH, Tuttlingen, Germany) inte-grates a fiberoptic bundle into the light source of astandard Miller type blade with a camera in the handleof the device. The image from the tip of the device isdisplayed on a screen providing a magnified viewduring intubation.

The Miller 1 video blade has been available for use inour department for difficult and routine airway mana-gement. After IRB approval, we queried our prospectivedifficult intubation registry to identify cases in which theSVL was used in infants identified as being difficult tointubate by direct laryngoscopy (DL). Seven cases re-turned from this query are presented below.

CASE DESCRIPTIONSCase 1

A 4-mo-old, 4.5-kg female with CHARGE syndromepresented for bilateral myringotomy with tympanos-tomy tube placement and bilateral nasal dilation. She

had a history of a tracheoesophageal fistula repair in theneonatal period and was reported to be difficult tointubate. Her physical examination was remarkable formicrognathia and a short neck. Difficult intubation wasanticipated based on the physical findings and a historyof more than three attempts at DL by an otolaryngologistat the time of her tracheoesophageal fistula repair. Gen-eral anesthesia was induced with thiopental and, afterconfirming the ability to ventilate by face mask, vecuro-nium was administered. Anesthesia was maintainedwith oxygen and sevoflurane. Laryngoscopy was per-formed by a Certified Registered Nurse Anesthetist(CRNA) with the Miller 1 SVL. A Cormack and LehaneGrade 1 view was obtained on the video screen, whereasa Grade 3 view was seen by a direct line of sight view. Astyletted 3.5 uncuffed endotracheal tube was advancedinto the trachea under video guidance on the firstattempt.

Case 2A 9-mo-old, 6.0-kg female with trisomy 18, Cri-du-Chat

syndrome, and congenital dislocation of the right hippresented for a right hip closed reduction and spicacast application. The patient’s trachea had previouslybeen intubated by fiberoptic bronchoscopy withoutincident. Her physical examination findings includedmicrognathia, a short neck, and a large tongue. Anes-thesia was induced with sevoflurane in nitrous oxideand oxygen, followed by maintenance with an IV propo-fol infusion with preservation of spontaneous respira-tion. The glottis was anesthetized with topical lidocaineand laryngoscopy was performed by a CRNA with theMiller 1 SVL. A Grade 1 view was seen on the videoscreen and the trachea was intubated successfully with a4.0 uncuffed endotracheal tube on the first attempt.Direct line of sight view at the time of video laryngos-copy revealed a Grade 3 view.

Case 3A 10-mo-old, 7.6-kg female with Moebius syn-

drome, laryngotracheomalacia, micrognathia, and a

From The General Anesthesia Division, Children’s Hospital ofPhiladelphia, University of Pennsylvania School of Medicine, Penn-sylvania, Philadelphia.

Accepted for publication March 27, 2009.Supported by the Department of Anesthesiology and Critical

Care Medicine of The Children’s Hospital of Philadelphia and theUniversity of Pennsylvania School of Medicine.

Reprints will not be available from the author.Address correspondence to John E. Fiadjoe, MD, Department of

Anesthesiology and Critical Care Medicine, The Children’s Hospital ofPhiladelphia, Main Building, 9th Floor, 34th and Civic Center Blvd.,Philadelphia, PA 19104. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ANE.0b013e3181ad8a05


history of a repaired gastroschisis presented for take-down of a tongue-lip adhesion. She had a history of aprevious difficult intubation at 14 days of age requir-ing four attempts at DL (two attempts by a pediatricanesthesiology fellow and two by the attending anes-thesiologist) before successful blind tracheal intuba-tion. On the day of the current surgery, generalanesthesia was induced with sevoflurane in oxygen.An IV catheter was placed and glycopyrrolate admin-istered. Laryngoscopy with the SVL was performed bythe pediatric anesthesiology fellow. A Cormack andLehane Grade 1 view was seen on the video screen,whereas only the epiglottis was seen by direct line ofsight (Grade 3 view). This intubation attempt failedbecause of difficulty in directing the tube into thetrachea by video guidance. A second attempt by thefellow produced a Grade 3 view on the video and wasaborted. The final intubation attempt was made by theattending anesthesiologist, which resulted in a Grade1 view on the video monitor and a Grade 4 view bydirect line of sight. The patient was successfullyintubated on the third attempt with a 4.0 uncuffedendotracheal tube by video laryngoscopy.

Case 4A 13-mo-old, 9.1-kg male with Goldenhar Syndrome,

right mandibular retrusion, limited mouth opening,cervical spine instability, repaired cleft palate, and leftthumb hypoplasia presented for thumb amputationand index finger pollicization. The patient had ahistory of a previous difficult intubation 1 mo priorrequiring fiberoptic intubation through a laryngealmask airway after a Grade 4 view by DL. For thecurrent case, anesthesia was induced with sevofluranein oxygen while maintaining the head and cervicalspine neutral. After IV insertion, glycopyrrolate andvecuronium were administered after confirming theability to deliver positive pressure ventilation by facemask. An initial attempt at DL by the CRNA using astandard Miller 1 larygnoscope failed to reveal anyglottic structures (Grade 4 view). A second attempt bythe CRNA using the SVL revealed a Grade 2 viewwith optimal external laryngeal manipulation. Tra-cheal intubation with a 4.0 cuffed endotracheal tubewas successful on the first attempt using the SVL.

Case 5A 4-mo-old, 4.8-kg former 36-wk infant with a

history of dysphagia and stridor presented for bron-choscopy, endoscopy, and percutaneous endoscopicgastrostomy tube placement. At 12 h of life, the patienthad a prolonged apneic episode and intubationattempts at an outside institution were reportedlydifficult. Details regarding intubation attempts andlaryngoscopy grade were unavailable. General anes-thesia was induced with sevoflurane in nitrous oxideand oxygen. Propofol was titrated to maintain spon-taneous ventilation. Intubation was unsuccessfullyattempted four times with a pediatric optical stylet

(Bonfils Pediatric Endoscope), two attempts by thepediatric anesthesia fellow, and two by the attendinganesthesiologist. The fifth attempt, performed by thefellow using the Miller 1 SVL, provided a Grade 2 viewon the video monitor, allowing for successful trachealintubation with a 4.0 uncuffed endotracheal tube.

Case 6A 10-mo-old, 9.3-kg former 33-wk triplet with trans-

location of chromosomes 7 and 8 and severe globaldevelopmental delay presented for a gastrostomy tubeplacement. The patient had a history of difficult DL(Grade 3 view with application of optimal externallaryngeal manipulation) during an anesthetic 3 wk prior.Anesthesia was induced with sevoflurane in nitrousoxide and oxygen and after confirming the ability todeliver positive pressure ventilation by face mask, vecu-ronium was administered. The Miller 1 SVL was used bythe pediatric anesthesia fellow for intubation and thevocal cords were easily visualized (Grade 1 view). Astyletted 3.5 cuffed endotracheal tube was placed on thefirst attempt.

Case 7A 3-mo-old, 5.5 kg otherwise healthy male pre-

sented for excision of a left frontal scalp dermoid cyst.The patient had a difficult intubation at 6 wk of ageduring a laparoscopic pyloromyotomy for pyloricstenosis requiring the use of a lighted stylet after threefailed attempts at DL (two by the pediatric anesthesi-ology fellow and one by the attending anesthesiolo-gist) with a Grade 3 view on each attempt. Generalanesthesia was induced with sevoflurane in nitrousoxide and oxygen, and propofol and glycopyrrolatewere administered IV. The Miller 1 SVL was usedsuccessfully by the pediatric anesthesia fellow on thefirst intubation attempt. A 3.5 cuffed endotrachealtube was placed without difficulty; details of directlaryngoscopic view were not documented.

DISCUSSIONThe SVL integrates video technology into a Miller

type blade. This allows the laryngoscopist to intubateusing a direct line of sight view or a video monitorview. The deflection of the blade at the tip is approxi-mately 12° and the built-in camera has a 60° lens.Intubation with the SVL requires a styletted endotra-cheal tube with a bend at the very tip of the stylet(mimicking the tip angle of the SVL). Laryngoscopy isperformed with the blade in the midline or to the leftin the oropharynx (to maximize space for passage ofthe endotracheal tube). After obtaining optimal glotticexposure on the video monitor, the laryngoscopist’sattention is directed to the passage of the tube along orslightly to the right of the blade shaft with carefulattention paid to avoiding injury to pharyngeal andtonsillar structures. Once the styletted tube is visual-ized on the screen, endotracheal intubation can ensue


with withdrawal of the stylet just after the tube tippasses the vocal cords.

Our case series describes the successful airwaymanagement with the Miller 1 SVL of seven infantswith a history of difficult intubation by DL. Thisreport is consistent with the published literature inadults showing that video laryngoscopy provides aglottic view equal to or better than that seen with DL,as well as a prior case report documenting successfuluse of the SVL in an infant after a failed DL.

Wald et al.13 reported the successful tracheal intu-bation of a 3-wk-old, 2.1-kg neonate with the Miller 1SVL after failed DL. The Cormack and Lehane Gradeobtained with DL was 3, whereas that obtained on thevideo monitor with the SVL was 1. Tracheal intuba-tion was successful on the first attempt.

The majority of the published literature regardingvideo laryngoscopy in pediatric patients focuses onolder children.7–10,12,14 Because of transitioning anat-omy, such as the descent of the larynx as childrengrow, devices that perform favorably in older childrenmay be less effective or inappropriate in infants andneonates. In all our cases in which the Cormack andLehane view was reported for DL, there was animprovement in grade using the SVL. Furthermore,use of the SVL resulted in a successful intubation in allof these patients in whom DL would likely have beenextremely difficult or failed, as shown by prior expe-rience in each patient.

Use of the SVL appears to be easily learned. All thepractitioners in our series were successful at intub-ation despite having varying levels of experience withthe device. Six of the seven patients were intubated onthe first attempt. Patient 3 was intubated on the thirdattempt after initial laryngoscopy revealed a Grade 1monitor view, whereas the second attempt by thesame practitioner revealed a Grade 3 view. There canbe variability in the view obtained from performinglaryngoscopy by a single operator with the samedevice. This can occur as a result of changes in theairway related to the laryngoscopy (e.g., edema),variable application of optimal external laryngeal ma-nipulation, or inadequate positioning of the device.Inadequate positioning is more likely when the opera-tor is not very experienced with the device. Wesuspect that the difference in grade observed by thefellow in Case 3 was related to inadequate positioningof the device. This suspicion is supported by the factthat the final attempt made by the attending anesthe-siologist was a Grade 1 view, consistent with the firstattempt of the fellow. Variable application of optimalexternal laryngeal manipulation may also have ac-counted for the differences in grade; however, therewas no documentation in the anesthetic record tosupport this.

The direct line of sight views in Patients 6 and 7were not documented in the anesthetic record, and theonly evidence for difficulty with laryngoscopy was

obtained from their prior anesthetic records. As chil-dren grow, the larynx moves caudally, the mandibleand maxilla enlarge creating more space for laryngos-copy. It is possible that the successful intubations withvideo laryngoscopy in Patients 6 and 7 may have beenrelated to enlargement of the airway with growthrather than any unique advantages of the video laryn-goscope. This is unlikely in these patients given theshort time between their intubations, 3 and 6 wk,respectively. Nevertheless, video laryngoscopy is veryuseful in the situation in which difficulty is suspectedbased on history because it allows the operator todocument the direct line of sight grade and thenintubate using the video monitor if the direct view issuboptimal.

Video laryngoscopy requires some degree of hand-eye coordination. Difficulty with endotracheal tubeplacement despite having a favorable view may be aproblem with many of these devices.2,3,5 There are twomain factors that contribute to difficulty with intuba-tion using the Miller 1 SVL. First, insertion of thestyletted tracheal tube while looking at the videomonitor requires a different skill set from intubationwith DL. Second, difficulty in advancing the tube intothe trachea after passing the cords may occur becauseof the anterior angulation of the distal end of thestyletted tube required with this indirect method,which causes the tube to strike the luminal surface ofthe anterior tracheal wall and impede advancementdown the trachea. This can often be overcome byrotating the tube 180° (after withdrawing the stylet) asit just passes the vocal cords and orients the endotra-cheal tube’s concavity in a posterior fashion.

Some limitations of the SVL include a lack of abuilt-in antifog system. Warming the device beforeuse or applying an antifog solution to the tip canmitigate this problem. Visualization is impaired withexcessive secretions or blood and the distal location ofthe camera sometimes necessitates elevation of theepiglottis to facilitate glottic exposure. The cameraattachment requires a light source and a separatevideo monitor connection for displaying the image,making it less portable than some of the other videodevices. The cost of the SVL ranges from $18,000 to$25,000 depending on the accessories included; there iscurrently no disposable version. The SVL can be steril-ized by high level disinfection (e.g., Cidex, STERIS,STERRAD, and Medivator) systems.

Several patients in our series would likely havebeen tracheally intubated using a fiberoptic broncho-scope had the SVL not been available. Fiberopticintubation in infants and neonates can be challenging.The smallest fiberoptic scopes are more difficult tocontrol and often lack a working channel,15 and thehigh oxygen consumption of neonates significantlyshortens the time available for intubation. Our seriessuggests that the Miller 1 SVL may be a useful adjunctin the management of infants who either fail DL or areanticipated to present with a difficult DL. Prospective


randomized studies are needed to fully evaluate thispossibility.

REFERENCES

1. Shippey B, Ray D, McKeown D. Use of the McGrath videolaryn-goscope in the management of difficult and failed trachealintubation. Br J Anaesth 2008;100:116–9

2. Cooper RM. The GlideScope videolaryngoscope. Anaesthesia2005;60:1042

3. Cooper RM, Pacey JA, Bishop MJ, McCluskey SA. Early clinicalexperience with a new videolaryngoscope (GlideScope) in 728patients. Can J Anaesth 2005;52:191–8

4. Hirabayashi Y, Hakozaki T, Fujisawa K, Yamada M, Suzuki H,Satoh M, Hotta K, Igarashi T, Taga N, Seo N. [GlideScopevideolaryngoscope: a clinical assessment of its performance in200 consecutive patients]. Masui 2007;56:1059–64

5. Kaplan MB, Hagberg CA, Ward DS, Brambrink A, ChhibberAK, Heidegger T, Lozada L, Ovassapian A, Parsons D, RamsayJ, Wilhelm W, Zwissler B, Gerig HJ, Hofstetter C, Karan S,Kreisler N, Pousman RM, Thierbach A, Wrobel M, Berci G.Comparison of direct and video-assisted views of the larynxduring routine intubation. J Clin Anesth 2006;18:357–62

6. Kim HJ, Chung SP, Park IC, Cho J, Lee HS, Park YS. Compari-son of the GlideScope video laryngoscope and Macintosh laryn-goscope in simulated tracheal intubation scenarios. Emerg Med J2008;25:279–82

7. Borland LM, Casselbrant M. The Bullard laryngoscope. A newindirect oral laryngoscope (pediatric version). Anesth Analg1990;70:105–8

8. Weiss M, Hartmann K, Fischer JE, Gerber AC. Use of angulatedvideo-intubation laryngoscope in children undergoing manualin-line neck stabilization. Br J Anaesth 2001;87:453–8

9. Dullenkopf A, Holzmann D, Feurer R, Gerber A, Weiss M.Tracheal intubation in children with Morquio syndrome usingthe angulated video-intubation laryngoscope. Can J Anaesth2002;49:198–202

10. Milne AD, Dower AM, Hackmann T. Airway managementusing the pediatric GlideScope in a child with Goldenharsyndrome and atypical plasma cholinesterase. Paediatr Anaesth2007;17:484–7

11. Trevisanuto D, Fornaro E, Verghese C. The GlideScope videolaryngoscope: initial experience in five neonates. Can J Anaesth2006;53:423–4

12. Kim JT, Na HS, Bae JY, Kim DW, Kim HS, Kim CS, Kim SD.GlideScope video laryngoscope: a randomized clinical trial in203 paediatric patients. Br J Anaesth 2008;101:531–4

13. Wald SH, Keyes M, Brown A. Pediatric video laryngoscoperescue for a difficult neonatal intubation. Pediatr Anesth2008;18:790–2

14. Belyamani L, Zidouh S, Kamili ND. [Intubation using a video-laryngoscope in an adolescent girl with Rubinstein-Taybi syn-drome]. Can J Anaesth 2008;55:57–8

15. Wood RE. Clinical applications of ultrathin flexible broncho-scopes. Pediatr Pulmonol 1985;1:244–8


Ambulatory AnesthesiologySection Editor: Peter S. A. Glass

Routine Use of Nasogastric Tubes Does Not ReducePostoperative Nausea and Vomiting

Karl-Heinz Kerger*†

Edward Mascha‡

Britta Steinbrecher§

Thomas Frietsch†

Oliver C. Radke�¶

Katrin Stoecklein#

Christian Frenkel**

Georg Fritz††

Klaus Danner§

Alparslan Turan‡‡§§

Christian C. Apfel, MD, PhD�

For the IMPACT Investigators

Routine use of a nasogastric (NG) tube has been suggested to prevent postoperativenausea and vomiting (PONV) despite conflicting data. Accordingly, we tested thehypothesis that routine use of a NG tube does not reduce PONV.

Our work is based on data from a large trial of 4055 patients initially designedto quantify the effectiveness of combinations of antiemetic treatments for theprevention of PONV. This analysis uses propensity scores for case matching toensure group comparability on baseline factors. Intraoperative NG tube usepatients and perioperative NG tube use patients were respectively matched tononuse patients on all available potential confounders.

Matched-pairs were identified using propensity scores for 1032 patients with orwithout intraoperative NG tube use and 176 patients with or without perioperativeNG tube use. The incidences of PONV in the intraoperative group were 44.4% vs41.5% (P � 0.35) with and without tube use, respectively, and 27.8% vs 31.3% (P �0.61) in the perioperative group.

Our results provide evidence that routine use of a NG tube does not reduce theincidence of PONV.(Anesth Analg 2009;109:768–73)

The use of a nasogastric (NG) tube to preventpostoperative nausea and vomiting (PONV) has longbeen suggested in the literature. Postulated mecha-nisms for an effect have included decompressing thestomach and decreasing acidity. Given that the expe-rience of the person ventilating the lungs with a facemask has been described as influencing PONV1 andthat use of histamine-antagonists can reduce PONV,2

the routine use of a NG tube to prevent PONV appears

plausible. The effect of a gastric tube reported in theliterature is very heterogeneous,3 but individual stud-ies may be underpowered to detect a small but stillclinically relevant difference.

Using a dataset of more than 1000 patients, wetested the hypothesis that routine intraoperative orperioperative use of a NG tube would not affect theincidence of PONV. The primary endpoint in thisanalysis was incidence of PONV during the first 24 hpostoperatively.

From the *Department of Anesthesiology and Critical CareMedicine, Evangelian Deaconry Hospital, Freiburg, Germany;†Department of Anesthesiology and Operative Critical Care Medicine,University Hospital Mannheim, Mannheim, Germany; ‡Departmentsof Quantitative Health Sciences, and Outcomes Research, ClevelandClinic, Cleveland, Ohio; §Westpfalz-Klinikum GmbH, Kaiserslaut-ern, Germany; �Perioperative Clinical Research Core, Department ofAnesthesia and Perioperative Care, University of California at SanFrancisco, UCSF Medical Center at Mount Zion, San Francisco,California; ¶Klinik und Poliklinik fur Anasthesiologie und Inten-sivtherapie, University Hospital Dresden, Dresden, Germany;#Department of Anesthesiology, VU University medical center,Amsterdam, The Netherlands; **Stadtisches Klinikum Luneburggemeinnutzige GmbH, Luneburg, Germany; ††Department of An-esthesiology, Intensive Care Medicine, and Pain Therapy, HeartCentre Brandenburg at Bernau, Bernau, Germany; ‡‡Department ofAnaesthesiology, Trakya University, Edirne, Turkey; and §§TheOutcomes Research Consortium, Department of Anesthesiologyand Perioperative Medicine, University of Louisville, Louisville,Kentucky.

Accepted for publication February 15, 2009.Supported by a grant to the Perioperative Clinical Research Core

from the Department of Anesthesia and Perioperative Care at theUniversity of California, San Francisco.

The International Multicenter Protocol to Assess the Single andCombined Benefits of Antiemetic Interventions in a ControlledClinical Trial of a 2 � 2 � 2 � 2 � 2 � 2 Factorial Design (IMPACT)Investigators are listed in the Appendix.

Address correspondence and reprint requests to Christian C.Apfel, MD, PhD, Perioperative Clinical Research Core, Departmentof Anesthesia and Perioperative Care, University of California SanFrancisco (UCSF), UCSF Medical Center at Mount Zion, 1600Divisadero, C-447, San Francisco, CA 94115. Address e-mail [email protected] or [email protected].


DOI: 10.1213/ane.0b013e3181aed43b


METHODSOur comparative study used data from the previ-

ously published International Multicenter Protocol toAssess the Single and Combined Benefits of Anti-emetic Strategies in a Controlled Clinical Trial ofFactorial Design (IMPACT)4 (Appendix).

In the IMPACT trial, patients were randomized indouble-blind fashion and assigned to several anti-emetic strategies. The insertion of the NG tube was not

randomized and left to the discretion of the anesthe-siologist. In patients with an intraoperative NG tube, thetube was placed after intubation, suctioned, capped, andremoved under suction immediately before extubation,whereas in patients with perioperative use, it was left inplace, suctioned, and capped, with intermittent suction-ing for more than 24 h after surgery.

In the postanesthesia care unit, the time, severity, andcharacteristics of PONV were recorded on standardized

Table 1. Intraoperative Nasogastric (NG) Tube Use Versus Non-Use After Matching Based on Propensity Score

Effect

IntraoperativeNG tube use No NG tube use

PNMean(sd) N

Mean(sd)

Propensity score 516 0.43 (0.24) 516 0.42 (0.24) 0.90Years of experience of anesthesiologista 516 8.6 (7.1) 516 8.3 (7.8) 0.43Patient’s age (yr)a 516 46.9 (14.1) 516 47.0 (14.1) 0.94Koivuranta’s PONV risk scorea 516 0.60 (0.16) 516 0.60 (0.16) 0.73Apfel’s POV risk score 515 0.40 (0.16) 514 0.40 (0.15) 0.34Weight (kg) 515 70.6 (14.2) 516 69.8 (13.4) 0.32Body mass index (kg/m2) 515 25.3 (4.5) 516 25.2 (4.4) 0.58

N % N % P

GenderM 75 14.5 62 12 0.23F 441 85.5 454 88

ASA classificationa

I 252 48.8 247 47.9 0.13II 221 42.8 241 46.7III 43 8.3 28 5.4

Centre (all used)a

#2 (largest centre) 126 24.4 124 24 0.99Operation categorya

Hernia repair 23 4.5 19 3.7 0.99Cholecystectomy 28 5.4 23 4.5Hysterectomy 140 27.1 149 28.9Thyroid surgery 21 4.1 19 3.7Breast surgery 12 2.3 9 1.7Hip replacement 2 0.39 1 0.19Knee arthroscopy 5 0.97 5 0.97Upper extremity 5 0.97 4 0.78ENT & eye surgery 22 4.3 26 5Other gynecologic surgery 169 32.8 170 33Bone surgery 15 2.9 18 3.5General surgery 74 14.3 73 14.2

Surgical approacha

Open abdominal 137 26.6 138 26.7 0.99Laparoscopic abdominal 160 31 160 31Other 219 42.4 218 42.3

Antiemetic prophylaxisOndansetron 258 50.0 266 51.6 0.62Dexamethasone 256 49.6 252 48.8 0.80Droperidol 240 46.5 248 48.1 0.62

Anesthetic regimena

Inhal, Fent, N2O 44 8.5 41 8 0.95Prop, Fent, N2O 83 16.1 87 16.9Inhal, Remi, N2O 52 10.1 48 9.3Prop, Remi, N2O 78 15.1 81 15.7Inhal, Fent, Air 50 9.7 45 8.7Prop, Fent, Air 84 16.3 81 15.7Inhal, Remi, Air 37 7.2 48 9.3Prop, Remi, Air 88 17.1 85 16.5

Patient distribution in the intraoperative nasogastric tube use group and the no use group after matching based on propensity score. All predictors, risk factors, operations, and anesthetic regimensare distributed evenly among the groups.PONV � postoperative nausea and vomiting; POV � postoperative vomiting; ENT � ear, nose, and throat; Inhal � inhalational; Prop � propofol; Fent � fentanyl; Remi � remifentanil.a Variable used to create propensity scores.


forms. PONV was defined as the occurrence of nausea(using a severity score 0–10), vomiting/retching, or bothduring the first 24 h after surgery.

Statistical AnalysisAssociations between NG tube use and three 24-h

outcomes (nausea, emesis, and overall PONV) wereassessed using propensity score analysis. Any baseline

variable even remotely predictive of NG tube use, de-fined as P � 0.30, was included in the calculation of thepropensity scores, including such factors as experienceof the anesthesiologist, patient age, PONV risk score,location, surgery type, surgical approach (open versuslaparoscopic), anesthetic regimen, and clinical center.

Our analysis for each exposure (NG tube use versusnonuse) thus consisted of two stages. In the first stage,

Table 2. Perioperative Nasogastric (NG) Tube Use Versus Non-Use After Matching Based on Propensity Score

Perioperativetube use No tube use

PN Mean (sd) N Mean (sd)Propensity score 83 0.37 (0.26) 83 0.37 (0.26) 0.98Body mass index (kg/m2)a 83 25.66 (4.89) 83 25.58 (4.66) 0.92Patient’s age (yr)a 83 52.64 (13.17) 83 52.35 (17.35) 0.90Anxiety before induction (VAS 0–10)a 83 3.47 (2.41) 83 3.70 (2.69) 0.56Years of experience of anesthesiologist 83 7.63 (7.89) 83 7.91 (9.34) 0.83Koivuranta’s PONV risk score 83 0.56 (0.17) 83 0.59 (0.15) 0.12Apfel’s POV risk score 83 0.37 (0.18) 83 0.34 (0.15) 0.21Weight (kg) 83 71.63 (13.98) 83 71.45 (13.09) 0.93

N % N % P

GenderM 27 32.5 26 31.3 0.23F 56 67.5 57 68.7

ASA classificationa

I 28 33.7 26 31.3 0.90II 42 50.6 45 54.2III 13 15.7 12 14.5

Centre#13 (largest) 15 18.1 12 14.5 0.99

BIS-level according to stratificationa

No BIS 45 54.2 46 55.4 0.8430–40 20 24.1 17 20.555–65 18 21.7 20 24.1

Operation categorya

Hernia repair 4 4.8 3 3.6 0.88Cholecystectomy 13 15.7 11 13.3Hysterectomy 10 12.1 6 7.2ENT & eye surgery 5 6 4 4.8Other gynaecologic surgery 13 15.7 13 15.7Bone surgery 1 1.2 2 2.4General surgery 37 44.6 44 53

Surgical approacha

Open abdominal 55 66.3 51 61.5 0.71Laparoscopic abdominal 15 18.1 15 18.1Other 13 15.7 17 20.5

Antiemetic prophylaxisOndansetron 44 53.0 48 57.8 0.53Dexamethasone 39 47.0 43 51.8 0.53Droperidol 52 62.7 42 50.6 0.12

Anaesthetic regimena

Inhal, Fent, N2O 7 8.4 7 8.4 0.98Prop, Fent, N2O 12 14.5 15 18.1Inhal, Remi, N2O 3 3.6 2 2.4Prop, Remi, N2O 15 18.1 12 14.5Inhal, Fent, Air 10 12.1 9 10.8Prop, Fent, Air 19 22.9 17 20.5Inhal, Remi, Air 8 9.6 10 12.1Prop, Remi, Air 9 10.8 11 13.3

Patient distribution among the perioperative (�24 h) nasogastric tube use group and the no use group after matching based on propensity score. All predictors, risk factors, operations, andanesthetic regimens are distributed evenly among the groups.PONV � postoperative nausea and vomiting; POV � postoperative vomiting; ENT � ear, nose, and throat; BIS � Bispectral Index; Inhal � inhalational; Prop � propofol; Fent � fentanyl; Remi �remifentanil.a Variable used to create propensity scores.

770 Nasogastric Tube Use and Risk of PONV ANESTHESIA & ANALGESIA

all available baseline factors were used in a model topredict NG tube use (yes/no), from which each pa-tient was assigned a predicted probability of havingreceived a NG tube. Each patient who actually didreceive a NG tube was then matched on that probabil-ity to a nonuse patient using the greedy matchingalgorithm5 with a matching criterion of 0.05 propen-sity score units.

In the second stage, we compared the matched NGtube groups (yes/no) on the outcome(s) of interest,PONV, using logistic regression analyses. Multivari-able models included any covariates significant at the0.05 level, further adjusting for any remaining imbal-ance on available potential confounders. Note that ourmultivariable analysis is based on the propensity-matched patients only and is quite distinct from atraditional multivariable model using all patients inthe dataset, regardless of distribution of baseline vari-ables. The significance level for the two-tailed �2 testwas 0.05.

For each analysis, we performed the usual two-tailed test for superiority of one treatment versus theother. We also performed a nonsuperiority analysis inwhich we tested the null hypothesis that NG tube useis beneficial. We defined “beneficial” as a reduction inthe odds of having the outcome by at least 5% withNG use, corresponding to an odds ratio (OR) of 0.95 orlower. The alternative hypothesis in this one-tailedtest was that the OR is �0.95, i.e., that NG tube use iseither worse than nontube use (OR �1) or that itreduces the odds of the outcome no more than 5% (OR�0.95). A significant test result would thus be inter-preted as NG tube use being not superior to nonuse(i.e., either equivalent or worse). The significance levelfor each hypothesis was 0.05. No adjustment wasmade for assessing the three primary outcomes. SASstatistical software (Cary, NC, version 9.1) was usedfor all analyses.

RESULTSA total of 4055 patients were initially considered for

analysis: 2743 patients did not receive a NG tube, 1185received a NG tube intraoperatively, and 127 receivedone intra- and postoperatively for 24 h. This initialgrouping demonstrated imbalance on important base-line predictors of morbidity. Propensity scores werethen used to compile a subgroup of matched NG tubeuse and control patients for intraoperative and 24-hpostoperative use. Balance was achieved for all vari-ables used in the propensity score matching and,innate to the methodology, also for variables thatinfluence the risk for PONV (Tables 1 and 2).

Results comparing propensity-matched intraopera-tive NG tube use versus controls are shown in Figure1 and with more detail in Table 3. Intraoperative use ofthe NG tube use was not associated with a reductionin nausea (multivariable OR of 1.23, P � 0.14), vom-iting (0.92, P � 0.64), or PONV (1.22, P � 0.16). The

24-h PONV incidence was 44.4% in patients with anintraoperative NG tube use versus 41.5% in controls,for a difference of 2.9% (95% CI �3.2%, 9.1%).

Perioperative NG tube use propensity score resultsare displayed in Table 4. There was no evidence of anassociation between perioperative NG tube use andreduction in nausea (0.85, P � 0.65), emesis (0.90, P �0.83), or overall PONV (0.84, P � 0.64). The 24-hPONV incidence was 27.8% in patients with perioper-ative NG tube use versus 31.3% in controls, for adifference of �2.4% (95% CI �16.1%, 11.1%).

In our nonsuperiority analyses, we rejected thenull hypotheses that intraoperative NG tube usewas more beneficial (i.e., superior) compared withnon-NG tube use for two of the three outcomes ofinterest, PONV (multivariable P � 0.033) and nau-sea (multivariable P � 0.037), assuming that an ORbetween 0.95 and 1.0 represents equivalence of thetwo methods of care (Table 3). From these one-tailedresults, we infer that the adjusted OR for perioper-ative NG tube use is �0.95 for PONV and nausea.Nonsuperiority was not demonstrated for perioper-ative NG tube use (Table 4).

DISCUSSIONThis analysis of a large case-matched dataset with

more than 1000 patients evaluating the effect of aNG tube on PONV shows no evidence of a reductionin incidence of PONV. This result seems surprisinggiven that mechanistically every effort that reducesintragastric volume should decrease the incidenceof vomiting.

A meta-analysis performed by Cheatham et al.6

identified 26 trials with 3964 patients and found nodifference in the incidence of postoperative nausea butdid find a decreased risk of vomiting. However,retching, which might occur instead of vomiting in thesetting of an emptied stomach, was not separatelyaccounted for in all included studies. Additionally, theeffect of a gastric tube reported in the literature is soheterogeneous that no reasonable point estimates couldbe calculated in a Cochrane review by Nelson et al.3

Our analysis includes a significantly larger samplesize than any other previous randomized controlled

Figure 1. Propensity score matched comparison for patientswith versus without intraoperative NG tube use.


trial and should thus be able to detect even smalleffects present. The main limitation of this analysis isthat the original study was not randomized for the useof a gastric tube; however, to address this drawbackpatients were matched using a propensity score toyield groups balanced on potential baseline confound-ers.7,8

In conclusion, these results provide strong evidencethat the routine use of a NG tube during surgicalprocedures does not reduce PONV.

ACKNOWLEDGMENTSThe authors thank Dr. Anuj Malhotra for his careful

editorial assistance.

APPENDIXThe IMPACT investigators are as follows:

• Steering Committee—C. C. Apfel, A. Biedler, andK. Korttila.

• Data Management and Monitoring—C. C. Apfel, E.Kaufmann, M. Kredel, A. Schmelzer, and J. Wermelt.

• and Data Analyses—C. C. Apfel, K.-H. Kerger, andE. Mascha.

Site Investigators—C. C. Apfel, S. Alahuhta, F.Bach, A. Bacher, H. Bartsch, H. Bause, A. Biedler, B.Book, H. Bordon, D. Buschmann, K. Danner, O.Danzeisen, D. Detzel, L. H. J. Eberhart, H. Feierfeil,H. Forst, C. Frenkel, G. Frings, B. Fritz, G. Fritz, A.Goebel, M. Hergert, C. Heringhaus, M. Hinojosa, C.Hoehne, W. Hoeltermann, H.-B. Hopf, C. Isselhorst,R. M. Jokela, E. Kaufmann, H. Kerger, T. Kangas-Saarela, P. Karjaleinen, A. Kimmich, M. Koivuranta,K. Korttila, U. Koschel, P. Kranke, M. Kredel, M.Lange, F. Liebenow, W. Leidinger, M. Lucas, C.Madler, J. N. Meierhofer, F. Mertzlufft, J. Motsch, S.Munoz, E. Palencikova, A. Paura, S. Pohl, C. Prause,R. Rincon, N. Roewer, U. Ruppert, A. Schmelzer,I. E. Schneider, R. Sneyd, Schramm, A. Soikkeli, S.Spieth, B. Steinbrecher, K. Stoecklein, M. Trick, A.Turan, S. Trenkler, I. Vedder, P. Vila, J. Wermelt, K.Werthwein, W. Wilhelm, and C. Zernak.

Table 3. Propensity Score Analysisa for Intraoperative Nasogastric (NG) Tube Use

OutcomeModel

(# covariates)

NG tube use Odds ratiob

(95% CI)

P

Superiorityc

(null: OR � 1)Nonsuperiorityd

(null: OR �0.95)No (%) Yes (%)PONV Univariable 41.5 44.4 1.13 (0.88–1.44) 0.35 0.09

Multivariable (8) 1.23 (0.93–1.61) 0.14 0.033*Emesis Univariable 18.2 16.9 0.91 (0.66–1.26) 0.57 0.60

Multivariable (6) 0.92 (0.66–1.29) 0.64 0.52Nausea Univariable 40.5 43.2 1.12 (0.87–1.43) 0.38 0.10

Multivariable (6) 1.22 (0.92–1.60) 0.16 0.037*N � 1032 for univariable and N � 1029 for multivariable analyses.CI � confidence interval; PONV � postoperative nausea and vomiting; OR � odds ratio.a Using greedy matching within 0.05 propensity score units.b Odds ratio for NG tube use versus nonuse (reference).c Two-tailed test of null hypothesis of no NG tube effect.d One-tailed test against the null hypothesis that the odds ratio of NG tube use is �0.95 (i.e., superior), where the alternative hypothesis and significant result means NG tube use odds ratio�0.95 (either equivalent to or worse than non-NG tube use, given the equivalence range of 0.95–1.0).* Significant at P � 0.05.

Table 4. Propensity Score Analysisa for Perioperative Nasogastric (NG) Tube Use

OutcomeModel

(# covariates)

NG tube use Odds ratiob

(95% CI)

P

Superiorityd

(null: OR � 1)Nonsuperioritye

(null: OR �0.95)No (%) Yes (%)PONV Univariable 31.3 27.8 0.84 (0.43–1.64) 0.61 0.64

Multivariable (1) 0.85 (0.43–1.71) 0.65 0.61Emesis Univariable 12.0 10.8 0.89 (0.34–2.31) 0.81 0.56

Multivariable (2) 0.90 (0.32–2.47) 0.83 0.55Nausea Univariable 30.1 26.5 0.84 (0.43–1.65) 0.61 0.64

Multivariable (1) 0.84 (0.42–1.69) 0.64 0.63N � 166 (83/group) for univariable and N � 165 for multivariable analyses.CI � confidence interval; OR � odds ratio.a Using greedy matching within 0.05 propensity score units.b Odds ratio for NG tube use versus nonuse (reference).c Two-tailed test of null hypothesis of no NG tube effect.d One-tailed test against the null hypothesis that the odds ratio of NG tube use is �0.95 (i.e., superior), where the alternative hypothesis and significant result means NG tube use odds ratio�0.95 (either equivalent to or worse than non-NG tube use, given the equivalence range of 0.95–1.0).e Significant at P � 0.05.

772 Nasogastric Tube Use and Risk of PONV ANESTHESIA & ANALGESIA

REFERENCES

1. Hovorka J, Korttila K, Erkola O. The experience of the personventilating the lungs does influence postoperative nausea andvomiting. Acta Anaesthesiol Scand 1990;34:203–5

2. Doenicke AW, Hoernecke R, Celik I. Premedication with H1and H2 blocking agents reduces the incidence of postoperativenausea and vomiting. Inflamm Res 2004;53(suppl 2):S154 –S158

3. Nelson R, Edwards S, Tse B. Prophylactic nasogastric decompres-sion after abdominal surgery. Cochrane Database Syst Rev2005:CD004929

4. Apfel CC, Korttila K, Abdalla M, Biedler A, Kranke P, Pocock SJ,Roewer N. An international multicenter protocol to assess thesingle and combined benefits of antiemetic interventions in acontrolled clinical trial of a 2 � 2 � 2 � 2 � 2 � 2 factorial design(IMPACT). Control Clin Trials 2003;24:736–51

5. Parsons LS. Reducing Bias in a Propensity Score Matched-PairSample Using Greedy Matching Techniques. In: Proceedings ofthe 26th annual SAS Users Group International (SUGI) Confer-ence, Long Beach, California, 2001:214–26

6. Cheatham ML, Chapman WC, Key SP, Sawyers JL. A meta-analysis of selective versus routine nasogastric decompressionafter elective laparotomy. Ann Surg 1995;221:469–76; discussion76–8

7. Cywinski JB, Koch CG, Krajewski LP, Smedira N, Li L, StarrNJ. Increased risk associated with combined carotid endarterec-tomy and coronary artery bypass graft surgery: a propensity-matched comparison with isolated coronary artery bypass graftsurgery. J Cardiothorac Vasc Anesth 2006;20:796–802

8. Koch CG, Khandwala F, Nussmeier N, Blackstone EH. Gender andoutcomes after coronary artery bypass grafting: a propensity-matched comparison. J Thorac Cardiovasc Surg 2003;126:2032–43


Anesthetic PharmacologyPreclinical PharmacologySection Editor: Marcel E. Durieux

Clinical PharmacologySection Editor: Tony Gin

Automated Responsiveness Monitor to TitratePropofol Sedation

Anthony G. Doufas, MD, PhD*†

Nobutada Morioka, MD†‡

Adel N. Mahgoub, MD†‡

Andrew R. Bjorksten, PhD§

Steven L. Shafer, MD�

Daniel I. Sessler, MD†

BACKGROUND: In previous studies, we showed that failure to respond to auto-mated responsiveness monitor (ARM) precedes potentially serious sedation-related adversities associated with loss of responsiveness, and that the ARMwas not susceptible to false-positive responses. It remains unknown, however,whether loss and return of response to the ARM occur at similar sedation levels.We hypothesized that loss and return of response to the ARM occur at similarsedation levels in individual subjects, independent of the propofol effecttitration scheme.METHODS: Twenty-one healthy volunteers aged 20–45 yr underwent propofolsedation using an effect-site target-controlled infusion system and two differentdosing protocol schemes. In all, we increased propofol effect-site concentration (Ce)until loss of response to the ARM occurred. Subsequently, the propofol Ce wasdecreased either by a fixed percentage (20%, 30%, 40%, 50%, 60%, and 70%; fixedpercentage protocol, n � 10) or by a linear deramping (0.1, 0.2, and0.3 �g � mL�1 � min�1; deramping protocol, n � 11) until the ARM responsereturned. Consequently, the propofol Ce was maintained at the new target for a6-min interval (Ce plateau) during which arterial samples for propofol determina-tion were obtained, and a clinical assessment of sedation (Observer’s Assessment ofAlertness/Sedation [OAA/S] score) performed. Each participant in the two proto-cols experienced each percentage or deramping rate of Ce decrease in randomorder. The assumption of steady state was tested by plotting the limits ofagreement between the starting and ending plasma concentration (Cp) at each Ceplateau. The probability of response to the ARM as a function of propofol Ce,Bispectral Index (BIS) of the electroencephalogram, and OAA/S score was esti-mated, whereas the effect of the protocol type on these estimates was evaluatedusing the nested model approach (NONMEM). The combined effect of propofol Ceand BIS on the probability for ARM response was also evaluated using a fractionalprobability model (PBIS/Ce).RESULTS: The measured propofol Cp at the beginning and the end of the Ce plateauwas almost identical. The Ce50 of propofol for responding to the ARM was 1.73(95% confidence interval: 1.55–2.10) �g/mL, whereas the corresponding BIS50 was75 (71.3–77). The OAA/S50 probability for ARM response was 12.5/20 (12–13.4). Afractional probability (PBIS/Ce) model for the combined effect of BIS and Ce fittedthe data best, with an estimated contribution for BIS of 63%. Loss and return ofARM response occurred at similar sedation levels in individual subjects.CONCLUSIONS: Reproducible ARM dynamics in individual subjects compares favor-ably with clinical and electroencephalogram sedation end points and suggests thatthe ARM could be used as an independent instrumental guide of drug effect duringpropofol-only sedation.(Anesth Analg 2009;109:778–86)

Individual requirements for sedatives vary. For ex-ample, there is considerable interindividual variability inthe propofol effect-site concentration (Ce) at loss ofresponsiveness.1–3 Consequently, standardized dosing

provides inadequate medication for some patients whileproving excessive in others.4 Effective titration of drugeffect in individual patients is necessary to avoid poten-tial adverse events due to inappropriate dosing.5,6

From the *Department of Anesthesia, Stanford University Schoolof Medicine, Palo Alto, California; †Outcomes Research Consor-tium, Cleveland, Ohio; ‡Department of Anesthesia and Periopera-tive Care, University of California San Francisco, San Francisco,California; §Department of Anaesthesia, Royal Melbourne Hospital,Parkville, Australia; and �Department of Anesthesiology, ColumbiaUniversity, New York City, New York.

Accepted for publication May 17, 2009.Supported by Scott Laboratories, Ltd. (Lubbock, TX) and the

Joseph Drown Foundation (Los Angeles, CA).

Steven L. Shafer is the Editor-in-Chief of the Journal. Thismanuscript was handled by James G. Bovill, Guest Editor-in-Chief,and Dr. Shafer was not involved in any way with the editorialprocess or decision.

Address correspondence and reprint requests to Anthony G.Doufas, MD, PhD, Department of Anesthesia, Stanford UniversitySchool of Medicine, 300 Pasteur Dr., H3590 Stanford, CA 94305-5640. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181b0fd0f


Patients given non-opioid sedatives are unlikely toexperience respiratory and/or hemodynamic compli-cations from doses that do not cause a loss of respon-siveness. We have evaluated responsiveness duringpropofol sedation both clinically and with an auto-mated responsiveness monitor (ARM), a novel nega-tive feedback system for individual titration of propofolsedation.2,7 The system incorporates a handset ap-proximately the size of a mobile phone that consists ofa conveniently located thumb switch and vibrator. It islinked to a single “ear bud” headphone worn by thesubject. A computerized voice asks the participant topush the button at intervals. The voice request isaccompanied by vibration of the handset. The voicerepeats the request four times over a 10-s period,becoming louder and more insistent with each repeti-tion. The handset vibrates during questioning, and thevibration becomes progressively more intense witheach query over the 10-s period. Pressing the button inresponse to any of the four queries presented in this10-s window is considered an evidence of responsive-ness and stops both the queries and vibration.

In previous studies, we showed that failure torespond to the ARM precedes potentially serioussedation-related adverse events associated with loss ofresponsiveness, such as apnea and hypotension, andthat the ARM was not susceptible to false-positiveresponses.2,7 It remains unknown, however, whetherloss and return of response to the ARM occurs atsimilar sedation levels, independent of the schemeused to titrate the drug effect. The issue is importantbecause time invariance is one of the basic assump-tions of pharmacokinetics.8 As a corollary, a clinicalsurrogate measure of sedation must be highly predict-able. Predictability in this context means that thedynamics of a behavioral titration instrument like theARM must be reliable and have a reasonably limitedintra- and interindividual variability.

We therefore tested the hypothesis that loss andreturn of response to the ARM occur at similar seda-tion levels in individual subjects during propofolsedation. We tested our theory by increasing thepropofol Ce until loss of response to the ARM wasobserved. After loss of response, we compared twomethods of decreasing the propofol Ce: a fixed per-centage decrease and a linear deramping of the Ceuntil the ARM response returned. Bispectral Index(BIS) of the electroencephalogram (EEG) and Ce infor-mation were used independently, as well as in com-bination, to characterize ARM response dynamics.

METHODSWith approval of the University of California, San

Francisco Human Studies Committees and writteninformed consent, we evaluated 21 healthy volunteersof both genders between April and May of 2000. Allvolunteers received propofol until they stopped re-sponding to the ARM. Ten volunteers were studied

using a fixed percentage protocol and 11 others werestudied using a linear deramping protocol, as de-scribed below. Age was restricted to 20–45 yr. Volun-teers fasted at least 8 h before the trial.

All standard anesthetic monitors including oscillo-metric blood pressure, electrocardiogram, end-tidalCO2 through a sealed anesthesia mask, and pulseoximetry (Spo2) were applied to the participatingvolunteers. Electrodes to capture the BIS of the EEG(A-2000 monitor, BIS 3.3 algorithm, system revision1.07, Aspect Medical Systems, Newton, MA) wereapplied to the forehead according to the manufactur-er’s instructions. The BIS recording began with a2-min period of quiet relaxation with the volunteer’seyes closed. Resistance of the BIS sensors was main-tained at �5 k� throughout the study period.

A 20-gauge catheter was inserted at the antecubitalfossa on the dominant arm for the propofol infusion,whereas a 20-gauge catheter was inserted into theradial artery in the contralateral arm for blood sam-pling. Normothermia was maintained with forced-airwarming. Volunteers breathed supplemental oxygenvia a sealed anesthesia mask to maintain a Spo2 morethan 92%.

The ARM apparatus was strapped loosely to thedominant hand. The volunteers were trained with theARM handset and headphone for 10–15 min beforethe first sedation trial. The volume of the query wasadjusted to a level that they were able to hear easily.We confirmed that the volunteers respondedpromptly to the ARM apparatus during this prestudyperiod.

We used a target-controlled infusion (TCI) drugdelivery system according to the method of Shafer andGregg9 to target propofol Ce using the covariate-adjusted propofol kinetic model reported by Schnideret al.10 with a ke0 of 0.46/min.11 The performanceof the system was previously evaluated underpseudosteady-state conditions.12 The drug deliverysystem consisted of a Harvard 22 (Harvard ClinicalTechnology, South Natick, MA) electronic syringepump, which could be commanded by a host system(Pentium II 450 MHz microprocessor-based system)through an RS232 serial communication port. A cus-tomized software platform, written by Scott Laborato-ries (Lubbock, TX), was used to drive the pump.

Fixed Percentage ProtocolTen volunteers were studied six times each during

administration of propofol using an infusion “ramp”with a slope adjusted to change the propofol Ce witha rate of 0.6 �g � mL�1 � min�1. The infusion ramp wasmaintained until the volunteers lost response to theARM apparatus, because this is determined by anonresponse to a 10-s-long query period. Subse-quently, propofol Ce was decreased by one of sixrandomly ordered percentages: 20%, 30%, 40%, 50%,60%, and 70%. The target propofol Ce was maintainedstable at this level for 6 min (Ce plateau) before the


infusion was stopped. Sedation was evaluated at1-min intervals during this steady-state period. After arecovery period of at least 15 min, and a reduction inthe predicted Ce to �0.5 �g/mL, the next trial began,again consisting of an infusion ramp followed by adecrease of a different percentage. Each participantexperienced each percentage decrease (Fig. 1).

Deramping ProtocolA set of 11 different volunteers was studied three

times each during administration of propofol using aninfusion ramp with a slope adjusted to change propo-fol Ce at a rate of 0.5 �g � mL�1 � min�1. The infusionwas maintained until the volunteers lost response tothe ARM apparatus, because this is determined by anonresponse during a 10-s query period. Subse-quently, the Ce of propofol was decreased by one ofthree randomly ordered slopes adjusted to change Ceby 0.1, 0.2, or 0.3 �g � mL�1 � min�1. The Ce of propo-fol was decreased until three successive positive re-sponses to the ARM apparatus occurred. After thethird ARM response, the propofol Ce was maintainedat that level for 6 min (Ce plateau) before the infusionwas stopped. At the end of each steady-state period,the sedation level was evaluated. As described above,after a recovery period of at least 15 min and areduction in the predicted Ce to �0.5 �g/mL, the nexttrial began to test a different deramping rate. Eachparticipant experienced each deramping rate decreasein propofol Ce (Fig. 1).

MeasurementsDemographic and morphometric characteristics of

the volunteers were recorded. All standard physi-ologic values were downloaded and recorded to anautomated data acquisition system for off-line analy-sis. These included heart rate, arterial blood pressure,respiratory rate, end-tidal CO2, and Spo2. BIS and all

standard anesthetic monitoring data, except for bloodpressure, were recorded at 15-s intervals.

Each ARM test lasted for 10 s, contained fourindividual queries, and was repeated with a rate offour tests per minute, i.e., after each completed (fourqueries) ARM test there was a 5-s interval before theinitiation of the next one. Failure to press the button inresponse to all four queries that were presented dur-ing a 10-s ARM test was considered a nonresponse. Onthe contrary, a positive response to any of the fourqueries was considered a positive response to theARM. Both the positive and the negative responses toeach ARM test were recorded approximately 5 s afterthe end of each test, i.e., just before the initiation of thenext test. Thus, the resolution of each ARM test wasapproximately 15 s. A detailed diagram in Figure 1depicts the timing characteristics of the ARM test.

An arterial blood sample for propofol determina-tion was obtained at the beginning and the end of eachCe plateau in both protocols to document the presenceof steady state. The samples were analyzed using ahigh performance liquid chromatography assay modi-fied from the method of Plummer.13 This method hasa coefficient variation of 4.1% at a propofol plasmalevel of 2 �g/mL.

Sedation was assessed clinically using the Observ-er’s Assessment of Alertness/Sedation score (OAA/S).The OAA/S score consists of four components. Asdescribed by Chernik et al.,14 we summed the compo-nent scores. The presence of consciousness was de-fined as an OAA/S score higher than 10 (of 20). Thescore was applied every 1 min at the Ce plateauduring the fixed percentage protocol, and only once atthe end of each Ce plateau during the derampingprotocol. An attempt was made to evaluate sedation atthe end of an ARM test so as to minimize anyinterference with the ARM function.

Figure 1. The time course of the predicted effect-site propofol concentration (Ce) in the fixed percentage and deramping dosingprotocol schemes. In the fixed percentage protocol the Ce is decreased by a certain percentage (20%, 30%, 40%, 50%, 60%, or70%), whereas in the deramping protocol the Ce is decreased by a certain rate (0.1, 0.2, or 0.3 �g � mL�1 � min�1), after the firstloss of automated responsiveness monitor (ARM) (LOA) response has occurred. A 6-min-long Ce steady state (SS) completeseach individual sedation trial. The third graph presents the time course for the ARM. Each ARM test lasts for 10 s and consistsof four individual queries (Q). Failure to press a button in response to all four queries that are presented during a 10-s-longARM test is considered a nonresponse. Between two successive ARM tests there is an interval of 5 s (Methods).

780 Automated Responsiveness Monitor ANESTHESIA & ANALGESIA

Data AnalysisDemographic and morphometric data were aver-

aged across volunteers and presented for each proto-col separately.

We have previously shown1 that when propofol Ceis increasing at a rate between 0.1 and 0.9�g � mL�1 � min�1, a ke0 of 0.17/min (tpeak � 2.7 min)more accurately reflects the plasma-effect-site equili-bration than the previously reported value of0.46/min (tpeak � 1.7 min).11 Predicted Ce reportedhere are thus based on a ke0 of 0.17/min.

The assumption of steady-state concentration ateach plateau (Ce plateau) was tested using the Blandand Altman method.15 The difference in the measuredplasma concentration (Cp) between the beginning(Cp-start) and the end (Cp-end) of each concentrationplateau was presented as a function of the Cp-startand Cp-end average. Differences between the twoprotocols were assessed using unpaired t-test.

The accuracy of the TCI system was evaluated bycalculating the median performance error (MDPE)and the median absolute performance (MDAPE) errorfor each protocol separately, as previously proposed.16

First, for each blood sample the performance error(PE) was calculated as:

PE �Cm � Cp

Cp

� 100

where Cm and Cp are the measured and predictedplasma propofol concentrations, respectively. Subse-quently, the MDPE and the MDAPE were calculatedfor each subject separately. The median (range) valuesfor MDPE and MDAPE were reported for each proto-col separately. In addition, MDPE and MDAPE valuesat the beginning and the end of the Ce plateau werepresented in a graph for each protocol separately.

Logistic regression was used to estimate the prob-ability of response (squeezing) to the ARM device as afunction of the predicted propofol Ce. Each responseto the ARM was given a score of 1, and each nonre-sponse to the ARM was given a score of 0. Theprobability of responding to ARM (PCe) was thencalculated as:

PCe � 1 �Ce�Ce, ARM

Ce50, ARM�Ce, ARM � Ce�Ce, ARM

where Ce50, ARM is the predicted propofol Ce associ-ated with a 50% probability for response to the ARMand �Ce, ARM is the steepness of the Ce versus prob-ability relationship (also termed the “Hill coefficient”).The parameters Ce50, ARM and �Ce, ARM were estimatedusing nonlinear mixed effects modeling (NONMEMV, GloboMax LLC, Hanover, MD). Interindividualvariability was permitted and assumed to be log-normally distributed. Residual intraindividual errorwas assumed to be additive. All data from both

protocols (7185 data points) were used for this analy-sis. The effect of protocol type (fixed percentage orderamping) on the Ce50, ARM was tested by permittingdifferent Ce50, ARM values when the protocol type wasadded to the model as a covariate. A decrease in theobjective function of the complete model more than3.84 points indicated a significant effect of the protocolon the ARM response dynamics.

The same analysis, as above, was used to estimatethe probability of a response to the ARM as a functionof BIS (PBIS). In this analysis, instead of the BIS valuethe BIS difference from the baseline, determined as BISeffect (BISeffect � 100 � BIS), was used. The BISeffect 50, ARM,indicating the BISeffect associated with a 50% probabil-ity for response to ARM and the �BISeffect, ARM, wereestimated using NONMEM. The effect of the protocoltype on BISeffect 50, ARM was evaluated by incorporat-ing the protocol type into the model as a covariate.

The combined effect of propofol Ce and BISeffect onthe probability for ARM response (PBIS/Ce) was alsoevaluated. An independent variable, IND, was calcu-lated as:

IND � 100 � BIS � Ce �

and logistic regression was used to model the prob-ability of response to ARM (PBIS/Ce) as a function ofIND:

PBIS/Ce � 1 �IND�BIS/Ce, ARM

IND50, ARM�BIS/Ce, ARM � IND�BIS/Ce, ARM

The combined effect of propofol Ce and BISeffect, asexpressed above, was considered significant if theminimum objective function (�2 log likelihood,�2LL) of the model decreased by at least 3.84 pointsfor each parameter added to the model.

Finally, in the complete model, the combined effectof propofol Ce and BISeffect was evaluated after ex-pressing the probability of ARM response (PBIS/Ce) asthe sum of the probability fractions derived from theeffects of propofol Ce (PCe) and BISeffect (PBIS):

PBIS/Ce � FBIS � PBIS � �1 � FBIS� � PCe,

where FBIS is the fraction of the combined probabilityPBIS/Ce that is determined by BISeffect. The combinedeffect of propofol Ce and BISeffect, expressed as above,was considered significant if it produced a decrease by3.84 points in the �2LL of the model, for each addedparameter.

The probability of response to the ARM was mod-eled as a function of the sedation level (OAA/S score)during the Ce plateau periods in both protocols, usinglogistic regression. The OAA/S50, ARM and �OAA/S, ARMwere also estimated by NONMEM. A total of 461 datapoints were used for this analysis.

Bootstrap resampling with replacement was usedto determine 95% confidence intervals for the P50


estimates of Ce50, BISeffect 50, and OAA/S50. One thou-sand bootstrap samples (simple random samples ofsize 21 with replacement) were created from each ofthe three (i.e., Ce50, BISeffect 50, and OAA/S50) samplesoriginally estimated by NONMEM, as describedabove. Confidence limits for each P50 were taken asthe 2.5th and 97.5th percentiles of the respectivebootstrap sample distribution.

The ability of each tested parameter or combina-tion of parameters to predict the observed responseto the ARM device was investigated by calculatingthe average of probabilities (with and without

rounding each probability to the closest integer, i.e.,1 or 0) for all the individual observations for each ofthe tested parameters, or combination of parame-ters, separately.

The median (range) propofol Ce at the first loss andfirst recovery of ARM response for each of the indi-vidual sedation trials (i.e., fixed percentages or de-ramping rates) were presented for each protocol andeach individual volunteer, separately. In addition, theintra- and interindividual variability, calculated asthe coefficient of variation (%), in the Ce and BIS at thefirst loss and first recovery of ARM response werepresented for each protocol separately in a tabular andgraph formats.

RESULTSThe volunteers participating in the fixed percent-

age protocol (n � 10) were 32.4 � 7.4 yr old,weighed 69.0 � 7.6 kg, and were 169.7 � 8.1 cm tall.The volunteers participating in the deramping pro-tocol (n � 11) were 33.4 � 5.8 yr old, weighed 69.9 �12 kg, and were 172.4 � 9.5 cm tall. All physiologyremained within normal limits during both sedationprotocols.

The measured arterial propofol Cp at the beginning(Cp-start) and the end (Cp-end) of the Ce plateaudiffered only by 0.05 � 0.39 �g/mL (Fig. 2). Arterialpropofol Cp obtained at steady state was used toassess the performance of the TCI. The results of thisanalysis are presented in Table 1 and Figure 2.Timing of the sampling has not been shown to be aconfounding factor regarding the performance ofthe TCI system.

The Ce50 of propofol for responding to the ARMwas 1.73 (95% confidence interval: 1.55–2.10) �g/mL,whereas the BISeffect 50 was 24.9 (23.0–28.7), corre-sponding to a BIS value of approximately 75 (Table 2,Fig. 3). The OAA/S score associated with a 50%

Figure 2. Bland and Altman analysis of the measured propofol concentrations at the beginning (plasma concentration[Cp]-start) and the end (Cp-end) of each effect-site concentration (Ce) plateau in the fixed percentage and derampingprotocols. The mean and 2sd of the difference (Cp-start � Cp-end) are indicated by the horizontal continuous and dottedlines, respectively. The mean difference (sd) for the fixed percentage and deramping protocols were �0.04 (0.42) and �0.08(0.33) �g/mL, respectively (unpaired t-test, P � 0.672). Data obtained during the two different protocols are presentedseparately. Median (range) of median performance error (MDPE) and the median absolute performance (MDAPE) values arepresented as a function of the time at which the samples were drawn during steady state (SS).

Table 1. Performance Metrics of the Target Controlled Infusion

Protocol MDPE (%) MDAPE (%)Fixed percentage 9 (�22 to 38) 17 (10–38)Deramping 31 (�6 to 97) 33 (10–97)Median perfomance error (MDPE) and median absolute performance error (MDAPE) for thetwo sedation protocols. A total of 120 samples obtained during the fixed percentage protocoland 58 samples obtained during the deramping protocol (in one volunteer we were not ableto draw samples during the last deramping trial, whereas in another volunteer the insertion ofarterial line was not feasible), were used in this analysis. Values are presented as medians(range).

Table 2. NONMEM Estimates and Coefficients of Variation forthe Effect of Different Parameters on the P50 for AutomatedResponsiveness Monitor (ARM) Response

Modelparameters

P50 for ARM response

Gamma(se)

NONMEMestimate 95 % CI

Ce 1.73 1.55–2.10 6.20 (0.76)BISeffect 24.9 23.0–28.7 5.12 (0.52)OAA/S score 12.5 12.0–13.4 5.31 (0.96)Propofol Ce, BISeffect, and Observer’s Assessment of Alertness/Sedation score (OAA/S)associated with a probability of 50% (P50) for responding to the automated responsivenessmonitor (ARM). Gamma (�) represents the steepness of the parameter versus the probabilityfor ARM response curve. All data (7185 data points) from both protocols were included in thisanalysis (see also Fig. 3). Best-estimate values with their 95% confidence intervals (CI)calculated using 1000 bootstrap samples with replacement from the originally estimated P50

samples are presented.Ce � effect site concentration; BISeffect � Bispectral Index difference from the baseline.


probability for ARM response was 12.5/20 (12.0–13.4).Figure 3 presents the probability of responding to theARM as a function of Ce, BISeffect, and OAA/S score.

Propofol Ce and BIS independently predicted theobserved ARM response with a probability of 0.82 and0.84, respectively, whereas their combination in-creased that probability to 0.85. The model that de-fined the probability of the observed ARM responsesas the sum of the fractional probabilities determinedby propofol Ce and BIS (PBIS/Ce � PCe� PBIS, Table 3,row D) demonstrated the lowest minimum objectivefunction (-2LL � 4796.38), when compared with othermodels that used only Ce (PCe � 0.82, �2LL � 5895.57,Table 3, row A) or BIS (PBIS � 0.84, �2LL � 5474.31,Table 3, row B), as predictor variables, and the modelthat combined Ce and BIS in the form of an indepen-dent variable IND � 100 � BIS � Ce � (PBIS/Ce �0.84, �2LL � 5101.49, Table 3, row C). In the PBIS/Cefractional probability model, the contribution of PBISto the overall probability was estimated to be 63%.

Table 4 presents the intra- and interindividualvariability, regarding the propofol Ce and BIS whenthe first loss and recovery of ARM response occurred.Figure 4 presents the actual Ce values and its intrain-dividual variability at the above end points.

DISCUSSIONUsing an effect-site TCI system, we have shown

that ARM can titrate propofol sedation in a repro-ducible manner over time even in nonsteady-stateconditions. Loss and return of response to the ARMoccurred at similar Ce of propofol in individualsubjects and with a reasonable interindividual vari-ability during the fixed percentage and derampingprotocols. Interestingly, when BIS and propofol Cewere independently used to characterize ARM re-sponse, the latter was not influenced by the protocoltitration scheme.

Our TCI system performed well during the fixedpercentage protocol, and its performance was similarto what we have previously demonstrated,12 using thesame kinetic model for propofol, developed bySchnider et al.,10 and subsequently validated by Dou-fas et al.1 The system did not perform as well duringthe deramping protocol but was still in an acceptablerange. The replacement of our original ke0 value of0.46/min10 with the value of 0.17/min is justified bytwo arguments: (a) the ke0 of 0.17/min has beenestimated in a study of a young healthy population1

with similar characteristics as our present participants,

Figure 3. The probability of responding to the automated responsiveness monitor (ARM) as a function of propofol effect-siteconcentration (Ce), Bispectral Index (BIS) (expressed as BISeffect � 100 � BIS), and sedation/alertness determined by theObserver’s Assessment of Alertness/Sedation (OAA/S) score (nonresponse to verbal and tactile stimuli correspond to scoresof 10 and 9/20, respectively). Vertical dotted lines indicate the values of the above parameters that are associated with a 50%probability of responding to the ARM, whereas the horizontal lines represent the 95% confidence intervals for these values.Data obtained from both the fixed percentage and deramping protocols are included in the analysis.

Table 3. Modeling the Probability of Response to Automated Responsiveness Monitor (ARM), as a Function of Propofol Effect SiteConcentration (Ce), Bispectral Index (BIS), and their Combination

Modelparameters (N) Probability of response to ARM

Minimumobjectivefunction �2LL

(A) Ce effect (N � 2) PCe � 1 �Ce�Ce, ARM

Ce50,ARM�Ce, ARM � Ce�Ce, ARM

5895.57 —

(A1) Protocol effect on(A) (N � 3) 5892.36 �3.21 (A1 � A)

(B) BIS effect (N � 2) PBIS � 1 �BISeffect

�BIS, ARM

BISeffect 50, ARM�BIS, ARM � BISeffect

�BIS ARM, BISeffect � 100 � BIS 5474.31 —

(B1) Protocol effect on(B) (N � 3) 5474.28 �0.03 (B1 � B)

(C) BIS/Ce effect(N � 3) PBIS/Ce � 1 �

IND�BIS/Ce, ARM

IND50, ARM�BIS/Ce, ARM � IND�BIS/Ce, ARM

, IND � 100 � BIS � Ce � 5101.49�794.08 (C � A)

�372.82 (C � B)

(D) BIS/Ce effect(N � 5) PBIS/Ce � FBIS � PBIS � �1 � FBIS� � PCe, FBIS 4796.38 �305.11 (D � C)


using similar infusion designs as in the current trial,and (b) the ke0 value of 0.17/min was derived from astudy,1 which prospectively validated the propofolkinetic set developed by Schnider et al.10

In one study, adequately characterized sedationend points like loss and recovery of consciousness(defined by the ability to respond to verbal command)occurred at similar propofol Ce in each subject,despite the presence of a large interindividual vari-ability.3 In this study, responsiveness to the ARMapparatus demonstrated similarly predictable dynam-ics with a propofol Ce50, ARM of 1.73 �g/mL (95%confidence interval: 1.55–2.10, intraindividual vari-ability � 19%). This Ce value is comparable with thosewe have found previously in pseudosteady-state (1.6�g/mL)2 and nonsteady-state (1.76 �g/mL)1 condi-tions and are approximately 0.5–1 �g/mL less thanthe Ce at loss of response to verbal command2,3,7,17,18

or tactile stimulation.1 Furthermore, the BIS50 for ARMresponse was much higher than the BIS level previ-ously associated with loss of response to verbal7,18,19

or tactile1 stimulation. BIS is highly correlated with

propofol Ce,20 and it has been shown to predictclinical sedation (OAA/S score) and loss of respon-siveness comparably well21 with, if not slightly bet-ter20 than, the Ce. In addition, the P50 of the OAA/Sscore for responding to the ARM was 12.5/20 wellabove the threshold for loss of consciousness (10/20).This OAA/S50, ARM value is very similar to what wedemonstrated previously under pseudosteady-stateconditions,2 and it was not influenced by the appliedprotocol scheme.

Thus, this study supports our previous finding thatloss of response to the ARM tends to precede loss ofconsciousness during propofol-only sedation andmight be used as a titration instrument when theactual loss of responsiveness is not a desired endpoint. Although it is difficult to compare the arousingpotential between an ARM and a human-based(OAA/S scale) sedation assessment, the results of thepresent and previous2 trials support a preponderanceof the latter. Nevertheless, we cannot exclude thepossibility of an interaction between these two typesof stimuli during our trial.

Figure 4. In the upper graph, the mean(standard deviation) propofol effect-site concentration (Ce) at which thefirst loss of response to the automatedresponsiveness monitor (ARM) andARM recovery occurred during thedifferent sedation trials are presentedfor each individual volunteer and eachprotocol separately. The lower graphdepicts the intraindividual variabilityof the Ce at the above end points,expressed as the coefficient of variation(%).

Table 4. Intra- and Interindividual Variability of the Effect Site Concentration (Ce) and Bispectral Index (BIS) for the Loss andRecovery of Automated Responsiveness Monitor (ARM) Response End Points

Protocol

Loss of ARM Recovery of ARM

Intra-CV (%) Inter-CV (%) Intra-CV (%) Inter-CV (%)Fixed percentage

Ce 13 � 3 25 � 2 17 � 7 27 � 5BIS 9 � 5 14 � 3 8 � 3 13 � 3

DerampingCe 16 � 11 23 � 6 19 � 11 32 � 7BIS 6 � 4 13 � 3 6 � 6 12 � 5

Intra- and interindividual variability of the Ce and BIS at the first loss and first recovery of the response to ARM are expressed by the coefficient variation of Ce and BIS at the respective endpoints for the two protocols separately. Data are presented as means� SD s.


Propofol Ce and BIS predicted the observed ARMresponses with a probability of 0.82 and 0.84, respec-tively. This probability increased to 0.85 when infor-mation from both Ce and BIS (fractional probabilities0.37:0.63) were simultaneously used to predict ARMresponse. This was highly statistically significant, inregard to model improvement (Table 3), and reflectsthe importance of combining BIS and Ce informationwhen attempting to characterize ARM response as anindependent sedation end point. This result of ourmodeling approach provides two important insights:(a) it strengthens the evidence that the ARM relaysinformation about a real drug effect, and (b) it ques-tions the interchangeable use of Ce and BIS, twohighly correlated but different, pharmacodynamicquantities, in characterizing drug effect.

Targeting the Ce, rather than the Cp propofolconcentration, has been associated with fewer hemo-dynamic and respiratory consequences.22,23 However,a relatively rapid increase of Ce always entails the riskof concentration overshoot and oversedation when thedesired end point is reached, with potential adversephysiological consequences. An almost reflexive, pref-erably clinical, monitoring system is necessary toprevent oversedation and enhance safety when thesedative effect is progressing quickly. Patient-maintained sedation systems that use a Ce-drivenpropofol TCI have managed to provide safe sedationmainly by pursuing a slow, stepwise increase in theCe.24 Nonetheless, a certain number of patients whoused patient-maintained sedation were able to delib-erately oversedate themselves, reaching a poten-tially unsafe sedation depth.25 As expected, the useof a Ce ramp (0.5– 0.6 �g � mL�1 � min�1) in ourstudy not only increased the speed of sedationinduction but also resulted in a relative Ce over-shoot after discontinuation of the infusion when lossof response to the ARM occurred. This Ce overshootled to oversedation in certain instances, which wasnever associated with severe adverse effects, such asapnea or hypotension.

We conclude that loss and return of response tothe ARM occurs at similar sedation levels in indi-viduals, even though there is considerable variabilityamong individuals. Reproducible ARM dynamicscompares favorably with clinical and EEG sedationend points and suggest that the ARM can be used asan independent instrumental guide of propofol effect.However, the wider applicability of the ARM inclinical settings, which are usually compounded bymultiple stimulating events and/or drug effects, re-mains to be tested.

ACKNOWLEDGMENTSThe authors greatly appreciate the assistance of Randy

Hickle, MD, Brett L. Moore, BS, and Jason Derouen, BS (allfrom Scott Laboratories, Inc., Lubbock, TX).

REFERENCES

1. Doufas AG, Bakhshandeh M, Bjorksten AR, Shafer SL, SesslerDI. Induction speed is not a determinant of propofol pharma-codynamics. Anesthesiology 2004;101:1112–21

2. Doufas AG, Bakhshandeh M, Bjorksten AR, Greif R, SesslerDI. Automated responsiveness test (ART) predicts loss ofconsciousness and adverse physiologic responses duringpropofol conscious sedation. Anesthesiology 2001;94:585–92

3. Iwakiri H, Nishihara N, Nagata O, Matsukawa T, Ozaki M,Sessler DI. Individual effect-site concentrations of propofol aresimilar at loss of consciousness and at awakening. Anesth Analg2005;100:107–10

4. Smith I, Monk TG, White PF, Ding Y. Propofol infusion duringregional anesthesia: sedative, amnestic, and anxiolytic proper-ties. Anesth Analg 1994;79:313–9

5. Bailey PL, Pace NL, Ashburn MA, Moll JW, East KA, StanleyTH. Frequent hypoxemia and apnea after sedation with mida-zolam and fentanyl. Anesthesiology 1990;73:826–30

6. Malviya S, Voepel-Lewis T, Tait AR. Adverse events and riskfactors associated with the sedation of children by nonanesthe-siologists. Anesth Analg 1997;85:1207–13

7. Doufas AG, Bakhshandeh M, Haugh GS, Bjorksten AR, Greif R,Sessler DI. Automated responsiveness test and bispectral indexmonitoring during propofol and propofol/N2O sedation. ActaAnaesthesiol Scand 2003;47:951–7

8. Schwilden H, Schuttler J. Target controlled anaesthetic drugdosing. Handb Exp Pharmacol 2008;425–50

9. Shafer SL, Gregg KM. Algorithms to rapidly achieve andmaintain stable drug concentrations at the site of drug effectwith a computer-controlled infusion pump. J PharmacokinetBiopharm 1992;20:147–69

10. Schnider TW, Minto CF, Gambus PL, Andresen C, Goodale DB,Shafer SL, Youngs EJ. The influence of method of administrationand covariates on the pharmacokinetics of propofol in adultvolunteers. Anesthesiology 1998;88:1170–82

11. Schnider TW, Minto CF, Shafer SL, Gambus PL, Andresen C,Goodale DB, Youngs EJ. The influence of age on propofolpharmacodynamics. Anesthesiology 1999;90:1502–16

12. Doufas AG, Bakhshandeh M, Bjorksten AR, Greif R, Sessler DI.A new system to target the effect-site during propofol sedation.Acta Anaesthesiol Scand 2003;47:944–50

13. Plummer GF. Improved method for the determination ofpropofol in blood by high-performance liquid chromatogra-phy with fluorescence detection. J Chromatogr 1987;421:171– 6

14. Chernik DA, Gillings D, Laine H, Hendler J, Silver JM,Davidson AB, Schwam EM, Siegel JL. Validity and reliabilityof the Observer’s Assessment of Alertness/Sedation Scale:study with intravenous midazolam. J Clin Psychopharmacol1990;10:244 –51

15. Bland JM, Altman DG. Statistical methods for assessing agree-ment between two methods of clinical measurement. Lancet1986;1:307–10

16. Varvel JR, Donoho DL, Shafer SL. Measuring the predictiveperformance of computer-controlled infusion pumps. J Pharma-cokinet Biopharm 1992;20:63–94

17. Chortkoff BS, Eger EI II, Crankshaw DP, Gonsowski CT, DuttonRC, Ionescu P. Concentrations of desflurane and propofol thatsuppress response to command in humans. Anesth Analg1995;81:737–43

18. Milne SE, Troy A, Irwin MG, Kenny GN. Relationship betweenbispectral index, auditory evoked potential index and effect-siteEC50 for propofol at two clinical end-points. Br J Anaesth2003;90:127–31

19. Irwin MG, Hui TW, Milne SE, Kenny GN. Propofol effectiveconcentration 50 and its relationship to bispectral index. Anaes-thesia 2002;57:242–8

20. Struys MM, Jensen EW, Smith W, Smith NT, Rampil I, DumortierFJ, Mestach C, Mortier EP. Performance of the ARX-derivedauditory evoked potential index as an indicator of anestheticdepth: a comparison with bispectral index and hemodynamicmeasures during propofol administration. Anesthesiology2002;96:803–16


21. Struys MM, Vereecke H, Moerman A, Jensen EW, Verhae-ghen D, De Neve N, Dumortier FJ, Mortier EP. Ability of thebispectral index, autoregressive modelling with exogenousinput-derived auditory evoked potentials, and predictedpropofol concentrations to measure patient responsivenessduring anesthesia with propofol and remifentanil. Anesthe-siology 2003;99:802–12

22. Kazama T, Ikeda K, Morita K, Kikura M, Doi M, Ikeda T, KuritaT, Nakajima Y. Comparison of the effect-site k(eO)s of propofolfor blood pressure and EEG bispectral index in elderly andyounger patients. Anesthesiology 1999;90:1517–27

23. Struys MM, De Smet T, Depoorter B, Versichelen LF, Mortier EP,Dumortier FJ, Shafer SL, Rolly G. Comparison of plasma compart-ment versus two methods for effect compartment—controlled target-controlled infusion for propofol. Anesthesiology 2000;92:399–406

24. Chapman RM, Anderson K, Green J, Leitch JA, Gambhir S,Kenny GN. Evaluation of a new effect-site controlled, patient-maintained sedation system in dental patients. Anaesthesia2006;61:345–9

25. Murdoch JA, Grant SA, Kenny GN. Safety of patient-maintainedpropofol sedation using a target-controlled system in healthyvolunteers. Br J Anaesth 2000;85:299–301


Should Dosing of Rocuronium in Obese Patients BeBased on Ideal or Corrected Body Weight?

Christian S. Meyhoff, MD, PhD*

Jørgen Lund, MD†

Morten T. Jenstrup, MD†

Casper Claudius, MD, PhD*

Anne M. Sørensen, MD, PhD*

Jørgen Viby-Mogensen, MD,DMSc*

Lars S. Rasmussen, MD, PhD,DMSc*

BACKGROUND: Pharmacokinetic studies in obese patients suggest that dosing ofrocuronium should be based on ideal body weight (IBW). This may, however,result in a prolonged onset time or compromised conditions for tracheal intubation.In this study, we compared onset time, conditions for tracheal intubation, andduration of action in obese patients when the intubation dose of rocuronium wasbased on three different weight corrections.METHODS: Fifty-one obese patients, with a median (range) body mass index of 44(34–72) kg/m2, scheduled for laparoscopic gastric banding or gastric bypass underpropofol-remifentanil anesthesia were randomized into three groups. The patientsreceived rocuronium (0.6 mg/kg) based on IBW (IBW group, n � 17), IBW plus20% of excess weight (corrected body weight [CBW]20% group, n � 17), or IBWplus 40% of excess weight (CBW40% group, n � 17). Propofol was administered asa bolus of 200 mg and an infusion at 5 mg � kg�1 � h�1 and remifentanil wasadministered at 1.0 �g � kg�1 � min�1, both according to CBW40%. Neuromuscularfunction was monitored with train-of-four nerve stimulation and acceleromyogra-phy. The primary end point was duration of action, defined as time to reappear-ance of the fourth twitch in train-of-four.RESULTS: The median (range) duration of action was 32 (18–49), 38 (25–66), and 42(24–66) min in the IBW, CBW20%, and CBW40% groups, respectively (P � 0.001for comparison of the IBW and CBW40% group). There were no significantdifferences in onset time (85 vs 84 vs 80 s) or in intubation conditions 90 s afteradministration of rocuronium.CONCLUSIONS: In obese patients undergoing gastric banding or gastric bypass,rocuronium dosed according to IBW provided a shorter duration of action withouta significantly prolonged onset time or compromised conditions for trachealintubation.(Anesth Analg 2009;109:787–92)

Clinicians may have difficulties with dosage cal-culations in obese patients. Dosing of neuromuscu-lar blocking drugs according to total body weight(TBW) is simple but carries the risk of prolongedduration of action in obese patients,1,2 because thereare important differences in distribution, proteinbinding, and elimination of drugs between obeseand lean patients.3

Therefore, it has been suggested that dosing shouldbe based on ideal body weight (IBW) rather than onTBW,1,2 but this could be inadequate because of pro-longed onset time and poor conditions for trachealintubation.

Pharmacokinetic parameters of drugs with lowlipophilicity, such as rocuronium, are not very differ-ent in obese and lean patients.4 Two studies per-formed using objective monitoring of neuromuscularfunction have, however, included few obese patients(12 in both studies1,2), and clinically relevant end points,such as time to reappearance of the fourth twitch (T4)after train-of-four (TOF) stimulation and time to TOFratio 0.90, were not reported. These end points areimportant, because they represent the time whenreversal of the block can be initiated5 and the patientcan be safely tracheally extubated,6 respectively. Inaddition, dosing of rocuronium according to IBWcould be inadequate because of prolonged onset timeand poor conditions for tracheal intubation. Therefore,it is unclear whether rocuronium in morbidly obesepatients should be dosed according to IBW or to adosing scheme based on corrected body weight(CBW), incorporating a percentage of the difference

From the *Department of Anaesthesia, Centre of Head andOrthopaedics, Copenhagen University Hospital, Rigshospitalet,Copenhagen; and †Department of Anaesthesia, Hamlet Hospital,Frederiksberg, Denmark.

Accepted for publication May 18, 2009.Supported by Rigshospitalet’s Research Foundation (to CSM),

Copenhagen, Denmark and the Novo Nordisk foundation (to LSR),Copenhagen, Denmark.

JV-M and CC have received consulting fees from Schering-Plough (producing Esmeron and the TOF-Watch�).

Reprints will not be available from the author.Address correspondence to Christian S. Meyhoff, MD, De-

partment of Anaesthesia, Section 4231, Centre of Head andOrthopaedics, Copenhagen University Hospital, Rigshospitalet,Blegdamsvej 9, Copenhagen DK-2100, Denmark. Address e-mailto [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181b0826a


between IBW and TBW.7 We hypothesized that adosing scheme based on IBW would be most suitablein morbidly obese patients, because duration of actionwould be shorter, without compromising the condi-tions for tracheal intubation.

The aim of this study was to compare duration ofaction, defined as time to reappearance of T4, onsettime, and tracheal intubation conditions in threegroups of morbidly obese patients in which the intu-bation doses of rocuronium were based on threedifferent weight corrections.

METHODSDanish Medicines Agency and the Local Ethics

Committee approved the study (NCT00540085), andwritten informed consent was obtained from all sub-jects. Patients aged 18–65 yr, scheduled for laparo-scopic gastric bypass or gastric banding were eligible.Exclusion criteria were expected difficult airway, in-terfering neuromuscular disease, known impaired he-patic or renal function, suspected allergy to the studydrugs, and medications known to influence the neu-romuscular transmission.

The study adhered to the International Conferenceon Harmonisation Good Clinical Practice standards.We recorded height, TBW, waist-hip ratio, and bodyfat percent, using the skinfold technique,8 after whichwe calculated (in kg):

1. IBW � Height in cm � 106 (for women) orheight � 102 (for men),9

2. CBW20% � IBW � 20% � (TBW � IBW),3. CBW40% � IBW � 40% � (TBW � IBW).

CBW40% was chosen because this correction isproposed for dosage of propofol in obese patients,7

and the CBW20% group was included to increase thepossibility of finding an optimal dosage algorithm.

Before arrival to the anesthetic room, patients wererandomly allocated 1:1:1 to receive rocuronium (0.6mg/kg) according to IBW, CBW20%, or CBW40%using a set of computer-generated random numberskept in sealed, sequentially numbered opaque enve-lopes. This rocuronium intubation dose was mixedwith saline to a total of 10 mL and administered by thestudy investigators and blinded to the patient, and theanesthetic and surgical staff. Standard monitoringconsisted of noninvasive arterial blood pressure, pulseoximetry, capnography, electrocardiography, andstate entropy.

Patients received oxycodone (10 mg) and parac-etamol (1 g) orally approximately 1 h before anes-thesia. Anesthesia was induced with IV infusion ofpropofol (5 mg � kg�1 � h�1) and remifentanil (1.0�g � kg�1 � min�1), both according to CBW40%, and 1min later followed by propofol (200 mg) IV. After lossof the eyelash reflex, the patients were mask ventilatedwhile the neuromuscular monitoring equipment wascalibrated. Anesthesia was maintained with infusions

of propofol and remifentanil adjusted to a state en-tropy between 30 and 50.

Neuromuscular monitoring followed good clinicalresearch practice (GCRP) guidelines for pharmaco-dynamic neuromuscular studies.10 After carefulcleaning of the skin, two pediatric surface electrodes(Neotrode�, ConMed Corporation, NY) were placedover the right ulnar nerve near the wrist with adistance of 3–6 cm. The forearm and four ulnar fingerswere immobilized and the acceleration transducer wassecured on the thumb using a Hand Adapter� (Or-ganon, Oss, the Netherlands). The response to ulnarnerve stimulation was recorded with a TOF-Watch�SX (Organon), and data were collected on a laptopusing the TOF-Watch SX monitor program. The moni-tor display was blinded to the anesthetic and surgicalstaff by means of an opaque sticker, and the hand wascovered by the sterile surgical covering. All IV infu-sions were to the left arm veins.

Once the patient was unconscious, a 50-Hz tetanicstimulus was applied for 5 s, and after baselinestabilization (�5% variation in at least 2 min), supra-maximal stimulation and calibration was ensured us-ing the built-in calibration function (CAL 2). Theallocated rocuronium dose was given over �5 s in arapidly flowing IV line.

Laryngoscopy was commenced after 80 s, andtracheal intubation conditions were evaluated after90 s by an experienced anesthesiologist blinded to thedose of rocuronium. The evaluation was based on astandard scheme including ease of laryngoscopy, po-sition and/or movement of the vocal cords, andreaction to intubation.10

An upper body air-warming device was used tomaintain a core temperature of more than 35°C andperipheral skin temperature of more than 32°C, asmeasured on the volar side of the thenar.10 Thepatients’ lungs were ventilated to normocapnia with60% oxygen in nitrogen.

If the neuromuscular blockade was insufficient forsurgery, boluses of remifentanil (0.5–1.0 �g/kg) orpropofol (20–30 mg) were given. Rocuronium (10 mg)was given if the block was still insufficient 5 min later.The surgeons requested intervention if they consid-ered the neuromuscular blockade to be insufficient,and the anesthesiologist administered the interventionin accordance with the protocol. None of them couldsee the response to TOF stimulation. Neostigmine (2.5mg) together with atropine (1 mg) or glycopyrrolate(0.5 mg) were given at end of surgery if the patienthad not recovered from neuromuscular block, definedas a TOF ratio less than 0.90. The trachea was extu-bated when the patient was fully awake, and TOFratio was more than 0.90. In case of supplementalrocuronium or reversal of the block, neuromusculardata after that timepoint were not included in the dataanalysis.

To evaluate blinding, the anesthesiologist and thesurgeon were asked which of the three groups they

788 Rocuronium in Obese Patients ANESTHESIA & ANALGESIA

believed the patients belonged to. We recorded alladverse events occurring within 24 h of surgery.

TOF-Watch data were stored on a computer, andthe reliability of the neuromuscular data was re-viewed by two blinded assessors based on specificquality variables according to GCRP guidelines (e.g.,presence of supramaximal stimulation, baseline drift,and artifacts).10

The primary end point was the duration of action,defined as time from start of rocuronium injection toreappearance of T4. The secondary end point wasonset time, defined as the time from the start ofrocuronium injection to 95% depression of T1. Thepharmacodynamic data obtained were as follows:time to reappearance of the T1, time to T1 recovery to25% (of the final T1), and time to TOF ratio 0.90 (withand without normalization). Because the acceleromyo-graphic control TOF ratio before administration of aneuromuscular blocking drug most often is more than1.00, it has been suggested to refer all TOF ratiosduring recovery to the control value (normalization).If, for instance, the TOF ratio is 1.20 before injection ofa neuromuscular blocking drug, a recorded TOF ratioof 0.90 during recovery corresponds to a normalizedvalue of only 0.75 (0.90/1.20).11,12 Surgical conditionswere evaluated by the surgeon at the start and the endof surgery as completely satisfactory, satisfactory,slightly unsatisfactory, or unacceptable.

Patient characteristics are reported with medianand interquartile range. Groups are compared withWilcoxon’s unpaired rank sum test using SAS forWindows, version 9.1. P �0.05 was considered statis-tically significant. We estimated a 10 min sd for time toreappearance of T4 based on two previous studies.1,13

We considered a difference in time to reappearance ofT4 of 10 min between the IBW and CBW40% groups tobe clinically relevant. We calculated that a sample sizeof 17 patients in each group would allow us to detectthis difference, with 5% Type 1 error risk, 80% power,and 10% dropout.

RESULTSThere were 59 eligible patients in the study period,

of which two refused to participate, one had anexpected difficult airway, one was not included be-cause no research staff was available, and four hadsurgery postponed. The characteristics of the 51 en-rolled patients are presented in Table 1.

Rocuronium was administered 6.5 (sd 1.4), 6.6(sd1.4), and 6.1 (sd1.1) min after start of propofol-remifentanil infusion in the IBW, CBW20%, andCBW40% groups, respectively. Onset time was notsignificantly different among the groups (P � 0.16 forcomparison of the IBW and CBW40% group; Table 2;Fig. 1). The trachea was intubated at first attempt in allbut three patients (two in the IBW group and one inthe CBW40% group), in whom a second or thirdattempt was necessary. Conditions for tracheal intu-bation were similar in the three groups (Table 2).

Time to reappearance of T4 was significantly longerin the CBW40% group than in the IBW group (P �0.001).

The surgeon requested intervention for insufficientneuromuscular blockade leading to a supplementaldose of rocuronium in three patients in the IBW group(at TOF ratio 0.18, 0.50, and 1.10) and in two patientsin the CBW40% group (at TOF ratio 0.28 and 0.85;Table 2). Surgical conditions were satisfactory or com-pletely satisfactory at start as well as during surgery in14, 15, and 15 of the patients in the IBW, CBW20%, andCBW40% groups, respectively.

One serious adverse event occurred for a patientin the CBW20% group. This patient had convulsionsand transient respiratory failure 6 h after surgeryand underwent second surgery because of intestinalbleeding. All other adverse events are reported inTable 2.

Anesthesiologists and surgeons correctly identified16 of the 51 patients’ allocation. In their answers, therewere no indications of unblinding.

Table 1. Characteristics for 51 Patients Who Underwent Bariatric Surgery

IBW group(n � 17)

CBW20% group(n � 17)


Age (yr) 37 (29–56) 41 (20–57) 34 (22–49)Sex (male:female) 7:10 1:16 2:15Height (cm) 173 (166–196) 167 (156–178) 169 (160–196)Body weight (kg) 132 (100–184) 122 (89–180) 133 (100–194)Body weight in percentage of IBW 198 (150–245) 190 (164–251) 198 (161–334)Body mass index (kg/m2) 44 (34–55) 42 (36–57) 45 (38–72)Body fat in percentage 45 (35–54) 46 (38–49) 46 (32–55)Waist-hip ratio 0.98 (0.81–1.15) 0.91 (0.81–1.12) 0.87 (0.73–1.00)ASA physical status category (I:II:III) 1:15:1 0:16:1 0:17:0Type of surgery (gastric bypass:gastric banding:other)a 14:2:1 16:1:0 17:0:0Duration of surgery (min) 72 (55–128) 85 (34–117) 85 (64–108)Duration of anesthesia (min) 111 (88–155) 112 (70–151) 121 (93–145)Values are median (range).CBW � corrected body weight; IBW � ideal body weight.a Bariatric surgery could not be completed in one patient because of poor surgical conditions and intraabdominal oozing.


DISCUSSIONOur results showed that in obese patients who were

given propofol-remifentanil anesthesia, a dosingscheme for rocuronium (0.6 mg/kg) based on IBWwas preferred to other CBWs. When dosing was basedon IBW, the duration of action of rocuronium wassignificantly shorter, without compromising the con-ditions for tracheal intubation or for surgery. Themean difference in time to reappearance of T4 be-tween the IBW and CBW40% group was 12 min (95%confidence interval (CI): 6–19 min).

The primary strength of our study was the objectiveneuromuscular monitoring with blinded assessmentof quality variables performed in accordance with theGCRP guidelines.10 We studied an obese populationwith little comorbidity in a highly standardized anes-thetic and surgical setting, and the study groups werewell balanced with respect to age and body composi-tion. Furthermore, we report two useful end points,representing the time when reversal of the block canbe initiated (reappearance of T4)5 and when the pa-tient can be safely tracheally extubated (TOF ratio0.90),6 respectively. However, we used a relativelyhigh remifentanil infusion rate at induction as per ourusual clinical practice, and tracheal intubation wasonly attempted after the neuromuscular monitoringwas setup. The propofol and remifentanil would have

Figure 1. Box plot illustrating onset time (A) and time toreappearance of T4 (B) in obese patients receiving 0.6mg/kg of rocuronium according to three different weightcorrections. Median and interquartile range (box), mean(�), and range (bars). IBW � ideal body weight; CBW �corrected body weight.

Table 2. Pharmacodynamic Parameters and Adverse Events in 51 Obese Patients Given 0.6 mg/kg of Rocuronium as IntubationDose According to Three Different Dosing Algorithms

IBW group(n � 17)



Rocuronium dose (mg) 42 (5.3) 44 (5.5) 56 (8.7)Rocuronium dose (mg/kg) 0.31 (0.05) 0.36 (0.03) 0.42 (0.03)Onset time (s) 85 (66–146) 84 (62–133) 80 (48–124)Time to reappearance of T1 (min) 21 (12–36) 28 (16–52) 31 (13–50)Time to reappearance of T4 (min) 32 (18–49) 38 (25–66) 42 (24–66)Time to T1 recovery to 25% of final value (min) (n � 14 vs 15

vs 10)a28 (21–44) 35 (24–48) 38 (21–52)

Time to TOF ratio 0.90 (min) (n � 14 vs 13 vs 10)a 63 (43–107) 75 (52–115) 76 (48–105)Time to normalized TOF ratio 0.90 (min)b (n � 13 vs 11 vs 8)a 69 (50–126) 80 (56–130) 78 (53–109)Conditions for intubation (excellent:good:poor) (n � 15 vs 17

vs 17)c12:3:0 14:3:0 11:6:0

Surgical conditionsd

At surgical start 14:3:0:0 14:3:0:0 14:2:0:1During surgery 12:2:0:3 14:1:2:0 13:2:0:2

Supplementary propofol or remifentanil boluses in percentage 3 (18) 1 (6) 1 (6)Supplementary rocuronium injections 3 (18) 0 2 (12)Reversal of neuromuscular blockade 1 (6) 3 (18) 5 (29)Any adverse events in percentage 6 (35) 6 (35) 8 (47)

Peroperative hypotension or bradycardia 1 (6) 3 (18) 2 (12)Postoperative nausea or vomiting 0 2 (12) 3 (18)Postoperative pain 4 (24) 2 (12) 2 (12)Other 1 (6) 1 (6) 5 (29)

Values are mean (SD) or median (range).CBW � corrected body weight; IBW � ideal body weight; T1 � first twitch; T4 � fourth twitch; TOF � train-of-four.a Time only recorded for patients that did not receive supplementary rocuronium or reversal of the neuromuscular blockade before recovery to final TOF ratio, TOF ratio 0.90, and normalizedTOF ratio 0.90 was documented with certainty.b Normalized TOF ratio 0.90 refers to the time when TOF ratio reach 90% of the control TOF before the study drug was given.c Tracheal intubation conditions10 could not be fully evaluated in two patients, because their vocal cords were not visualized. Laryngoscopy was easy and there was no reaction to insertion ofthe tracheal tube and cuff inflation in these two patients.d Completely satisfactory: satisfactory:slightly unsatisfactory:unacceptable.One patient in the CBW40% group received supplementary rocuronium and reversal of the neuromuscular blockade.


facilitated the conditions for tracheal intubation,which were excellent in more than two-thirds of thepatients.14

The IBW group had a higher proportion of menthan the CBW20% and CBW40% groups. This could bea confounding factor, because the duration of action ofa neuromuscular blocking drug may be shorter inmales than in females.15 All measurements of bodycomposition were, however, comparable, and withinthe IBW group, time to reappearance of T4 wasmedian 31 and 37 min for female and male patients,respectively. Thus, we do not believe that this poten-tial confounder has contributed significantly to theresults of our study.

In lean patients receiving rocuronium (0.6 mg/kg)according to TBW, the time to reappearance of T1 isaround 20 min,16 and time to T1 recovery to 25% ofcontrol (duration 25%) ranged from 23 to 36 min.16–18

Our data in the IBW group approach this upper range,recognizing that duration 25% and reappearance of T4occur approximately at the same time.19

We found the 75th percentile for duration of actionin the CBW40% group to be 55 min. Accordingly,reversal of the block may not be initiated in 25% of thepatients for almost 1 h after an intubation dose ofrocuronium based on CBW40%. In contrast, the 75thpercentile for duration of action in the IBW group wasonly 37 min. This general difference may be clinicallyimportant in morbidly obese patients, and in addition,duration of action can be prolonged in individualpatients.20

Time to TOF ratio 0.90 with and without normal-ization was nearly 70 min in the IBW group, and thisis longer than that reported in lean patients, i.e., 43min after receiving 0.6 mg/kg of rocuronium accord-ing to TBW, but this was assessed using mechanomyo-graphy.18 We evaluated time to TOF ratio 0.90 only inpatients who did not receive supplementary rocuro-nium or reversal of the neuromuscular blockade be-fore TOF ratio 0.90 was documented with certainty. Itmust be acknowledged that this approach tends tounderestimate the median time to TOF ratio 0.90.

Onset time was almost the same as in previousstudies of obese patients when rocuronium was givenaccording to IBW1 but longer than in patients givenrocuronium according to TBW, in which onset timewas only 60 s.2 In lean patients, onset time is reportedto range from 80 to 120 s.16–18 We did not find anysignificant differences in onset time among the threegroups, and the mean difference between the IBW andCBW40% group was only 15 s (95% CI: �3; 33 s). Thus,considering the confidence interval, we cannot ex-clude that onset time can be reduced by approxi-mately 30 s by dosing rocuronium according toCBW40%. However, we do not consider this possibilityto be of major clinical importance in elective patients.

The conditions for tracheal intubation appearedbetter than those previously reported when rocuro-nium was administered to lean patients. Excellent

conditions were obtained only in 15%–45% of thepatients in these studies.16,21 This difference may becaused primarily by the high remifentanil infusionrate used in our study, although another study foundexcellent conditions in 25 of 30 lean patients usingalfentanil.22 The statistical power is, however, limitedin these relatively small studies, and the requiredsample size to detect a difference of 2% in the inci-dence of difficult intubation conditions would beapproximately 750 patients with 80% power.

The rocuronium dose per actual body weight was0.31 mg/kg in the IBW group and 0.42 mg/kg in theCBW40% group. It is interesting to note similaritiesbetween this and reports of the use of low-doserocuronium where good conditions for tracheal intu-bation can still be obtained, depending on the use ofadjuvant drugs and the time that tracheal intubation isattempted. For example, 0.3 mg/kg given to leanpatients resulted in optimal conditions for trachealintubation in 18 of 20 patients.23

Our data indicate that in obese patients givenrocuronium according to IBW, onset time is similar tolean patients given rocuronium according to TBW,whereas duration of action may be longer. The ob-served onset time around 80 s was clinically accept-able, and reversal of the neuromuscular blockade(reappearance of T4) was possible after a median of 32min in the IBW group.

The observed excellent conditions for tracheal intu-bation may not be generalizable to obese patients inother settings where lower doses of propofol andremifentanil are used at induction. Surgical conditionsin bariatric laparoscopy were not impeded by earlierreappearance of T4 in our study. Surgical conditionswere good and comparable among the three groups(satisfactory or completely satisfactory in 14, 15, and15 of the patients in the IBW, CBW20%, and CBW40%groups, respectively). Our findings concern bariatricsurgery and may not be generalizable to laparotomies,surgical procedures of considerably different dura-tion, settings using less remifentanil at induction, orpatients with significant hepatic or renal dysfunction.Also, special precautions are warranted in patientswith expected difficult airway.

We conclude that, in our patients undergoinggastric banding or gastric bypass under propofol-remifentanil anesthesia, the intubation dose of rocu-ronium should be calculated according to IBW. Theduration of action was shorter, and this wasachieved without a significantly prolonged onsettime or compromised conditions for tracheal intu-bation or surgery.

ACKNOWLEDGMENTSThe authors thank Susanne Schiang, Research Nurse,

Department of Anesthesia, The Juliane Marie Center, Copen-hagen University Hospital, Rigshospitalet, Copenhagen, Den-mark as well as the anesthetic and surgical staff at Hamlet


Hospital, Søborg, Denmark for their contribution to datacollection.

REFERENCES

1. Leykin Y, Pellis T, Lucca M, Lomangino G, Marzano B, Gullo A.The pharmacodynamic effects of rocuronium when dosed ac-cording to real body weight or ideal body weight in morbidlyobese patients. Anesth Analg 2004;99:1086–9

2. Puhringer FK, Khuenl-Brady KS, Mitterschiffthaler G. Rocuro-nium bromide: time-course of action in underweight, normalweight, overweight and obese patients. Eur J AnaesthesiolSuppl 1995;11:107–10

3. Adams JP, Murphy PG. Obesity in anaesthesia and intensivecare. Br J Anaesth 2000;85:91–108

4. Puhringer FK, Keller C, Kleinsasser A, Giesinger S, Benzer A.Pharmacokinetics of rocuronium bromide in obese female pa-tients. Eur J Anaesthesiol 1999;16:507–10

5. Kirkegaard H, Heier T, Caldwell JE. Efficacy of tactile-guidedreversal from cisatracurium-induced neuromuscular block.Anesthesiology 2002;96:45–50

6. Eriksson LI. The effects of residual neuromuscular blockade andvolatile anesthetics on the control of ventilation. Anesth Analg1999;89:243–51

7. Servin F, Farinotti R, Haberer JP, Desmonts JM. Propofolinfusion for maintenance of anesthesia in morbidly obese pa-tients receiving nitrous oxide. A clinical and pharmacokineticstudy. Anesthesiology 1993;78:657–65

8. Durnin JV, Womersley J. Body fat assessed from total bodydensity and its estimation from skinfold thickness: measure-ments on 481 men and women aged from 16 to 72 years. Br JNutr 1974;32:77–97

9. Viby-Mogensen J, Englbaek J, Eriksson LI, Gramstad L, JensenE, Jensen FS, Koscielniak-Nielsen Z, Skovgaard LT, OstergaardD. Good clinical research practice (GCRP) in pharmacodynamicstudies of neuromuscular blocking agents. Acta AnaesthesiolScand 1996;40:59–74

10. Fuchs-Buder T, Claudius C, Skovgaard LT, Eriksson LI, MirakhurRK, Viby-Mogensen J. Good clinical research practice in phar-macodynamic studies of neuromuscular blocking agents II: theStockholm revision. Acta Anaesthesiol Scand 2007;51:789–808

11. Claudius C, Viby-Mogensen J. Acceleromyography for use inscientific and clinical practice: a systematic review of the evi-dence. Anesthesiology 2008;108:1117–40

12. Kopman AF, Klewicka MM, Neuman GG. The relationshipbetween acceleromyographic train-of-four fade and singletwitch depression. Anesthesiology 2002;96:583–7

13. Robertson EN, Driessen JJ, Booij LH. Pharmacokinetics andpharmacodynamics of rocuronium in patients with and withoutrenal failure. Eur J Anaesthesiol 2005;22:4–10

14. Stevens JB, Wheatley L. Tracheal intubation in ambulatorysurgery patients: using remifentanil and propofol withoutmuscle relaxants. Anesth Analg 1998;86:45–9

15. Adamus M, Gabrhelik T, Marek O. Influence of gender on thecourse of neuromuscular block following a single bolus dose ofcisatracurium or rocuronium. Eur J Anaesthesiol 2008;25:589–95

16. Schultz P, Ibsen M, Ostergaard D, Skovgaard LT. Onset andduration of action of rocuronium—from tracheal intubation,through intense block to complete recovery. Acta AnaesthesiolScand 2001;45:612–7

17. Naguib M. Neuromuscular effects of rocuronium bromide andmivacurium chloride administered alone and in combination.Anesthesiology 1994;81:388–95

18. Dahaba AA, Bornemann H, Holst B, Wilfinger G, Metzler H.Comparison of a new neuromuscular transmission monitorcompressomyograph with mechanomyograph. Br J Anaesth2008;100:344–50

19. Lee CM. Train-of-4 quantitation of competitive neuromuscularblock. Anesth Analg 1975;54:649–53

20. Claudius C, Karacan H, Viby-Mogensen J. Prolonged residualparalysis after a single intubating dose of rocuronium. Br JAnaesth 2007;99:514–7

21. Combes X, Andriamifidy L, Dufresne E, Suen P, Sauvat S,Scherrer E, Feiss P, Marty J, Duvaldestin P. Comparison of twoinduction regimens using or not using muscle relaxant: impacton postoperative upper airway discomfort. Br J Anaesth2007;99:276–81

22. Kopman AF, Klewicka MM, Neuman GG. Reexamined: therecommended endotracheal intubating dose for nondepolariz-ing neuromuscular blockers of rapid onset. Anesth Analg2001;93:954–9

23. Barclay K, Eggers K, Asai T. Low-dose rocuronium improvesconditions for tracheal intubation after induction of anaesthesiawith propofol and alfentanil. Br J Anaesth 1997;78:92–4


Ketamine Inhibits Maturation of Bone Marrow-DerivedDendritic Cells and Priming of the Th1-Type Immune Response

Noriyuki Ohta, MD, PhD

Yoshifumi Ohashi, MD

Yuji Fujino, MD, PhD

BACKGROUND: Dendritic cells (DCs) play a key role as antigen-presenting cells andgrowing evidence suggests that DCs influence T-cell activation and regulate thepolarity of the immune response. Ketamine has been reported to have immuno-modulatory properties that affect immune cells, including macrophages andnatural killer cells. However, the effect of ketamine on DCs has not beencharacterized. We examined the immunomodulation of DCs by ketamine.METHODS: We used bone marrow-derived DCs induced by granulocyte–monocyte-colony stimulating factor and interleukin (IL)-4 from bone marrow and analyzedthe expression of costimulatory molecules (CD40, CD80, and CD86), majorhistocompatibility complex class II molecules, and secretion of IL-12p40. Further-more, we evaluated the immune response in mixed cell cultures of DCs and T cellsand the contact hypersensitivity response in a whole animal.RESULTS: Ketamine suppressed the expression of CD40, CD80, and major histocom-patibility complex class II molecules in DCs. DCs treated with ketamine alsosecreted less IL-12p40 and displayed greater endocytosis. In mixed cell cultureswith CD4� T cells and DCs, ketamine-treated DCs showed less propensity tostimulate the proliferation of CD4� T cells and the secretion of interferon fromCD4� T cells. Furthermore, ketamine-treated DCs impaired the induction of acell-mediated immune response.CONCLUSION: Our findings suggest that ketamine inhibits the functional maturation ofDCs and interferes with DC induction of Th1 immunity in the whole animal. Thesenovel findings provide new insight into the immunopharmacological role of ketamine.(Anesth Analg 2009;109:793–800)

The first step in the induction of an adaptive immuneresponse is when professional antigen-presenting cells(APCs) present antigen to naïve T cells. This presentationof foreign antigen involves an antigen-major histocom-patibility complex (MHC) and costimulatory signals tonaïve T cells. Macrophages, B lymphocytes, epithelialcells, and dendritic cells (DCs) can all act as APCs, butDCs are the most potent in the initial presentationthrough the MHC to naïve T cells and are responsiblefor the subsequent T cell-specific immune response. Thus,the possibility of harnessing the power of DCs has beengiven prominent attention in research immunology.1–3

In mice, DCs develop from bone marrow (BM) stemcells. Usually, DCs exist in a functionally and pheno-typically immature state and in this state, because theydo not express costimulatory molecules, they do notinduce an immune response. Immature DCs begin tomature when they capture and process antigens in

peripheral tissues. Maturing DCs stimulate naïve Tcells through signaling both by Ag peptides, presentedby MHC molecules, and by costimulatory molecules. DCmaturation is accompanied by decreased Ag uptake,high levels of MHC class II and costimulatory moleculeexpression, and production of interleukin (IL)-12 onstimulation.1,3

Anesthetics and sedatives play an essential role inthe stable and safe control of critically ill patients.Furthermore, ketamine has been often used as ananesthetic for patients who are hemodynamically un-stable due, for example, to sepsis or cardiac surgery.Consequently, the effects of various anesthetics onimmunity have been extensively reported. Althoughmacrophages, lymphocytes, and natural killer cellshave been investigated, little attention has been paidto the effects of anesthetics and sedatives on DCs.Among many anesthetics, ketamine is an anestheticthat affects the immunoregulatory activities on mac-rophages,4,5 neutrophils,6 mast cells,7 and whole bloodcells.8,9 Even so, we could find no report about howanesthetics affect DCs, the most potent of the APCs.

In this initial study, we designed experiments toillustrate the effects of ketamine on some of thefunctions of DCs. We found that ketamine inhibits thematuration of BM-derived DCs (BMDCs) and further-more, impedes the ability of DCs to prime a Th1-biased immune response.

From the Intensive Care Unit, Osaka University Hospital, Osaka,Japan.

Accepted for publication March 30, 2009.Please see supplementary material available at www.anesthesia-

analgesia.org.Address correspondence and reprint requests to Noriyuki Ohta,

MD, PhD, 2-15 Yamadaoka, Suita, Osaka, Japan. Address e-mail [email protected].



METHODSAnimals

To provide cell samples, female 4–6-week-oldBALB/c and C57BL/6 mice were purchased fromJapan CLEA (Tokyo, Japan). They were housed withfree access to chow and water in the specific pathogen-free central animal facility of Osaka University Medi-cal School. All experimental protocols in this studywere reviewed and approved by the Institutional Ani-mal Care and Use Committee and performed accordingto the National Institutes of Health guidelines.

Reagents and AntibodiesRecombinant mouse (rm) granulocyte–monocyte-

colony stimulating factor and rmIL-4 were purchasedfrom R&D Systems (Minneapolis, MN). Fluorescein-conjugated dextran (40,000 molecular mass) (fluoresceinisothiocyanate (FITC)-dextran) and lipolysaccharide(LPS) (from Escherichia coli 055:B5) were obtained fromSigma-Aldrich (St Louis, MO). FITC- or phycoerythrin(PE)-conjugated monoclonal antibodies (mAbs) wereused to detect the expression of CD11c (HL3), MHCantigen class II (I-Ad) (M5/114.15.2), CD40 (3/23), CD80(16-10A1), and CD86 (GL1) were purchased from BDPharmingen (San Diego, CA). For intracellular cytokinedetection, we used mAbs for IL-4 and interferon (IFN)(11B11 and XMG1.2: BD Pharmingen).

Isolation and Culture of DCDCs were generated from murine BM cells using

a previously described method with minor modifi-cations.10,11 Briefly, BM was flushed from the tibiaeand femurs of Balb/C mice and then depleted of redblood cells with ammonium chloride. BM cells weresuspended in complete media (CM: RPMI-1640supplemented with 10% fetal bovine serum, 2 mMl-glutamine, 100 U/mL penicillin, and 100 mg/mLstreptomycin). Cells for each mouse were plated totwo 10-cm plates and cultured for 7 days in thepresence of 20 ng/mL rm granulocyte–monocytecolony-stimulating factor and rmIL-4 at 37°C in 5%CO2. On Day 7, nonadherent cells and loosely adher-ent proliferating DCs were harvested and purified on14.5% Accudenz (Accurate Chemicals, Westbury, NJ)density gradients by centrifugation at 600g for 20 minat room temperature. Purified DCs were cultured for40 h in the absence and presence of ketamine inconcentrations of 0 to 100 �M.

The viability of cultured cells was assessed by thetrypan-blue exclusion test. Cell viability of more than90% was observed in all experiments in the study.

Flow Cytometric Analysis of Surface MoleculesThe expression of surface molecules on DCs was

analyzed under flow cytometry. At each step of thestaining, to block nonspecific binding of antibodies,1–2 � 105 cells were incubated for 15 min on ice instaining buffer containing anti-CD16/CD32 mAb.Cells were stained with specific antibodies. After mAb

staining, 2% propidium iodide (PI) was applied tostain dead cells and the samples were analyzed usingFACSCalibur and CellQuest software (BD Biosciences,Franklin Lakes, NJ). We used FITC or PE-labeled mono-clonal Abs to stain for MHC class, CD40, CD80, CD86,and CD11c. Dead cells were flow-cytometorically gatedout by staining with PI and only live cells were pheno-typically assessed.

Interleukin-12 p40 Enzyme-linked Immunosorbent AssayDCs were cultured in the presence or absence of

ketamine for 40 h followed by stimulation with LPS(10 ng/mL) for 12 h. Following the manufacturer’sinstructions, we analyzed culture supernatants usingIL-12 p40 enzyme-linked immunosorbent assay kits(R&D Systems, Minneapolis, MN).

Intracellular Cytokine AssayFor intracellular cytokine assay, T cells were re-

stimulated with ionomycin and phorbol myristateacetate in the presence of GolgiStop (BD Pharmingen).Following the maker’s instructions, intracellular cyto-kines were detected using standard Cytofix/Cytopermkits (BD Biosciences). We used PE-labeled monoclonalAbs to stain IL-4 and IFN- and FITC-labeled mAb forstaining CD4.

Annexin V and Propidium Iodide Binding AssayFor analysis of DC apoptosis, using a FACSCalibur

and CellQuest software (BD Biosciences), 1 � 105 cellswere stained with FITC-labeled anti-CD11c mAb, washedin phosphate-buffered saline, and stained with PI andallophycocyanin-labeled Annexin V (BD Pharmingen).

Quantitation of Ag UptakeAs described by Sallusto et al.,12 endocytosis was

quantitated. In brief, 2 � 105 cells were equilibrated at37°C or 4°C for 10 min and then pulsed with FITC-dextran (Sigma-Aldrich) at a concentration of 1 mg/mL.Cold staining buffer was added to stop the reaction.The cells were washed three times and stained withPE-conjugated anti-CD11c Abs and then analyzedusing a FACSCalibur. Nonspecific binding of FITC-dextran to DCs was assessed by evaluating FITC-dextran uptake at 4°C. Mean fluorescence intensity at37°C minus mean fluorescence intensity at 4°C wasused as the measure of antigen uptake.

Allogeneic Mixed Cell Culture ReactionTo enrich CD3� T cells in the sample, splenocytes,

isolated from female 5–8-week-old C57BL/6 mice(haplotype: I–Ab), were purified in a magnetic cellsorting and separation of biomolecules (MACS) col-umn (Miltenyi Biotec, Bergisch Gladbach, Germany).DCs induced from Balb/C mice (haplotype: I–Ad)were incubated in the presence or absence of ket-amine. Subsequently, DCs were stimulated by LPS (20ng/mL) for 12 h and treated with mitomycin C (50�g/mL). Enriched CD3� T cells were cocultured withmitomycin C-treated DCs. In 96-well round-bottom

794 Inhibitory Effect of Ketamine on Dendritic Cell Function ANESTHESIA & ANALGESIA

plates, these mixed samples were cultured for 4 daysin RPMI 1640 supplemented with 10% fetal bovineserum at 37°C in 5% CO2 in air. Cell proliferation wasestimated based on uptake of [3H]-thymidine. For thispurpose, the cells were pulsed with [3H]-thymidinefor the final 18 h of mixed cell culture. Radioactivitywas then measured using a liquid scintillation counter(PerkinElmer, Waltham, MA). Intracellular cytokines weredetected using standard Cytofix/Cytoperm kits followingthe manufacturer’s instructions (BD Bioscience).

Establishing Contact Hypersensitivity by AdoptiveTransfer of DCs

DCs were prepared as described earlier. After beingcultured in the presence or absence of ketamine, 5 �105 DCs (in 100 �L of saline) were pulsed with 100�g/mL 2,4-dinitrobenzene sulfonic acid (DNBS) andinjected subcutaneously on Day 0. After 5 days, micewere challenged by the application on both sidesof the right ear of 10 �L of 0.2% 2,4-dinitro-1-fluorobenzene (DNFB) in 4:1 acetone/olive oil solu-tion. Negative control animals were injected with only100 �L of saline at the time of initial immunizationand exposed to DNFB 5 days later. After 24 h, using anengineer’s spring-loaded micrometer (Mitsutoyo, Ka-wasaki, Japan), we measured the right (challenged)and the left (unchallenged) ear thickness. The increasein the ear thickness was evaluated by simple subtrac-tion: thickness of the right (challenged) ear—thicknessof the left (unchallenged) ear.

StatisticsData for samples were compared using the Stu-

dent’s t-test. When P � 0.05 the difference was con-sidered statistically significant. All statistical analysiswas performed using JMP software (SAS Institute,Cary, NC).

RESULTSKetamine Inhibits Maturation of Murine DCs

To examine whether ketamine influences the matu-ration of DCs, we cultured immature DCs inducedafter 7 days of culture for another 40 h in the presenceor absence of different concentrations of ketamine.The expression of surface molecules (CD11c, MHCclass II) on DCs was assessed using flow cytometry.As DC maturation progressed, we observed a higherpresence of MHC class II molecules. Figure 1 showsCD11c cell populations. Ketamine had no effect on thenumbers of BM cells found in the wells of culturedishes after BM cells were cultured in the presence orabsence of ketamine in various concentrations of up to200 �M (data not shown). Similarly, DCs cultured inthe presence or absence of ketamine, at least in con-centrations of up to 100 �M, showed no statisticallysignificant differences in the total number of CD11c�

DCs including mature MHC class IIhigh and imma-ture MHC class IIlo DCs (Fig. 1A). To further excludethe possibility that ketamine has a toxic action on

cultured DCs, using an Annexin V-PI binding assay,we assessed the effect of ketamine, in concentrationsof up to 100 �M, on apoptosis (Fig. 1B and C). Ourfindings showed that ketamine has no harmful effect onDCs in concentrations of up to 100 �M. In subsequentprotocols, we used ketamine in concentrations of 40 �M.

We ascertained that the total number of CD11c�

DCs, including mature MHC class IIhigh and immatureMHC class IIlo DCs, was not affected by exposure toketamine in concentrations of up to 100 �M. Asimmature DCs matured, we observed higher expres-sion of MHC class II, CD40, CD80, and CD86 mol-ecules. We found that ketamine specifically decreasedthe number of MHC class IIhigh DCs. Figure 2 showsdata for the expression of MHC class II, CD40, CD80,and CD86. The expression of CD40 and CD80 mol-ecules, important for costimulating T-cell activation,was also suppressed when ketamine was present. Thisfinding indicates that the phenotypic maturation of

Figure 1. Effect of ketamine on CD11c� DC. In concentra-tions of up to 100 �M, ketamine has no influence and nocytotoxicity on CD11c� DC. DCs were generated as de-scribed in Methods section (without or in the indicatedconcentration of ketamine) and analyzed at Day 9 by flowcytometry. DCs were stained for CD11c (A), and Annexin Vand PI (B and C). A single typical result of Annexin V and PIstaining is shown from samples for each set of three indepen-dent experiments. The percentage within each histogram rep-resents the incidence of CD11c� cells (A) and Annexin-V�PI�

cells (C). The cytotoxic effect of ketamine was evaluatedfrom the fraction of necrotic cells that were detected asAnnexinV�PI� cells. Results are means � sds (n � 6). DC �dendritic cell; PI � propidium iodide.


DCs is at least partially retarded by the presence ofketamine. Conversely, no differences in the expression ofCD86 molecules were detected between samples thathad been exposed to ketamine and control samples.

Ketamine Inhibits Secretion of Interleukin-12 p40 from DCMature DCs are important for the synthesis and

secretion of cytokines that affect T-cell differentiationand are largely responsible for the quality of immuneresponse. DCs produce proinflammatory cytokines:IL-12 production is a particular marker of DC matura-tion and can be used as method of selecting the Th1-dominant adjuvant. Here, we tested the expression ofIL-12p40 from LPS-stimulated DCs. As Figure 3A shows,ketamine inhibited the secretion of IL-12p40.

Ketamine Induces Immature State DCs with HighEndocytotic Capacity

Evaluation of the expression of surface moleculesand IL-12p40 secretions indicated that exposure toketamine significantly suppressed the phenotypic andfunctional maturation of DC generated in vitro. Theseresults did not exclude the possibility that ketamine

might, however, cause a general inhibition of DCfunctions. Consequently, we assessed whether expo-sure of DCs to ketamine alters the ability of DCs tocapture Ag through the uptake of FITC-conjugateddextran. As Figure 3B shows, after 40 h exposure toketamine, DCs displayed increased endocytotic capac-ity for FITC-dextran. All our findings, including theexpression of surface molecules and IL-12p40 andendocytotic activity, strongly suggest that ketamineprevents the maturation of DCs.

Ketamine inhibits the ability of DCs to stimulateT-cell proliferation and to prime the Th1-type immuneresponse in allogeneic mixed cell culture reaction.

To clarify the relevance to immune responses ofthe ketamine-mediated alteration of DC functions thatwe had so far observed, we analyzed the effect ofketamine on the mixed cell culture reaction of lympho-cytes and DCs. Using samples derived from Balb/Cmice (haplotype: I–Ad), DCs that had been incubated in

Figure 2. Effect of ketamine on expression of costimulatorymolecules on DCs. Ketamine suppresses DC maturation.DCs were treated with ketamine (40 �M). A, Flow cytometrywas used to assess the expression rate for CD40, CD80,CD86, and major histocompatibility complex (MHC) class IImolecules in CD11c-gated cells. Ketamine inhibits the ex-pression on DCs of CD40, CD80, and MHC class II mol-ecules. B, Representative histogram of the expression of eachsurface molecule on DC. The number in each histogramshows the percentage of DCs (CD11c� cells) expressinghighly each molecule. Results are means � sds (n � 4).DC � dendritic cell.

Figure 3. Effect of ketamine on production of interleukin-12p40 from DCs (A) and on endocytotic activity of DCs (B).Ketamine inhibits the production of interleukin-12 p40 (IL-12p40) from DCs. A, DCs were treated with ketamine (40�M) for 40 h and thereafter exposed to 10 ng/mL oflipopolysaccharide (LPS) for 12 h. The expression of IL-12p40 was measured by cytokine-specific ELISA in culturesupernatant. B, Ketamine-treated DCs exhibit enhancedendocytotic capacity. DCs were generated as described inMethods section and harvested on Day 7. FITC-dextran wasanalyzed on CD11c-PE–positive cells by flow cytometry. Theuptake of FITC-dextran is shown as the product of meanfluorescence intensity (MFI) at 37°C minus MFI at 4°C.Results are means � sds (n � 6). DC � dendritic cell; PE �phycoerythrin; FITC � fluorescein isothiocyanate; ELISA �enzyme-linked immunosorbent assay.


the presence or absence of ketamine were tested for theircapacity to stimulate allogeneic T cells derived fromC57BL/6 (haplotype: I–Ab). From Day 7 cultures thathad been incubated with ketamine for 40 h, DC sampleswere tested for their capacity to stimulate allogeneic T cells.

Although coculture with LPS-stimulated DCs effec-tively enhanced proliferative responses, when LPS-stimulated DCs were pretreated with ketamine, therewas less [3H] uptake by allogeneic T cells (Fig. 4A).Another determinant of DCs potency is how well theyare able to adhere to T cells to form clusters (Fig. 4B).Compared with control cells, we found that ketamine-treated DCs formed fewer clusters on T cells.

We also evaluated the effects on IFN- and IL-4synthesis when CD4� T cells were cocultured withketamine-treated DCs. Intracellular cytokine analysisrevealed a lower density of IFN-producing CD4� cellsin cocultures that contained ketamine-treated BMDCs

(Fig. 5). No differences in the secretion of IL-4 weredetected in ketamine-treated and control DC samples.

Ketamine-Treated DCs Fail to Elicit ContactHypersensitivity Response

Contact hypersensitivity (CHS) is a typical cell-mediated immune response that is induced mainly byTh1-type T cells. CHS is originally induced by epicu-taneous immunization and subsequent challenge withhaptens, such as DNFB. CHS can be also induced by asingle subcutaneous injection at Day 0 of 5 � 105 DCsthat have been pulsed with DNBS (the water-solublederivative of DNFB) and subsequent epicutaneouschallenge with DNFB at Day 5.13,14 We used thismodel to assess the in vivo effect of ketamine on DCs andDC-mediated Th1-type immune response in the wholeanimal. Immunization with ketamine-treated DCs elic-ited less CHS response than immunization withphosphate-buffered saline-treated DCs (Fig. 6).

DISCUSSIONAs far as we know, this is the first report detailing

the effects of ketamine on the phenotypic and func-tional properties of murine DCs. As such, it is also the

Figure 4. In the presence and absence of ketamine: in vitrodendritic cell (DC)-induced proliferation of allogeneic T cellsand Th1 response. Ketamine impeded the proliferation ofallogeneic T cells and Th1 response. DCs were incubatedwith and without ketamine (40 �M) for 48 h with theadministration of lipolysaccharide (LPS) for final 12 h. TheDCs were washed and cocultured with T cells derived fromBalb/C mice as described in Methods section. A, Mixed cellculture was performed for 4 days. For the final 18 h of mixedcell culture, [3H]-TdR was added to the culture. Cell prolif-eration was estimated based on uptake of [3H] thymidine,which was pulsed during the final 18 h of culture. Theradioactivity of the harvested cells was measured using aliquid scintillation counter (PerkinElmer). B, After 64 h ofmixed cell culture, clustering was counted under micro-scopic analysis. Results are means � sds (n � 6).

Figure 5. Ketamine inhibits the production of interferon(IFN) from CD4� T cells stimulated by allogeneic dendriticcell (DC) culture in the presence or absence of ketamine. Inthe presence or absence of ketamine: production of IFN-�from CD4� T cells stimulated by allogeneic DC culture.Ketamine inhibited the production of IFN-�. Mixed cell culturewas performed with bone marrow-derived DCs (BMDCs)from Balb/C mice (I–Ad) and CD3� T cells from C57BL/6 mice(I–Ab) for 4 days. At Day 4, T cells were harvested andrestimulated with ionomycin and phorbol myristate acetate(PMA) in the presence of GolgiStop (BD Pharmingen). Theproduction of IFN-� and interleukin (IL)-4 from CD4� T cellswas assessed by flow cytometry with intracellular staining ofcytokine using Cytofix/Cytoperm kits (BD Pharmingen).Single, typical results are shown from each set of three inde-pendent experiments. Results are means � sds (n � 6).


first study to show that the presence of ketamine incultures makes DCs less able to elicit T-cell Th1-typeimmune response.

Several previous studies have reported that ket-amine affects various types of immune cells, includingmacrophages.4–9 Although these studies mentionedthe direct effects of ketamine on particular types ofcells, they did not investigate the effect of ketamine onimmune responses that arise from the interaction ofdifferent immune cells.

During functional maturation, DCs show increasedexpression of MHC and costimulatory molecules(CD40, CD80, CD86, etc), increased IL-12-secretingactivity, and reduced endocytosis of antigens.1–3 Inthis study, the DC phenotype changes induced byketamine included reduced expression of MHC classII and costimulatory molecules, less secretion of IL-12,and increased capacity to internalize antigens. Theseresults suggest that ketamine suppresses the func-tional maturation of DCs. As they mature, DCsbecome increasingly able to stimulate T cells to pro-liferate and differentiate into effector T cells. We foundthat DCs matured by LPS acquired the ability tostimulate the proliferation of allogeneic T cells. Incontrast, LPS-stimulated DCs treated with ketaminedid not manifest the same ability. This reversal sug-gests that ketamine affects the ability of DCs to elicitT-cell response.

There is accumulating evidence that the cytokineproduction of DCs depends on DC subsets or onstimuli received by DCs.15 IL-12 has multiple immu-noregulatory functions, including the activation of the

Th1 T-cell subset, which plays a pivotal role in theinduction of inflammation and host-defense response.Many lines of evidence indicate that the developmentof the Th1-type immune response is regulated byDC-derived IL-12.16–18 Our current finding that ket-amine inhibits DC production of IL-12 suggests thatketamine strongly affects the differentiation of T cells.In fact, culturing CD4� T cells with ketamine-treatedDCs suppressed the differentiation of CD4� T cellsinto IFN-producing Th1 T cells. Conversely, culturingCD4� T cells with ketamine-treated DCs did notinduce the differentiation of IL-4–producing Th2 Tcells. Overall, our data demonstrate that ketamineaffects, at least in part, the ability of DCs to tilt theimmune response toward an increased Th1 respo-nse rather than Th2 response. With practical develop-ment in the prospect of inducing Th1 responses, suchas ex vivo manipulation of DCs for cell transfer,19–21

our findings indicate a candidate means of counter-regulatory DC therapy. Conversely, the effect of ket-amine on DCs and the Th1-type immune responsesuggest immunosuppression by ketamine, which pos-sibly compromises the crucial initial protective Th1-type immune response against invading pathogens.

Several studies of postoperative patients have re-ported that ketamine suppresses the immune re-sponse.22–24 It seems that just a single preoperativeadministration of ketamine (0.15 mg/kg) is enough toattenuate the production of proinflammatory cyto-kines from peripheral blood mononuclear cells andthe proliferative response of mononuclear cells.23

Meanwhile, the impairment of IL-12 production frommonocytes is reported to be a predictor of lethaloutcome in postoperative sepsis.25,26 Moreover, a ratmodel of tumor metastasis has shown that ketaminepromotes tumor metastasis.27 We suggest that, in viewof the central role of DCs in the induction and regu-lation of the immune response,1–3 the suppressiveeffects of ketamine on various immune responsesobserved in these several reports can be mediated bythe effect of ketamine on DCs.22–24,27 Thus, in certainclinical settings, the immunosuppressive action ofketamine on the functions of DCs, including thesuppression of IL-12 production may increase risk, socautious use of ketamine is advised.

For anesthesia in which ketamine is used as themain anesthetic reagent for major surgery, it has beenreported that the plasma concentration of ketamine isabout 3 �g/mL.28,29 Furthermore, when administratedin combination with midazolam for sedation in emer-gency trauma care, the concentration of ketamine hasbeen reported to be 2.6 � 2.2 �g/mL.30 For pharma-cological research, the concentration of ketamine usedin our in vitro experiment (40 �M � 10.9 �g/mL) wastwo to three times the reported concentration ofketamine in anesthesia or sedation. For an in vitroexperiment, the different concentration of ketaminewas reasonable. Two studies found that the adminis-tration of a single small dose of ketamine (0.15–0.50

Figure 6. Ketamine inhibits Th1-type immune responsein DC-transfer model of contact hypersensitivity (CHS).Ketamine-treated DCs fail to induce a normal cell-mediatedimmune response. As described in Methods section, afterbeing cultured in the presence or absence of ketamine, 5 �105 DCs were pulsed with 100 �g/mL DNBS and injectedsubcutaneously on Day 0. After 5 days, mice were chal-lenged by the application on both sides of the right ear of 10�L 0.2% DNFB in 4:1 acetone/olive oil solution. Right(challenged) and left (unchallenged) ear thicknesses weremeasured after 24 h and the results are shown as simplesubtraction. Results are means � sds (n � 6). DC � dendriticcell; DNBS � 2,4-dinitrobenzene sulfonic acid; DNFB �2,4-dinitro-1-fluorobenzene.


mg/kg) in patients undergoing cardiac surgery withcardiopulmonary bypass (CPB)22 or major abdominalsurgery23 reduced postoperative cytokine secretion,such as IL-6 and tumor necrosis factor-�. Just one doseof ketamine resulted in a plasma concentration of 400ng/mL. In in vivo settings, such as postoperativeperiods after major abdominal surgery or cardiacsurgery on CPB in these studies, immunomodulatoryactivities induced by major surgery or the use of CPBcould have a synergistic immunosuppressive effect onimmune response together with ketamine. Thus, ket-amine may have effects at lower concentrations thanin an in vitro study.

Other commentators have suggested that ketaminemight have nonspecific inhibitory effects.31 One reportsuggested that the use of ketamine in high concentra-tions could be nonspecifically cytostatic to variousbiological activities, and the authors cautioned aboutthe use of high concentrations in in vitro experiments.To clarify the situation, by demonstrating that theexpression of CD86 was not altered in the presence ofketamine, we confirmed that ketamine did not gener-ally suppress all DC functions. We further investi-gated the capacity of DCs to internalize FITC-dextran.Our assay showed that, far from being suppressed,endocytosis had increased. These findings exclude thepossibility that the action of ketamine is generally andnonspecifically suppressive. The specific actions aredistinctively characteristic of immature DCs.6 Further-more, through the use of Annexin V and PI staining,we confirmed that ketamine in the range of the concen-tration used in this experiment was not cytotoxic.

Based on our in vitro observations, we conjecturethat treatment with ketamine may impair the ability ofDCs to initiate a cell-mediated immune response. Ithas been shown that, in recipient mice transferredwith DNBS-DCs, 5 � 105 DNBS-pulsed DCs (DNBS-DC) could induce strong CHS.13,14 We checked theability of DCs to induce the T-cell–mediated immuneresponse by sensitizing recipient mice for CHS toDNBS-DCs. Subcutaneous immunization with 5 � 105

DNBS-DC made the mice susceptible to CHS, butwhen similarly exposed to DNBS-DCs pretreated withketamine they showed no hypersensitivity. This resultis evidence that ketamine suppresses the DC-mediatedinduction of the Th1-type immune response in thewhole animal. Furthermore, these results show thatthe impaired ability of ketamine-pretreated DCs tostimulate the T-cell response cannot be reversed invivo after withdrawal of ketamine.

Mostly based on in vitro experiments, it is question-able how far the findings of the current study arerelevant to the in vivo conditions found in wholeanimals. The BMDC culture system used in most ofthe experiments reported here has, however, beenwidely used as an established means for investigatingthe effects of various agents on DCs.10,11 Furthermore,to assess whether the effect of ketamine found in invitro experiments can be extrapolated into in vivo

conditions, we showed the suppressive effect of ket-amine on the DC-induced immune response in a wholeanimal by the use of adoptive transfer model of CHS.Although we treated DCs with ketamine for 40 h andassessed the change of phenotype, we also assessed theeffect of ketamine on DCs for shorter periods of expo-sure, including 10 h, which more closely matches ket-amine administration in clinical applications, such asanesthesia. The results after 10 h incubation with ket-amine show the same tendencies as results after 40 hincubation (Supplementary Figure). The findings ob-tained by this system are generally assumed to closelyresemble what happens in whole animals.

In conclusion, we have characterized a variety ofeffects exerted by ketamine on DCs. Resulting in asignificant inhibition of Th1 development, ketamine in-hibited phenotypic maturation and modulated cytokineproduction in these murine DCs. Exposure to ketaminemay provide a nontoxic means of modulating of theimmunostimulatory capacity of DCs. During sedationand analgesia in critical care, the use of ketamine cansuppress the DC-mediated immune response.

REFERENCES

1. Ueno H, Klechevsky E, Morita R Aspord C, Cao T, Matsui T,Di Pucchio T, Connolly J, Fay JW, Pascual V, Palucka AK,Banchereau J. Dendritic cell subsets in health and disease.Immunol Rev 2007;219:118–42

2. Steinman RM, Banchereau J. Taking dendritic cells into medi-cine. Nature 2007;449:419–26

Supplemental Figure. Effect of duration of dendritic cell (DC)exposure to ketamine on expression of costimulatory mol-ecules. Ketamine suppresses DC maturation. DCs weretreated with ketamine (40 �M) for indicated duration (10 hrand 40 hr). A-D, flow cytometry was used to assess theexpression rate for CD80 and CD86 in CD11c gated cells.Results are means � sds (n � 4) DC, dendritic cell.


3. Banchereau J, Steinman RM. Dendritic cells and the control ofimmunity. Nature 1998;392:245–52

4. Li CY, Chou TC, Wong CS, Ho ST, Wu CC, Yen MH, Ding YA.Ketamine inhibits nitric oxide synthase in lipopolysaccharide-treated rat alveolar macrophages. Can J Anaesth 1997;44:989–95

5. Shimaoka M, Iida T, Ohara A, Taenaka N, Mashimo T, Honda T,Yoshiya I. Ketamine inhibits nitric oxide production in mouse-activated macrophage-like cells. Br J Anaesth 1996;77:238–42

6. Nishina K, Akamatsu H, Mikawa K, Shiga M, Maekawa N,Obara H, Niwa Y. The inhibitory effects of thiopental, midazo-lam, and ketamine on human neutrophil functions. AnesthAnalg 1998;86:159–65

7. Fujimoto T, Nishiyama T, Hanaoka K. Inhibitory effects ofintravenous anesthetics on mast cell function. Anesth Analg2005;101:1054–9

8. Kawasaki C, Kawasaki T, Ogata M, Nandate K, Shigematsu A.Ketamine isomers suppress superantigen-induced proinflam-matory cytokine production in human whole blood. Can JAnaesth 2001;48:819–23

9. Kawasaki T, Ogata M, Kawasaki C, Ogata J, Inoue Y, ShigematsuA. Ketamine suppresses proinflammatory cytokine production inhuman whole blood in vitro. Anesth Analg 1999;89:665–9

10. Son YI, Egawa S, Tatsumi T, Redlinger RE Jr, Kalinski P, KantoT. A novel bulk-culture method for generating mature dendriticcells from mouse bone marrow cells. J Immunol Methods2002;262:145–57

11. Lutz MB, Kukutsch N, Ogilvie AL, Rossner S, Koch F, RomaniN, Schuler G. An advanced culture method for generating largequantities of highly pure dendritic cells from mouse bonemarrow. J Immunol Methods 1999;223:77–92

12. Sallusto F, Cella M, Danieli C, Lanzavecchia A. Dendritic cellsuse macropinocytosis and the mannose receptor to concentratemacromolecules in the major histocompatibility complex class IIcompartment: downregulation by cytokines and bacterial prod-ucts. J Exp Med 1995;182:389–400

13. Krasteva M, Kehren J, Horand F, Akiba H, Choquet G,Ducluzeau MT, Tedone R, Garrigue JL, Kaiserlian D, Nicolas JF.Dual role of dendritic cells in the induction and down-regulation of antigen-specific cutaneous inflammation. J Immu-nol 1998;160:1181–90

14. Lappin MB, Weiss JM, Delattre V, Mai B, Dittmar H, Maier C,Manke K, Grabbe S, Martin S, Simon JC. Analysis of mousedendritic cell migration in vivo upon subcutaneous and intra-venous injection. Immunology 1999;98:181–8

15. Kadowaki N, Ho S, Antonenko S, Malefyt RW, Kastelein RA,Bazan F, Liu YJ. Subsets of human dendritic cell precursorsexpress different toll-like receptors and respond to differentmicrobial antigens. J Exp Med 2001;194:863–9

16. Heufler C, Koch F, Stanzl U, Topar G, Wysocka M, Trinchieri G,Enk A, Steinman RM, Romani N, Schuler G. Interleukin-12 isproduced by dendritic cells and mediates T helper 1 develop-ment as well as interferon-gamma production by T helper 1cells. Eur J Immunol 1996;26:659–68

17. Macatonia SE, Hosken NA, Litton M, Vieira P, Hsieh CS,Culpepper JA, Wysocka M, Trinchieri G, Murphy KM,O’Garra A. Dendritic cells produce IL-12 and direct thedevelopment of Th1 cells from naive CD4� T cells. J Immu-nol 1995;154:5071–9

18. Reis e Sousa C, Hieny S, Scharton-Kersten T, Jankovic D,Charest H, Germain RN, Sher A. In vivo microbial stimulationinduces rapid CD40 ligand-independent production of interleu-kin 12 by dendritic cells and their redistribution to T cell areas.J Exp Med 1997;186:1819–29

19. Kanto T, Hayashi N, Takehara T, Tatsumi T, Kuzushita N, Ito A,Sasaki Y, Kasahara A, Hori M. Impaired allostimulatory capac-ity of peripheral blood dendritic cells recovered from hepatitis Cvirus-infected individuals. J Immunol 1999;162:5584–91

20. Tatsumi T, Huang J, Gooding WE, Gambotto A, Robbins PD,Vujanovic NL, Alber SM, Watkins SC, Okada H, Storkus WJ.Intratumoral delivery of dendritic cells engineered to secreteboth interleukin (IL)-12 and IL-18 effectively treats local anddistant disease in association with broadly reactive Tc1-typeimmunity. Cancer Res 2003;63:6378–86

21. Tatsumi T, Takehara T, Kanto T, Miyagi T, Kuzushita N,Sugimoto Y, Jinushi M, Kasahara A, Sasaki Y, Hori M, Hayashi N.Administration of interleukin-12 enhances the therapeutic effi-cacy of dendritic cell-based tumor vaccines in mouse hepatocel-lular carcinoma. Cancer Res 2001;61:7563–7

22. Bartoc C, Frumento RJ, Jalbout M, Bennett-Guerrero E, Du E,Nishanian E. A randomized, double-blind, placebo-controlledstudy assessing the anti-inflammatory effects of ketamine in car-diac surgical patients. J Cardiothorac Vasc Anesth 2006;20:217–22

23. Beilin B, Rusabrov Y, Shapira Y, Roytblat L, Greemberg L,Yardeni IZ, Bessler H. Low-dose ketamine affects immuneresponses in humans during the early postoperative period.Br J Anaesth 2007;99:522–7

24. Zeyneloglu P, Donmez A, Bilezikci B, Mercan S. Effects ofketamine on serum and tracheobronchial aspirate interleukin-6levels in infants undergoing cardiac surgery. J CardiothoracVasc Anesth 2005;19:329–33

25. Novotny AR, Emmanuel K, Ulm K, Bartels H, Siewert JR,Weighardt H, Holzmann B. Blood interleukin 12 as preoperativepredictor of fatal postoperative sepsis after neoadjuvant radio-chemotherapy. Br J Surg 2006;93:1283–9

26. Weighardt H, Heidecke CD, Westerholt A, Emmanuilidis K,Maier S, Veit M, Gerauer K, Matevossian E, Ulm K, Siewert JR,Holzmann B. Impaired monocyte IL-12 production before sur-gery as a predictive factor for the lethal outcome of postopera-tive sepsis. Ann Surg 2002;235:560–7

27. Melamed R, Bar-Yosef S, Shakhar G, Shakhar K, Ben-Eliyahu S.Suppression of natural killer cell activity and promotion oftumor metastasis by ketamine, thiopental, and halothane, butnot by propofol: mediating mechanisms and prophylactic mea-sures. Anesth Analg 2003;97:1331–9

28. Dallimore D, Anderson BJ, Short TG, Herd DW. Ketamineanesthesia in children—exploring infusion regimens. PaediatrAnaesth 2008;18:708–14

29. Atallah MM, el-Mohayman HA, el-Metwally RE. Ketamine-midazolam total intravenous anaesthesia for prolonged ab-dominal surgery. Eur J Anaesthesiol 2001;18:29–35

30. Bourgoin A, Albanese J, Leone M, Sampol-Manos E, Viviand X,Martin C. Effects of sufentanil or ketamine administered intarget-controlled infusion on the cerebral hemodynamics ofseverely brain-injured patients. Crit Care Med 2005;33:1109–13

31. Lewis E, Rogachev B, Shaked G, Douvdevani A. The in vitroeffects of ketamine at large concentrations can be attributed to anonspecific cytostatic effect. Anesth Analg 2001;92:927–9


Increasing the Duration of Isoflurane AnesthesiaDecreases the Minimum Alveolar AnestheticConcentration in 7-Day-Old but Not in 60-Day-Old Rats

Greg Stratmann, MD, PhD

Jeffrey W. Sall, MD, PhD

Edmond I Eger, II, MD

Michael J. Laster, DVM

Joseph S. Bell, BA

Laura D. V. May, MA

Helge Eilers, MD

Martin Krause, MD

Frank v. d. Heusen, MD

Heidi E. Gonzalez

BACKGROUND: While studying neurotoxicity in rats, we observed that the anestheticminimum alveolar anesthetic concentration (MAC) of isoflurane decreases withincreasing duration of anesthesia in 7-day-old but not in 60-day-old rats. After 15min of anesthesia in 7-day-old rats, MAC was 3.5% compared with 1.3% at 4 h. Weinvestigated whether kinetic or dynamic factors mediated this decrease.METHODS: In 7-day-old rats, we measured inspired and cerebral partial pressures ofisoflurane at MAC as a function of duration of anesthesia. In 60-day-old rats, wemeasured inspired partial pressures of isoflurane at MAC as a function of durationof anesthesia. Finally, we determined the effect of administering 1 mg/kg naloxoneand of delaying the initiation of the MAC determination (pinching the tail) on MACin 7-day-old rats.RESULTS: In 7-day-old rats, both inspired and cerebral measures of MAC decreasedfrom 1 to 4 h. The inspired MAC decreased 56%, whereas the cerebral MACdecreased 33%. At 4 h, the inspired MAC approximated the cerebral MAC (i.e., thepartial pressures did not differ appreciably). Neither administration of 1 mg/kgnaloxone nor delaying tail clamping until 3 h reversed the decrease in MAC. In60-day-old rats, inspired MAC of isoflurane was stable from 1 to 4 h of anesthesia.CONCLUSIONS: MAC of isoflurane decreases over 1–4 h of anesthesia in 7-day-oldbut not in 60-day-old rats. Both pharmacodynamic and a pharmacokinetic compo-nents contribute to the decrease in MAC in 7-day-old rats. Neither endorphins norsensory desensitization mediate the pharmacodynamic component.(Anesth Analg 2009;109:801–6)

Anesthesia in 7-day-old rats causes neurodegenera-tion and delayed persistent hippocampal dysfunc-tion.1–3 Whether such anesthetic neurotoxicity occursin developing human brains remains unknown.4,5 Atest of this possibility requires the development ofrodent models, including a measure of clinically rel-evant anesthetic doses, such as anesthetic minimumalveolar anesthetic concentration (MAC) (the mini-mum alveolar concentration of an inhaled anestheticrequired to eliminate movement in response to asupramaximal noxious stimulus in 50% of subjects).

In studies of developmental anesthetic toxicity, weroutinely deliver a clinically relevant anesthetic dose

of 1 MAC by anesthetizing 10 or more rats simulta-neously, tail clamping the animals every 15 min, andadjusting the inspired anesthetic concentration ac-cording to how many animals moved (see Methods).In doing so, we noticed that the isoflurane concentra-tion required to produce 50% immobility in 7-day-oldrats (hereafter referred to as “inspired MAC”) de-creases dramatically and progressively over 4 h. Pre-vious investigations report that duration of anesthesiadoes not influence MAC in 2.5-mo-old rats.6

The goals of this study were fourfold. First, wesought to determine whether the progressive decreasein inspired MAC is a “real” phenomenon as opposedto a consequence of the method used to anesthetizeanimals or to determine MAC. Here, we show thatinspired MAC of isoflurane in 7-day-old but not in60-day-old rats decreases progressively over 4 h.

The second goal was to describe a model of aclinically meaningful anesthetic in 7-day-old rats. Inan Anesthetic and Life Support Drugs Advisory Com-mittee Meeting on March 29, 2007, the Food and DrugAdministration attempted to interpret the relevance ofpreclinical findings of anesthetic toxicity in the devel-oping brain and recognized that one of the majorobstacles is the absence of a clinically relevant dosingschedule of anesthetics in animals.7 Here, we describe

From the Department of Anesthesia and Perioperative Care,University of California San Francisco, San Francisco, California.

Accepted for publication April 7, 2009.Supported by a grant from the Anesthesia Patient Safety Foun-

dation (to GS) and by NIH grant 1P01GM47818 (to EIE).Dr. Eger is a paid consultant to Baxter Healthcare Corp. who

donated the isoflurane used in these studies.Address correspondence and reprint requests to Greg Strat-

mann, MD, PhD, Department of Anesthesia and Perioperative Care,University of California San Francisco, Box 0464, Room U286, 513Parnassus Ave., San Francisco, CA 94143. Address e-mail [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181aff364


how to deliver an inhaled anesthetic to 7-day-old ratsat a clinically relevant dose.

Third, we aimed to determine whether pharmaco-kinetic or pharmacodynamic factors govern the de-crease in MAC of isoflurane in 7-day-old rats. Thefollowing observations form the rationale for this goal.Equilibration of alveolar/inspired anesthetic concen-tration of volatile anesthetics remains incomplete after60 min in ventilated adult rats8 and after 3 h inspontaneously breathing tracheostomized adult rats.9

A still greater difference between alveolar and in-spired isoflurane concentration might be found forspontaneously breathing 7-day-old rats because theseare more susceptible to the respiratory-depressanteffects of isoflurane.10 These observations suggest thatthe decrease in inspired MAC with increasing dura-tion of anesthesia may be solely a pharmacokineticphenomenon, i.e., because of incomplete equilibrationof inspired and brain partial pressures of isoflurane.By determining both inspired and cerebral partialpressures at various times during the anesthetic, weshow that both pharmacokinetic and pharmacody-namic factors govern the decrease in inspired MAC.

The fourth goal was to test some obvious possiblemechanisms mediating the decrease in MAC, namelyendogenous opioids, sensory sensitization, or desen-sitization. Anesthesia in neonatal animals causes arte-rial hypotension,11 hypotension increases endogenousopioids,12 and opioids decrease MAC.13 We hypoth-esized that naloxone given at 3 h would reverse thedecrease in MAC.

Repeated supramaximal stimuli may alter the re-sponse to the same stimulus by peripheral sensitiza-tion14 or desensitization of mechanoreceptors. Oneconcern of investigators using tail clamping for MACdetermination has been a possible sensitization be-cause of tissue injury and inflammation after repeatedsupramaximal stimulation.15 On the other hand,mechanoreceptors express adaptation resulting in adecreasing response to sustained stimulation.14 Fur-thermore, temporal summation as described by Dut-ton et al.16 may lead to an increase in MAC because ofthe stimulation pattern. All three of these possiblemechanisms need to be considered in MAC testingwith repeated tail clamping because they may alter thesensitivity of the animal over time independent ofpharmacologic effects. If desensitization because ofrepeated stimulation contributes to the decrease inMAC, animals not subjected to tail clamp until lateduring the anesthetic should have a higher MAC oninitial tail clamping than animals subjected to tailclamp throughout the course of the anesthetic. Like-wise, animals undergoing experiments with delayedclamping would be expected to have a decreasedMAC if sensitization or temporal summation signifi-cantly contributed to the findings. We show thatneither naloxone nor delayed tail clamp changes thedecrease in MAC in 7-day-old rats.

METHODSWith University of California, San Francisco IRB

approval, 21 separate isoflurane anesthetics were con-ducted involving between 10 and 20 rats per anes-thetic. For Aims 1 and 2 (definition of MAC as afunction of anesthetic duration in 7-day-old rats (n �141) and comparison with MAC in P60 rats [n � 40]),18 anesthetics were delivered. Two anesthetics of7-day-old rats (n � 40) were used to compare inspiredwith brain MAC (aim 3). Of 20 rats that were simul-taneously anesthetized, four animals were used fordetermination of brain MAC at one of the two time-points. The remaining animals were used to determineinspired MAC. One experiment using 7-day-old rats(n � 20) was conducted to test if the decrease ininspired and brain MAC observed in experimentspertaining to Aims 1–3 could be due to either endog-enous opioids or altered peripheral mechanoreceptorsensitivity.

Rat AnesthesiaThe anesthetizing chamber was a preheated, hu-

midified glove box to which we delivered isofluranein 6 L/min 50% oxygen/nitrogen. The chamber waspart of a semiclosed anesthetic circuit incorporating afan that recirculated gases via a canister containingsoda lime and a humidifier. Gas composition withinthe anesthetic chamber was measured using a cali-brated Datex Capnomac Ultima (Datex Instrumenta-rium Corp., Helsinki, Finland). A supramaximal painstimulus was generated by application of an alligatorclamp to each rat’s tail for 30 s or until the rat moved.Movement was defined as any movement exceptbreathing. Tail clamping was repeated every 15 min,starting 15 min after induction of general anesthesia.Before the first tail clamping at 15 min, the inspiredisoflurane concentration was set to 3.5%. Once allanimals had their tails clamped, the anesthetic concen-tration was adjusted, if needed, according to thealgorithm in Table 1. The new anesthetic concentra-tion was recorded as the inspired MAC value for that

Table 1. Protocol for MAC Determination and Adjustment ofIsoflurane Concentration in Response to Tail Clamping Every 15min for 4 h

Percent of rats movingin response

to tail clamping

Subsequent percentadjustment of inspired

isoflurane concentration0 �1.0

10 �0.820 �0.630 �0.440 �0.250 No change60 No change70 �0.180 �0.290 �0.3

100 �0.5MAC � anesthetic minimum alveolar anesthetic concentration.

802 Anesthetic Duration Changes MAC in Rats ANESTHESIA & ANALGESIA

timepoint. For example, if 40% of rats moved withapplication of the tail clamp at a measured concentra-tion of 2.5% isoflurane, MAC for that timepoint wouldbe 2.3% (2.5%–0.2%). In addition, the isoflurane con-centration for the following 15-min period would bedecreased to 2.3%.

Custom-made temperature probes were inserted sub-cutaneously over the skull to facilitate control of tem-perature at 36.5°C � 1°C using computer-controlledPeltier heater/cooler plates integrated into the floor ofthe anesthetizing chamber.

Measurement of Inhaled and Brain Partial Pressuresof Isoflurane

Inhaled and brain partial pressures associated withMAC were determined in 7-day-old rats but onlyinspired partial pressures were determined in 60-day-old rats. One and 4 h after induction of generalanesthesia, anesthetic gas from the chamber was aspi-rated into a glass syringe and analyzed for the isoflu-rane concentration using gas chromatography. Ateach timepoint, four 7-day-old rats were decapitatedand each brain quickly removed inside the anestheticchamber and transferred to a preweighed gas-tight20-mL syringe containing a preweighed amount ofglass beads and capped with a three-way stopcock. Allbut 10 mL of the air in the syringe was ejected, and thesyringe weighed once more to determine the weight ofthe brain placed in the syringe. The volume of thebrain was then estimated assuming a brain density of1.1 g/mL. The stopcock was connected to an empty10-mL glass syringe, and the plunger of the gas-tightsyringe was pushed forward to near empty, forcingthe brains into the glass beads, which thereby macer-ated the brain. The forward movement of the plungerforced the air into the attached glass syringe. Afterproducing maceration of the brain, the gas in the glasssyringe was drawn back into the gas-tight syringe,thereby retaining any anesthetic that had transferredto the gas phase. After maceration and warming for1 h to 37°C, the plunger in the gas-tight syringe wasdrawn to the 20 mL mark and reequilibrated for anadditional 15 min. The concentration of anesthetic inthe gas phase (Cg) was measured in duplicate by gaschromatography and the two values were averaged.The concentration of anesthetic originally in the brain(Cb) was estimated from knowledge of the gas volume(Vg), the brain volume (Vb), and the separately deter-mined brain/gas partition coefficient of the anesthetic(l). That is, the total amount of isoflurane (At) equaledthe amount of agent in the gas phase (Ag � Vg � Cg)plus the amount retained in the brain (Ab � Vb � l �Cg). Thus, Cb � (Ag�Ab)/Vb. The partial pressure thatthis represented as a percent of 1 atm thus equals100 � Cb/l.

Brain/Gas Partition Coefficient DeterminationBecause the brain/gas partition coefficient in 7-day-

old rats is not known for any volatile anesthetic, we

took the opportunity to determine it concurrently forisoflurane, sevoflurane, and desflurane. Groups offour brains from 16 7-day-old rats were placed in 20mL preweighed gas-tight syringes (capped with athree-way stopcock) containing a preweighed amountof glass beads (i.e., of known volume). The plunger ofthe syringe was advanced to ensure maceration of thebrains. Gas containing all three volatile anestheticsthen was introduced to approximately the 18 mLmark, and the syringe equilibrated for an hour in arotameter. The plunger then was drawn to the 20 mLmark, the three-way stopcock briefly opened to allowentry of room air, and the syringe then reequilibratedat 37°C for 15 min. The concentration of volatileanesthetics was determined (C1) by gas chromatogra-phy and all of the gas phase expelled through thethree-way stopcock. Room air was drawn into thesyringe to the 18 mL mark and the above processrepeated, giving a second volatile anesthetic concen-tration (C2). The process again was repeated, givingC3. An exponential curve was fit to these concentra-tions, allowing an estimate of the decay with eachdilution. l was calculated as:

l � �C2/�C1 � C2�/�Vg/Vb�

The C2 and C1 values were the estimated values fromthe fitted curve rather than the actual determinedvalues.

Naloxone/Delayed Tail-Clamping ExperimentIn a separate experiment, application of the tail

clamp began immediately in 10 (“clamped”) rats ran-domly selected from 20 simultaneously anesthetizedanimals and at 3 h in the other 10 (“not clamped”). Ofthose animals that were alive at 3 h (n � 15), a nearequal number of animals from each group was chosenrandomly to receive naloxone (1 mg/kg) IP (n � 4,clamped; n � 3, not clamped). The others received anequal volume of normal saline.

During the fourth hour of anesthesia, all rats weretail clamped and the response of the entire cohort wasused to adjust the anesthetic concentration as per thealgorithm in Table 1. After unblinding the investiga-tors to group assignment, the recorded responses totail clamping were used to determined MAC retro-spectively using the algorithm in Table 1 for each ofthe four treatment conditions: clamped/naloxone,clamped/no naloxone, not clamped/naloxone, andnot clamped/no naloxone. Consequently, MAC val-ues of the two groups that were not clamped until3 h of anesthesia (not clamped/naloxone and notclamped/no naloxone) are available only for the lasthour of anesthesia.

Statistical MethodsData are expressed as medians and interquartile

ranges except for the brain/gas partition coefficientmeasurements, each of which are given as the meanand its standard deviation.


Brain partial pressures of isoflurane at 1 and 4 hwere compared using the Mann–Whitney U-test.

Differences in MAC values among the four treat-ment conditions involving naloxone and delayed tailclamping were compared using a two-way analysis ofvariance. The lowest order polynomial equation re-sulting in an acceptable curve fit, a second orderpolynomial equation, was applied to the data of7-day-old animals in the naloxone/delayed tail clamp-ing experiment. A P value of 0.05 was consideredstatistically significant. Prism 4.0 for MacIntosh(GraphPad Software, San Diego, CA) was used for allanalyses.

RESULTSBrain/gas partition coefficients of isoflurane,

sevoflurane, and desflurane are shown in Table 2. In7-day-old rats, the inspired MAC of isoflurane de-creased from a median of 3.5% at 15 min to 1.3% at 4 hof anesthesia (Fig. 1). In 60-day-old rats, MAC ofisoflurane decreased from a median of 2.36% at 15 minto 1.65% at 60 min and was stable thereafter, reaching1.5% at 4 h (Fig. 1).

The ratio of brain/inspired partial pressures ofisoflurane was determined in 7-day-old animals at 1 h(n � 6) and in separate animals at 4 h (n � 8) (Fig. 2).

At 1 h after induction of general anesthesia when theinspired partial pressure of isoflurane at MAC was2.75%, the median brain partial pressure was 1.9% atm(interquartile range 1.7%–2.3% atm) and a brain/inspired partial pressure ratio was 0.72. This indicatesthat 1 h after induction of general anesthesia theinspired and brain partial pressures had not yet equili-brated. After 4 h of anesthesia, the median brainpartial pressure of isoflurane at MAC was 1.27% atm(interquartile range 1.08%–1.4% atm) and the inspiredpartial pressure of isoflurane at MAC was 1.21% atmindicating that the inspired and brain partial pressureshad equilibrated (Table 3). The brain partial pressureat MAC at 4 h was 33% less than at 1 h after inductionof anesthesia (P 0.001 Mann–Whitney U-test). Thus,from 1 to 4 h, the “inspired” MAC of isoflurane in7-day-old rats decreased by 56%, whereas the “brain”MAC decreased by 33% (Table 3). This means thatthere is both a pharmacokinetic (incomplete equilibra-tion of inspired and brain partial pressures of isoflu-rane) and a pharmacodynamic component (decreasein brain partial pressures from 1 to 4 h) of the decreasein MAC. The decrease in inspired MAC for isofluranewas not reversed by either naloxone administration at

Figure 1. The inspired isoflurane concentration required toproduce 1 anesthetic minimum alveolar anesthetic concen-tration (MAC) of isoflurane decreases progressively over 4 hof anesthesia in 7-day-old rats. The MAC of 60-day-old ratsis stable after 1 h. Rats were anesthetized in groups of 10–20(14 isoflurane anesthetics in 7-day-old rats and four anes-thetics in 60-day-old rats). MAC, which was determinedevery 15 min, was estimated as the administered isofluraneconcentration adjusted by the algorithm in Table 1. Imme-diately after tail clamping, the administered concentrationwas adjusted to the isoflurane concentration given by thealgorithm in Table 1. Data are medians and interquartileranges. The data labels are median inspired isofluraneconcentrations resulting in 1 MAC (“inspired MAC”) andare shown for 7-day-old rats only.

Figure 2. Brain/inspired partial pressures of isoflurane at 1and 4 h of anesthesia in 7-day-old rats (n � 14). The “n � 2”for inspired isoflurane partial pressures denotes that all ratswere part of two groups of 20 simultaneously anesthetizedrats each. The isoflurane partial pressure in the anestheticchamber was determined at 1 and 4 h once (in duplicate) foreach group of 20 rats. The brain partial pressures of isoflu-rane were determined in brains harvested at 1 h (n � 6) andat 4 h (n � 8). Data are medians and interquartile ranges.***P 0.001 Mann–Whitney U-test.

Table 2. Brain/Gas Partition Coefficients of Isoflurane,Sevoflurane, and Desflurane in 7-Day-Old Rats

Isoflurane Sevoflurane Desflurane1.69 � 0.13 1.10 � 0.10 0.85 � 0.08Data are means � SD.

Table 3. Inspired and Brain Partial Pressures at 1 MAC at 1and 4 h of Isoflurane Anesthesia in 7-Day-Old Rats

TimeInspired

MACBrainMAC

Ratiobrain/inspired

1 h 2.75% atm 1.9% atm 0.724 h 1.21% atm 1.27% atm 1.03Percent decrease 56 33MAC � anesthetic minimum alveolar anesthetic concentration.


3 h or by delaying tail clamping until 3 h of anesthesia(Fig. 3).

DISCUSSIONWe found that the “inspired” MAC of isoflurane

decreases progressively during the first 4 h of anes-thesia in 7-day-old, but not in 60-day-old adult, rats.We found an initial (15 min) inspired isoflurane MACof 3.5%, a value that exceeds the MAC of 2.34%previously reported in 9-day-old rats.17 However, the2.34% value was probably obtained after 1–2 h ofanesthesia and thus is close to our 1-h value of 2.75%.

Part of the decrease of MAC with increasing dura-tion of anesthesia in 7-day-old rats results fromdelayed equilibration of brain and inspired partialpressures of isoflurane. However, equilibration iscomplete (Table 2) by 4 h of isoflurane anesthesia.Because the brain partial pressure of isoflurane thatproduces immobility in 50% of 7-day-old rats de-creases by one third between 1 and 4 h of anesthesia,while the inspired partial pressure decreases by 56%,

there is both a pharmacokinetic and a pharmacody-namic component to the decrease in MAC. Both ofthese components are attenuated or absent in 60-day-old rats (i.e., MAC is the same, or nearly so, at 1 vs 4 hof anesthesia). We do not know what might underliethe decrease in the brain MAC in the immature rat, adecrease that has vanished in the mature rat. Neitherendogenous opioid release nor altered peripheralmechanoreceptor sensitivity appear to contribute tothis decrease in MAC.

The 33%–56% decreases we found in inspired, butparticularly cerebral, MAC between 1 and 4 h haveimplications for the results of experiments of develop-mental neurotoxicity.1,18–20 Studies of developmentalneurotoxicity should be informed by clinically mean-ingful anesthetic concentrations; investigators mustrecognize that the inhaled isoflurane concentrationrequired to produce anesthesia (1 MAC) is initiallymore than twice as high as in adult rats21 and about150% more than the published MAC for infantilerats.17 Furthermore, they should recognize that MACfor isoflurane in 7-day-old rats decreases progres-sively over 4 h to 60% of the published MAC forisoflurane in immature rats.17 Thus, such studies re-quire a diminishing concentration schedule to avoidunderdosing and overdosing. Based on our experiencegained over the course of these studies, we recom-mend priming the anesthetic chamber with at least 4%isoflurane and adjusting the isoflurane concentrationaccording to the rats’ responses to tail clamping asoutlined in Table 1. If MAC determination is notpossible or not desired, the inspired isoflurane concen-trations shown in Figure 1 should provide a reasonablestarting point for modeling a clinically meaningful anes-thetic in 7-day-old rats.

Whether these findings also apply to other animalspecies, other anesthetics, or to humans is unknown.

In conclusion, the inspired and cerebral concentra-tions of isoflurane resulting in 1 MAC of anesthesiadecreases progressively over 4 h as a function of bothpharmacokinetic and pharmacodynamic phenomena.The pharmacodynamic component is not mediated byendorphins or by altered peripheral mechanoreceptorsensitivity.

REFERENCES

1. Jevtovic-Todorovic V, Hartman RE, Izumi Y, Benshoff ND,Dikranian K, Zorumski CF, Olney JW, Wozniak DF. Earlyexposure to common anesthetic agents causes widespread neu-rodegeneration in the developing rat brain and persistent learn-ing deficits. J Neurosci 2003;23:876–82

2. Fredriksson A, Archer T, Alm H, Gordh T, Eriksson P. Neuro-functional deficits and potentiated apoptosis by neonatalNMDA antagonist administration. Behav Brain Res 2004;153:367–76

3. Fredriksson A, Ponten E, Gordh T, Eriksson P. Neonatal expo-sure to a combination of N-methyl-d-aspartate and gamma-aminobutyric acid type A receptor anesthetic agents potentiatesapoptotic neurodegeneration and persistent behavioral deficits.Anesthesiology 2007;107:427–36

4. Olney JW, Young C, Wozniak DF, Ikonomidou C, Jevtovic-Todorovic V. Anesthesia-induced developmental neuroapopto-sis. Does it happen in humans? Anesthesiology 2004;101:273–5

Figure 3. Inspired MAC of isoflurane under four treatmentconditions: clamped naloxone, clamped no naloxone, notclamped naloxone, and not clamped no naloxone (see Meth-ods). At the beginning of anesthesia, 10 rats were randomlyassigned to be tail clamped every 15 min for the duration ofanesthesia and 10 not to be tail clamped until 3 h. The curvesare a second-order polynomial fit to the data from the“clamped” groups only. The number of surviving animalsover time is given as “clamped, alive” and “not clamped,alive” underneath the graph. At 3 h, 7 of the 15 survivors(four clamped and three not clamped) were randomlyassigned to receive naloxone and the others (four clampedand four not clamped) to receive normal saline. The “n” inthe legend refers to the group size at the time of groupassignment, which is 0 h for the clamped/not clampedcondition and 3 h for the naloxone/no naloxone condition.Curve fits for the “not clamped” conditions were omitted forclarity because the 3-h timepoint in this context is crucial. Ifaltered peripheral mechanoreceptor sensitivity had beenresponsible for the decrease in MAC, initial tail clamping at3 h should have caused a greater proportion of movement inthe previously not clamped rats, which was not the case.Neither naloxone injection at 3 h nor delaying tail clampinguntil 3 h was able to reverse the decrease in MAC in7-day-old rats.


5. Anand KJ, Soriano SG. Anesthetic agents and the immaturebrain: are these toxic or therapeutic? Anesthesiology 2004;101:527–30

6. Eger EI II, Johnson BH. MAC of I-653 in rats, including a test ofthe effect of body temperature and anesthetic duration. AnesthAnalg 1987;66:974–6

7. Groupe Miller C, Shafer S. Summary of Minutes of the Anes-thetic and Life Support Drugs Advisory Committee Meeting onMarch 29, 2007. Rockville, Maryland, 2007. Available at: http://www.fda.gov/ohrms/dockets/ac/07/minutes/2007– 4285m1-Final.pdf; accessed February 20, 2009

8. Wahrenbrock EA, Eger EI II, Laravuso RB, Maruschak G.Anesthetic uptake—of mice and men (and whales). Anesthesi-ology 1974;40:19–23

9. White PF, Johnston RR, Eger EI II. Determination of anestheticrequirement in rats. Anesthesiology 1974;40:52–7

10. Stratmann G, Sall JW, May LD, Bell JS, Magnusson KR, Rau V,Visrodia KH, Alvi RS, Ku B, Lee MT, Dai R. Isoflurane differ-entially affects neurogenesis and long-term neurocognitivefunction in 60-day old and 7-day old rats. Anesthesiology2009;110:834–48

11. LeDez KM, Lerman J. The minimum alveolar concentration(MAC) of isoflurane in preterm neonates. Anesthesiology1987;67:301–7

12. Molina PE. Endogenous opioid analgesia in hemorrhagic shock.J Trauma 2003;54:S126–32

13. Kurita T, Takata K, Uraoka M, Morita K, Sanjo Y, Katoh T, SatoS. The influence of hemorrhagic shock on the minimum alveolaranesthetic concentration of isoflurane in a swine model. AnesthAnalg 2007;105:1639–43, table of contents

14. Reeh PW, Bayer J, Kocher L, Handwerker HO. Sensitization ofnociceptive cutaneous nerve fibers from the rat’s tail by noxiousmechanical stimulation. Exp Brain Res 1987;65:505–12

15. Sobair AT, Cottrell DF, Camburn MA. A mechanical stimulatorfor the determination of the minimum alveolar concentration(MAC) of halothane in the rabbit. Vet Res Commun 1993;17:375–85

16. Dutton RC, Zhang Y, Stabernack CR, Laster MJ, Sonner JM, EgerEI II. Temporal summation governs part of the minimumalveolar concentration of isoflurane anesthesia. Anesthesiology2003;98:1372–7

17. Orliaguet G, Vivien B, Langeron O, Bouhemad B, Coriat P, RiouB. Minimum alveolar concentration of volatile anesthetics in ratsduring postnatal maturation. Anesthesiology 2001;95:734–9

18. Yon JH, Daniel-Johnson J, Carter LB, Jevtovic-Todorovic V.Anesthesia induces neuronal cell death in the developing ratbrain via the intrinsic and extrinsic apoptotic pathways. Neu-roscience 2005;135:815–27

19. Johnson SA, Young C, Olney JW. Isoflurane-induced neuro-apoptosis in the developing brain of nonhypoglycemic mice.J Neurosurg Anesthesiol 2008;20:21–8

20. Loepke AW, McCann JC, Kurth CD, McAuliffe JJ. The physi-ologic effects of isoflurane anesthesia in neonatal mice. AnesthAnalg 2006;102:75–80

21. Holdcroft A, Bose D, Sapsed-Byrne SM, Ma D, Lockwood GG.Arterial to inspired partial pressure ratio of halothane, isoflu-rane, sevoflurane and desflurane in rats. Br J Anaesth 1999;83:618–21


Technology, Computing, and SimulationSection Editor: Dwayne Westenskow

Auditory Event-Related Potentials, Bispectral Index, andEntropy for the Discrimination of Different Levels ofSedation in Intensive Care Unit Patients

Matthias Haenggi, MD*

Heidi Ypparila-Wolters, PhD†

Sarah Buerki, cand. med.*

Rebekka Schlauri, cand. med.*

Ilkka Korhonen, PhD†

Jukka Takala, MD, PhD*

Stephan M. Jakob, MD, PhD*

BACKGROUND: Sedation protocols, including the use of sedation scales and regularsedation stops, help to reduce the length of mechanical ventilation and intensivecare unit stay. Because clinical assessment of depth of sedation is labor-intensive,performed only intermittently, and interferes with sedation and sleep, processedelectrophysiological signals from the brain have gained interest as surrogates. Wehypothesized that auditory event-related potentials (ERPs), Bispectral Index� (BIS),and Entropy� can discriminate among clinically relevant sedation levels.METHODS: We studied 10 patients after elective thoracic or abdominal surgery withgeneral anesthesia. Electroencephalogram, BIS, state entropy (SE), response entropy(RE), and ERPs were recorded immediately after surgery in the intensive care unit atRichmond Agitation-Sedation Scale (RASS) scores of �5 (very deep sedation), �4(deep sedation), �3 to �1 (moderate sedation), and 0 (awake) during decreasingtarget-controlled sedation with propofol and remifentanil. Reference measurementsfor baseline levels were performed before or several days after the operation.RESULTS: At baseline, RASS �5, RASS �4, RASS �3 to �1, and RASS 0, BIS was 94 [4](median, IQR), 47 [15], 68 [9], 75 [10], and 88 [6]; SE was 87 [3], 46 [10], 60 [22], 74 [21],and 87 [5]; and RE was 97 [4], 48 [9], 71 [25], 81 [18], and 96 [3], respectively (all P �0.05, Friedman Test). Both BIS and Entropy had high variabilities. When ERP N100amplitudes were considered alone, ERPs did not differ significantly among sedationlevels. Nevertheless, discriminant ERP analysis including two parameters of principalcomponent analysis revealed a prediction probability PK value of 0.89 for differenti-ating deep sedation, moderate sedation, and awake state. The corresponding PK forRE, SE, and BIS was 0.88, 0.89, and 0.85, respectively.CONCLUSIONS: Neither ERPs nor BIS or Entropy can replace clinical sedation assessmentwith standard scoring systems. Discrimination among very deep, deep to moderate,and no sedation after general anesthesia can be provided by ERPs and processedelectroencephalograms, with similar PKs. The high inter- and intraindividual variabil-ity of Entropy and BIS precludes defining a target range of values to predict thesedation level in critically ill patients using these parameters. The variability of ERPs isunknown.(Anesth Analg 2009;109:807–16)

Most critically ill patients receive sedative andanalgesic drugs to attenuate discomfort and pain.1 Theexcessive use of sedatives and analgesics prolongsmechanical ventilation, and increases the incidence ofnosocomial pneumonia, time spent in the intensive

care unit (ICU), and costs.2–4 Strategies to reduce theuse of sedatives and analgesics may improve theoutcome.2,5 Whereas under-sedation is generally easyto identify, over-sedation, with its associated prob-lems, is more difficult to recognize but should beavoided. Although daily pauses in sedation help toavoid gross over-sedation, this is not always possible,for example, when the patient’s condition is unstable.5

Also, accumulation of sedatives and analgesics may

From the *Department of Intensive Care Medicine, Bern Univer-sity Hospital and University of Bern, Bern, Switzerland; and †VTTTechnical Research Centre of Finland, Tampere, Finland.

Accepted for publication March 9, 2009.Supported by Datex-Ohmeda, now GE Healthcare, Helsinki,

Finland.Ilkka Korhonen’s employer received funding from GE Health-

care to carry out research projects related to depth of anesthesiamonitoring. He has been working in these projects, and part of thework reported here has resulted from these projects. The relation-ship does not, however, have any effect on the results reported inthis study. Jukka Takala and Stephan M. Jakob, The Department ofIntensive Care Medicine, Bern University Hospital, have receivedresearch grants from GE Healthcare (formerly Datex-Ohmeda),Helsinki, Finland. The authors affiliated with the department re-ceived no personal funds from GE.

Jukka Takala is editor of Critical Care and Trauma for the Journal.This manuscript was handled by Jeffrey M. Feldman, Section Editor ofTechnology, Computing, and Simulation. Dr. Takala was not involvedin any way with the editorial process or decision.

Reprints will not be available from the author.Address correspondence to Stephan M. Jakob, MD, PhD, Depart-

ment of Intensive Care Medicine, Inselspital, Freiburgstrasse, CH-3010 Bern, Switzerland Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181acc85d


occur rapidly, especially in patients with renal and/orliver dysfunction. Monitoring the depth of sedation isdifficult and is currently based on clinical assessmentand the use of clinical scoring systems.4,6,7 Thesescoring systems cannot be applied continuously, theyare subjective, and they measure arousal in responseto stimulation rather than the level of consciousness inthe unstimulated state, i.e., evaluating the level ofsedation influences what is being assessed.6

Several methods based on the electroencephalo-gram (EEG) have been tested to avoid these problems,but the results have been disappointing.8,9 Entropy�, anonlinear statistic parameter which describes the or-der of random repetitive signals, is a relatively newmethod of processed EEG. In patients, Entropy trans-lates the anesthesia-induced, more synchronized EEGinto a single parameter.10 Spectral entropy can repro-ducibly indicate the hypnotic effects of propofol, thio-pental, and different anesthetic gases.11–14 Anothermethod frequently used in the operating room tomonitor depth of anesthesia is midlatency auditory-evoked potentials (MLAEPs), e.g., the Danmeter AEPMonitor/2.15 There are virtually no published studiesusing MLAEP in adult ICU patients16–18 and fewstudies are done during conscious sedation.19,20 Stud-ies suggest that variability of the derived valuesimpedes the use of MLAEPs to guide sedation duringthe light levels of sedation. The most popular methodof processed EEG for assessment of sedation is theBispectral Index� (BIS).21 Although BIS has beentested and validated for use in the operating room toassess anesthetized patients,21,22 data on using BIS inthe ICU to assess sedation are controversial.7,23–26 Themultiple concomitant medications and heterogeneityof underlying pathologies present a further challengeto the use of neuromonitoring in the ICU in general.27

We have previously shown that the time-lockedcortical response to standard external auditory stimuli�100 ms (long-latency auditory-evoked potentials orevent-related potentials [ERPs]) can discriminate be-tween clinically relevant light to moderate and deepsedation levels in healthy volunteers when sedation isinduced with a combination of propofol or midazolamwith remifentanil.28,29 Based on our previous experi-ence, the N100 response (the negative amplitude ap-pearing about 100 ms after an acoustic stimulus),which represents conscious detection of changes in theacoustic environment,30,31 is the acoustic ERP bestqualified to evaluate sedation, especially if presentedin a sequence of four tones to see the orienting reactioncoming and going, followed by a pause of 12 s to“clear” the sensory memory. We therefore hypoth-esized that these ERPs may be used to monitor thedepth of sedation in ICU patients as well. As the firststep to test this hypothesis, we evaluated the use ofERPs to assess the level of sedation in patients under-going major elective surgery and admitted to the ICUfor short-term postoperative mechanical ventilation.

METHODSThis study was approved by the Ethics Committee

of the Canton of Bern, and written informed consentwas obtained from each patient. In a pilot series, 10patients were recorded, but the signal quality waspoor as a result of difficulties in fixing external ear-phones in the awakening and moving patients. For thepresent series of patients, a new ear canal earphonesystem was used. These 10 patients required an elec-tive thoracic surgical intervention under general anes-thesia and were assigned to the ICU for postoperativecare. The study took place in the ICU of the BernUniversity Hospital. Exclusion criteria were ASA III orhigher, adverse events during former surgery or an-esthesia, neurological impairment in the medical his-tory, and hearing abnormalities.

The reference or baseline measurements were re-corded depending on the patient’s availability duringpreoperative evaluation on the day before surgery (twopatients) or several days postoperatively (eight patients)when the patients were on the regular ward and were nolonger receiving narcotic or sedative drugs . The eveningbefore surgery, the patients received their premedicationaccording to the anesthesiologist’s prescription. The an-esthetic regime was left to the discretion of the attendinganesthesiologist. All but one patient received an epiduralcatheter. Postoperatively, the tracheally intubated pa-tients were transferred to the ICU, where standardmonitoring (electrocardiogram, invasive arterial bloodpressure, pulse oximetry, respiratory rate, end-tidal car-bon dioxide concentration) with an S/5 Critical CarePatient Monitor (Datex-Ohmeda, GE Healthcare, Hel-sinki, Finland) was continued. The parameters (includ-ing the processed and raw EEGs) were recorded onlinewith S/5 Collect software (GE Healthcare) (an upgradedWinCollect� version) and saved on a laptop for furtheranalysis. Standard treatment protocols were used forhemodynamic and ventilatory management.

In the ICU, four sets of measurements were takenfrom each patient: the first set was taken after arrivalin the ICU, at Richmond Agitation-Sedation Scale(RASS)32 level �5, followed by measurements at RASS�4, then at a target of RASS �2, and after trachealextubation at RASS 0 (Table 1). Assessments of RASSscore were performed by two observers just before therecording period, but at least 15 min after the last drugadjustment to obtain a steady state, and just at the endof the sedation period. If the assessments of theobservers differed from each other, consensus wassought (only needed in the lighter sedation levels).This is in accordance with the validation of the RASSprovided by the original publication.7 To adjust thedifferent sedation levels according to RASS, propofol(Disoprivan� 1%, AstraZeneca, Zug, Switzerland) andremifentanil (Ultiva�, GlaxoSmithKline, Schonbuhl,Switzerland) were infused by a computer-controlledpump (Alaris Asena�, ALARIS Medical Systems, Car-bamed, Bern, Switzerland), driven by the Rugloop II

808 Discriminating Sedation Level in ICU Patients ANESTHESIA & ANALGESIA

TCI program (BVBA Demed, Temse, Belgium), withthe pharmacokinetic variable set of Schnider et al.33

for propofol and that of Minto et al.34 for remifentanil.Remifentanil target was initially set at 2 ng/mL,propofol was started at about 2 �g/mL concentration,depending on the amount of anesthetics and analge-sics used during the operation, and both drugs wereadjusted as needed to reach the target sedation levelwithout leaving the patient with signs indicatinginsufficient analgesia. A stabilization period of 15 minwas maintained after each change in the doses ofpropofol or remifentanil.

At the beginning of each step, background EEG,BIS, and Entropy were recorded for 5 min. Afterward,auditory stimulation was started and ERPs were re-corded. The stimulation was applied according to ahabituation paradigm. In the habituation paradigm,four equal auditory stimuli (800 Hz) were appliedthrough earphones at intervals of 1 s, followed by apause, and this set of stimuli was repeated after 12 s.Altogether, 40 sets of stimuli were delivered at eachmeasurement, corresponding to a recording time ofabout 10 min. The tones were generated by the Pre-sentation� stimulus delivery software (PresentationVersion 9.51, built 05.24.05, Neurobehavioral Systems,Albany, CA) and delivered through foam-protectedin-ear earphones (ER-4S MicroPro, Ethymotic Re-search, Elk Grove Village, IL).

EEG, BIS, and Entropy RecordingThe EEG signal was recorded using Ag/AgCl elec-

trodes placed on the scalp, according to the interna-tional 10-20 system. Two electrode locations—, frontal

(Fz) and central (Cz)—, were used. Both electrodeswere referred to the right mastoid, and the electrode-skin impedances were kept below 5 k[Omega]. Auto-matic impedance checks were performed every 15min. The EEG signal was amplified and digitalizedcontinuously at 200 Hz (modified EEG module, S/5monitor, Datex-Ohmeda, GE Healthcare). This EEGmodule can measure a maximum of four channels, hasa range of �400 �V, a frequency range of 0.5–40 Hz, aresolution of 60 �V, an input impedance of �10 MW, anoise level of �0.5 �V root mean square (rms) from 0.5to 40 Hz, and a common mode rejection ratio of �100 dB.BIS electrodes (Aspect Medical, S/5 BIS Module M-BIS[XP-level], Datex-Ohmeda, GE Healthcare) and Entropyelectrodes (S/5 M-Entropy, Datex-Ohmeda, GE Health-care) were placed on each side of the patient’s foreheadaccording to the manufacturer’s recommendations. Thesmoothing rate of M-BIS was set to 30 s.

EEG and ERP ProcessingThe background EEG was first band-pass filtered

with a finite impulse response type filter using cutofffrequencies of 0.5 and 32 Hz (Matlab, version 6.12, TheMathworks, Natick, MA). Five minutes of the filteredEEG signal was cut into 5-s epochs with 50% overlap.Obvious artifacts were excluded based on the maxi-mum amplitude for each epoch. Epochs with ampli-tudes more than the predefined limits (100–300 �V)were excluded. The appropriateness of the artifactrejection was manually confirmed.

For each EEG epoch, the root mean squared totalpower was calculated. The power spectral density was

Table 1. Richmond Agitation-Sedation Scale (RASS) (see Ref. 32)

Score Term Description4 Combative Overtly combative or violent; immediate danger to staff3 Very agitated Pulls on or removes tube(s) or catheter(s) or has aggressive behavior toward staff2 Agitated Frequent nonpurposeful movement or patient-ventilator dyssynchrony1 Restless Anxious or apprehensive but movements not aggressive or vigorous0 Alert and calm

�1 Drowsy Not fully alert, but has sustained (more than 10 s) awakening, with eye contact to voice�2 Light sedation Briefly (less than 10 s) awakens with eye contact to voice�3 Moderate sedation Any movement (but no eye contact) to voice�4 Deep sedation No response to voice, but any movement to physical stimulation�5 Unarousable No response to voice or physical stimulation

Procedure

1. Observe patient. Is patient alert and calm (score 0)?Does patient have behavior that is consistent with restlessness or agitation (score �1 to �4 using the criteria listedabove, under description).

2. If patient is not alert, in a loud speaking voice state patient’s name and direct patient to open eyes and look at speaker.Repeat once if necessary.Can prompt patient to continue looking at speaker.Patient has eye opening and eye contact, which is sustained for more than 10 s (score �1).Patient has eye opening and eye contact, but this is not sustained for 10 s (score �2).Patient has any movement in response to voice, excluding eye contact (score �3).

3. If patient does not respond to voice, physically stimulate patient by shaking shoulder and then rubbing sternum ifthere is no response to shaking shoulder.Patient has any movement to physical stimulation (score �4).Patient has no response to voice or physical stimulation (score �5).


estimated for each epoch using Welsh averaged perio-dogram method, and spectral edge frequency 95%(SEF 95%) and mean power frequency were computedfrom the power spectral density using a frequencyrange from 0.5 to 32 Hz. In addition, the followingspectral powers were computed: Delta power (0.5–4Hz), Theta power (4–8 Hz), Alpha power (8–13 Hz),Beta1 power (13–20 Hz), Beta2 power (20–32 Hz), andthe slow-fast ratio ([Delta � Theta]/[Alpha � Beta1 �Beta2]). The mean parameter values of the acceptedepochs were individually computed, and used in thestatistical analysis.

The EEG signal recorded during the auditorystimulation was first filtered using cutoff frequenciesof 1 and 20 Hz and then transformed to epochs lastingfrom �100 to 900 ms relative to each stimulus onset.After removal of epochs with artifacts (rejection level�100 �V), the individual responses to the first andsecond stimuli of the habituation paradigm wereaveraged. The responses to the third and the fourthstimuli were averaged to increase the number ofstimuli for averaging, which in turn improves thesignal-to-noise ratio. The N100 component was de-fined as a maximum negative deflection appearing80–150 ms after the stimulus onset. The amplitudeand the latency of the prominent N100 componentswith respect to the prestimulus baseline (50 ms toonset of the tone) were manually recorded. The first tosecond tone ratio of the habituation paradigm wascomputed by dividing the N100 amplitude of the firststimulus by the N100 amplitude of the second stimu-lus. An advanced signal processing technique wasnecessary to increase the accuracy of discriminationamong the sedation levels. We therefore chose princi-pal component (PC) analysis the averaged responsesof the first, second, and the combined third and fourthstimulus of the habituation paradigm. In this analysis,each measurement can be presented as a linear sum ofso-called “basis vectors,” which are multiplied by PCs.These can be obtained by solving the eigendecompo-sition problem.35 In general, the more the averagedresponses have common features, the less basis vec-tors and PC are needed. The individual PC may thenbe used as features of the N100 component in thestatistical analysis.

BIS and Entropy ProcessingFrontal muscle electromyography (EMG) can influ-

ence processed EEG because the frequency bands areoverlapping. EMG is considered an artifact by the BISdevice, whereas the Entropy device considers EMG (asresponse entropy [RE], as opposed to state entropy[SE]). Both devices have regular internal impedancechecks, and both have built-in artifact recognition,which considers movements and high EMG. For dataprocessing, we used only signals of both processedEEG devices, which were cleared by the devices’built-in algorithm. As the smoothing rate of BIS is30 s and the smoothing rate of Entropy is between

15 and 30 s, depending on the frequency, thedownloaded values were cut into 30 s epochs forfurther processing.

Statistical AnalysisThe descriptive data of the N100 responses are

shown as mean � sd. As the Entropy and BIS are onan ordinal scale, these data are shown as median andinterquartile ranges (IQR). Friedman test with respectto the sedation levels was applied. Pairwise compari-sons within the time row were corrected with theStudent–Keuls–Newman method. A P value of 0.05was considered significant.

To find a combination of variables which was ableto identify the sedation level most accurately, weapplied discriminant analysis. To avoid overestima-tion, a maximum of four variables was tested. Dis-criminant analysis was first applied to the PCs of theN100 characteristics, then in a stepwise manner withaddition of the variables obtained from the EEGspectrum, BIS, and Entropy values. The statisticaldifferences among the measurement conditions (finalstep of the discriminant analysis) were tested usingone-way analysis of variance. The analysis steps havebeen described in detail by Ypparila et al.36 Theperformance of this classification was estimated withprediction probability, calculated from Somer d.37 Avalue of PK � 0.5 means that the parameter predictsthe steps with no better than a 50:50 chance. A value ofPK � 1.0 means that the parameter predicts the stepscorrectly 100% of the time.

Basic statistics were computed with the SigmaStatfor Windows Version 3.1 software package (SystatSoftware, Point Richmond, CA). Discriminant analysisand PK were calculated with SPSS (SPSS for Windows12.0, SPSS, Chicago, IL).

RESULTSThe 10 patients had a median age of 64 yr (range,

47–85 yr). All patients completed the full set ofmeasurements. The data quality was very good. Forthe ERP recordings, 94.9% � 5.3% of all individualresponses of the habituation paradigm could be used,with a minimum of 72.2% in one patient during thetarget RASS �2 level. From the processed EEG record-ings, BIS data were not transferred after self-impedance check in two different patients, one duringRASS �4 and the other at RASS �3 to �1, resulting inacceptance rates of 86% � 32% and of 87% � 32% of allepochs during these two sedation states. In all othersedation levels, acceptance rates were above 96% �10% for BIS and above 98% � 1% for RE and SE.

Stepwise maintenance of the predefined lightersedation levels postoperatively was more difficultthan anticipated: RASS �2 could be achieved in onlyfour patients, and in two of these four patients theRASS �2 changed during the measurement period.Therefore, the lighter sedation levels (RASS �3 to �1)


were combined, and the levels RASS �5 (unarous-able), RASS �4 (deep sedation), RASS �3 to �1 (lightto moderate sedation), and RASS 0 (awake/after ex-tubation) were analyzed.

Drug effect-site concentrations to achieve the de-sired sedation levels are as follows (mean � sd):remifentanil RASS �5 1.98 � 0.24 ng/mL, RASS �41.20 � 0.29, RASS �3 to �1 1.1 � 0.28; propofol 2.32 �0.34 �g/mL, 1.87 � 0.46 and 1.36 � 0.38.

Figure 1 demonstrates the individual ERPs of allpatients at the different sedation levels. The amplitudeof the first N100 response (H1) at the electrode loca-tion Fz decreased from �10.6 � 3.3 �V at baseline to

�3.7 � 1.5 �V at RASS �5 (P � 0.05) and thenincreased to �5.3 � 1.6 �V at RASS 0 (P � 0.05,compared with RASS �5). Individual responsesshowed a wide variation within the measures (Fig. 2).Neither latency nor habituation was useful to dis-criminate between the postoperative RASS levels (datanot shown). There were no differences between valuesrecorded at electrode locations Fz and Cz (data notshown).

BIS was 94 (IQR 4) at baseline, 47 (IQR 15) at levelRASS �5 (P � 0.05 compared with baseline), and 88(IQR 6) after tracheal extubation (P � 0.05 comparedwith RASS �5, Fig. 3). The corresponding values for

Figure 1. Individual event-related po-tential (ERP) responses of all 10 pa-tients, recorded at central location ofthe electrode.

Figure 2. Amplitudes of the N100peak (100 ms after the first auditorystimulus during the habituation para-digm) of each of the 10 patients at thedifferent sedation levels.


RE were 97 (IQR 4), 48 (IQR 9) (P � 0.05 comparedwith baseline), and 96 (IQR 3), and for SE were 87 (IQR5), 46 (IQR 10) (P � 0.05 compared with baseline), and87 (IQR 3), respectively (Fig. 3). Between RASS �4 andRASS �3 to �1 levels, the values frequently over-lapped. Within the 10-min ERP recording time of each

individual patient, the processed EEG variables fluc-tuated frequently, with the highest variation up to anIQR of 15 (Fig. 4).

Of the quantitative EEG variables (root meansquare, mean power frequency, SEF 95%, power in thefrequency bands), only SEF 95%, Beta 1/Beta2 power,

Figure 3. Box plots (median, end of box:25th and 75th percentiles, error bars: 10thand 90th percentiles, outliers) of the pro-cessed electroencephalogram (EEG)variables Bispectral Index (BIS), re-sponse entropy (RE), and state entropy(SE) at different sedation levels. Be-cause RE and SE are not independentmeasurements of Entropy, we did notperform comparisons between pro-cessed EEG variables. Friedman testwas applied on sedation levels withineach processed EEG variable, and pair-wise comparisons within the time rowwere corrected with the Student–Keuls–Newman method. The asterisk indi-cates the differences of processedEEG variables; there is no statisti-cally significant difference betweenbaseline and Richmond Agitation-Sedation Scale (RASS) 0 in any pro-cessed EEG variable.

Figure 4. Box plots of the variation ofthe processed electroencephalogram(EEG) parameters in the individualpatients during the 10-min record-ings (absolute values of BispectralIndex [BIS], response entropy [RE],and state entropy [SE]).


and slow-fast ratio could discriminate among differentsedation levels in the overall test (Table 2), but pair-wise comparisons failed to differentiate further (datanot shown).

To improve the discriminative power of the mea-sured parameters post hoc, we further combined clini-cally relevant sedation levels (deep sedation RASS �5and �4; moderate sedation RASS �3 to �1, andawake; RASS 0 postextubation and during referencerecording).

The stepwise discriminant analysis of the signifi-cant variables of the PC analysis (PC2 of Peak 1, PC1and 2 of Peak 2 and PC1 and 2 of the combined 3rdand 4th peak) resulted in 82% correctly classified caseswith only the PC2 of Peak 2 and PC1 of the combined3rd and 4th peak. Addition of any quantitative vari-able did not improve the classification. The same istrue for the H1 and H2 amplitudes and latencies. Onlythe addition of RE or SE increased the size of thecorrect classification to 86%.

Therefore the prediction probabilities PK for discrimi-nation of the three sedation levels awake, moderate, anddeep sedation were PK �0.89 (standard error �0.08) for

PCs (PC2-Peak 1; PC1-Peak 3/4) alone, and 0.93 � 0.06for PCs of ERPs and RE (Table 3).

DISCUSSIONThe main finding of this study was that the PC

analysis of N100 responses was able to differentiateamong clinically relevant sedation levels in patients.In contrast to our previous results in healthy volun-teers, the absolute amplitudes of the ERPs were notable to differentiate among the sedation levels. Wehave no clear explanation for this difference, but it isreasonable to assume that the mixture of anestheticand analgesic drugs, and the duration and depth ofanesthesia likely contributed.

The PK of PC analysis of N100 combined withquantitative EEG parameters, recorded with the sameelectrode, was as high as the PK of the BIS. CombiningPC analysis with either BIS or Entropy did not con-siderably change the accuracy of sedation assessment.Although the processed EEG variables BIS, RE, and SEcould discriminate among different levels of sedation,their high inter- and intraindividual variability withinthe clinical steady-state of sedation precludes thedefinition of target ranges for different sedation levels.Concerns that the ERP recordings per se might influ-ence variability of the processed EEG are unwarrantedand not supported by the literature.38 A direct com-parison of the variability of ERP monitoring andprocessed EEG monitoring of sedation is not yetpossible. The ERPs were recorded over a 10-minperiod, whereas BIS has a smoothing time of 30 s andRE/SE have 15/60-s smoothing times, making themprone to fluctuations.

Corresponding to published data, BIS was slightlymore accurate than the Entropy or EEG measures, asreflected by the higher PK.11 During the 10-min ERPrecording period, the volunteers were in a stable stateof sedation as estimated by the observers. Despite this,the individual EEG patterns fluctuated substantially,

Table 2. Results of the Friedman Test of the Principal Components Analysis (PCA), the Processed Electroencephalogram (EEG), andthe Quantitative EEG Values

Variable P Variable P Variable PPC1 Peak 1 0.022 N100 amplitude, Peak 1, Fz 0.000 Spectral edge frequency 95% (SEF 95%) 0.000PC2 Peak 1 0.000 N100 latency, Peak 1, Fz 0.000 Root mean squared (RMS) total power 0.851PC3 Peak 1 0.078 N100 amplitude, Peak 2, Fz 0.000 Total power 0.837PC1 Peak 2 0.000 N100 latency, Peak 2, Fz 0.000 Mean power frequency (MPF) 0.030PC2 Peak 2 0.000 N100 amplitude, Peak 1, Cz 0.000 Delta power (0.5–4 Hz) 0.031PC3 Peak 2 0.161 N100 latency, Peak 1, Cz 0.000 Theta power (4–8 Hz) 0.794PC1 Peak 3 0.000 N100 amplitude, Peak 2, Cz 0.003 Alpha power (8–13 Hz) 0.551PC2 Peak 3 0.000 N100 latency, Peak 2, Cz 0.000 Beta1 power (13–20 Hz) 0.004PC3 Peak 3 0.300 Beta2 power (20–32 Hz) 0.000PC1 Peak 4 0.000 Response entropy 0.000 Slow-fast ratio (�Delta � Theta�/�Alpha

� Beta1 � Beta2�)0.005

PC2 Peak 4 0.000 State entropy 0.000PC3 Peak 4 0.374 BIS 0.000PC1 Peak 3 � 4 0.000PC2 Peak 3 � 4 0.000PC3 Peak 3 � 4 0.033Fz � frontal location of the electrode; Cz � central location of the electrode; BIS � Bispectral Index.

Table 3. PK of the Variables

Variable

Prediction probability

PK Standard errorResponse entropy (RE) 0.88 0.08State entropy (SE) 0.89 0.08BIS 0.85 0.05SEF 95% 0.77 0.06H1 amplitude 0.72 0.06Principal components

(PC2-Peak 1;PC1-Peak 3/4)

0.89 0.08

Principal components� response entropy

0.93 0.06

Sedation levels: awake, moderate (RASS �1 to �3), and deep (RASS �4 and �5).RASS � Richmond Agitation-Sedation Scale; SEF 95% � spectral edge frequency 95%;BIS � Bispectral Index.


as indicated by the BIS, RE, and SE values at eachsedation level (Fig. 4). This occurred despite the use ofcomputer-controlled drug administration with vali-dated pharmacokinetic/pharmacodynamic models.This fluctuation was more pronounced at the deepersedation levels. A possible explanation is the decay ofanesthesia, which could not be controlled for in thisstudy setting. The high interindividual variability(Fig. 3), with substantial overlap among the differentsedation levels, has been described for both BIS andEntropy.7,24–26,39 As we calculated ERPs off-line andmeasured only a 10-min epoch, variability of ERPs isunknown. The analysis may be modified to be appli-cable in real-time for on-line analysis, so the variabilitycould be assessed in the future.

In contrast to the results of previous studies involunteers,28,29,40 measurement of only the amplitudesof the N100 component of the auditory-evoked poten-tials could not discriminate among the different seda-tion levels in this patient population. The presence ofN100 responses at deep sedation levels has beendescribed, but these responses were small41 or hardlydetectable.42 This was interpreted as ongoing detec-tion and processing of auditory information. Supportof continuing cortical processing in the associativeauditory cortex with reduced intensity comes fromfunctional magnetic resonance imaging studies, inwhich the blood oxygen level dependency techniquecould find activation in areas where N100 responseswere generated.43 In the discriminant analysis, the PCsof the N100 response to the first tone were notconsidered, and PCs of the N100 responses to thesecond and combined third and fourth tones werechosen. This is rather unexpected, because generally itis believed that habituation to the repetitive stimulusoccurs and the amplitude of the ERP will diminish.Also unexpectedly, the low N100 amplitudes persistedat more superficial sedation levels and even aftertracheal extubation.

As the N100 response reflects conscious detectionof any change in the auditory environment, our pa-tients should have had easily detectable responses inthe awake states, and they are to be expected in therange of the baseline recordings,30,31 independent ofwhether the baseline recordings were done before ordays after surgery. In our prior study in volunteers,three repeated baseline measurements of N100 with-out any medication, separated by at least 1 wk, did notdiffer significantly, with baseline amplitudes being inthe same range as in this study.28 Baseline recordingswere done in a fully cooperative patient without anymedication, whereas the RASS 0 recordings were donein a noisy ICU with a patient just recovered fromanesthesia and surgery. We believe that these twostates can explain the measurement differences. Wecannot exclude that movements of the patients duringawakening may have changed the position of thesealed in-ear headphones and modified the loudnessof the stimulus. These movements caused technical

problems in our pilot series before we changed to thesealed headphones. This could be controlled in thefuture by monitoring signal delivery, e.g., bursts ofmidlatency or brainstem acoustic-evoked potentials orstapedius reflex potentials.

In this study, only patients with obvious hearingdifficulties (acoustic devices and tinnitus) were ex-cluded. As the median age of the patients was 64 yr,the hearing threshold could have been reduced in manyof the patients. An individual adaptation of the loudness,e.g., 30 dB above the hearing threshold, might haveimproved discrimination of sedation levels.

A further reason for the discordant results com-pared with our previous findings is the use of otheranesthetics and opiates before neurophysiologicaltesting. The effects of combined opiates and sedativedrugs on ERPs and consciousness have not been wellestablished. High-dose opiates result in a generalslowing of EEG, with a concomitant decrease in SEF95%.44 The effect of opioids on BIS is variable: opiatesalone may or may not decrease BIS.45 In studies ofopioids used in combination with a hypnotic drug, BISwas decreased46 or the dose of the hypnotic could bereduced to achieve the same BIS value.47 Midlatencyacoustic-evoked potentials behave the same way asthe BIS, with a tendency to mirror the effect-siteconcentrations of the hypnotic drug rather than thesedation effect.48,49 Studies exploring opioid effects onERPs did not show any changes, but in these studies,the doses of morphine and buprenorphine were small,and the study population consisted of chronic painand drug-dependent patients.50,51 Our previousstudy28 demonstrates an opioid-independent effect ofsedation on the N100 response. Therefore, it is pos-sible that the opiates used for anesthesia blunted theN100 responses of our patients, but the fact that allpatients could be tracheally extubated according tostandard criteria and recovered without hypoventi-lation argues against substantial opiate effect-siteconcentrations.

Another concern might arise from the fact thatsedation was titrated against a sedation scale (RASS)and not against a processed EEG variable. Sedation inICU patients is usually controlled by clinical assess-ment, and processed EEG parameters are not en-dorsed by guidelines,4 nor can they be recommendedfor guidance of sedation in ICU patients because oftheir variability.8,23

In conclusion, at present, sedation in ICU patientscan only be assessed with repeated standard sedationscoring. This cannot be replaced by either ERPs orprocessed EEG parameters. We show that PK of theERPs is not inferior compared with either PK of BIS orEntropy monitors, despite their persistently low am-plitudes during light sedation levels and after trachealextubation. This is conceivable because the clinicallevel of sedation is defined as a response to a stimulus,analogously with ERPs, whereas the processed EEG


rather reflects background activity. With on-line moni-toring of ERPs and standardization of perceived loud-ness of the tones, the performance of ERPs mightimprove.

REFERENCES

1. Novaes MA, Knobel E, Bork AM, Pavao OF, Nogueira-MartinsLA, Ferraz MB. Stressors in ICU: perception of the patient,relatives and health care team. Intensive Care Med 1999;25:1421–6

2. Kollef MH, Levy NT, Ahrens TS, Schaiff R, Prentice D, ShermanG. The use of continuous i.v. sedation is associated withprolongation of mechanical ventilation. Chest 1998;114:541–8

3. Rello J, Diaz E, Roque M, Valles J. Risk factors for developingpneumonia within 48 hours of intubation. Am J Respir Crit CareMed 1999;159:1742–6

4. Jacobi J, Fraser GL, Coursin DB, Riker RR, Fontaine D, WittbrodtET, Chalfin DB, Masica MF, Bjerke HS, Coplin WM, CrippenDW, Fuchs BD, Kelleher RM, Marik PE, Nasraway SA Jr,Murray MJ, Peruzzi WT, Lumb PD. Clinical practice guidelinesfor the sustained use of sedatives and analgesics in the criticallyill adult. Crit Care Med 2002;30:119–41

5. Kress JP, Pohlman AS, O’Connor MF, Hall JB. Daily interrup-tion of sedative infusions in critically ill patients undergoingmechanical ventilation. N Engl J Med 2000;342:1471–7

6. Kress JP, Pohlman AS, Hall JB. Sedation and analgesia in theintensive care unit. Am J Respir Crit Care Med 2002;166:1024–8

7. Ely EW, Truman B, Shintani A, Thomason JWW, Wheeler AP,Gordon S, Francis J, Speroff T, Gautam S, Margolin R, SesslerCN, Dittus RS, Bernard GR. Monitoring sedation status overtime in ICU patients: reliability and validity of the RichmondAgitation-Sedation Scale (RASS). JAMA 2003;289:2983–91

8. Sessler C, Jo Grap M, Ramsay M. Evaluating and monitoringanalgesia and sedation in the intensive care unit. Crit Care2008;12:S2

9. Kalkman CJ, Drummond JC. Monitors of depth of anesthesia,quo vadis? Anesthesiology 2002;96:784–7

10. Viertio-Oja H, Maja V, Sarkela M, Talja P, Tenkanen N,Tolvanen-Laakso H, Paloheimo M, Vakkuri A, Yli-Hankala A,Merilainen P. Description of the Entropy algorithm as applied inthe Datex-Ohmeda S/5 Entropy Module. Acta AnaesthesiolScand 2004;48:154–61

11. Schmidt GN, Bischoff P, Standl T, Hellstern A, Teuber O, SchulteEJ. Comparative evaluation of the Datex-Ohmeda S/5 EntropyModule and the Bispectral Index monitor during propofol-remifentanil anesthesia. Anesthesiology 2004;101:1283–90

12. Ellerkmann RK, Soehle M, Alves TM, Liermann VM, Wenning-mann I, Roepcke H, Kreuer S, Hoeft A, Bruhn J. Spectral entropyand bispectral index as measures of the electroencephalographiceffects of propofol. Anesth Analg 2006;102:1456–62

13. Vakkuri A, Yli-Hankala A, Talja P, Mustola S, Tolvanen-LaaksoH, Sampson T, Viertio-Oja H. Time-frequency balanced spectralentropy as a measure of anesthetic drug effect in central nervoussystem during sevoflurane, propofol, and thiopental anesthesia.Acta Anaesthesiol Scand 2004;48:145–53

14. Maksimow A, Snapir A, Sarkela M, Kentala E, Koskenvuo J,Posti J, Jaaskelainen SK, Hinkka-Yli-Salomaki S, Scheinin M,Scheinin H. Assessing the depth of dexmedetomidine-inducedsedation with electroencephalogram (EEG)-based spectral en-tropy. Acta Anaesthesiol Scand 2007;51:22–30

15. Plourde G. Auditory evoked potentials. Best Pract Res ClinAnaesthesiol 2006;20:129–39

16. Doi M, Morita K, Mantzaridis H, Sato S, Kenny GN. Predictionof responses to various stimuli during sedation: a comparison ofthree EEG variables. Intensive Care Med 2005;31:41–7

17. Rundshagen I, Schnabel K, Pothmann W, Schleich B, Schulte amEsch J. Cortical arousal in critically ill patients: an evokedresponse study. Intensive Care Med 2000;26:1312–8

18. Schulte-Tamburen AM, Scheier J, Briegel J, Schwender D, PeterK. Comparison of five sedation scoring systems by means ofauditory evoked potentials. Intensive Care Med 1999;25:377–82

19. Oei-Lim VLB, Dijkgraaf MGW, de Smet MD, White M, KalkmanCJ. Does cerebral monitoring improve ophthalmic surgicaloperating conditions during propofol-induced sedation? AnesthAnalg 2006;103:1189–95

20. Huang YY, Chu YC, Chang KY, Wang YC, Chan KH, TsouMY. Performance of AEP Monitor/2-derived composite in-dex as an indicator for depth of sedation with midazolam andalfentanil during gastrointestinal endoscopy. Eur J Anaesthe-siol 2007;24:252–7

21. Johansen JW, Sebel PS. Development and clinical application ofelectroencephalographic bispectrum monitoring. Anesthesiol-ogy 2000;93:1336–44

22. Rampil IJ. A primer for EEG signal processing in anesthesia.Anesthesiology 1998;89:980–1002

23. LeBlanc JM, Dasta JF, Kane-Gill SL. Role of the bispectral indexin sedation monitoring in the ICU. Ann Pharmacother2006;40:490–500

24. Simmons LE, Riker RR, Prato BS, Fraser GL. Assessing sedationduring intensive care unit mechanical ventilation with theBispectral Index and the Sedation-Agitation Scale. Crit CareMed 1999;27:1499–504

25. Riker RR, Fraser GL, Simmons LE, Wilkins ML. Validating theSedation-Agitation Scale with the Bispectral Index and VisualAnalog Scale in adult ICU patients after cardiac surgery. Inten-sive Care Med 2001;27:853–8

26. De Deyne C, Struys M, Decruyenaere J, Creupelandt J, Hoste E,Colardyn F. Use of continuous bispectral EEG monitoring toassess depth of sedation in ICU patients. Intensive Care Med1998;24:1294–8

27. Riker RR, Fraser GL. Sedation in the intensive care unit: refiningthe models and defining the questions. Crit Care Med2002;30:1661–3

28. Haenggi M, Ypparila H, Takala J, Korhonen I, Luginbuhl M,Petersen-Felix S, Jakob SM. Measuring depth of sedation withauditory evoked potentials during controlled infusion of propo-fol and remifentanil in healthy volunteers. Anesth Analg2004;99:1728–36, table of contents

29. Haenggi M, Ypparila H, Hauser K, Caviezel C, Korhonen I, TakalaJ, Jakob SM. The effects of dexmedetomidine/remifentanil andmidazolam/remifentanil on auditory-evoked potentials and elec-troencephalogram at light-to-moderate sedation levels in healthysubjects. Anesth Analg 2006;103:1163–9

30. Hyde M. The N1 response and its applications. Audiol Neu-rootol 1997;2:281–307

31. Naatanen R, Picton T. The N1 wave of the human electric andmagnetic response to sound: a review and an analysis of thecomponent structure. Psychophysiology 1987;24:375–425

32. Sessler CN, Gosnell MS, Grap MJ, Brophy GM, O’Neal PV,Keane KA, Tesoro EP, Elswick RK. The Richmond Agitation-Sedation Scale: validity and reliability in adult intensive careunit patients. Am J Respir Crit Care Med 2002;166:1338–44

33. Schnider TW, Minto CF, Gambus PL, Andresen C, Goodale DB,Shafer SL, Youngs EJ. The influence of method of administrationand covariates on the pharmacokinetics of propofol in adultvolunteers. Anesthesiology 1998;88:1170–82

34. Minto CF, Schnider TW, Shafer SL. Pharmacokinetics andpharmacodynamics of remifentanil. II. Model application. An-esthesiology 1997;86:24–33

35. Jolliffe IT. Principal component analysis. 2nd ed. Springer Seriesin Statistics. New York: Springer Verlag, 2002.

36. Ypparila H, Korhonen I, Tarvainen M, Musialowicz T, JakobSM, Partanen J. N100 auditory potential and electroencephalo-gram discriminate propofol-induced sedation levels. J ClinMonit Comput 2004;18:163–70

37. Smith WD, Dutton RC, Smith NT. Measuring the performanceof anesthetic depth indicators. Anesthesiology 1996;84:38–51

38. Absalom AR, Sutcliffe N, Kenny GNC. Effects of the auditorystimuli of an auditory evoked potential system on levels ofconsciousness, and on the bispectral index. Br J Anaesth2001;87:778–80

39. Walsh TS, Ramsay P, Lapinlampi TP, Sarkela MO, Viertio-OjaHE, Merilainen PT. An assessment of the validity of spectralentropy as a measure of sedation state in mechanically venti-lated critically ill patients. Intensive Care Med 2008;34:308–15

40. Simpson TP, Manara AR, Kane NM, Barton RL, Rowlands CA,Butler SR. Effect of propofol anaesthesia on the event-relatedpotential mismatch negativity and the auditory-evoked poten-tial N1. Br J Anaesth 2002;89:382–8

41. Ypparila H, Karhu J, Westeren-Punnonen S, Musialowicz T,Partanen J. Evidence of auditory processing during postop-erative propofol sedation. Clin Neurophysiol 2002;113:1357– 64


42. van Hooff JC, de Beer NA, Brunia CH, Cluitmans PJ, KorstenHH. Event-related potential measures of information processingduring general anesthesia. Electroencephalogr Clin Neuro-physiol 1997;103:268–81

43. Plourde G, Belin P, Chartrand D, Fiset P, Backman SB, Xie G,Zatorre RJ. Cortical processing of complex auditory stimuliduring alterations of consciousness with the general anestheticpropofol. Anesthesiology 2006;104:448–57

44. Scott JC, Ponganis KV, Stanski DR. EEG quantitation of narcoticeffect: the comparative pharmacodynamics of fentanyl andalfentanil. Anesthesiology 1985;62:234–41

45. Barr G, Anderson RE, Owall A, Jakobsson JG. Effects on thebispectral index during medium-high dose fentanyl inductionwith or without propofol supplement. Acta Anaesthesiol Scand2000;44:807–11

46. Ferreira DA, Nunes CS, Antunes LM, Santos IA, Lobo F, CasalM, Ferreira L, Amorim P. The effect of a remifentanil bolus onthe bispectral index of the EEG (BIS) in anaesthetized patientsindependently from intubation and surgical stimuli. Eur JAnaesthesiol 2006;23:305–10

47. Bouillon TW, Bruhn J, Radulescu L, Andresen C, Shafer TJ,Cohane C, Shafer SL. Pharmacodynamic interaction betweenpropofol and remifentanil regarding hypnosis, tolerance oflaryngoscopy, bispectral index, and electroencephalographicapproximate entropy. Anesthesiology 2004;100:1353–72

48. Schraag S, Flaschar J, Schleyer M, Georgieff M, Kenny GN. Thecontribution of remifentanil to middle latency auditory evokedpotentials during induction of propofol anesthesia. AnesthAnalg 2006;103:902–7

49. Manyam SC, Gupta DK, Johnson KB, White JL, Pace NL, Westen-skow DR, Egan TD. When is a Bispectral Index of 60 too low?:Rational processed electroencephalographic targets are dependenton the sedative-opioid ratio. Anesthesiology 2007;106:472–83

50. Lorenz J, Beck H, Bromm B. Differential changes of laser evokedpotentials, late auditory evoked potentials and P300 undermorphine in chronic pain patients. Electroencephalogr ClinNeurophysiol 1997;104:514–21

51. Kouri EM, Lukas SE, Mendelson JH. P300 assessment of opiateand cocaine users: effects of detoxification and buprenorphinetreatment. Biol Psychiatry 1996;40:617–28


Case Report

Evoked Potential Monitoring Identifies PossibleNeurological Injury During Positioning for Craniotomy

Zirka H. Anastasian, MD*

Brian Ramnath, EEG/EP T, CNIM†

Ricardo J. Komotar, MD‡

Jeffrey N. Bruce, MD‡

Michael B. Sisti, MD‡

Edward J. Gallo, EEG T, CNIM†

Ronald G. Emerson, MD†

Eric J. Heyer, MD, PhD*†

Somatosensory-evoked potential (SSEP) monitoring is commonly used to detectchanges in nerve conduction and prevent impending nerve injury. We present acase series of two patients who had SSEP monitoring for their surgical craniotomyprocedure, and who, upon positioning supine with their head tilted 30°–45°,developed unilateral upper extremity SSEP changes. These SSEP changes werereversed when the patients were repositioned. These cases indicate the clinicalusefulness of monitoring SSEPs while positioning the patient and adjustingposition accordingly to prevent injury.(Anesth Analg 2009;109:817–821)

Neurologic injury secondary to positioning is a sig-nificant perioperative problem and a common causeof patient injury in the practice of anesthesiology.Somatosensory-evoked potential (SSEP) monitoring isreproducible, reliable, and commonly used during sur-gical procedures to detect changes in electrophysiologi-cal conduction in peripheral nerves and central nervepathways and, thus, to prevent nervous system dam-age.1 A significant change in the SSEP responses isindicated by a decrease in amplitude and/or an increasein latency. Changes in SSEP responses may be due tospinal instrumentation, hypoperfusion, hypothermia,anesthetic drugs, and positioning.

SSEP monitoring has also been noted to be useful inevaluating upper extremity conduction changes relatedto positioning. Changes in nerve conduction are ex-pected to occur before permanent nerve injury, thus,repositioning that reverses SSEP conduction changesshould prevent perioperative peripheral nerve injury.2–4

The following case series is the first, to our knowl-edge, to describe two cases of asymmetric SSEP changesin the brachial plexus after positioning for craniotomy

that resolved after repositioning. It underlines theclinical usefulness of monitoring SSEPs while posi-tioning the patient and adjusting the position ac-cordingly to prevent peripheral neurological injury,a common cause of patient injury and malpracticeclaims.

CASE DESCRIPTIONSCase 1

A 73-yr-old woman with a history of progressive loss ofcoordination and left-sided hearing presented for a suboc-cipital craniectomy for acoustic neuroma. Her medical his-tory was significant for hypertension and diabetes. Themagnetic resonance imaging showed an acoustic neuromawith enlarged ventricles and chronic displacement of thecerebellum and brainstem.

After induction of general anesthesia, the patient waspositioned supine. Her head was turned approximately 45°toward the right and fixed with a Mayfield neurosurgicalhead holder. A “sandbag” was placed under the mattress onthe left side of the operating table to extend the neck and leftshoulder.

Electrophysiologic monitoring was performed bilater-ally for SSEPs in upper (median nerve) and lower (poste-rior tibial nerve) extremities, brainstem auditory-evokedpotentials, and motor-evoked potentials. SSEPs from themedian nerves were recorded using needle electrodesplaced at Erb’s point over the brachial plexus for assessingperipheral conduction and on the scalp at CP3 and CP4locations, for assessing central conduction.

SSEP needle electrodes were placed on the patient beforepositioning. Positioning required 8 min, after which, SSEPswere recorded from both upper and lower extremities.Standard filter setting for these SSEPs is 30–1500 Hz, andstandard stimulation parameters were used including rate of4.7/s, 20 mA, and 0.3 ms duration. At the start of recording,after a 1-min interval of acquiring a steady signal, the SSEPamplitude from stimulation of the left median nerve was

From the Departments of *Anesthesiology, †Neurology, and‡Neurological Surgery, New York-Presbyterian Hospital, ColumbiaUniversity, New York City, New York.

Accepted for publication May 18, 2009.EJH was supported in part by a grant from the NIA (RO1

AG17604).Address correspondence and reprint requests to Zirka H. Anas-

tasian, MD, Department of Anesthesiology, Columbia University,622 West 168th St., New York City, NY 10032. Address e-mail [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181b086bd


noted to be reduced at Erb’s point on all recording channelsin comparison with contralateral recordings. When thepatient’s left shoulder was raised to reduce extension of theneck and shoulder, the SSEPs from stimulation of the leftmedian nerve were improved at recordings from Erb’spoint and subcortical and cortical electrodes and becameequal in amplitude to the contralateral side in 4 min (Fig.1). Surgical exposure was not compromised significantlywith this adjustment.Case 2

A 62-yr-old man with a history of transient diffuseextremity weakness presented for left temporal and suboc-cipital craniotomy for subtotal resection of a skull basemeningioma. His medical history was significant for hyper-tension, gout, and diverticulitis. A magnetic resonance im-aging showed the presence of a left-sided mass consistentwith a meningioma, at the level of the clivus and petrousbone, with compression of the pons and ventricular dilation.

After inducing general anesthesia, the patient was posi-tioned supine. His head was turned toward the right by 30°,slightly extended and fixed with a Mayfield neurosurgicalhead holder. A “sandbag” was placed under the mattress onthe left side of the operating table to extend the neck and leftshoulder.

Electrophysiologic monitoring was performed bilaterally forSSEPs in upper (median nerve) and lower (posterior tibial nerve)extremities, and brainstem auditory-evoked potentials. Motor-evoked potentials were not obtained because most of the

surgery was performed under microscope guidance. SSEPsfrom the median nerves were recorded using needle electrodesplaced at Erb’s point over the brachial plexus for assessingperipheral conduction and on the scalp at CP3 and CP4locations, for assessing central conduction.

SSEP needle electrodes were placed on the patient beforepositioning. Positioning required 10 min, after which, SSEPswere recorded from both upper and lower extremities.Standard filter settings for these SSEPs were the same as theprevious case. At the start of recording, after a 1-min intervalof acquiring a steady signal, the SSEP amplitude fromstimulation of the left median nerve was reduced at Erb’spoint on all recording channels in comparison with contralat-eral recordings. When the patient’s left shoulder was raised toreduce extension of the neck and shoulder, the SSEPs fromstimulation of the left median nerve were improved at record-ings from Erb’s point and subcortical and cortical electrodesand became equal in amplitude to the contralateral side in 6min (Fig. 2). Surgical exposure was not compromised signifi-cantly in this position.

Both patients gave witnessed verbal informed consent topublish any collected data.

DISCUSSIONThe reversibility of upper extremity SSEP changes

with repositioning in our patients establishes a causeand effect relationship between positioning and SSEP

Figure 1. Somatosensory-evoked potential (SEEP) changes in the left median nerve in Case 1. SSEPs from bilateral mediannerves were recorded using needle electrodes placed at Erb’s point over the brachial plexus, for assessing peripheralconduction, and on the scalp at CP3 and CP4 locations, for assessing central conduction. Time in minutes is recorded on they axis. From the start of the recordings (time � 1 min), there is a unilateral decrease in the amplitude of the left median nerverecordings compared with that of the right median nerve. This difference exists at both peripheral (Erb’s) and central (CP3and CP4) recordings, suggesting a peripheral mechanism. With repositioning of the shoulder, the amplitude increases on theleft side with time in central and peripheral recordings, approaching the amplitude on the right side.


change. Although we cannot be certain that the ob-served SSEP changes would have been associated witha permanent deficit, if the changes indeed heraldedischemia of the nerves, clinical neuropathy would belikely after a lengthy procedure. In addition, althoughnot routine in our center for cases not involvingcervical instability, these cases identify the utility ofpreposition baseline SSEPs, especially because thepatients will be monitored during the case. This wouldclearly identify positioning changes by having pre-and postrecordings.

SSEP changes caused by positioning patients havebeen reported for prone2,5,6 and supine spine sur-gery,7–10 cardiac,2,4 and orthopedic surgeries.10–12 Ourcase report shows a change in SSEPs of the brachialplexus during positioning for craniotomy.

The incidence of SSEP changes during positioningof the prone spine surgery patient ranges from 3.6% to15%. Schwartz et al.2 found a 30% decrease in ulnarnerve SSEP amplitude in 3.6% of pediatric patientshaving scoliosis correction. O’Brien et al.5 reported a15% prevalence of brachial plexopathy during lumbarand spinal deformity surgery (�60% decrease in am-plitude or �10% increase in latency). Kamel et al.6

found that the lateral decubitus position (7.5%) andprone “superman” position (7.0%) had a higher inci-dence of position-related upper extremity SSEP changescompared with other positions including supine, armstucked, and arms out (1.8%–3.2%).

The incidence of positioning changes in SSEP re-cordings during anterior spine surgery is lower thanthat of prone spine surgery.13 Schwartz et al.7 foundthat 1.8% of patients undergoing anterior cervicalspine surgery showed intraoperative SSEP changessecondary to positioning. SSEP changes are morefrequent in patients with myelopathy who were hav-ing anterior spine surgery.8

There has been only one study to describe position-ing changes during SSEP monitoring for craniotomysurgery. Deinsberger et al.14 performed SSEP monitor-ing for positioning of patients for posterior fossasurgery in the semisitting position. Monitoring of themedian and tibial nerve was recorded for 55 consecu-tive patients. SSEPs of the median nerve showed nochanges while placing patients in the sitting position;however, tibial SSEP recordings were altered in 14cases (25%).

Figure 2. Somatosensory-evoked potential (SSEP) changes in left median nerve in Case 2. SSEPs from bilateral median nerveswere recorded using needle electrodes placed at Erb’s point over the brachial plexus, for assessing peripheral conduction, andon the scalp at CP3 and CP4 locations, for assessing central conduction. Time in minutes is recorded on the y axis. Uponstimulation of the left median nerve, there is no SSEP response from the start of the recordings (time � 1 min). Again, thedifference exists at both peripheral (Erb’s) and central (CP3 and CP4) recordings, suggesting a peripheral mechanism. Withrepositioning of the shoulder, the amplitude increases on the left side with time in central and peripheral recordings,approaching the amplitude on the right side.


We reviewed all cases of craniotomy for skull basetumors and acoustic neuromas in a 2-yr period toderive an incidence of SSEP changes during thiscategory of neurosurgical procedure. At our institu-tion, all craniotomy cases for acoustic neuromas andskull base tumors receive SSEP neuromonitoring. Wefound 83 cases performed in the 2-yr period betweenJanuary 2007 and December 2008. Of these cases, wereviewed the neuromonitoring records and identifiedtwo cases with SSEP changes upon positioning, whichare described in this case series: an incidence of 2.4%.This is approximately the incidence for SSEP changesfor anterior cervical spine surgery (1.8%), but less thanthat found in prone and lateral decubitus positioning.

The clinical correlation of SSEPs and clinical find-ings has been the subject of several investigations.Prielipp et al.15 studied the onset of clinical symptomsand SSEP changes in the ulnar nerve in 50 volunteerswith their arm in 30°–90° of abduction, as well as insupination, neutral orientation, and pronation. Half ofthe patients who developed SSEP changes did notdevelop clinical symptoms, two of which manifestedsevere SSEP changes (�60% decrease in amplitude). Incontrast, Lorenzini and Poterack16 monitored SSEPs atthe median and ulnar nerves in awake volunteersplaced in a prone position as their arms were movedin a step-wise cephalad position. Three of sevenpatients developed upper extremity symptoms de-scribed as tingling, numbness, or aching in the hand,forearm, or upper arm without changes in their SSEPs,suggesting that SSEP monitoring is imperfect in de-tecting positioning injury. However, volunteer studiesdo not apply directly to anesthetized patients, who areoften placed in positions that awake patients could nottolerate.

These data demonstrate the false positive and nega-tive predictive values of clinical peripheral neuro-pathic changes based on SSEP monitoring. There may,indeed, be instances in which SSEP changes, or thelack thereof, may be misleading in predicting postop-erative clinical neuropathy. However, many studiesthat have evaluated SSEP monitoring with postopera-tive peripheral neurological changes studied SSEPchanges over a short interval. In the study by Loren-zini and Poterack,16 recordings for SSEP signals weremade 10–15 min after positioning the arm. The studyby Prielipp et al.15 was performed for a maximum of60 min, and on average, patients experienced clinicalsymptoms after 37 min, with a range of 20–59 min. Incontrast, our first case took 6 h and 50 min, and thesecond case took 11 h and 33 min. It is unclear, butseems likely, that changes observed by SSEP monitor-ing would eventually lead to clinical neuropathyduring these lengthy procedures.

To determine if we had clinical peripheral neuropathychanges that were not predicted by SSEPs, we reviewedthe case records of our department obtained from resi-dent postoperative visits, consults, and patient phonecalls after hospital discharge. From January 2007 to

December 2008, 65,041 cases were reviewed. Of all typesof surgical cases, 10 cases were identified in whichpostoperative peripheral neuropathy was reported: anincidence of 0.02%. None of these cases were for crani-otomy. The major limitation of this type of review is thatit is retrospective, thus underreporting of a complicationcan underestimate the incidence of peripheral neuropa-thy. However, with SSEP monitoring for cases, we maybe decreasing the incidence of peripheral neuropathydue to positioning.

Although the incidence of peripheral nerve injury islow, it does remain a common cause of professionalliability in the practice of anesthesiology. Lee et al.17

reviewed the American Society of Anesthesiologistsclosed-claims analysis and found that peripheralnerve injury was the complication recorded in 21% ofneurosurgical closed claims. This finding emphasizesthe importance of taking measures to prevent periph-eral nerve damage, including vigilance of neuromoni-toring changes.

These cases demonstrate that changes in SSEPs ofthe brachial plexus can occur during positioning forskull base craniotomy and acoustic neuromas. Thiscase series, in addition to the literature on this topic,underlines the clinical usefulness of monitoring SSEPsduring and after positioning the patient and adjustingposition accordingly to prevent neurological injury.

REFERENCES

1. Epstein NE, Danto J, Nardi D. Evaluation of intraoperativesomatosensory-evoked potential monitoring during 100 cervicaloperations. Spine 1993;18:737–47

2. Schwartz DM, Drummond DS, Hahn M, Ecker ML, Dormans JP.Prevention of positional brachial plexopathy during surgicalcorrection of scoliosis. J Spinal Disord 2000;13:178–82

3. Jellish WS, Martucci J, Blakeman B, Hudson E. Somatosensoryevoked potential monitoring of the brachial plexus to predictnerve injury during internal mammary artery harvest: intraop-erative comparisons of the rultract and pittman sternal retrac-tors. J Cardiothorac Vasc Anesth 1994;8:398–403

4. Hickey C, Gugino LD, Aglio LS, Mark JB, Son SL, Maddi R.Intraoperative somatosensory evoked potential monitoring pre-dicts peripheral nerve injury during cardiac surgery. Anesthe-siology 1993;78:29–35

5. O’Brien MF, Lenke LG, Bridwell KH, Padberg A, Stokes M.Evoked potential monitoring of the upper extremities duringthoracic and lumbar spinal deformity surgery: a prospectivestudy. J Spinal Disord 1994;7:277–84

6. Kamel IR, Drum ET, Koch SA, Whitten JA, Gaughan JP, BarnetteRE, Wendling WW. The use of somatosensory evoked potentialsto determine the relationship between patient positioning andimpending upper extremity nerve injury during spine surgery:a retrospective analysis. Anesth Analg 2006;102:1538–42

7. Schwartz DM, Sestokas AK, Hilibrand AS, Vaccaro AR, Bose B,Li M, Albert TJ. Neurophysiological identification of position-induced neurologic injury during anterior cervical spine sur-gery. J Clin Monit Comput 2006;20:437–44

8. Kombos T, Suess O, Da Silva C, Ciklatekerlio O, Nobis V, BrockM. Impact of somatosensory evoked potential monitoring oncervical surgery. J Clin Neurophysiol 2003;20:122–8

9. Jones SC, Fernau R, Woeltjen BL. Use of somatosensory evokedpotentials to detect peripheral ischemia and potential injuryresulting from positioning of the surgical patient: case reportsand discussion. Spine J 2004;4:360–2

10. Swenson JD, Hutchinson DT, Bromberg M, Pace NL. Rapidonset of ulnar nerve dysfunction during transient occlusion ofthe brachial artery. Anesth Analg 1998;87:677–80


11. Mills WJ, Chapman JR, Robinson LR, Slimp JC. Somatosensoryevoked potential monitoring during closed humeral nailing: apreliminary report. J Orthop Trauma 2000;14:167–70

12. Porter SS, Black DL, Reckling FW, Mason J. Intraoperativecortical somatosensory evoked potentials for detection of sciaticneuropathy during total hip arthroplasty. J Clin Anesth 1989;1:170–6

13. Labrom RD, Hoskins M, Reilly CW, Tredwell SJ, Wong PK.Clinical usefulness of somatosensory evoked potentials fordetection of brachial plexopathy secondary to malpositioning inscoliosis surgery. Spine 2005;30:2089–93

14. Deinsberger W, Christophis P, Jodicke A, Heesen M, Boker DK.Somatosensory evoked potential monitoring during positioningof the patient for posterior fossa surgery in the semisittingposition. Neurosurgery 1998;43:36–40; discussion 40–2

15. Prielipp RC, Morell RC, Walker FO, Santos CC, Bennett J,Butterworth J. Ulnar nerve pressure: influence of arm positionand relationship to somatosensory evoked potentials. Anesthe-siology 1999;91:345–54

16. Lorenzini NA, Poterack KA. Somatosensory evoked potentialsare not a sensitive indicator of potential positioning injury in theprone patient. J Clin Monit 1996;12:171–6

17. Lee LA, Posner KL, Cheney FW, Domino KB. ASA closed claimsproject: an analysis of claims associated with neurosurgicalanesthesia. Anesthesiology 2003;99:A362


Patient SafetySection Editor: Sorin J. Brull

The Diagnostic Value of the Upper Lip Bite TestCombined with Sternomental Distance, ThyromentalDistance, and Interincisor Distance for Prediction of EasyLaryngoscopy and Intubation: A Prospective Study

Zahid Hussain Khan, MD*

Mostafa Mohammadi, MD*

Mohammad R. Rasouli, MD†

Fahimeh Farrokhnia, MD*

Razmeh Hussain Khan‡

BACKGROUND: Accuracy of upper lip bite test (ULBT) has been compared with theMallampati classification. In this study, we investigated whether the combinationof the ULBT classification with sternomental distance (SMD), thyromental distance(TMD), and interincisor distance (IID) or a composite score can improve the abilityto predict easy laryngoscopy and intubation compared with each test alone.METHODS: In a prospective study, 380 patients who were scheduled for electivesurgery were selected randomly and enrolled in the study. Before inducinganesthesia, the airways were assessed, and ULBT class, SMD, TMD, and IIDdetermined. Laryngoscopic view according to the Cormack and Lehane gradingsystem was determined after induction of anesthesia and Grades 3 and 4 definedas “difficult intubation.” By using receiver operating characteristic analysis, thebest cutoff points of the tests were calculated. Finally, sensitivity, specificity,positive and negative predictive values and accuracy of these tests and theircombinations with the ULBT were calculated.RESULTS: The prevalence of difficult intubation was 5% (n � 19). Class III ULBT, IID�4.5 cm, TMD �6.5 cm, and SMD �13 cm were defined as predictors of difficultintubation. There was no significant difference regarding difficult intubation basedon gender (P � 0.05), whereas there were significant differences between the oldertests and laryngeal view (P � 0.05, Mc-Nemar test). Specificity and accuracy of theULBT were significantly higher than TMD, SMD, and IID individually (specificitywas 91.69%, 82.27%, 70.64%, and 82.27%, respectively, and accuracy was 91.05%,71.32%, 81.84%, and 76.58%, respectively). The combination of the ULBT with SMDprovided the highest sensitivity.CONCLUSION: We conclude that the specificity and accuracy of the ULBT is signifi-cantly higher than the other tests and is more accurate in airway assessment.However, the ULBT in conjunction with the other tests could more reliably predicteasy laryngoscopy or intubation.(Anesth Analg 2009;109:822–4)

Although many advances have been made and manytime-tested methods have been used to overcome theconundrum of an unanticipated difficult laryngoscopictracheal intubation, most tests are not reliable.1 Allpreoperative airway assessment tests are characterizedby low sensitivity, reasonable specificity, low positivepredictive value (PPV), and significant false positives.2–4

Although our initial evaluation of the upper lip bitetest (ULBT1) showed greater specificity and accuracy

compared with the Mallampati classification, theULBT has not been compared with other tests, such asmeasurement of sternomental distance (SMD), thyro-mental distance (TMD), and interincisor distance(IID). In this study, the ULBT is compared with thesetests for preoperative assessment of airway and pre-diction of ease of tracheal intubation. We also aim todescribe a composite measure that combines ULBTwith each of the other measures.

METHODSThree hundred eighty ASA I patients older than 16

yr scheduled for elective surgical procedures requir-ing endotracheal intubation were enrolled in the studyafter approval of the ethics committee of the univer-sity. Verbal informed consent was obtained from eachpatient before starting the study. Patients with anyairway abnormality or obvious neck pathology wereexcluded.

From the *Department of Anesthesiology, Imam KhomeiniMedical Center, Tehran University of Medical Sciences; †School ofMedicine, Tehran University of Medical Sciences; and ‡TehranUniversity of Medical Sciences, Tehran, Iran.

Accepted for publication April 18, 2009.Address correspondence and reprint requests to Zahid Hussain

Khan, MD, Department of Anesthesiology, Imam Khomeini Medi-cal Center, Tehran University of Medical Sciences, Keshavarz Blvd.,Tehran 1419733141, Iran. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181af7f0d


The SMD was measured in supine position with thehead fully extended and with the mouth closed. Thestraight distance between the upper border of the ma-nubrium sterni and the bony point of the mentum wasmeasured. For TMD, the straight distance between theupper border of the thyroid cartilage and the bony pointof mentum was measured.5 IID was measured when thepatient opened his or her mouth, and the distancebetween incisors was obtained. The ULBT class wasdetermined according to the following criteria: Class I,lower incisors can bite the upper lip above the vermilionline; Class II, lower incisors can bite the upper lip belowthe vermilion line; and Class III, lower incisors cannotbite the upper lip.1

Anesthesia was induced with midazolam (1 mg),fentanyl (2 �g/kg), thiopental (5 mg/kg), and atra-curium (0.5 mg/kg). With the head in the sniffingposition, laryngoscopy with a Macintosh 3 blade wasattempted, and the view determined using theCormack-Lehane (C-L) grading system.6 C-L Grades 1and 2 were categorized as “easy intubations” andGrades 3 and 4 as “difficult intubations.” All preop-erative airway assessments and measurements wereperformed by a third-year resident, and subsequentlaryngoscopies and C-L grading were conducted andscored by one of the authors (ZHK), who was blindedto the observations made preoperatively.

Statistical analysis was performed using SPSS soft-ware version 10.5 (SPSS, Chicago, IL) and MedCalcversion 9.2 (MedCalc Software, Maria-kerke, Bel-gium). Receiver operating characteristic (ROC) analy-sis was used to determine the accuracy of each testand the combination of ULBT with the other tests(SMD, TMD, and IID). For this purpose, a binaryvariable was defined. If both the ULBT and the othertest had predicted easy intubation based on obtainedcutoff points, the new variable was coded as “easy.” Ifone or both of them had predicted difficult intubation,the variable value was coded as “difficult intubation.”Sensitivity, specificity, accuracy, PPV, and negativepredictive values (NPV) were then calculated. Thebest cutoff points were determined by selecting apoint where the sensitivity and specificity were ap-proximately equal. Data were analyzed by using Fish-er’s exact and Mc-Nemar tests, and a P value �0.05was considered statistically significant.

RESULTSThree hundred nine patients (209 men) were in-

cluded in the study. The mean age was 34 � 10 yr(mean � sd). Intubation was difficult in 19 patients(5%, C-L Grades of 3 and 4 in 17 and two cases,respectively). The ULBT classes versus C-L grades aredepicted in Figure 1.

By using receiver operating characteristic analysis,Class III ULBT, IID �4.5 cm, TMD �6.5 cm, and SMD�13 cm were defined as cutoff points for difficultintubation (Table 1). These criteria were determined topredict difficult intubation.

There was no significant difference regarding diffi-cult intubation according to gender (P � 0.05, �2 test).However, there were differences by gender with re-gard to the tests and C-L grades (P � 0.05, Mc-Nemartest). A combination of each test with the ULBTshowed the highest sensitivity for the combination ofULBT with SMD, whereas the highest specificity wasfound in the combination of ULBT with TMD.

DISCUSSIONOur results show that the ULBT has higher accu-

racy and specificity than the other tests and also a highNPV. The results also indicate that Class I ULBT ismore likely to predict an easy intubation than theother tests. We further found that the combination ofSMD and ULBT improved the sensitivity of ULBTwhen compared with the latter alone. This finding wasthe hallmark of our results when the tests werecombined. However, the combination of the ULBTwith the other tests did not show any superiority tothe ULBT alone with regard to specificity. A combi-nation of these tests did not enhance PPV, NPV, andaccuracy compared with those obtained with theULBT alone.

One of the most important challenges in usingSMD, TMD, and IID is the quantitative nature of thesetests,7,8 whereas the classification of patients based onthe ULBT is of a qualitative nature, making differen-tiation of classes easy and precise. In brief, the differ-ences between the ULBT and the other tests are thosebetween continuous and discrete variables. Thus, theULBT is associated with the least interobserver vari-ability, which adds to its advantage as an airwayassessment test. These findings are consistent with aprevious report by Eberhart et al.,9 which showed thatthe interobserver reliability of the ULBT is higher thanthe Mallampati classification.

The prevalence of difficult intubation in our studywas 5%; however, failure to intubate was not encoun-tered. Our results corroborate those of a previousstudy, which reported a prevalence of 4.7% for diffi-cult intubation.3 Wilson et al.10 suggested five riskfactors in predicting difficult intubation, including

Figure 1. The upper lip bite test (ULBT) classes versusCormack-Lehane (C-L) grading.


weight (P � 0.05), head and neck movement (P �0.001), jaw movement (P � 0.001), receding mandible(P � 0.001), and protruding (“buck”) upper incisors(P � 0.001). The ULBT when tested initially had thepotential to evaluate both jaw movement and buckteeth simultaneously, providing additional supportfor its use as an airway assessment test.

Sensitivity, specificity, and accuracy of the ULBT(78.95%, 91.96%, and 91.05%, respectively) were simi-lar to those reported in the earlier study (76.5%, 88.7%,and 88%, respectively).1

The ULBT has high specificity and NPV, making itsuperior in identifying easy tracheal intubation andlaryngoscopy. The sensitivity and specificity of SMD andTMD corroborate previous data.2 With regard to thecombination of ULBT and other tests, we found that thecombination of the SMD and the ULBT had a highersensitivity than the ULBT alone; however, this combina-tion had lower specificity and PPV than the ULBT alone.

Our results differ from those of Richa et al.,11 whichshowed a low sensitivity for the combination of theULBT with the TMD and ULBT with SMD (18.7% and15.6%, respectively) but high specificity for thesecombinations (99% and 98%, respectively). The PPV ofthe test combinations were 60% and 50%, respectively,whereas in our study, these combinations had lowerPPV.11 Because the predictive values depend on thevalues of sensitivity, specificity, and prevalence(which was higher in their study), this could explainthe difference between our results and theirs.

A test to predict difficult intubation should have highsensitivity, so that it will identify most patients in whomintubation will truly be difficult.7 It should also have ahigh PPV, so that only few patients with airways actu-ally easy to intubate are subjected to the protocol formanagement of a difficult airway.12,13 Similarly, a testshould have a high NPV to correctly predict the ease oflaryngoscopy and intubation. It is being argued that bothlong and short TMD portend difficulty in correctlyanticipating the laryngeal view,14 which challenges thevalidity of TMD as a useful screening test. On the otherhand, the ULBT has the ability to assess jaw movementand protruding incisors simultaneously, enhancing itspredictability. In conclusion, despite the fact that thisstudy showed acceptable sensitivity and PPV of ULBT incomparison with the other tests, the ULBT is a test with

high specificity and NPV, making it a favorable test foridentifying easy intubations and laryngoscopy. Thesefindings are in agreement with those of Eberhart et al.9

However, we suggest applying a combination of assess-ment methods in predicting the ease of intubation. Sucha combination is preferable because anatomic predictorsof difficult intubation carry a low-sensitivity rate whenused alone, whereas a multivariate composite risk indexmay achieve better results than single, independentcriteria.

REFERENCES

1. Khan ZH, Kashfi A, Ebrahimkhani E. A comparison of theupper lip bite test (a simple new technique) with modifiedMallampati classification in predicting difficulty in endotra-cheal intubation: a prospective blinded study. Anesth Analg2003;96:595–9

2. Savva D. Prediction of difficult tracheal intubation. Br J Anaesth1994;73:149–53

3. Rose DK, Cohen MM. The airway: problems and predictions in18,500 patients. Can J Anaesth 1994;41:372–83

4. Samsoon GL, Young JR. Difficult tracheal intubation: a retro-spective study. Anaesthesia 1987;42:487–90

5. Karkouti K, Rose DK, Wigglesworth D, Cohen MM. Predictingdifficult intubation: a multivariable analysis. Can J Anaesth2000;47:730–9

6. Cormack RS, Lehane J. Difficult tracheal intubation in obstetrics.Anaesthesia 1984;39:1105–11

7. Arne J, Descoins P, Fusciardi J, Ingrand P, Ferrier B, BoudiguesD, Aries J. Preoperative assessment for difficult intubation ingeneral and ENT surgery: predictive value of a clinical multi-variate risk index. Br J Anaesth 1998;80:140–6

8. Karkouti K, Rose DK, Ferris LE, Wigglesworth DF, Meisami-Fard T, Lee H. Inter-observer reliability of ten tests used forpredicting difficult tracheal intubation. Can J Anaesth 1996;43:554–9

9. Eberhart LH, Arndt C, Cierpka T, Schwanekamp J, Wulf H,Putzke C. The reliability and validity of the upper lip bite testcompared with the Mallampati classification to predict difficultlaryngoscopy: an external prospective evaluation. Anesth Analg2005;101:284–9

10. Wilson ME, Spiegelhalter D, Robertson JA, Lesser P. Predictingdifficult intubation. Br J Anaesth 1988;61:211–6

11. Richa F, Yazbeck P, Yazigi A, Karim N, Antakly MC. Value ofthe association of the upper lip bite test (ULBT) with other testsin predicting difficulty of endotracheal intubation. Anesthesiol-ogy 2005:A1418 [abstract]

12. Tse JC, Rimm EB, Hussain A. Predicting difficult endotrachealintubation in surgical patients scheduled for general anesthesia:a prospective blind study. Anesth Analg 1995;81:254–8

13. Merah NA, Wong DT, Foulkes-Crabbe DJ, Kushimo OT, BodeCO. Modified Mallampati test, thyromental distance and inter-incisor gap are the best predictors of difficult laryngoscopy inWest Africans. Can J Anaesth 2005;52:291–6

14. Brodsky JB, Lemmens HJ, Brock-Utne JG, Vierra M, Saidman LJ.Morbid obesity and tracheal intubation. Anesth Analg 2002;94:732–6

Table 1. Area Under the ROC Curve, Sensitivity, Specificity, Positive and Negative Predictive Values, and Accuracy of InterincisorDistance (IID), Thyromental Distance (TMD), Sternomental Distance (SMD), and Upper Lip Bite Test (ULBT) Are Being Shown

Area under the ROC curve Sensitivity Specificity Positive predictive value Negative predictive value Accuracy

IID �4.5 cm 0.72 (0.6–0.85) 68.4 (46.7–84.4) 77.0 (75.9–77.9)* 13.5 (9.3–16.7) 97.8 (96.4–99) 76.5 (74.2–78.2)*TMD �6.5 cm 0.78 (0.66–0.89) 73.6 (52.1–88) 82.2 (81.1–83)* 17.9 (12.7–21.4) 98.3 (97–99.2) 81.8 (79.7–83.3)*SMD �13.5 cm 0.77 (0.67–0.87) 84.2 (63.1–94.4) 70.6 (69.5–71.2)* 13.1 (9.8–14.7)* 98.8 (97.3–99.6) 71.3 (69.2–72.3)*ULBT class III 0.85 (0.74–0.96) 78.9 (58.3–91.3) 91.9 (90.9–92.6) 33.3 (25.2–39.4) 98.8 (97.6–99.5) 91.0 (89.3–92.5)IID � ULBT 0.77 (0.73–0.81) 78.9 (57.4–91.4) 76.2 (75–76.8) 14.9 (10.8–17.2) 98.6 (97.1–99.4) 76.3 (74.2–77.6)TMD � ULBT 0.79 (0.74–0.83) 78.9 (57.5–91.4) 79.8 (78.8–80.4) 17.0 (12.4–19.7) 98.6 (97.2–99.4) 79.7 (77.6–81)SMD � ULBT 0.76 (71–80) 84.2 (63.1–94.4) 67.9 (66.8–68.4) 12.1 (9.1–13.6) 98.8 (97.2–99.6) 68.7 (66.6–69.7)

Negative predictive value for all tests is high, indicating that all tests can predict easy intubation readily.ROC � Receiver operating characteristic.* Significant differences with the similar parameter in ULBT (P � 0.05, Fisher’s exact test).

824 Easy Laryngoscopy Using ULBT ANESTHESIA & ANALGESIA

A Macintosh Laryngoscope Blade for VideolaryngoscopyReduces Stylet Use in Patients with Normal Airways

Andre van Zundert, MD, PhD,FRCA*†

Ralph Maassen, MD‡§

Ruben Lee, BE�

Remi Willems, MD‡§

Michel Timmerman, MD‡§

Marc Siemonsma, MD‡§

Marc Buise, MD*

Marco Wiepking, MD*

BACKGROUND: Although most tracheal intubations with direct laryngoscopy are not per-formed with a styletted endotracheal tube, it is recommended that a stylet can be used withindirect videolaryngoscopy. Recently, there were several reports of complications associ-ated with styletted endotracheal tubes and videolaryngoscopy. In this study, we comparedthree videolaryngoscopes (VLSs) in patients undergoing tracheal intubation for electivesurgery: the GlideScope� Ranger™ (GlideScope, Bothell, WA), the V-MAC™ Storz� BerciDCI� (Karl Storz, Tuttlingen, Germany), and the McGrath� (McGrath series 5, Aircraftmedical, Edinburgh, UK) and tested whether it is feasible to intubate the trachea of patientswith indirect videolaryngoscopy without using a stylet.METHODS: Four hundred fifty consecutive adults (ASA PS I–II) undergoing trachealintubation for elective surgery were randomly allocated for airway managementwith one of the three devices. Anesthesia induction for tracheal intubationconsisted of fentanyl-propofol-rocuronium. An independent anesthesiologist usedthe Cormack-Lehane grading system to score an initial direct laryngoscopic viewusing a classic metal Macintosh blade. After subsequent positive-pressure ventila-tion using a face mask and an oxygen-sevoflurane mixture for 1 min, the tracheawas intubated using one of the three VLSs. During intubation, the following datawere collected: intubation time, number of intubation attempts, use of extra tools tofacilitate intubation, and overall satisfaction score of the intubation conditions.RESULTS: The trachea of every patient was intubated using the VLSs, and none of thepatients required conversion to the classic Macintosh laryngoscope. All three VLSsoffered equal or better view of the glottis as assessed by the mean Cormack-Lehanegrade, compared with the traditional Macintosh laryngoscopy, including a largerviewing angle of the glottic entrance. The average intubation time was 34 � 20 s forthe GlideScope, 18 � 12 s for the V-MAC Storz, and 38 � 23 s for the McGrath VLS.Intubation with the Storz was faster (P � 0.05) than the other two VLS tested andnecessitated fewer additional tools (P � 0.01), resulting in a higher first-passsuccessful intubation rate. A stylet had to be used in 7% of the patients in the Storzgroup versus about 50% of the patients when the other two VLS were used.CONCLUSIONS: The trachea of a large proportion of patients with normal airways canbe intubated successfully with certain VLS blades without using a stylet, althoughthe three studied VLSs clearly differ in outcome. The Storz VLS displaces softtissues in the fashion of a classic Macintosh scope, affording room for tracheal tubeinsertion and limiting the need for stylet use compared with the other two scopes.Although VLSs offer several advantages, including better visualization of theglottic entrance and intubation conditions, a good laryngeal view does notguarantee easy or successful tracheal tube insertion. We recommend that thegeometry of VLSs, including blade design, should be studied in more detail.(Anesth Analg 2009;109:825–31)

There is clear evidence that indirect videolaryngos-copy offers improved viewing of the glottic entrance

over direct classic laryngoscopy.1,2 A better view isassumed to facilitate easier intubations, but this is notentirely confirmed,3,4 as a good laryngeal view doesnot guarantee easy or successful endotracheal tubeFrom the *Department of Anesthesiology, Intensive Care and Pain

Therapy, Catharina Hospital, Brabant Medical School, Eindhoven, TheNetherlands; †Department of Anesthesiology, Ghent University Hos-pital, Ghent, Belgium; ‡Department of Anesthesiology, CatharinaHospital, Eindhoven, Netherlands; §Department of Anesthesiology,University Hospital, Maastricht, The Netherlands; and �Department ofBiomechanical Engineering, Mechanical, Materials and Maritime En-gineering, Delft University of Technology, Delft, The Netherlands.

Accepted for publication April 9, 2009.Supported by departmental funds of the Catharina Hospital,

Eindhoven, the Netherlands. The videolaryngoscopes were madeavailable to the study center, on a temporary basis, at no cost by therespective manufacturers: Ranger™ GlideScope�, Verathon Medi-cal, Bothell, WA; V-Mac™ Storz� Macintosh, Karl Storz, Tuttlingen,Germany; and McGrath� Series 5, Aircraft Medical, Edinburgh, UK.

All patients in this clinical study underwent surgery and anes-thesia at the Catharina Hospital, Brabant Medical School, Eind-hoven, The Netherlands.

Address correspondence to Andre van Zundert, MD, PhD,FRCA, Department of Anesthesiology, Intensive Care and PainTherapy, Catharina Hospital—Brabant Medical School, Michelan-gelolaan 2, NL-5623 EJ Eindhoven, The Netherlands. Address e-mailto [email protected].

Reprints will not be available from the author.Copyright © 2009 International Anesthesia Research Society

DOI: 10.1213/ane.0b013e3181ae39db


(ETT) insertion. Several manufacturers are producingvideolaryngoscopes (VLSs) with differing specifica-tions, user interface, and geometry. However, therelative performance of the different models is un-known because no comparative studies have beenpublished. Most tracheal intubations using direct la-ryngoscopy are performed without instruments otherthan the ETT itself. However, the 60° angle of someVLS flanges limits the advancement of the ETTthrough the vocal cords into the trachea.5–7 Somemanufacturers of VLSs advocate the use of stylets withthe ETT to facilitate an easier insertion into the tra-chea.8–10 However, recent reports have shown rare butpotentially serious complications associated withstyletted ETT and VLSs.3,11–16

In this prospective, randomized comparative study,we evaluated, in clinical circumstances, the effective-ness of three commonly used VLSs in laryngoscopyand tracheal intubation of patients with normal air-ways and tested whether it is feasible to intubate thetrachea with indirect videolaryngoscopy without us-ing a stylet. Our first objective was to assess thenecessity of stylet use with the VLS. It is of clinicalinterest to determine which VLS has the most suitablegeometric and ergonomic designs for tracheal place-ment of a standard ETT without the use of a stylet. Wehypothesized that there are significant differences inthe ease of insertion of the ETT given the substantiallydifferent laryngoscope blade designs of the VLSsstudied. Second, we considered intubation conditionsbetween the blades with use of a styletted ETT.Because the stylet essentially compensates for thegeometrical mismatch of the VLS with the laryngealanatomy of the patient, we expected no discernabledifferences among the three VLSs. Finally, we per-formed a comparative assessment of the glottic viewamong the respective VLSs and classic direct Macin-tosh laryngoscopy. We hypothesized that all indirectVLSs are equal or superior to classic direct laryngos-copy in terms of the glottic view and that there are nosignificant differences in visualization quality amongthe respective VLSs.

METHODSAfter approval of the hospital medical ethics commit-

tee (Catharina Hospital, Eindhoven, the Netherlands)and obtaining informed consent, 450 consecutive adultpatients, undergoing intubation for elective surgery,were randomly selected to receive general anesthesiaand tracheal intubation using one of three VLSs: Glide-Scope� (Ranger, Verathon Bothell, WA), V-Mac™ Storz�Berci DCI� (Storz, Karl Storz, Tuttlingen, Germany), andMcGrath� (McGrath Series 5, Aircraft Medical, Edin-burgh, UK) (Fig. 1). Randomization was done throughsealed envelope. Exclusion criteria were physical statusASA Class III–V; age �18 yr; body mass index (BMI)�35 kg/m2; and patients with known airway pathologyor cervical spine injury.

The preanesthetic visit of the patient (performed byan anesthesiologist not involved in this study) deter-mined history of difficult intubation, measurement ofcommon predictive indices for difficult intubation(BMI, thyromental distance, Mallampati grade, inter-dental [or intergum] distances), and evaluation ofstatus of dentition and neck movement.

When the patients arrived at the operating room,they were placed in the “sniffing position” with theirhead placed on a pillow, connected to standard moni-toring devices and breathed 100% oxygen for at least 3min. Anesthesia induction consisted of IV fentanyl 1.5�g/kg, propofol 3 mg/kg, and rocuronium 0.7mg/kg, and the lungs were manually inflated througha face mask using sevoflurane in oxygen.

After approximately 3 min, guided by objectiveconfirmation of adequate degree of neuromuscularblockade (train-of-four monitoring), the same inde-pendent anesthesiologist not involved in this studyperformed an initial direct laryngoscopy using a clas-sic metal Macintosh (Heine Optotechnik GmbH & Co.KG, Herrsching, Germany) blade; laryngoscopic viewwas scored according to the Cormack-Lehane (C&L)grading system, although no intubation took place.After subsequent positive-pressure ventilation using aface mask and an oxygen-sevoflurane mixture for 1min, the trachea was intubated using one of the threeVLSs available in our hospital. The anesthesiologistperforming the intubation was blinded to the C&Llaryngoscopy score given by the first anesthesiologist.All tracheal intubations were performed by one of fivedifferent anesthesiologists, all of whom were experi-enced in anesthesia, and the use of the VLS wasstudied (introduction of VLS course in airway skillslaboratory and minimal of 30 uses with each VLS).During intubation, intraprocedural metrics of intuba-tion difficulty (C&L grade) and our dependent vari-ables of intubation time, number of attempts, and useof extra tools to facilitate tracheal intubation weremeasured. In a pilot study, the use of a stylet was

Figure 1. Photo compilation of the three videolaryngoscopes(VLSs) studied. From left to right: the GlideScope� Ranger™,the Storz� V-MAC™, and the McGrath� Series-5™ VLS.

826 Intubation with Videolaryngoscopes ANESTHESIA & ANALGESIA

favored over the gum-elastic bougie. Therefore, thechoice was made to use a specific rigid stylet, formedin the shape of a hockey stick with a 90° bend,optimized for use with the VLS (GlideScope RigidStylet, Saturn Biomedical Systems, Burnaby, BC, Can-ada), as the first option if intubation was not feasibleafter two intubation attempts.17,18

The number of intubation attempts was counted aseach approach of the ETT to the glottis entrance.Intubation time was measured (by an assistant) as thetime between picking up the ETT (Hi-contour™,Mallincrodt Medical, Athlone, Ireland) and the visualpassage of the ETT until the vocal cords were betweenthe two black line markings on the distal end of theETT. Interim bag and mask ventilation time, if needed,was not included in the total intubation time. Morethan five attempts or 120 s were regarded as failure ofintubation. If failure to secure the airway occurs withthe VLS, then conventional difficult intubation proto-cols from the hospital were to be implemented.

An overall satisfaction score of the intubation con-ditions was rated on a scale from 0 to 4: 0 � failure,intubation not possible; 1 � poor (had to use a toolother than the VLS); 2 � fair (need for an extra toolplus intubation time �90 s); 3 � moderate (need forextra tool to intubate the trachea, but intubation time�90 s); and 4 � good (intubation successful on first orsecond attempt, within 90 s, and no need for extratools to secure the airway). Attention was paid toinsert and remove the VLS smoothly not to damagethe oral cavity, the tongue, or the patient’s dentition.After removal of the VLS, the oral cavity was in-spected for any bruises, lacerations, bleedings, dentaldamage, or other possible complications.

A priori sample size testing was conducted assum-ing an analysis of variance (ANOVA) model for thetime measurements. Using three treatments (blade),an effect size of 5 s from clinical experience, a high-desired statistical power level of 0.95 and � level of

0.05, we calculated a sample size of 50 patients. Weexpanded the patient group to account for the threehypotheses tested and necessary correction of thesample size (i.e., Bonferroni). Data were reported asmean (�sd) and incidences (both absolute and per-centage). ANOVA was used to assess any differencesamong the groups regarding the patient-specific char-acteristics (i.e., age, BMI, thyromental distance, andinterdental distance). Nonparametric patient metrics(i.e., gender, ASA PS, and dentition) were evaluatedfor differences among the groups using Kruskal–Wallisone-way ANOVA. The differences in the dependentparameters of intubation time, attempts, use of addi-tional tools, and overall satisfaction for the respectiveVLS groups was evaluated using Kruskal–Wallis non-parametric one-way ANOVA (to forgo assumptions ofnormality) and Bonferroni correction for the multiplehypothesis testing. Finally, the C&L grades were com-pared for each of the tested VLSs and the classicalMacintosh blade again using Kruskal–Wallis one-wayANOVA. All statistical analysis was performed usingMATLAB� 7.2 (R2006a) (Mathworks, MA). P � 0.05was considered statistically significant.

RESULTSPatient characteristics and preprocedural intuba-

tion conditions did not differ among patient groups(Table 1). Patients underwent a large variety of gen-eral surgery, orthopedic surgery, urology, gynecology,and plastic surgery. Peripheral oxygen saturation wasmaintained above 95% in all patients throughout thelaryngoscopy and intubation period. All operationswere completed uneventfully. We did not detect anyinjury of the palatoglossal arch or dental injury inany patient. Minor lip lacerations were seen in fourpatients.

The first hypothesis concerned the differences be-tween the VLSs studied in their effectiveness for

Table 1. Patient Characteristics and Preprocedural Intubation Conditions

VideolaryngoscopeGlideScope Ranger

(n � 150)Storz V-Mac

(n � 150)McGrath Series-5

(n � 150)Male:female

n 54:96 62:88 60:90(%) (36:64) (41:59) (40:60)

Age (yr) 50.4 � 16.3 54.4 � 16.4 56.2 � 15.3Weight (kg) 76.3 � 15.7 77.1 � 14.6 76.1 � 14.6Height (m) 1.71 � 0.09 1.71 � 0.09 1.70 � 0.09ASA 1.52 � 0.51 1.59 � 0.51 1.59 � 0.49Body mass index (kg/m2) 26.1 � 4.27 26.3 � 4.04 26.3 � 4.10Thyromental distance (cm) 7.3 � 1.1 7.4 � 1.0 7.5 � 1.1Max mouth opening (cm) 4.4 � 0.6 4.3 � 0.6 4.3 � 0.6Mallampati grade

Mean � sd 1.65 � 0.66 1.75 � 0.65 1.70 � 0.66(I:II:III:IV) 68:66:16:0 55:77:18:0 61:72:17:0

DentitionDouble denture:single:none, n 117:6:27 104:12:34 101:13:36Percentage 78:4:18 69:8:23 67:9:24

ASA � American Society of Anesthesiologists.


intubation without a stylet. Intubation was successfulon the first attempt in 46 patients (53%) with theGlideScope, 118 patients (84%) with the Storz, and 32patients (52%) with the McGrath VLS, all withoutusing a stylet (Table 2). A stylet had to be used tosuccessfully intubate almost half the patients in theGlideScope group (n � 64, 43%) and the McGrathgroup (n � 88, 59%); however, it was less for the Storzgroup (n � 10, 7%), (P � 0.01) (Fig. 2). The Storz grouprequired fewer attempts to secure the airway(Kruskal–Wallis, �2 � 126, P � 0.01), (Table 2) withand without stylet. The average intubation times were34 � 20 s for the GlideScope, 18 � 12 s for the Storz,and 38 � 23 s for the McGrath VLS (Table 2), again

considering the total intubation attempts, both withand without stylet. Intubation with the Storz VLS wasfaster than the other two VLSs tested (Kruskal–Wallis,�2 � 116, P � 0.01) (Fig. 3).

Concerning the second hypothesis, there were nodifferences using a stylet among the three VLSs withregard to the number of required intubation attempts(P � 0.05). A successful intubation was achieved onthe first pass with the stylet in 49 patients (76%) whoused the GlideScope, eight patients (80%) who usedthe Storz, and 65 patients (74%) who used the McGrath.However, because we did not differentiate the timebefore and after using a stylet, we cannot draw anyconclusions regarding differences in intubation time.Subjectively, there did not seem to be any differencesconcerning the intubation time among the three VLSs

Figure 2. Comparison of necessary intubation attempts usingthree VLSs. There are less attempts necessary with the Storz�VLS than with both the GlideScope� and the McGrath� VLS(P � 0.01) and less attempts necessary with the GlideScopethan with the McGrath VLS (P � 0.05). The gray shadingindicates attempts that were done with the addition of a stylet(i.e., more than two attempts).

Figure 3. Comparison of necessary intubation time for threeVLSs. There is less time required to intubate with the Storz�VLS than with both the GlideScope� and the McGrath� VLS(P � 0.01), and less time necessary with the GlideScope thanwith the McGrath VLS (P � 0.05).

Table 2. Intubation Metrics

GlideScope Ranger(n � 150)

Storz V-Mac(n � 150)

McGrath Series-5(n � 150)

Intubation attemptsMean � sd 2.23 � 1.00* 1.30 � 0.63† 2.52 � 1.001:2:3:�4 46:40:49:15* 118:22:8:2† 32:30:65:23Percentage 31:27:33:10 79:15:5:2 22:20:44:15

Intubation attempts without stylet1 attempt, n (%) 46 (53) 118 (84)† 32 (52)2 attempts, n (%) 40 (47) 22 (16)† 30 (48)Total, n (% from all subjects) 86 (57) 140 (93)† 62 (41)

Intubation attempts with stylet1 attempt, n (%) 49 (76) 8 (80) 65 (74)�2 attempts, n (%) 15 (24) 2 (20) 23 (26)Total, n (% from all subjects) 64 (43) 10 (7) 88 (59)

Intubation TimeMean � sd (s) 34 � 20* 18 � 12† 38 � 23

Cormack-Lehane grade, mean � sdClassic laryngoscope 1.68 � 0.76 1.68 � 0.81 1.77 � 0.83VLS 1.01 � 0.11 1.01 � 0.11 1.01 � 0.08

Overall satisfaction scoreGood:moderate:fair:poor:failure, n 87:59:4:0:0* 140:10:0:0:0† 62:83:5:0:0Percentage 58:39:3:0:0 93:7:0:0:0 42:55:3:0:0

* Statistically significant difference over McGrath (P � 0.05).† Statistically significant difference over other tested videolaryngoscopes (VLSs) (P � 0.01).


when using a stylet. All VLSs performed well in termsof effective intubation time necessary for securing theairway because it was not necessary to revert tostandard difficult airway protocols.

No dropouts were encountered, as the tracheas ofall patients could be intubated using the VLSs. All theVLSs tested offered an equal or better view of theglottis as assessed by the mean C&L grade comparedwith traditional direct intubation techniques (P �0.01) (Fig. 4). Only very few patients had C&L gradesother than Grade I with the VLS, and none of thepatients included in this study had a C&L gradepoorer than II. The VLSs tested were rated favorablyfor their larger viewing angle of the glottic entrancecompared with classic laryngoscopy techniques. Thisproved useful for guidance of the ETT and nasogastrictube into position and avoidance of contact with softtissues of the mouth and pharynx. In general, visualiza-tion of the glottis entrance with the VLS was not aproblem, although intubation was not always straight-forward. In the context of this study, overall satisfactionwas greater using the Storz VLS compared with theother two VLSs (Kruskal–Wallis, �2 � 95, P � 0.01).

DISCUSSIONThis study compares three VLS devices in a clinical

setting during endotracheal intubation and confirmsthat a stylet is not necessary with some VLSs (Storz)but highly recommended when other VLSs (e.g., Gli-deScope and McGrath) are used. When using a stylet,the VLSs studied did not differ in intubation time ornumber of intubation attempts. This study also con-firms the excellent unobstructed view of the glotticopening obtained indirectly with a VLS as opposed tothe direct classic Macintosh laryngoscope.

No conversion to direct laryngoscopy was neces-sary in any patients studied. An equal or better C&Lgrade could be obtained in all cases, which is inagreement with other studies.19,20 There were no sig-nificant differences in the visualization quality of the

glottis among the three VLSs except for the dimensionof the device monitor. Good visualization of the glotticentrance is paramount for successful tracheal intuba-tion. However, providing a good view of the glottisdoes not always correlate with successful intubation.Indeed, this study shows that devices that offer thesame unhindered view of the glottis are not alike intheir ease of use.

This study demonstrates that stylet use is notalways required with certain VLSs. The Storz VLSgroup was associated with a shorter intubation time,required significantly fewer attempts to secure theairway compared with the other two groups, and astylet was required only in a minority (7%) of thepatients, whereas a styletted ETT had to be used inalmost half of the patients in the GlideScope andMcGrath VLS groups. Presumably, this is due to thefact that the Storz VLS uses the same Macintoshlaryngoscope blade as with direct laryngoscopy,providing a better view and better access, whichdecreases the need for stylet use. During direct laryn-goscopy, a stylet is rarely used routinely at firstattempt in our clinical practice. Given the fact thatstyletted ETT have rare but potentially significantcomplications, we believe it is important to reservetheir use for difficult intubations.3,11–16

Using a styletted ETT with the GlideScope VLS, thefirst pass success rates were higher in the studiesperformed by Sun et al.21 (94%) and Xue et al.22 (97%)compared with our study. However, the other studiesused a different definition of a “single pass” in whicha successive attempt was only recorded on retractingthe ETT completely out of the mouth; in our study,each approach to the vocal cords was counted as anattempt. Similarly, Shippey et al.10 also found a firstpass success rate of 93% when using the McGrath VLSand a styletted ETT. In our study, successful intuba-tion (without using a stylet) in the Storz group was93%, supporting our contention that a stylet is notneeded at all times and, thus, preventing potentialcomplications. Successful intubation with the StorzVLS (without stylet) is as good as with the reportedsuccess rate in the literature using the GlideScope/McGrath VLS (with stylet).10,20–22 The direct laryngo-scope and the indirect Storz VLS are generally insertedon the right side of the tongue, which is compressedand deflected laterally, whereas the indirect Glide-Scope and McGrath VLS are inserted in the midlineand advanced over the tongue because there is noneed to sweep the tongue laterally. It might be that thegreater success rate using the Storz VLS without astylet depends on the angle of its blade, which issimilar to the conventional direct Macintosh laryngo-scope and the fact that the tongue is displaced later-ally. Presumably, use of a styletted ETT from theoutset would mitigate the differences among the VLSsthat we found; however, this may also increase therisk of injury. The addition of a stylet essentially

Figure 4. Comparison of Cormack-Lehane (C&L) grades forthe pooled VLSs versus the direct Macintosh blade. Therewere significantly better C&L grades for each of the indirectVLS compared with the direct view (P � 0.01).


compensates for the geometrical shortcomings ofsome of the VLS designs.

Since its commercial introduction in 2002, numerousstudies have reported the efficacy and safety of theGlideScope VLS for tracheal intubation in patients (andsimulators) with easy and difficult airways.1,5,20,23,24

However, some authors have noted that the GlideScopeVLS is difficult to insert into the patient’s mouth, doesnot reach deep enough in some cases, insertion of ETT isnot easy, the advancement of the ETT after removal ofthe stylet is difficult,22 and complications because of theuse of a styletted ETT and a VLS may occur.3,11–16

The arytenoid cartilages, the interarytenoid softtissues, anterior commissure of the glottis, or theanterior wall of the cricoid cartilage sometimes inter-fere with advancement of the ETT into the trachea.Manipulation of the ETT orientation is often notsufficient because the curvature of the distal end of theETT is insufficient; in such cases, an extra tool isnecessary. Additionally, patient characteristics, suchas dentition and mouth opening, may greatly influ-ence the ease of insertion of the ETT. The VLS essen-tially positions the operator’s eye proximal to thelarynx. Therefore, care should be taken to do the initialintroduction (passing the teeth and first part ofmouth) of the ETT directly, until the distal end comesinto view of the VLS. Indeed, the VLS is essentially astandard laryngoscope in form and function until thecritical insertion of the ETT through the vocal cords isperformed.

A number of techniques can be used during theintubation procedure to improve the success rate.Previously, Xue et al.22 noted that the use of a mal-leable stylet, preheating of the blade to body tempera-ture, and avoiding the use of superfluous lubricantwere important considerations for successful use ofthe GlideScope. Also, increased lifting force, with-drawal and reinsertion of the blade, and externallaryngeal pressure have been proposed as helpfulmeasures for successfully securing the airway.23 Sev-eral maneuvers may overcome the problem of insert-ing the ETT: relaxing the VLS; withdrawing the VLS1–2 cm; use of a StyletScopeTM (Nihon Kohden Co.,Tokyo, Japan) in which the operator can adjust theangle of the ETT tip between 30° and 90° by grippingthe handle strongly;25 or the use of a stylet-ETT thatcan increase the angle between the axis of the ETT tipand the tracheal axis. We neither experience anyimprovement in the ease of intubation when usingexternal laryngeal pressure nor withdrawal and rein-serting the blade. In this study, it was noticed that theuse of a stylet with a relatively pronounced curve (thebest angle is reported to be 90°)17,18 at the distal endwas most helpful in advancing the tip of the ETT to theglottic opening.

Further study is required to determine optimalgeometrical forms for the stylet or gum-elastic bougiesused for difficult intubations. More importantly, theintegration of the ETT with the VLS blade is the major

issue for redesign in future generations of VLS, espe-cially considering that the classical problem of visual-ization now seems to be resolved (all patients in ourstudy showed a C&L I or II with all three types ofVLSs).

The McGrath VLS that uses a disposable blade andthe recent introduction of the GlideScope Cobaltsingle-use disposable blades26 are promising develop-ments, especially in busy settings in which there maynot be sufficient time to sterilize the blades betweenuses. Portability of the VLS systems is also an issue,and there are clear advantages of the McGrath andGlideScope VLS over the Storz. The integration of anantifogging mechanism on the McGrath and the Glide-Scope VLS is advantageous over the Storz V-Mac VLS,which lacks this feature. Preheating the VLS with theformer two is unnecessary because the light emittingdiode heats a window over the video chip. If foggingdoes occur, it likely means that the VLS is defective.However, it is still possible to blur the view if thelubricated ETT makes contact with the imaging system.

This study has several limitations: 1) The attendinganesthesiologist was not blinded to the type of VLSused, which this may have introduced bias, despitebeing blinded to the preoperative metrics and initialC&L grade with the use of the classic Macintoshlaryngoscope; 2) There are more VLSs available on themarket so this review is not complete, but the threemost common models available in our hospital areincluded; 3) There was very low patient morbidity inthis study, and it remains debatable how importantthe metrics of intubation time, attempts, and satisfactionare with regard to patient morbidity; 4) It is clear thatif the study were performed using a stylet routinely inall cases, then the second or third intubation attemptwould not have been necessary; 5) The selection ofpatients lacking features associated with a difficultairway may have reduced the potential superiority ofVLS over direct laryngoscopy and minimized thedifferences among the three VLS models; 6) Failure toroutinely use a stylet may bias our study in favor of adevice which most closely resembles a conventionalMacintosh laryngoscope; 7) A study of patients withdifficult airway anatomy may be needed to determinethe need for the routine use of a stylet; and 8) Finally,this study deals with a specific population of electivesurgical patients with normal airways and no conclu-sions can be made for patients in whom difficulttracheal intubation is expected.

CONCLUSIONSThe use of a styletted ETT is not ideal during

tracheal intubation because it can potentially contrib-ute to complications. Our study confirms that a largeproportion of patients with normal airway anatomycan be intubated successfully with certain VLS bladeswithout using a stylet, although there is a largedifference among the types of VLSs tested. Certainly,


the problem of visualization of the glottic arch isresolved by a VLS, but this does not guarantee easy orsuccessful endotracheal intubation. The stylet essen-tially compensates for the geometrical mismatch be-tween the VLS blade and the laryngeal anatomy of thepatient.

The Storz VLS performed better in overall satisfac-tion, intubation time, and number of attempts, includingattempted intubations without a stylet, most probablydue to the better view and access, which limited the needfor stylet use. The GlideScope and McGrath VLS areequally successful in achieving good visualization andintubation in all patients. It seems that geometry andintegration of ETT with the VLS is the next question thatneeds to be addressed in blade design for intubation.

REFERENCES

1. Cooper RM. Use of a new videolaryngoscope (GlideScope) inthe management of a difficult airway. Can J Anaesth 2003;50:611–3

2. Van Zundert A, Stessel B, De Ruiter F, Giebelen D, Weber E.Video-assisted laryngoscopy: a useful adjunct in endotrachealintubation. Acta Anaesthesiol Belg 2007;58:129–31

3. Cooper RM. Complications associated with the use of theGlideScope videolaryngoscope. Can J Anaesth 2007;54:54–7

4. Kaplan MB, Ward D, Hagberg CA, Berci G, Hagiike M. Seeingis believing: the importance of video laryngoscopy in teach-ing and in managing the difficult airway. Surg Endosc2006;20(suppl 2):S479 –S483

5. Cooper RM, Pacey JA, Bishop MJ, McCluskey SA. Early clinicalexperience with a new videolaryngoscope (GlideScope) in 728patients. Can J Anaesth 2005;52:191–8

6. Kramer DC, Osborn IP. More maneuvers to facilitate trachealintubation with the GlideScope. Can J Anaesth 2006;53:737

7. Muallem M, Baraka A. Tracheal intubation using the Glide-Scope with a combined curved pipe stylet, and endotrachealtube introducer. Can J Anaesth 2007;54:77–8

8. Cuchillo JV, Rodriguez MA. Considerations aimed at facilitatingthe use of the new GlideScope videolaryngoscope. Can J An-aesth 2005;52:661; author reply 661–2

9. Shippey B, Ray D, McKeown D. Case series: the McGrathvideolaryngoscope—an initial clinical evaluation. Can J Anaesth2007;54:307–13

10. Shippey B, Ray D, McKeown D. Use of the McGrath videolaryn-goscope in the management of difficult and failed trachealintubation. Br J Anaesth 2008;100:116–9

11. Vincent RD Jr, Wimberly MP, Brockwell RC, Magnuson JS.Soft palate perforation during orotracheal intubation facili-tated by the GlideScope videolaryngoscope. J Clin Anesth2007;19:619 –21

12. Choo MK, Yeo VS, See JJ. Another complication associated withvideolaryngoscopy. Can J Anaesth 2007;54:322–4

13. Hirabayashi Y. Pharyngeal injury related to GlideScope video-laryngoscope. Otolaryngol Head Neck Surg 2007;137:175–6

14. Hsu WT, Hsu SC, Lee YL, Huang JS, Chen CL. Penetratinginjury of the soft palate during GlideScope intubation. AnesthAnalg 2007;104:1609–11

15. Malik AM, Frogel JK. Anterior tonsillar pillar perforationduring GlideScope video laryngoscopy. Anesth Analg 2007;104:1610 –1

16. Hsu WT, Tsao SL, Chen KY, Chou WK. Penetrating injury of thepalatoglossal arch associated with use of the GlideScope video-laryngoscope in a flame burn patient. Acta Anaesthesiol Taiwan2008;46:39–41

17. Jones PM, Turkstra TP, Armstrong KP, Armstrong PM, CherryRA, Hoogstra J, Harle CC. Effect of stylet angulation andendotracheal tube camber on time to intubation with theGlideScope. Can J Anaesth 2007;54:21–7

18. Turkstra TP, Harle CC, Armstrong KP, Armstrong PM, CherryRA, Hoogstra J, Jones PM. The GlideScope-specific rigid styletand standard malleable stylet are equally effective for Glide-Scope use. Can J Anaesth 2007;54:891–6

19. Kaplan MB, Hagberg CA, Ward DS, Brambrink A, ChhibberAK, Heidegger T, Lozada L, Ovassapian A, Parsons D, RamsayJ, Wilhelm W, Zwissler B, Gerig HJ, Hofstetter C, Karan S,Kreisler N, Pousman RM, Thierbach A, Wrobel M, Berci G.Comparison of direct and video-assisted views of the larynxduring routine intubation. J Clin Anesth 2006;18:357–62

20. Xue F, Zhang G, Liu J, Li X, Sun H, Wang X, Li C, Liu K, Xu Y,Liu Y. A clinical assessment of the Glidescope videolaryngo-scope in nasotracheal intubation with general anesthesia. J ClinAnesth 2006;18:611–5

21. Sun DA, Warriner CB, Parsons DG, Klein R, Umedaly HS,Moult M. The GlideScope video laryngoscope: randomizedclinical trial in 200 patients. Br J Anaesth 2005;94:381–4

22. Xue FS, Zhang GH, Liu J, Li XY, Yang QY, Xu YC, Li CW. Theclinical assessment of Glidescope in orotracheal intubationunder general anesthesia. Minerva Anestesiol 2007;73:451–7

23. Fun WL, Lim Y, Teoh WH. Comparison of the GlideScope videolaryngoscope vs. the intubating laryngeal mask for females withnormal airways. Eur J Anaesthesiol 2007;24:486–91

24. Lai HY, Chen IH, Chen A, Hwang FY, Lee Y. The use of theGlideScope for tracheal intubation in patients with ankylosingspondylitis. Br J Anaesth 2006;97:419–22

25. Hirabayashi Y. The StyletScope(R) facilitates tracheal intubationwith the GlideScope�. Can J Anaesth 2006;53:1263–4

26. Jones PM, Harle CC, Turkstra TP. The GlideScope cobaltvideolaryngoscope—a novel single-use device. Can J Anaesth2007;54:677–8


Nasogastric Tube Insertion Using Different Techniques inAnesthetized Patients: A Prospective, Randomized Study

Jithesh Appukutty, MD*

Prerana P. Shroff, MD†

BACKGROUND: It is often difficult to correctly place nasogastric (NG) tubes underanesthesia. We hypothesized that simple modifications in technique of NG tubeinsertion will improve the success rate.METHODS: Two hundred patients were enrolled into the study. The patients wererandomized into four groups: control, guidewire, slit endotracheal tube, and neckflexion with lateral neck pressure. The starting point of the procedure was the timewhen NG tube insertion was begun through the selected nostril. The end point wasthe time when there was either a successful insertion of the NG tube or a failureafter two attempts. The success rate of the technique, duration of insertionprocedure, and the occurrence of complications (bleeding, coiling, kinking, andknotting, etc.) were noted. �2, analysis of variance, and Student’s t-test were usedto analyze the data.RESULTS: Success rates were higher in all intervention groups compared with thecontrol group. The time necessary to insert the NG tube was significantly longer inthe slit endotracheal tube group. Kinking of the NG tube and bleeding were themost common complications.CONCLUSION: The success rate of NG tube insertion can be increased by using aureteral guidewire as stylet, a slit endotracheal tube as an introducer, or headflexion with lateral neck pressure. Head flexion with lateral neck pressure is theeasiest technique that has a high success rate and fewest complications.(Anesth Analg 2009;109:832–5)

The insertion of a nasogastric (NG) tube in anesthe-tized, paralyzed, and intubated or unconscious pa-tients may be difficult, with reported failure rates ofnearly 50% on the first attempt with the head inneutral position.1–3 After a failure, subsequent at-tempts are usually unsuccessful due to coiling, kink-ing, or knotting of the NG tube as it loses stiffness dueto warming to body temperature. The memory effectalso contributes to subsequent failures; once kinked,the NG tube is subsequently more likely to kink at thesame place. The most common sites of impaction ofthe NG tube are piriform sinuses and the arytenoidcartilage.4 Maneuvers to keep the NG tube along thelateral or posterior pharyngeal wall during insertionencourages the smooth passage into the esopha-gus.1,2,5 Common methods used to facilitate NG tubeinsertion include the use of a slit endotracheal tube,forward displacement of the larynx and the use ofvarious forceps, the use of an ureteral guidewire as a

stylet, head flexion, lateral neck pressure, and the useof a gloved finger to steer the NG tube after impac-tion.2,6–8 Neck flexion, in combination with the curveof the NG tube, tends to keep the tube in closeproximity to the posterior pharyngeal wall, facilitatingits smooth passage into the esophagus.2 The ureteralguidewire imparts stiffness to the NG tube by actingas a stylet and preventing kinking.

We hypothesized that slight modifications in NG tubeinsertion technique would improve the rate of successfulinsertion. We compared three techniques to the commonmethod of NG insertion to determine the success rate,average time for insertion, and incidence of complica-tions, such as bleeding, coiling, knotting, and kinking.

METHODSHospital Ethical committee approval was obtained,

and a valid written informed consent was obtained fromeach patient. Patients younger than 20 yr and older than70 yr were excluded from the study. Two hundredpatients were enrolled in the study. All patients receivedgeneral anesthesia and tracheal intubation for varioussurgical procedures that required NG tube insertion.

After induction of general anesthesia and trachealintubation, the patients were randomly allocated intofour groups according to a computer-generated ran-domization order. In the control group (Group C),patients had a lubricated NG tube inserted gently

From the *Department of Anesthesiology, KJ Somaiya MedicalCollege and Research Centre, Sion; and †Department of Anaesthe-siology, Seth GSMC and KEM Hospital, Parel, Mumbai, Maharash-tra, India.

Accepted for publication April 27, 2009.Address correspondence and reprint requests to Jithesh Ap-

pukutty, MD, 3A/501, Hema Park, Veer Savarkar Marg, Bhand-up(E), Mumbai 400042, Maharashtra, India. Address e-mail [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181af5e1f


through the selected nostril, the head being main-tained in the neutral position. The guidewire group(Group W) made use of a ureteral guidewire that wasintroduced within a 14-F NG tube until the tip of theguidewire was at the tip of the NG tube. Tubeinsertion was then performed in the same manner asdescribed for the control group. In the slit trachealtube (TT) group (Group S), the NG tube was insertedthrough the selected nostril and taken out through themouth, leaving at least 10 cm of NG tube at thenostril. It was then passed through a longitudinallycut 7.0-mm internal diameter polyvinyl chloride TT,so that the tip of the NG tube was at the level of theMurphy eye of the TT. The TT was lubricated generouslyand was then inserted blindly into the oral cavity to adepth of 18 cm and the NG tube advanced further. TheNG tube was then freed from the cut TT, and the cut TTwas removed and the rest of the NG tube passed into theesophagus and was then fixed at the required length bypulling out through the nostril. In the neck flexion withlateral pressure group (Group F), a lubricated NG tubewas inserted through the selected nostril to a depth of 10cm. The patient’s neck was flexed, lateral neck pressurewas applied, and the NG tube was advanced in a similarmanner to that described for Group C.

Preoperatively, the nostril to be used for NG tubeinsertion was chosen based on two criteria: the amountof fogging produced on a metal tongue depressor duringexhalation and the relative size of the nostril. In allpatient groups, a 14F, 105-cm NG tube with lead mark-ings at the distal end was used.

NG tube insertion was performed by a group offour third-year anesthesia residents (to avoid operatorbias the authors did not perform NG tube insertions).These residents were all judged to be proficient in thetechniques described. They were assigned patientsaccording to a computer-generated randomizationschedule. The procedure start time was defined whenthe NG tube insertion was begun through the selectednostril. The procedure end time was defined as the timeof successful insertion of NG tube or the time after twofailed attempts. The procedure duration was measuredwith a stopwatch. Successful NG tube insertion wasconfirmed when the tube passed smoothly and a gur-gling sound was heard on auscultation over the epigas-trium when injecting 10 cc of air through the NG tube.

If the first attempt failed, the NG tube was with-drawn fully and was cleaned. Lubricating jelly wasapplied generously, and the procedure was repeatedusing the same technique. If both attempts at insertionusing the selected technique were unsuccessful, thenthe technique was considered a failure. The NG tubewas then inserted with the help of Magill forcepsduring a direct laryngoscopy.

The following data were collected:

1. Success rate of the selected technique—first, sec-ond attempt, and overall.

2. Number of attempts for successful insertion.

3. Duration of insertion using the selected technique.4. Complications during insertion—kinking, knot-

ting, and bleeding.

An unpublished pilot study of 12 cases per groupsuggested an approximate 20% improvement (frombase rate of 65% to 85%) in success rate using thesetechniques. Consequently, a power calculation (� �0.05 and � � 0.2) indicated a minimum of 46 patientsfor each group using an analysis of variance(ANOVA) test. Continuous data are presented asmean � sd; categorical data are presented as fre-quency and percentage. Demographic data were ana-lyzed by Pearson’s �2 test. The time necessary to insertthe NG tube in each group was compared usingANOVA test. The complication rates during insertionof NG tubes in all four groups were compared usingANOVA for multiple variables. A value of P �0.05was considered statistically significant.

RESULTSThere were no statistically significant differences in

the demographic data (age and gender) of the fourpatient groups. In Group C, successful NG tube inser-tion was achieved in 36 patients (72%) (Fig. 1) . Thesuccess rates of NG insertion were greater in GroupsW, S, and F: 46 patients (92%, P � 0.011), 46 patients(92%, P � 0.011), and 47 patients (92%, P � 0.004),respectively. In Group C, 17 patients (34%) had a NGtube placed successfully on the first attempt and 19patients (38%) on the second attempt (Fig. 1). In GroupW, 33 patients (66%) had a NG tube placed success-fully on the first attempt and 13 patients (26%) on thesecond attempt (P � 0.002 compared with Group C).In Group S, 41 patients (82%) had a NG tube placedsuccessfully on the first attempt and five patients(10%) on the second attempt (P � 0.0006 comparedwith Group C). In Group F, 41 patients (82%) had aNG tube placed successfully on the first attempt andsix patients (12%) on the second attempt (P � 0.0006compared with Group C).

Total NG tube insertion time was 56 � 36 s inGroup C. This time was significantly longer in GroupS (98 � 43 s) and significantly shorter in Group F (31 �19 s). Group W time (42 � 29 s) was not statisticallydifferent from Group C.

The most common complication in Group C waskinking of the NG tube, which occurred in 10 patients(20%); knotting occurred in one patient (2%) (Table 1).In Group W, the NG tube became kinked in fourpatients (8%) (P � NS), and knotting occurred in onepatient (2%) (P � NS versus Group C). In Group S,11 patients (22%) developed bleeding during NG tubeinsertion, significantly more frequently than in GroupC; in one patient, the NG tube could not be freed fromthe slit TT, and the whole assembly had to be removed(complication classified as “other”). In Group F, fourpatients (8%) developed kinks during insertion of theNG tube (P � NS versus Group C).


DISCUSSIONInsertion of the NG tubes in anesthetized and

intubated patients has an average failure rate of nearly50% on the first attempt with the patient’s head inneutral position.2 The piriform sinuses and arytenoidcartilages are the most common sites of impaction.4

Maneuvers to avoid impaction on these structuresinclude insertion of the NG tube along the posterior orlateral pharyngeal wall, by head flexion and lateralneck pressure, or by turning the head to one side.1,5

Other methods to facilitate NG tube insertion includethe use of an ureteral guidewire or cooling the NGtube to stiffen it,9 the use of a slit-TT as a conduit,7 theuse of a guitar wire as a stylet,10 endoscopic place-ment, or the use of various endoscopic forceps andlifting the thyroid cartilage.

We observed a success rate of 34% in Group C onthe first attempt, which was significantly lower com-pared with the success rates of the ureteral guidewire(66%), slit endotracheal tube (82%), and head flexionwith lateral neck pressure (82%) groups, confirmingthat the latter procedures increase the success rate. A

ureteral guidewire helps to reduce the flexibility of theNG tube, whereas a slit TT, which is resistant tokinking, directs the NG tube into the esophagus. Headflexion and lateral neck pressure help keep the NGtube along the lateral and posterior pharyngeal wall,thereby facilitating passage into the esophagus.

Ratzlaff et al.11 found that the degree of NG tubeflexibility significantly affected the ease with whichthe NG tube was inserted and also reported that therigid tubes required fewer insertion attempts. How-ever, as the NG tube rigidity increases, the incidenceof trauma also increases, with a subsequent increasein the incidence of bleeding.10,11 We used an ureteralguidewire (6F) to decrease the flexibility of the NGtube and found that insertion was successful in 92%of patients compared with a 72% success rate inGroup C.

In Groups C and W, the time required for insertionwas 56 � 36 s and 42 � 29 s, respectively; Group S hada longer insertion time. In Group F, the insertion time(31 � 19 s) was significantly shorter than Group C’sinsertion time. Among the four groups, the Group F

Table 1. Duration of Nasogastric Tube Insertion (s) and Complications

Group C(n � 50)

Group W(n � 50)

Group S(n � 50)

Group F(n � 50)

Duration of insertion (s) 56 � 36 42 � 29* 98 � 43† 31 � 19‡Complication (number of cases)

Kinking 10 4 0 4Knotting 1 1 0 0Bleeding 0 0 11§ 0Others 0 0 1 0

Group C � control; Group W � guidewire; Group S � slit tracheal tube; Group F � neck flexion with lateral pressure.* P � 0.166.† P � 0.0003.‡ P � 0.001.§ P � 0.0005 versus control.†‡§ Significant at P � 0.05.

Figure 1. Successful nasogastric tubeinsertion. Group C � control; GroupW � guidewire; Group S � slit tra-cheal tube; and Group F � neckflexion with lateral pressure.

834 Techniques for Nasogastric Tube Insertion ANESTHESIA & ANALGESIA

had the shortest time to insertion whereas the Group Shad the longest time. Matsuki and Zsigmond10 usedguitar strings to facilitate NG tube insertion but re-ported a few cases of bleeding. In our study of 200patients, 32 (16%) developed complications. The mostcommon complications were kinking of the NG tube,knotting of the NG tube, and bleeding. We observedthat of the 32 complications, 18 (56%) were due tokinking, which underscored the importance of reduc-ing flexibility to improve the success of NG tubeinsertion. Decreased flexibility can be accomplishedby using the ureteral guidewire as a stylet. However,bleeding was a frequent complication in the slit TTgroup: 11 of 50 (22%) patients experienced bleeding.The frequent incidence could be attributed to a tech-nique that involves insertion of an additional TT intothe oral cavity in an already intubated patient. Thiscomplication was evident in the patient in whom theslit TT could not be withdrawn while keeping the NGtube in place, such that the entire assembly had to beremoved with great difficulty.

CONCLUSIONThe success rate of NG tube insertion can be

increased by using an ureteral guidewire as a stylet, aslit TT as an introducer, or keeping the head flexedwhile applying lateral neck pressure. The time neededto insert a NG tube was shortest using head flexionwith lateral pressure and longest with the use of a slitTT. Kinking was the most frequent complication en-countered, and bleeding was the most common when

the slit TT was used. Overall, considering the successrate, the duration of insertion, and the complicationrate, we conclude that head flexion with lateral neckpressure is the simplest technique that has the highestsuccess rate and lowest incidence of complications.Therefore, we recommend the use of either a headflexion with lateral neck pressure or an ureteral guide-wire as a stylet in all NG tube insertions.

REFERENCES

1. Bong CL, Macachor JD, Hwang NC. Insertion of the nasogastrictube made easy. Anesthesiology 2004;101:266

2. Mahajan R, Gupta R. Another method to assist nasogastric tubeinsertion. Can J Anaesth 2005;52:652–3

3. Kayo R, Kajita I, Cho S, Murakami T, Saito H. A study oninsertion of a nasogastric tube in intubated patients. Masui2005;54:1034–6

4. Parris WC. Reverse Sellick maneuver. Anesth Analg 1989;68:4235. Ozer S, Benumof JL. Oro- and nasogastric tube passage in

intubated patients: fiberoptic description of where they go at thelaryngeal level and how to make them enter the esophagus.Anesthesiology. 1999;91:137–43

6. Flegar M, Ball A. Easier nasogastric tube insertion. Anaesthesia2004;59:197

7. Sprague DH, Carter SR. An alternative method for nasogastrictube insertion. Anesthesiology 1980;53:436

8. Campbell B. A novel method of nasogastric tube insertion.Anaesthesia 1997;52:1234

9. Mahajan R, Poddar S, Grover VK. A simple and reliable methodfor nasogastric tube insertion. J Anaesth Clin Pharmacol2004;20:95–6

10. Matsuki A, Zsigmond EK. Simple and reliable method ofinserting a nasogastric tube during anaesthesia. Br J Anaesth1972;44:610

11. Ratzlaff HC, Heaslip JE, Rothwell ES. Factors affecting nasogas-tric tube insertion. Crit Care Med 1984;12:52–3


Case Report

“Where Are My Teeth?” A Case of Unnoticed Ingestion ofa Dislodged Fixed Partial Denture

Gary Lau, MD*

Vivek Kulkarni, MD, PhD*

Gary K. Roberts, DDS†

John Brock-Utne, MD, PhD*

What are the dangers of swallowing foreign bodies of dental origin? How do werecognize when a patient has actually swallowed a dental appliance? How farshould we pursue the retrieval of the appliance? We report a case of a patient withunnoticed ingestion of a dislodged fixed partial denture while undergoing generalanesthesia and review the literature on dangers of swallowing foreign bodies ofdental origin. Anesthesiologists should understand the dangers and recognize thiscomplication when it happens, so that appropriate treatment can be pursued ifnecessary.(Anesth Analg 2009;109:836–8)

Ingestion of items of odontogenic origin, includingdislodged teeth, crowns, fixed partial dentures (bridges),removable partial and complete dentures, as well asvarious other dental and orthodontic appliances bypatients under general anesthesia is rare but often ini-tially goes unnoticed, leading to potentially dangerouslate complications that require invasive surgical inter-ventions. Certain patient populations are at increasedrisk for unnoticed ingestion and some are at increasedrisk of developing perforations from the ingested bodies.The shape and dimension of the ingested odontogenicitem can affect whether it will pass through the gutwithout incidents. Perforations occur more often in cer-tain portions of the gastrointestinal tract (GI) than others.We report a case of a patient with unnoticed ingestion ofdislodged fixed partial denture while undergoing gen-eral anesthesia and review the literature on dangers ofswallowing foreign bodies of dental origin.

CASE DESCRIPTIONA 36-yr-old man underwent left ureteroscopic laser litho-

tripsy for nephrolithiasis. His surgical history was signifi-cant for a hernia repair in 2005, which was uneventful withno recorded difficulties with tracheal intubation. Examina-tion of his airway revealed a maxillary anterior fixed partialdenture that according to the patient was “permanent.” Hestated that he had had the bridge for more than 17 yr andthat it had never caused any problems. After induction ofgeneral anesthesia, the patient was easily mask ventilated. AGrade I view of the larynx was achieved with atraumaticdirect laryngoscopy and a tracheal tube was placed easily.The rest of the anesthesia and surgery were uneventful.

At the end of surgery, the patient’s trachea was extubatedwithout problems and he was transported to the postopera-tive care unit, where he experienced a bout of coughing.Upon becoming more awake and alert, his first questionwas, “Where are my teeth?” On examination, patient wasnoted to have missing front incisors where his fixed partialdenture had been. On questioning, the patient stated that hisbridge had never come off before and did not think he hadswallowed it. The operating room was thoroughly searchedbut his missing fixed partial denture was not located. Anabdominal radiographic film revealed a radio-opaque for-eign body consistent in shape with the missing fixed partialdenture overlying the stomach (Fig. 1). A gastroenterologistwas consulted and the patient underwent emergent upperendoscopy. However, the bridge was not visualized endo-scopically. Repeat abdominal film revealed that the bridgehad passed into the small intestine (Fig. 2). The patient wasobserved for a period of time. He neither complained of anyabdominal pain, nausea nor exhibited fever or hematemesis.He was discharged home with close follow-up. On postop-erative Day 3, the bridge passed into the stool withoutproblems.

DISCUSSIONIn the general population, ingestion of foreign

bodies is not uncommon, especially in children, alco-holics, edentulous people, and mentally handicappedpeople. It has been reported that about 1500 people dieannually from the ingestion of foreign bodies in theUnited States.1 However, the incidence of anesthe-tized patients ingesting dental appliances is unknown.Fortunately, the majority of foreign bodies enteringthe oropharynx eventually pass through the GI tractwithout complications. However, there is a potentialrisk of gut perforation, which can have serious conse-quences including death.2–4 Other reported late com-plications of unnoticed foreign body ingestion includesepsis, peritonitis, retropharyngeal and intraabdomi-nal abscesses, esophageal impaction and stricture,ulcerative esophagitis, tracheoesophageal and entero-colonic fistulas, recurrent pneumonitis, and massivehemorrhage.3–5 Large objects, especially those withsharp edges, can get impacted, usually at the level of

From the Departments of *Anesthesia, and †Otolaryngology—Headand Neck Surgery, Stanford University Hospital and Clinics, Stan-ford, California.

Accepted for publication April 9, 2009.Address correspondence and reprint requests to John Brock-

Utne, MD, PhD, Department of Anesthesia, Stanford UniversitySchool of Medicine, 300 Pasteur Dr., H3580, Stanford, CA 94305-5640. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181ae06c9


the fourth cervical vertebra.6 Symptoms of esophagealobstruction can be nonspecific and resemble those of amildly traumatic direct laryngoscopy, which makes itdifficult for the anesthesiologists to diagnose. Thesymptoms include dysphagia, odynophagia, cough-ing, choking sensation, hematemesis, or vomiting.

Radiographic evidence that includes both anterior-posterior and lateral films is warranted. However,negative radiological findings do not exclude thepossibility of a foreign body in the esophagus. Persis-tence of symptoms, even in the absence of positiveclinical or radiological signs, warrants an endoscopicexamination. Once a foreign body has reached thestomach, it has an 80%–90% chance of passing alongthe gut spontaneously without problems, but bodiesthicker than 2 cm and longer than 5 cm will not likelyleave the stomach spontaneously.7,8 About 10%–20%will require removal from the GI tract by endos-copy.3,8 Less than 1% of all foreign bodies will cause aperforation.6,9 However, all sharp and pointed objectsshould be removed before they pass from the stomachbecause 15%–35% of this type of foreign body willcause intestinal perforation.10 Dull foreign bodies canalso cause perforations by causing pressure necrosisand subsequent destruction of underlying mucosa andmuscle.5 Patients with intrinsic bowel disease are at anincreased risk of developing perforations from theingested foreign body. This includes patients withbowel adhesions, inflammatory bowel disease, GItumors, diverticulosis of large bowel, hernias, andMeckel’s diverticulum.4,5 The most common sites forperforation are the ileocecal junction and the sigmoidcolon.5 The usual time taken for a foreign body totraverse the intestinal tract is 2 to 12 days.7

In our case, the patient did not exhibit any signs orsymptoms typical of ingestion of a dental applianceother than the initial bout of coughing, which mayhave been related to the ingestion. This is a rare casereport, in which the diagnosis of an odontogenicforeign body ingestion was made because the patientasked about the whereabouts of his own dental appli-ance after recovery from general anesthesia. It isfortunate that this happened in a patient who wascognitively coherent enough to express that his fixedpartial denture was missing. It is easy to see how anincident like this could occur unnoticed in a mentallychallenged patient and be left undiagnosed, poten-tially leading to further complications as describedabove without an obvious etiology. The uncommonpresentation of this case, in the context of previousreports of ingested odontogenic items, underscoresthe need for a high index of suspicion in mentallychallenged patients with dental restorations who arescheduled to undergo general anesthesia. Further-more, one should keep in mind that so called “perma-nent bridges” may not be so permanent after all. It alsoshould be noted that our review focuses on ingestionrather than pulmonary aspiration of items of odonto-genic origin. Aspiration of items of odontogenic originpresents a more critical situation that has been re-viewed elsewhere in the literature.

In conclusion, the unnoticed swallowing of items ofodontogenic origin (Fig. 3), though infrequent, canpotentially be dangerous and lead to GI tract perfora-tions. If it is suspected that an anesthetized patient has

Figure 1. Dental bridge seen in the stomach.

Figure 2. Dental bridge seen in the small bowel.


swallowed a foreign body, the appropriate medicalspecialist should be consulted, along with a dentisttrained in the care of hospitalized and anesthetizedpatients, as it may be necessary to identify and removean object with sharp edges to avoid organ perfora-tion. Early diagnosis and treatment can avoid latecomplications that may require surgical interven-tion. Attention must be paid to patients at increasedrisk of unnoticed foreign body ingestion. This includesyoung children and patients with comorbidities thatlimit cognition and communication, such as stroke, de-mentia, Parkinson’s disease, cerebral palsy, autism, andmental retardation.

REFERENCES

1. DeVaneson J, Pisani A, Sharman P, Kazarian K, MersheimerW. Metallic foreign bodies in the stomach. Arch Surg1977;112:664 –5

2. Ghori A, Dorricott NJ, Sanders DSA. A lethal ectopic denture:an unusual case of sigmoid perforation due to unnoticedswallowed dental plate. J R Coll Surg Edin 1999;44:203– 6

3. Schwartz G, Polsky H. Ingested foreign bodies of the gastroin-testinal tract. Am Surg 1976;42:236–8

4. Maleki M, Evans W. Foreign body perforations of the intestinaltract. Arch Surg 1970;101:475–7

5. McCanse D, Kurchin A, Hinshaw J. Gastrointestinal foreignbodies. Am J Surg 1981;142:335–7

6. Nandi P, Ong GB. Foreign body in the oesophagus: review of2394 cases. Br J Surg 1978;65:5–9

7. Webb WA, McDaniel L, Jones L. Foreign bodies of the uppergastrointestinal tract: current management. South Med J1978;77:1083–6

8. Perelman H. Toothpick perforation of the gastrointestinal tract.J Abdom Surg 1962;4:51–3

9. Gonzalez JG, Gonzalez RR, Patino JV, Garcia AT, AlvarezCP, Pedrosa CS. CT findings in gastrointestinal perforationby ingested fish bones. J Comput Assist Tomogr 1988;12:88 –90

10. Webb W. Management of foreign bodies of the upper gastroin-testinal tract: update. Gastrointest Endosc 1995;41:39–51

Figure 3. Examples of dental appliances.


Critical Care and TraumaSection Editor: Jukka Takala

The Practice of and Documentation on Withholding andWithdrawing Life Support: A Retrospective Study in TwoDutch Intensive Care Units

Peter E. Spronk, MD, PhD*†‡

Alexej V. Kuiper, MSc†

Johannes H. Rommes, MD, PhD*

Joke C. Korevaar, MD§

Marcus J. Schultz, MD, PhD†‡

OBJECTIVE: We determined how often life support was withheld or withdrawn inpatients who died in the intensive care unit (ICU) or early after ICU discharge andevaluated documentation on decisions regarding these changes in life supportorders.METHODS: This was a retrospective study in a university hospital and a generalteaching hospital. Charts of patients who died during ICU stay or within 7 daysafter ICU discharge in 2005 were reviewed.RESULTS: Of 2578 admitted patients, 356 patients (14%) died either in the ICU orwithin 7 days after ICU discharge. For 9 patients data were missing, leaving 347patients for analysis. Seventy-seven patients (22%) died with full life support, 85(25%) died while treatment was being withheld, and 185 (53%) patients died whiletreatment was being withdrawn. One or more changes in life support orders werenoted in 266 patients (77%). Only 8% of the patients were recorded to beincapacitated at the time of the change. Patients’ preferences regarding life supportwere documented in less than one-quarter of cases. In approximately one third ofcases, it was not documented which member(s) of the ICU team were involved inan end-of-life decision. In the documented cases, end-of-life decisions were madealong with the patient (7%) or with the patient’s representatives (59%).CONCLUSION: ICU nonsurvivors and patients who die shortly after ICU dischargepredominantly die with orders to withhold or withdraw life support. Documen-tation on the decisions to forgo full life support is poor.(Anesth Analg 2009;109:841–6)

Intensive care unit (ICU) patients may die whiletreatment is being either withheld or withdrawn.Although the decision to limit or forgo further treat-ment may at times be made by ICU patients them-selves, critically ill patients frequently are not able tomake or (adequately) communicate such decisionsbecause of sedation, cognitive dysfunction, or commu-nication barriers like endotracheal tubes.1 With ad-vanced care planning, patient preferences regardingdiscontinuation of therapy may be known by surro-gate decision-makers (usually the patient’s spouse orlife companion) and/or treating physicians. However,advanced directives/living wills frequently do notsufficiently state when and how to discontinue treat-ment in specific medical conditions.2 In the majority of

cases, therefore, the decision to continue (or discon-tinue) ICU treatment is left to the attending ICUphysicians and/or other members of the ICU team.3

Documentation of medical decisions is crucial topreserve continuity inpatient care, particularly duringoff-hour periods. A recent study by the Dutch healthinspection demonstrated that only a small percentageof necessary information was adequately recorded in themedical patient chart before surgical interventions(http://www.igz.nl/15451/475693/2007-02_Rapport_Preoperatie1.pdf). In particular, the lack of standardiza-tion of which information should be recorded in themedical chart was prominent. Although this study didnot address the issues pertaining to life support orders,in particular in the ICU setting, it is possible thatdocumentation on this item may be worse too.

In this study, we analyzed how often therapy iseither withheld or withdrawn during the ICU stay intwo Dutch teaching hospitals. For this analysis wecollected all data of patients who died in the ICU.Because treatment and patient approach during theICU stay could also have influenced life supportorders in step-down units or normal wards, patientswho died within 7 days after ICU discharge were alsoincluded in the analysis. We evaluated the precisenessof documentation on the decisions on life supportorders.

From the *Department of Intensive Care Medicine, Gelre Hos-pitals, Location Lukas, Apeldoorn; †Department of Intensive CareMedicine, Academic Medical Center, University of Amsterdam;‡HERMES Critical Care Group; and §Department of Clinical Epi-demiology and Biostatistics, Academic Medical Center, Universityof Amsterdam, Amsterdam, The Netherlands.

Accepted for publication March 17, 2009.Address correspondence and reprint requests to Peter E. Spronk,

MD, PhD, FCCP, Department of Intensive Care Medicine, GelreHospitals, Location Lukas, PO Box 9014, 7300 DS Apeldoorn, TheNetherlands. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181acc64a


METHODSThe clinical records of patients who were admitted

to the ICU in 2005 and subsequently died during theirICU stay or within 7 days after ICU discharge werecollected. As no interventions were part of the study,the need for obtaining informed consent was waivedby the local ethics committee.

Study LocationThe study was performed in one academic hospital

(Academic Medical Center (AMC), University of Am-sterdam) and one university-affiliated teaching hospi-tal (Gelre Hospital, Location Lukas). In the AMC, theICU comprises a 28-bed “closed unit” in which medical/surgical patients (including neurosurgery/neurology,cardiothoracic surgery, and cardiology patients) are un-der the direct care of the ICU team. The ICU teamcomprises 8 full-time ICU physicians, 8 subspecialtyfellows, 12 residents, and occasionally 1 intern. In theGelre Hospital, the ICU is a 10-bed closed unit withmedical/surgical patients (as in AMC, with the excep-tion of cardiothoracic surgery and neurosurgery pa-tients). The ICU team comprises two full-time ICUphysicians, five physicians who participate in eveningand night shifts, and one resident.

Data SourcePatient data from the AMC were retrieved from the

patient data management system (Metavision, iMDsoft,Sassenheim, The Netherlands). This database auto-matically stores patient-specific information duringthe complete ICU stay, including daily reports andspecial forms related to decisions on withholding orwithdrawing life support. The reports from ICU phy-sicians and ICU nurses, family consultations, andtreatment orders were all read and documented ina separate database. In the Gelre Hospital, clinicalrecords were only present in paper form; data similarto those mentioned above were collected. In addition,the database of the National Intensive Care Evaluation(The Netherlands, http://www.stichting-nice.nl) wasused to collect baseline data of all patients.

Patient-Specific DataThe following data were collected for each patient:

baseline data, such as gender, age, type of admission(acute medical, acute surgical, elective surgical), referringspecialty (medical, surgical, neurosurgery/neurology, car-diothoracic surgery, cardiology, or other), severity ofillness (Acute Physiology and Chronic Health Evalua-tion II score, Simplified Acute Physiology Score II), andlength of stay. Orders on life support at ICU admission,subsequent changes in life support orders during theICU stay, and life support orders at end-of-life werecollected from the typically used forms and the dailyreports. The date of change was also recorded. If noorder on life support or no change in order on lifesupport was mentioned, either on the form or in thedaily reports, it was assumed that full life support was

given or that life support was given according to theorder at ICU admission. If a change in life support orderwas found, we searched for any documentation in theclinical records concerning the next five issues:

1. Which member(s) of the ICU team were involvedin the decision to change orders on life support?

2. Were the patient and/or the patient’s represen-tatives involved in the change in orders?

3. Was the change in life support preceded bypsychiatric consultation?

4. Was the patient capable of making a decisionregarding his medical treatment at the time thedecision was made to change orders?

5. Was there knowledge of the patient’s preferencesregarding life support?

Definitions

• “Full life support” (order “A”): all life-savinginterventions were to be performed whenneeded.

• “Withhold life support” (order “B”): a decisionwas made not to start one or more life-savinginterventions, or only with certain restrictions.Interventions withheld in both ICU departmentsincluded defibrillation for ventricular fibrillation,cardiopulmonary resuscitation, treatment of ar-rhythmia, treatment with vasopressors and/orinotropics, tracheal intubation and mechanicalventilation, surgery, transfusion of blood prod-ucts, antimicrobial treatment, or renal replace-ment therapy. Interventions withheld only in theICU of Gelre Hospital included certain diagnosticprocedures (which had to be documented on theform).

• “Withdraw life support” (order “C”): a decisionwas made to actively stop all life-supportinginterventions that were already being performed.This meant that modalities aimed at survivalwere stopped, but other modalities aiming atpatient comfort were continued.

Statistical AnalysisThe completed data were analyzed using SPSS

version 12.0 (SPSS, Chicago, IL). Continuous data areexpressed as medians with interquartile range andcategorical data in percentages. Comparisons weremade using Mann–Whitney and Kruskal–Wallis testsfor continuous data and the �2 test for categorical data.All tests were two-tailed, and differences with a Pvalue �0.05 were considered significant. Data fromthe ICUs were analyzed separately but may be pre-sented together.

RESULTSPatients

Of 2578 patients admitted to the two ICUs in 2005, 293patients (11%) died during the ICU stay and 63 patients(2%) died �7 days after ICU discharge. Of this group,

842 End-of-Life Decisions in Dutch ICUs ANESTHESIA & ANALGESIA

the clinical record files of 9 were missing, leaving 347patients for further analysis. Demographic data are sum-marized in Table 1. In the AMC, relatively more patientsdied in the ICU as compared with the Gelre Hospital(P � 0.007). Conversely, at the Gelre Hospital, a higher

percentage of patients died after ICU discharge com-pared with the AMC (P � 0.0004). This proved to be dueto a different case mix. In particular, in the AMC, 43(86%) neurosurgical patients died in the ICU, whereas inGelre no neurosurgery was performed. Patients who

Table 1. Demographic Characteristics of All Admitted Patients Who Died in 2005

Patients who died

AMC GH P value AMC versus GHNumber of patients 269 78

Died in ICU, N (%) 237 (88) 56 (72) 0.007*Died �7 days after ICU discharge, N (%) 32 (12) 22 (28) 0.028*

Age (yr) 66 (52–66) 76 (68–82) �0.001†Gender (male), N (%) 149 (55) 51 (65) 0.198*Length of stay in ICU (d) 4 (2–7) 3 (2–8) 0.538†APACHE II 25 (20–30) 20 (15–28) 0.001†SAPS II 58 (46–71) 51 (38–64) 0.001†Type of ICU admission, N (%) 0.202*

Acute 181 (67) 76 (97)Elective 88 (33) 2 (3)

Reason for admission to the ICU, N (%) 0.001*Medical 68 (25) 27 (35)Surgical 40 (15) 42 (54)Neurosurgery/neurology 68 (25) 3 (4)Cardiothoracic surgery 27 (10) NACardiology 66 (25) 6 (8)Other/undefined 0 (0) 0 (0)

Data are medians (interquartile range), unless stated otherwise.APACHE II � Acute Physiology and Chronic Health Evaluation II; SAPS II � Simplified Acute Physiology Score II; ICU � intensive care unit; AMC � Academic Medical Center; GH � Gelre Hospital.Comparisons were made using the �2 test* for categorical data and the Mann–Whitney test for continuous data†.

Table 2. Orders at the End of Life

AMC GH

Order“A”

Order“B”

Order“C”

Order“A”

Order“B”

Order“C”

Number of patients, N (%) 62 59 148 15 16 47Age (yr) 60 (45–71) 67 (53–77) 68 (52–76) 74 (59–79) 81 (69–87) 75 (67–81)Gender (male), N (%) 43 (70) 31 (53) 80 (55) 10 (67) 11 (69) 30 (64)Length of stay in ICU (d) 2 (1–3) 3 (2–7) 5 (2–9) 2 (1–4) 2 (2–6) 3 (2–10)Readmission, N (%) 5 (8) 4 (7) 14 (10) 3 (20) 2 (13) 7 (15)APACHE II 26 (17–32) 25 (20–34) 25 (20–29) 20 (12–25) 18 (16–28) 22 (15–30)SAPS II 58 (44–74) 57 (46–72) 57 (58–69) 56 (40–74) 41 (36–59) 51 (39–64)Order at ICU admission,

N (%)Order “A” 62 (100) 55 (93) 140 (95) 15 (100) 13 (81) 36 (77)Order “B” 0 (0) 4 (7) 8 (5) 0 (0) 3 (19) 11 (23)Order “C” 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)

Type of ICU admission,N (%)

Acute 53 (86) 52 (88) 76 (51) 15 (100) 14 (88) 47 (100)Elective 9 (14) 7 (12) 72 (59) 0 (0) 2 (12) 0 (0)

Reason for ICU admission,N (%)

Medical 16 (26) 16 (27) 36 (24) 6 (40) 9 (56) 13 (28)Surgical 6 (10) 10 (17) 24 (16) 8 (53) 6 (38) 28 (60)Neurosurgery/neurology 12 (19) 16 (27) 40 (27) 0 (0) 0 (0) 2 (4)Cardiopulmonary

surgery11 (18) 7 (12) 9 (6) 0 (0) 0 (0) 0 (0)

Cardiology 17 (24) 10 (17) 39 (26) 1 (7) 1 (7) 4 (9)Unknown 0 (0) 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)

Data are medians (interquartile range), unless stated otherwise. For definitions of orders A, B, and C, see the Methods section in the text.APACHE II � Acute Physiology and Chronic Health Evaluation II; SAPS II � Simplified Acute Physiology Score II; ICU � intensive care unit; AMC � Academic Medical Center; GH � Gelre Hospital.


eventually died were slightly older, had a longer ICUlength of stay, and had higher Acute Physiology andChronic Health Evaluation II and Simplified AcutePhysiology Score II scores than patients who survived(data not shown).

Life Support Orders on ICU Admission and ThereafterOf 347 patients, 321 (93%) were admitted to the

ICU with an order “A” and 26 (7%) with an order“B”; there were no patients who were admitted tothe ICU with an order “C” (Table 2). For 266 patients(76%), one or more changes in their life supportorders were made before death (Fig. 1, details areshown in Table 3). Seventy-seven patients (22%)died with an order “A,” 85 patients (25%) with anorder “B,” and 185 patients (53%) with an order “C.”The pattern of life support orders was comparablein the two ICUs. Patients who died with an order

“C” had a longer ICU stay than patients who diedwith full support.

Documentation of Changes in Life Support OrdersFor 85/266 patients (32%) who had one or more

changes in their life support orders, it was not clearwhich ICU team member was involved in the decision tochange the orders (details shown in Table 4). Although21 patients (8%) were mentioned as being capable ofmaking a decision regarding their medical treatment atthe time of a change in their life support orders, only 13(5%) of the patients were compos mentis at the time ofchange and actively involved in the decision-makingprocess. For 206 patients (78%), the patient’s preferenceregarding life support was not reported. For 94 patients(36%), it was not reported whether a patient’s represen-tative existed or was involved in the decision to changelife support orders.

Figure 1. Change and type of ordersover time. See text for details on“orders.”

Table 3. Order Changes in Patients Who Died in Intensive Care Unit (ICU) and in Patients Who Died Within 7 Days After ICU Discharge

AMC GH

ICUnonsurvivors

Hospitalnonsurvivors

ICUnonsurvivors

Hospitalnonsurvivors

Number of evaluated patients, N 237 32 56 22Patients with changes in order, N (%) 179 (76) 27 (84) 42 (75) 18 (82)Timing of change of orders

LOS in ICU before a 1st change inorders (d)

4 (3–7) 2 (0–4) 1 (0–6) 2 (1–8)

Length of life after a 1st change inorders (d)

3 (1–5) 1 (0–2) 0 (0–2) 3 (2–5)

Order at admission to the ICU, N (%)Order “A” 228 (96) 29 (91) 46 (82) 18 (82)Order “B” 9 (4) 3 (9) 10 (18) 4 (18)Order “C” 0 (0) 0 (0) 0 (0) 0 (0)

Order end of life, N (%)Order “A” 59 (25) 3 (9) 12 (21) 3 (14)Order “B” 50 (21) 9 (28) 9 (16) 7 (32)Order “C” 128 (54) 20 (63) 35 (63) 12 (54)

Data are medians (interquartile range), unless stated otherwise. For definitions of orders A, B, and C, see the Methods section in the text.AMC � Academic Medical Center; GH � Gelre Hospital; LOS � length of stay.


DISCUSSIONIn this study, we found that ICU nonsurvivors pre-

dominantly die with orders for withholding or with-drawing life support. We also found that documentationon changes in life support is far from complete, and thatfrequently, important information was lacking.

Our results regarding withholding and withdrawinglife support are in line with Sprung et al.,3,4 who dem-onstrated that 73% of European ICU patients die whilelife support is being withheld or withdrawn. In contrast,Eidelman et al.5 showed that physicians in Israel dowithhold, but never withdraw life-supporting interven-tions, which is in accordance with Jewish law. Thisemphasizes the fact that withholding or withdrawinglife support is strongly influenced by culture. Still, ingeneral, the incidence of withholding and withdrawal oflife support is increasing, partly because more countriesare legalizing this process if specific conditions are met.6

We can only hypothesize why documentation ofchanges in decisions on end-of-life orders was poor in

our hospitals. We may conclude this to be a reflectionof bad documentation on important decisions in gen-eral. Indeed, documentation of decisions on bloodtransfusion, start or change of antimicrobial therapy,change of ventilatory mode, tracheal extubation, andmany other important decisions in daily ICU practiceis reported to be poor.7,8 However, decisions on end-of-life care are considered so important, at least from amedico-judicial viewpoint, that we expected morecomplete and lucid documentation. In addition, al-though the usual manner of documentation might bedifferent in the general as compared with the univer-sity hospital, which is probably caused by under-staffing of intensivists in the general hospital, webelieve that this should never be a reason for poordocumentation of decisions over withholding or with-drawing therapy.

Bad documentation could also be due to less con-tinuity of care, with fewer doctors in the nonacademicsetting, although the absence of differences between

Table 4. Documentation of Change in Orders

AMC GH

1st code �(n � 203)

2nd code �(n � 84)

3rd code �(n � 3)

1st code �(n � 60)

2nd code �(n � 22)

Which people were involved in the decision tochange orders on life support, N (%)

Not reported 66 (33) 15 (18) 1 (25) 19 (32) 0 (0)Patient 8 (4) 5 (6) 0 (0) 11 (18) 2 (9)Physician 136 (67) 68 (81) 2 (50) 40 (67) 22 (100)Family 114 (56) 61 (73) 3 (75) 38 (63) 22 (100)Representative 2 (1) 0 (0) 0 (0) 0 (0) 0 (0)

Was the patient’s representative involved in thechange in orders?, N (%)

Not reported 76 (37) 27 (32) 1 (25) 18 (30) 5 (23)Family 104 (51) 52 (62) 2 (67) 41 (68) 6 (27)Partner 34 (17) 14 (17) 0 (0) 8 (13) 16 (73)Legal representative 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)Other 4 (2) 1(10 0 (0) 3 (5) 0 (0)None 17 (8) 1 (1) 0 (0) 1 (2) 0 (0)

Was the patient compos mentis?, N (%)Not reported 13 (6) 8 (10) 0 (0) 1 (2) 1 (5)Yes 12 (6) 5 (6) 0 (0) 9 (15) 2 (9)No

Patient was awake but considered incapablea 14 (7) 6 (7) 0 (0) 14 (23) 6 (27)Patient was sedated 48 (24) 12 (14) 1 (25) 22 (37) 8 (36)Patient was not sedated but unconscious 116 (57) 53 (63) 2 (75) 14 (23) 5 (23)

Knowledge of patient preference by surrogatedecision-makers

Not reported 161 (78) 56 (67) 4 (100) 45 (75) 16 (73)No 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)Yes 13 (6) 10 (12) 0 (0) 13 (22) 2 (9)

Information given beforehand by patient 27 (13) 17 (20) 0 (0) 2 (3) 4 (18)Information given by family 1 (1) 1 (1) 0 (0) 0 (0) 0 (0)Advanced directive/living will 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)

Psychiatric consultNo/not reported 198 (98) 82 (97) 4 (100) 59 (99) 22 (100)Before code change 5 (2) 2 (3) 0 (0) 1 (2) 0 (0)After code change 0 (0) 0 (0) 0 (0) 0 (0) 0 (0)

A 3rd code change did not occur in the GH.AMC � academic medical center; Code � � change in code (first, second, and third time); GH � Gelre Hospital.a Because of established encephalopathy, delirium, or preexisting cognitive dysfunction and/or dementia.


the academic and nonacademic settings does notsupport this argument. Perhaps ICU physicians in oursettings are too busy with direct patient care toadequately document all discussions and agreementswith patients and proxies. They could also lack train-ing or not be fully aware of the importance of strictlydocumenting changes in life support orders.

Decisions on end-of-life orders are influenced bythe professional experience of individual ICU teammembers making the decision (mostly ICU physi-cians),9–12 and by their age,11 religious beliefs,4,5 andcountry or culture of origin,4,11,13–15 potentially result-ing in differences between ICUs. Indeed, in Westerncountries, limitation of therapy precedes up to 90% ofdeaths, whereas in India the rate is reported to be nomore than 22%–50%.4,16 However, in Western coun-tries the legal context of end-of-life decisions may beconfusing because of the lack of specific laws.17

To support the decision-making process in the faceof ethical dilemmas, several countries are developingguidelines and laws.18 In particular, patients’ relativesshould be informed and consulted before a decision ismade, the decision should be documented in themedical charts, and finally, the decision should bemade collectively.6 However, these guidelines do notinclude statements pertaining to documentation ofdecisions to forego life support. Lack of documenta-tion may mean that the decision of whether to with-draw or withhold life support treatment is made onlyby the physician, without consulting the relatives.“Noninvolvement” was shown to be as high as 50%for decisions to change end-of-life orders in the studyby Ferrand et al.19 Our findings regarding poor docu-mentation of decisions to change life support ordersdo not necessarily relate to an insufficiently carefuldecision-making process. However, all patients’ lifesupport orders should be adequately documented forevaluation and legal purposes.

There are several limitations to our study. First, ourstudy design does not allow generalization of ourfindings to all ICU patients. Indeed, we only includedICU nonsurvivors and patients who died shortly afterICU discharge in The Netherlands. Second, this studywas restricted to only two ICUs in The Netherlands.Results may not be generalized to other institutions,particularly those with a patient population substan-tially different from that of the study hospitals. Weshowed that proportionally more patients died in theICU in the academic AMC setting than in the GelreICU, which proved to be due to differences in casemix. Nevertheless, the similarities between these twocenters with regard to practices on withholding orwithdrawing life support are striking, particularly inview of the fact that they represented an academic anda nonacademic, albeit university-affiliated, teachingsetting. This at least suggests that the situations inother hospitals in The Netherlands may be similar tothose in our centers.

In conclusion, ICU nonsurvivors in The Nether-lands die predominantly with orders to withhold orwithdraw life support. Documentation of these deci-sions is poor and inconsistent, however, and deservesmore attention from attending physicians for evalua-tion and legal purposes.

REFERENCES

1. Luce JM. Ethical principles in critical care. JAMA 1990;263:696–700

2. Ditto PH, Danks JH, Smucker WD, Bookwala J, Coppola KM,Dresser R, Fagerlin A, Gready RM, Houts RM, Lockhart LK,Zyzanski S. Advance directives as acts of communication: arandomized controlled trial. Arch Intern Med 2001;161:421–30

3. Sprung CL, Cohen SL, Sjokvist P, Baras M, Bulow HH, Hov-ilehto S, Ledoux D, Lippert A, Maia P, Phelan D, SchobersbergerW, Wennberg E, Woodcock T. End-of-life practices in Europeanintensive care units: the Ethicus Study. JAMA 2003;290:790–7

4. Vincent JL. Forgoing life support in western European intensivecare units: the results of an ethical questionnaire. Crit Care Med1999;27:1626–33

5. Eidelman LA, Jakobson DJ, Pizov R, Geber D, Leibovitz L,Sprung CL. Foregoing life-sustaining treatment in an IsraeliICU. Intensive Care Med 1998;24:162–6

6. Ferrand E, Marty J. Prehospital withholding and withdrawal oflife-sustaining treatments. The French LATASAMU survey.Intensive Care Med 2006;32:1498–1505

7. Wynn A, Wise M, Wright MJ, Rafaat A, Wang YZ, Steeb G,McSwain N, Beuchter KJ, Hunt JP. Accuracy of administrativeand trauma registry databases. J Trauma 2001;51:464–8

8. Golob JF Jr, Fadlalla AM, Kan JA, Patel NP, Yowler CJ, ClaridgeJA. Validation of Surgical Intensive Care-Infection Registry: amedical informatics system for intensive care unit research,quality of care improvement, and daily patient care. J Am CollSurg 2008;207:164–73

9. Cook DJ, Guyatt GH, Jaeschke R, Reeve J, Spanier A, King D,Molloy DW, Willan A, Streiner DL. Determinants in Canadianhealth care workers of the decision to withdraw life supportfrom the critically ill. Canadian Critical Care Trials Group.JAMA 1995;273:703–8

10. Walter SD, Cook DJ, Guyatt GH, Spanier A, Jaeschke R, ToddTR, Streiner DL. Confidence in life-support decisions in theintensive care unit: a survey of healthcare workers. CanadianCritical Care Trials Group. Crit Care Med 1998;26:44–9

11. Cuttini M, Nadai M, Kaminski M, Hansen G, de Leeuw R,Lenoir S, Persson J, Rebagliato M, Reid M, de Vonderweid U,Lenard HG, Orzalesi M, Saracci R. End-of-life decisions inneonatal intensive care: physicians’ self-reported practices inseven European countries. EURONIC Study Group. Lancet2000;355:2112–8

12. Burns JP, Mitchell C, Griffith JL, Truog RD. End-of-life care inthe pediatric intensive care unit: attitudes and practices ofpediatric critical care physicians and nurses. Crit Care Med2001;29:658–64

13. Randolph AG, Zollo MB, Egger MJ, Guyatt GH, Nelson RM,Stidham GL. Variability in physician opinion on limiting pedi-atric life support. Pediatrics 1999;103:e46

14. Nyman DJ, Sprung CL. End-of-life decision making in theintensive care unit. Intensive Care Med 2000;26:1414–20

15. Vincent JL. Cultural differences in end-of-life care. Crit CareMed 2001;29:N52–5

16. Prendergast TJ, Claessens MT, Luce JM. A national survey ofend-of-life care for critically ill patients. Am J Respir Crit CareMed 1998;158:1163–7

17. Zamperetti N, Proietti R. End of life in the ICU: laws, rules andpractices: the situation in Italy. Intensive Care Med 2006;32:1620–2

18. Steinberg A, Sprung CL. The dying patient: new Israeli legisla-tion. Intensive Care Med 2006;32:1234–7

19. Ferrand E, Robert R, Ingrand P, Lemaire F. Withholding andwithdrawal of life support in intensive-care units in France: aprospective survey. French LATAREA Group. Lancet 2001;357:9–14


Low Tidal Volume Ventilation in a Porcine Model of AcuteLung Injury Improves Cerebral Tissue Oxygenation

Johannes Bickenbach, MD*

Norbert Zoremba, MD†

Michael Fries, MD†

Rolf Dembinski, MD, PhD*

Robert Doering

Eileen Ogawa, MD*

Rolf Rossaint, MD, PhD*†

Ralf Kuhlen, MD, PhD‡

BACKGROUND: In study, we investigated the effects of different tidal volumes on cerebraltissue oxygenation and cerebral metabolism in a porcine model of acute lung injury (ALI).We hypothesized that mechanical ventilation with low tidal (LT) volumes improvescerebral tissue oxygenation and metabolism after experimentally induced ALI.METHODS: After inducing experimental ALI by surfactant depletion, we studied twoconditions in 10 female pigs: 1) LT volume ventilation with 6 mL/kg body weight,and 2) high tidal (HT) volume ventilation with 12 mL/kg body weight. Variablesof gas exchange, hemodynamic, continuous cerebral tissue oxygen tension (ptiO2),cerebral microdialysis, and systemic cytokines were analyzed. After induction ofALI, data were collected at 2, 4, and 8 h. The primary end point was the change inptiO2. For group comparisons, a t-test was used. A value of �0.05 was consideredto indicate statistical significance.RESULTS: At baseline and after induction of ALI, no differences between groups werefound in ptiO2; however, ptiO2 was significantly lower in the HT group after 4 and 8 h.Pao2 and Paco2 showed no significant differences between the groups at all time-points. Regarding cerebral microdialysis, a significantly higher level of extracellularlactate could be demonstrated after 2, 4, and 8 h in the HT group. The release ofcytokines resulted in higher values for interleukin-6 and interleukin-8 in the HT group.CONCLUSION: Protective ventilation with LT yielded a significant improvement incerebral tissue oxygenation and metabolism compared to HT ventilation in aporcine model of ALI. There was dissociation between arterial and cerebral tissueoxygenation. Cerebral oxygenation and metabolism might have possibly beenimpaired by a more distinctive inflammatory response in the HT group.(Anesth Analg 2009;109:847–55)

Acute respiratory distress syndrome (ARDS) is stilla life-threatening disease with high mortality.1,2 How-ever, partly, because of less invasive mechanical ven-tilation, survival rates have improved over the pastdecade,3,4 and hence various studies have focused onlong-term effects after ARDS.

Seventy percent of ARDS survivors show distinctiveneurological impairment, including memory, language,and cognitive decline.5 Moreover, 90% of critical carepatients who undergo long-term mechanical ventilation(i.e., �5 days) display these findings.6 Still, the mecha-nisms that are of importance for this poor neurologicaloutcome have not yet been fully explained.

Memory impairment is associated with hypoxicdamage to hippocampal structures.7–9 However, re-fractory hypoxemia inherent to ARDS cannot be seen

as the single mechanism contributing to neurologicalimpairment, as we have previously demonstrated.10

Ventilation strategy may affect the central nervoussystem (CNS) by modifying the inflammatory re-sponse.11–14 We, therefore, designed a laboratory ani-mal study to investigate effects of ventilation withdifferent tidal volumes on cerebral tissue using fluo-rescence quenching (ptiO2) as a local measure ofoxygenation and intracerebral microdialysis as a mea-sure of local metabolism. We hypothesized that, afterexperimentally induced acute lung injury (ALI), me-chanical ventilation with low tidal (LT) volumeswould result in improved cerebral tissue oxygenationand brain metabolism by a more attenuated inflam-matory response when compared to high tidal (HT)volume ventilation.

METHODSThe experimental protocol was approved by the

appropriate governmental committee for the use andcare of laboratory animals.

Animal PreparationTen female pigs weighing 30.2 � 2.0 kg (mean �

sd) were included in the study. Preexisting diseaseswere excluded after examination by a veterinarian.

From the *Department of Surgical Intensive Care; †Departmentof Anesthesiology, RWTH University Hospital, Aachen, Germany;and ‡Department of Intensive Care Medicine, Helios HospitalBerlin Buch, Berlin, Germany.

Accepted for publication April 27, 2009.Address correspondence and reprint requests to Johannes Bick-

enbach, Department of Surgical Intensive Care, RWTH UniversityHospital, Pauwelsstr. 30, D-52074 Aachen, Germany. Addresse-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181ad5769


IM azaperone (6 mg/kg) and atropine (0.01 mg/kg)were administered 45 min before anesthesia. Anesthe-sia was performed by continuous infusion of thiopen-tal (5–10 mg/kg/h) and fentanyl (8–12 �g/kg/h).Animals were then orally intubated and placed in asupine position. Volume-controlled ventilation wasused with a respiratory rate of 15 to 25 breaths/min toyield a Paco2 of 35 to 40 mm Hg, a positive end-expiratory pressure of 0 mm Hg and an inspiration:ex-piration ratio of 1:1. Initially, tidal volume was adjustedto 10 mL/kg body weight. The inspiratory oxygenfraction was kept at 1.0 throughout the experiment.

An arterial catheter (Vygon, Ecouen, France) and an8.5-F venous sheath (Arrow Deutschland GmbH, Er-ding, Germany) were percutaneously positioned afterultrasound-guided puncture of the femoral vessels. ASwan-Ganz catheter (Arrow Deutschland GmbH, Er-ding, Germany) was positioned into a pulmonaryartery under transducer pressure guidance. The bloodtemperature, as determined by the pulmonary arterycatheter, was maintained around 38°C using a convec-tive heating blanket (Warm Touch 5200, Tyco Health-care, Pleasanton, CA). Fluid replacement was providedby administration of balanced electrolyte solution inaccordance with hemodynamics.

After positioning of the head in midline and fixa-tion with a custom-made holding device, a burr holewith a diameter of 2 mm was created 1 cm lateral tothe sagittal suture and 1 cm rostral to the coronalsuture into the right hemisphere. A double-lumenBOLT Catheter (Licox IM3, Integra Neurosciences,Plainsboro, NJ) was carefully screwed into the skull,and the dura was carefully punctured with a needlebefore advancing the OxyLite sensor and the microdi-alysis catheter.

MeasurementsMean arterial blood pressure (MAP), mean pulmo-

nary arterial pressure (MPAP), central venous pres-sure (CVP), and pulmonary arterial occlusion pressurewere measured (pvb Medizintechnik, Kirchseeon,Germany; AS/3 Compact; Datex Ohmeda, Helsinki,Finland). Cardiac output (CO) and mixed venoussaturation (SvO2) were continuously recorded (Vigi-lance, Edwards Lifesciences Irvine, CA).

Heart rate was derived from the blood pressurecurve. Systemic vascular resistance (SVR) and pulmo-nary vascular resistance (PVR) were calculated usingstandard formula:

[SVR � (MAP-CVP)/CO � 80; PVR �

(MPAP-pulmonary capillary wedge pressure)/

CO � 80].

Arterial and mixed venous blood gases, hemoglo-bin, electrolytes, and lactate were analyzed (ABL 510and OSM 3; Radiometer, Copenhagen, Denmark).

Oxygen delivery (DO2) and oxygen consumption(VO2) were calculated using standard formula:

[DO2 � CaO2 � CO; VO2 � avDO2 � CO]

Cerebral microdialysis was performed using aprobe with a membrane length of 10 mm, an outerdiameter of 0.6 mm, and a cutoff at 20 kDa (CMA 70,CMA-Microdialysis, Sweden). A precision infusionpump (CMA 102, CMA-Microdialysis, Sweden) wasused at a flow rate of 2 L/min (Perfusion fluid CNS,CMA-Microdialysis, Sweden).15–17 Before and at theend of the experiment, the in vitro recovery rates foreach probe were determined in a calibration solutionequilibrated to 37°C by continuing the perfusion withthe settings used during the experiment. In all experi-ments, no significant changes in the in vitro recoveryrate were found. The measured experimental valueswere adjusted according to the relative recovery rateto estimate the in vivo extracellular concentration ofthe substances in the immediate environment of theprobes.

Lactate and glucose were collected for every mea-surement timepoint, stored in aliquots at �10°C, andlater analyzed enzymatically with a CMA 600 Micro-dialysis Analyzer. The lactate/pyruvate ratio (L/Pratio) was also determined as a marker for disturbedcellular energy metabolism in hypoxia.18

Cerebral ptiO2 was Measured with an OxyLab System(Oxford Optronics, UK)

Blood samples for the determination of S-100 proteinand proinflammatory cytokines (interleukin [IL]-6 andIL-8) were taken from the arterial line and allowed to clotfor 30 min at room temperature. After centrifugationwith 3000g for 10 min, the supernatant was stored inaliquots at �80°C until analysis. Serum levels of IL-6 andIL-8 were quantitated using commercially availableELISAs (R&D Systems, Minneapolis, MN). S-100 levelswere measured using an automated immunolumino-metric assay (DiaSorin, Dietzenbach, Germany).

Experimental ProtocolInduction of experimental ALI was performed by

repeated surfactant washout.19,20 The experimentalprotocol was started when an arterial oxygen tension(PaO2) �100 mm Hg persisted for �60 min withoutadditional lavages. After induction of ALI, the ani-mals were randomly assigned to two groups: (a) thetidal volume was set to 6 mL/kg body weight (LTgroup); and (b) 12 mL/kg body weight (HT group).A positive end-expiratory pressure of 5 mm Hg wasadjusted in both groups. No further interventionswere performed.

At baseline, PacO2 levels were allowed to rangefrom 35 to 45 mm Hg. Later, the respiratory rate wasadjusted to minimize hypercapnia in the LT group.MAP was allowed to range between 60 and 150mm Hg.21

848 Neurological Consequences of Mechanical Ventilation ANESTHESIA & ANALGESIA

After equilibration of 1 h, baseline measurementswere obtained. Hemodynamics, pulmonary gas ex-change, respiratory mechanics, brain tissue oxygentension, intracerebral microdialysis, and systemic cy-tokines were measured at baseline, after induction ofALI, and 2, 4, and 8 h afterward.

Statistical AnalysisAll data are expressed as mean � sd. Normal

distribution of the data was confirmed using theKolmogorov–Smirnov test. Group comparisons at thegiven timepoints were performed using the t-test forindependent measurements.

To detect significant changes within groups overtime, analysis of variance was performed and fol-lowed by post hoc tests for multiple comparisons(Bonferroni). In case of significant differences, exact Pvalues are reported. In general, a P value of �0.05 wasconsidered to indicate statistical significance.

RESULTSAll animals survived the entire study period. No

differences in baseline variables were observed be-tween groups. A mean of 7 � 1 lavages were per-formed to obtain a stable ALI.

In both groups, induction of ALI resulted in com-parable significant reductions of oxygen-derived vari-ables (PaO2, ptiO2, and VO2), hemodynamic (MAP),and metabolic variables (pH). Concurrently, mean andpeak inspiratory pressures increased significantly.

Hemodynamic VariablesOverall, hemodynamic variables were relatively

unchanged in both groups throughout the study pe-riod. Fluid replacement was equal in the groups, witha mean of 5 mL/kg/h. The MAP was significantlylower in the HT group at 4 and 8 h (P � 0.05 for both).Other hemodynamic variables are summarized inTable 1.

Respiratory MechanicsThere were no differences between the groups at

baseline and at induction of ALI. Significantly highermean and peak inspiratory pressures were observedin the HT group at 2, 4, and 8 h (Table 2).

Gas Exchange and Cerebral Tissue OxygenationNo differences between the groups could be shown

for the pH value at any timepoint (Table 3). RegardingPaO2, induction of ALI resulted in a remarkable decreasein arterial oxygenation. However, at no time were sig-nificant differences between the groups observed. PacO2increased by approximately 50% after induction of ALI.No differences were noted between groups.

As depicted in Figure 1, ptiO2 was not significantlydifferent between the groups at baseline. In both groups,induction of ALI resulted in a dramatic decrease in ptiO2.There was already a strong tendency toward improvedptiO2 values after 2 h of ventilation in animals ventilatedwith LT volumes, in comparison to animals in the HTgroups, reaching statistical significance after 4 and 8 h

Table 1. Hemodynamic Variables

BL ALI 2 h 4 h 8 hHR (bpm)

HT 89.4 � 9.4 118.6 � 19.8 132.6 � 43.8 136.4 � 42.9 188.3 � 84.2LT 104.6 � 16.2 92 � 17.0 90.8 � 13.8 97.6 � 11.5 116.6 � 47.6

MAP (mm Hg)HT 129.2 � 18.6 86.4 � 9.7 79.2 � 15.8 75.6 � 9.4 63.6 � 23.8LT 128.6 � 16.7 95.4 � 7.1 95.4 � 3.8 89.8 � 8.7* 63.2 � 10.6*

CVP (mm Hg)HT 6.0 � 1.8 6.8 � 1.3 7.2 � 1.5 8.6 � 2.5 11.7 � 14.5LT 6.6 � 1.9 7.4 � 1.1 8.6 � 1.3 9.2 � 0.8 12.9 � 12.2

CO (L/min)HT 3.8 � 0.8 4.6 � 0.9 3.1 � 0.6 3.1 � 0.8 3.0 � 0.8LT 3.2 � 0.5 3.3 � 0.3 2.9 � 0.4 2.7 � 0.4 2.7 � 0.2

MPAP (mm Hg)HT 17.8 � 2.8 27.2 � 7.2 31.4 � 3.4 29.8 � 6.7 30.6 � 7.5LT 17.4 � 6.6 29.0 � 2.0 33.4 � 3.8 34.4 � 5.2 27.8 � 5.7

PCWP (mm Hg)HT 7.6 � 2.3 8.0 � 1.8 9.8 � 1.5 11.4 � 2.7 10.2 � 4.0LT 7.4 � 0.9 9.6 � 1.8 9.6 � 1.8 10.0 � 1.6 10.0 � 1.4

SVR (dyn � sec � cm�5)HT 2677 � 852 1421 � 306 1902 � 732 1850 � 775 1678 � 699LT 2630 � 150 2018 � 466 2376 � 250 2309 � 223 2619 � 856

PVR (dyn � sec � cm�5)HT 218 � 53 349 � 149 562 � 143 502 � 226 547 � 173LT 200 � 21 454 � 59 687 � 159 137 � 97 556 � 62

Data are presented as mean � SD.BL � baseline; ALI � acute lung injury; HR � heart rate; MAP � mean arterial blood pressure; CVP � central venous pressure; CO � cardiac output; MPAP � mean pulmonary artery pressure;PCWP � pulmonary capillary wedge pressure; SVR � systemic vascular resistance; PVR � pulmonary vascular resistance.* P � 0.05 between groups.


(P � 0.05). Ventilation with LT volumes resulted in asignificant increase of ptiO2 8 h after ALI.

Concerning arterial oxygen saturation, a decreasecould be observed after ALI in both groups (Figure 2),followed by an increase thereafter. No significantdifferences between the groups could be shown.

Venous Oxygen Saturation was Significantly Lower in theHT Group After 8 h

No significant differences between the groups werefound for DO2 and VO2, as shown in Table 2. VO2values were clearly higher in the HT group after 4 and8 h (Figure 2).

Cerebral MicrodialysisFor lactate, no difference could be shown at base-

line and after induction of ALI (Figure 3). It wassignificantly higher in the HT group after 2 h (3.4 � 1.4vs 1.1 � 0.5 mmol/L), 4 h (2.4 � 0.8 vs 1.0 � 0.7mmol/L), and 8 h (1.9 � 0.6 vs 1.0 � 0.4 mmol/L). Nosignificant differences in glucose were seen. There was

a trend toward lower extracellular glucose levels inthe HT group after 4 and 8 h. The L/P ratio did notachieve statistical significance, but there was a strongtendency toward a higher level in the HT group(Figure 3).

S-100 and CytokinesSerum concentrations of S-100 protein were not

significantly different between the groups at baseline.After induction of ALI, no noticeable increase wasseen in either group. After 2 h, a decrease of S-100 wasnoted in the LT group, whereas the levels in the HTgroup remained unchanged. Continuing higher levelsfor S-100 were found in the HT group after 4 h (0.3 �0.1 vs 0.1 � 0.02 �g/L, P � 0.052) and 8 h (0.3 � 0.17vs 0.1 � 0.03 �g/L, P � 0.05).

The measurement of IL-6 showed no differencesbetween the groups at baseline and after ALI. After2 h, significantly higher levels could be demonstratedin the HT group (279.7 � 187.1 vs 45.4 � 101.6 pg/mL,

Table 2. Respiratory Mechanics

BL ALI 2 h 4 h 8 hRR

HT 17 � 2 22 � 5 34 � 2† 37 � 4† 37 � 4†LT 18 � 2 27 � 5 37 � 6 37 � 6 37 � 6

PEEP (mbar)HT 0 0 5 5 5LT 0 0 5 5 5

MIP (mbar)HT 15 � 1.5 29 � 2 37 � 4.3 38 � 5.9† 39 � 5.8†LT 14 � 0.5 27 � 1 23 � 2*† 22 � 2.4*† 22 � 2.2*†

PIP (mbar)HT 20 � 2.1 37 � 3 56 � 8† 57 � 6.7† 61 � 4.6†LT 19 � 1.3 35 � 2.4 28 � 2.4*† 28 � 2.4*† 28 � 2.2*†

Data are presented as mean � SD.BL � baseline; ALI � acute lung injury; RR � respiratory rate; PEEP � positive end-expiratory pressure; MIP � mean inspiratory pressure; PIP � peak inspiratory pressure.* P � 0.05 between groups.† P � 0.05 vs. ALI.

Table 3. Variables of Gas Exchange and Tissue Oxygenation

BL ALI 2 h 4 h 8 hPao2 (mm Hg)

HT 482.6 � 36.7 43.3 � 4.4 118.2 � 142.2 135.0 � 162.9 217.5 � 188.3LT 474.8 � 95.2 50.8 � 11.3 84.1�20.3 142.4 � 114.2 219.2 � 112.9†

PaCo2 (mm Hg)HT 36.2 � 3.8 61.2 � 8.3 63.0 � 21.7 69.2 � 30.1 63.5 � 21.9LT 39.6 � 1.6 60.2 � 8.8 68.2 � 12.2 69.8 � 12.6 64.0 � 11.7

pHHT 7.5 � 0.0 7.26 � 0.05 7.28 � 0.13 7.32 � 0.13 7.3 � 0.14LT 7.5 � 0.04 7.32 � 0.08 7.24 � 0.06 7.26 � 0.09 7.3 � 0.04

Do2 (mL/min)HT 5454 � 971 3968 � 1356 3699 � 844 3904 � 923 4013 � 804LT 4730 � 868 3607 � 903 3884 � 1050 3754 � 449 3770 � 119

Vo2 (mL/min)HT 731 � 305 1804 � 498 1359 � 359 1677 � 490 1349 � 744LT 735 � 303 1461 � 378 1560 � 280 1297 � 286 796 � 455

Data are presented as mean � SD.BL � baseline; ALI � acute lung injury; pH � pH value; PaCO2 � arterial carbon dioxide partial pressure; PaO2 � arterial oxygen partial pressure; DO2 � oxygen delivery; VO2 � oxygenconsumption.* P � 0.05 between groups.† P � 0.05 vs. ALI.


P � 0.05). After 4 h, a clear trend toward higher IL-6release was seen in the HT group (591.6 � 480.2 vs66.7 � 137.7, P � 0.07).

The analysis of IL-8 revealed higher levels after 2 h(2785.8 � 2246.1 vs 349.1 � 510.4, P � 0.1) and 8 h(2752.5 � 3597.9 vs 2.2 � 2.7, P � 0.2), althoughstatistical significance was not reached (Figure 4).

Systemic Lactate, Hemoglobin, and ElectrolytesFor lactate, significantly higher levels in the HT

group were observed after ALI and at 2 and 8 h(Figure 5). Ventilation with LT volumes amelioratedthe increases observed in the HT group and led to asignificant decrease at 2, 4, and 8 h after ALI. Therewere no differences in hemoglobin and electrolytelevels between the groups at any timepoint (Table 4).

DISCUSSIONThe purpose of this study was to determine the

effects of different modes of mechanical ventilation onthe CNS in a porcine model of ALI. Our major findingwas that cerebral ptiO2 improved only during ventila-tion with LT volumes, although global variables ofoxygenation were comparable.

Importantly, measurement of ptiO2 is a technique toreveal oxygen metabolism and therefore the vitality oforgans. Concerning brain tissue, previous experimentshave demonstrated physiological brain ptiO2 values of25 to 40 mm Hg.22 Thresholds of �10 mm Hg are

Figure 1. ptiO2. Data are presented as mean � sd *P � 0.05between groups. $P � 0.05 vs acute lung injury (ALI) (exactP value is given in brackets).

Figure 2. Arterial and venous oxygen saturation. Data arepresented as mean � sd. *P � 0.05 between groups.

Figure 3. Extracellular metabolites of cerebral microdialysis.Data are presented as mean � sd. *P � 0.05 between groups.


indicative of ischemia. In a study evaluating hypoxicevents, ptiO2 values were 11 � 3 mm Hg at an arterialPO2 of 40 mm Hg.23 These results are partly consistentwith ours. We found even lower ptiO2 levels at anarterial PO2 around 50 mm Hg (Figure 6).

This is the first study evaluating ptiO2 levels in amodel of ALI. However, with regard to the reproduc-ibility of arterial PO2 values in both groups, the

course of this variable alone cannot explain thedevelopment of ptiO2 levels in this study. In ARDSpatients, numerous factors have an impact on theCNS, such as long-term sedation,24 hyperglycemia,6

and inflammation.Concerning the impact of mechanical ventilation, it

is well known that ventilation with LT volumes isassociated with an attenuated inflammatory re-sponse.11–14 Conversely, there is growing evidencethat more injurious, HT volume ventilation results in amassive inflammatory response due to strain on non-injured, non-atelectatic lung regions in ALI.25 HTvolumes lead to increased levels of peripheral organdysfunction.26 However, the mechanisms by whichmechanical ventilation culminates in organ dysfunc-tion and how lung-protective ventilatory strategieswould reduce these effects are unknown.

Imai et al. demonstrated epithelial cell apoptosis ofperipheral organs during injurious ventilation withHT volumes. It was suggested that increased levels ofchemokines and inflammatory mediators enhance theseeffects leading to multiple organ dysfunction.27 Imai etal.’s study did not examine the CNS, and the extent towhich these mechanisms could also contribute to neuro-nal damage is unclear. However, inflammation is alsoinvolved in neurodegenerative processes, particularly inhippocampal neurons.28

In our study, although only reaching significancefor IL-6 after 2 h, the more distinctive cytokine levelsin the HT group might have been a consequence ofmechanical stress in the lung due to strain and higherinspiratory pressures. This systemic inflammatory re-sponse might have affected the CNS in our model aswell, leading to compromised cerebral oxygenationand metabolism in the HT group.

According to Imai et al.’s results, apoptosis mightbe one explanation for the observed CNS compromise.Within apoptotic processes, mitochondrial apoptoticalterations are initiated. Mitochondria are relevant forcellular metabolism, cellular oxygen use, and high-energy phosphate production (ATP).29 Mitochondrialdamage leads to increased reliance on anaerobic me-tabolism, which favors lactic acid production. Asobserved in our study, the phenomena of alteredtissue oxygen use at the mitochondrial level maycontribute to dysfunction of the integrity of the CNS.The tendency toward higher VO2 in the HT groupcould provide an indication for these metabolicchanges.

Furthermore, inflammation may cause cerebral mi-crocirculatory dysfunction.30 Such alterations in mi-crocirculation, triggered by a more pronouncedinflammatory response in the HT group, could be afurther mechanism explaining lower cerebral ptiO2levels.

Moreover, the use of cerebral microdialysis allowedexamination of brain metabolism directly in the regionof interest.31–33 The extracellular measurement ofenergy-related metabolites reflects metabolic events in

Figure 4. Systemic cytokines. Data are presented as mean �sd *P � 0.05 between groups. #P � 0.05 vs acute lung injury(ALI) (exact P value is given in brackets).

Figure 5. Systemic lactate. Data are presented as mean � sd.*P � 0.05 between groups. †#$P � 0.05 vs acute lung injury(ALI) (exact P values are given in brackets).


the intracellular compartment. Although data suggesthigh cerebral lactate levels for ischemia,21 indicative asa marker for secondary injury after brain damage,34,35

significant increases in cerebral lactate concentrationscan also be found after global hypoxia.36

We also found significantly higher cerebral lactatelevels in the HT group. Interestingly, lactate levels fur-ther increased in the HT group after normoxic conditionshad been restored. Again, a systemic and regional in-flammatory response triggered by more injurious me-chanical ventilation could explain these mechanisms inthe HT group. We suggest that the accumulation ofanaerobic metabolites, as observed by cerebral microdi-alysis, additionally underlines the compromised cellularoxygen use in the CNS because of a more pronouncedinflammatory response in the HT group.

The course of lactate seems comparable when mea-sured systemically and intracerebrally, as demonstratedin previous studies.37 This may underline the reliabilityof the techniques used to indicate hypoxic phenomena.

Although significant differences were not seen in theL/P ratios, at least the strong tendency in these resultsmay further demonstrate anaerobic conditions due tomechanical ventilation with HT volumes.

Hemodynamic results showed significantly lowerMAP levels in the HT group after 4 and 8 h. However,in both groups, MAP levels were above the lowerpressure limit for autoregulation, which is one of themost important mechanisms regulating cerebral bloodflow (CBF).37 The cerebral circulation plays a majorrole in maintaining a constant chemical microenviron-ment in the brain. It is of prime importance in auto-regulation, and therefore, although significantlydifferent, MAP levels were set between the definedlimits at all timepoints in both groups.

Another mechanism influencing CBF is the PacO2.38

The vasodilatory effects have direct impact on CBF,and consequently on brain tissue oxygenation andmetabolism.37,39–41 Because PacO2 levels in our study

Figure 6. Spearman correlation coefficient be-tween PaO2 and ptiO2.

Table 4. Hemoglobin and Electrolytes

BL ALI 2 h 4 h 8 hHb (g/dL)

HT 10.2 � 0.7 10.6 � 0.6 11.9 � 1.4 11.9 � 1.0 11.3 � 1.1LT 10.9 � 0.4 10.5 � 0.6 10.8 � 0.5 10.9 � 1.0 10.9 � 1.0

K� (mmol/L)HT 4.1 � 0.2 4.0 � 0.2 4.3 � 0.3 4.6 � 0.1 4.7 � 0.2LT 4.0 � 0.1 4.1 � 0.2 4.4 � 0.2 4.5 � 0.2 4.4 � 0.2

Na� (mmol/L)HT 139 � 1 141 � 1 141 � 2 142 � 2 142 � 2LT 141 � 2 142 � 2 141 � 1 141 � 1 141 � 1

Ca�� (mmol/L)HT 1.4 � 0.1 1.4 � 0.5 1.3 � 0.1 1.3 � 0.1 1.3 � 0.0LT 1.4 � 0.0 1.4 � 0.0 1.4 � 0.0 1.4 � 0.0 1.3 � 0.0

Data are presented as mean � SD.BL � baseline; ALI � acute lung injury; Hb � arterial hemoglobin; K� � sodium; Na� � potassium; Ca�� calcium.* P � 0.05 between groups.


were comparable between groups, it can be assumedthat CBF was within a normal range.

In addition, apart from a global measurement likeCBF, regulation of cerebral microcirculation is de-pendent on numerous factors.42 Different microcir-culatory effects due to the different tidal volumescould have played a role in the observed changes ofcerebral tissue oxygenation and metabolism.

The release of specific markers can be used toidentify neuronal damage. S-100 protein, prevalent inastroglial cells of the CNS, is a sensitive and specificmarker representing brain tissue damage and disinte-gration of the blood–brain barrier. It has been shownto correlate well with the extent and prognosis of braininjury.10,43–46

The peak serum concentrations at baseline and afterinduction of ALI are comparable to those obtained inother studies concerning brain damage.10,47,48 How-ever, it seems justified to assume that the early peakafter baseline represents neuronal damage due toinsertion of the microprobe. The constantly higherlevels of S-100 in the HT group may reflect persistentneuronal damage that was not detectable in the LTgroup. Although statistical significance was onlyreached after 8 h, this may be considered as improvedneuronal recovery in the LT group. However, theseresults may be limited, as mechanical ventilation per semay lead to a release of S100 protein.49

Our study has limitations. First, we cannot showevidence but can only speculate on the potentialmechanisms playing a role in the observed results. Inretrospect, the analysis of further organ dysfunctionmarkers, such as monocyte-chemotactic protein 1 orgrowth-regulated oncogene, as well as quantitation ofapoptosis could have provided further insights intothe pathomechanisms. Therefore, elaborate in vivo andin vitro analysis is required.

However, this is the first study evaluating neuronalcompromise in experimental ALI and detecting rel-evant phenomena in conjunction with injurious me-chanical ventilation. The specific aim was to directlymonitor its neurological consequences.

Second, concerning the length of the study, theeffect on neuronal damage might have occurred moreclearly in a chronic trial. Any long-term effects likeneurocognitive decline after ALI cannot be demon-strated here. Nevertheless, even after this short-termobservation, significant findings could be demon-strated, allowing new insights into the pathophysiol-ogy of brain damage after ALI. Within these acutelyinstrumented animals, the assessment of cerebral tis-sue oxygenation and metabolism in a model of ALImay be a valuable tool for identifying early neurologi-cal compromise.

Third, the CBF was not measured in our study.However, both major variables influencing CBF,namely PacO2 and MAP, showed a comparable coursein both groups. Besides, it is more likely that micro-circulatory effects influenced by an inflammatory

response play a role in the differences observed.Therefore, it might have been helpful to also monitormicrocirculation.

Intracranial pressure (ICP) was also not monitored.As ICP is partly affected by the CBF and PacO2, webelieve that ICP did not increase. Other factors influ-encing ICP, such as edema or swelling, seem unlikely.It is also possible that a further potential pattern ofinjury could have been caused by inserting a furtherprobe. We wanted to focus on the measurement ofoxygenation and resulting metabolism.

In conclusion, we demonstrate for the first timethat, in an established porcine model of ALI, LTvolume ventilation leads to significantly improvedcerebral tissue oxygenation when compared to HTvolume ventilation. One explanation could be a morepronounced inflammatory response during mechani-cal ventilation with HT volumes. This might haveinjurious effects on cerebral oxygenation and, conse-quently, on cerebral metabolism, because activation ofcomplex inflammatory cascades can lead to earlyimpairment of neuronal metabolism.50 Conversely, wesuggest that there may be a link between an attenu-ated release of inflammatory mediators during lung-protective ventilation and the impact of neuroinflam-matory processes.

These data have potential implications for the clini-cal effects of mechanical ventilation in ARDS. Themechanism by which the mode of ventilation affectsbrain function should be investigated as a basis fordeveloping possible treatment options for this sce-nario in clinical circumstances.

REFERENCES

1. Kraft P, Friedrich P, Pernerstorfer T, Fitzgerald RD, Koc D,Schneider B, Hammerle AF, Steltzer H. The Acute RespiratoryDistress Syndrome: definitions, severity, and clinical outcome:an analysis of 101 clinical investigations. Intensive Care Med1996;22:519–29

2. Bernard GR, Artigas A, Brigham KL, Carlet J, Falke KJ, HudsonL, Lamy M, Legall JR, Morris A, Spragg R. The Am-EurConsensus Conference on ARDS. Definitions, mechanisms, rel-evant outcomes and clinical trial coordination. Am J Respir CritCare 1994;149:818–24

3. The Acute Respiratory Distress Syndrome Network. Ventilationwith lower tidal volumes as compared with traditional tidalvolumes for acute lung injury and the acute respiratory distresssyndrome. N Engl J Med 2000;342:1301–8

4. Amato MB, Barbas CS, Medeiros DM, Magaldi RB, SchettinoGP, Lorenzi-Filho G, Kairalla RA, Deheinzelin D, Munoz C,Oliveira R, Takagaki TY, Carvalho CR. Effect of a protective-ventilation strategy on mortality in the acute respiratory distresssyndrome. N Engl J Med 1998;338:347–54

5. Hopkins RO, Weaver LK, Collingridge D, Parkinson BR, ChanKJ, Orme JF. Two-year cognitive, emotional, and quality-of-lifeoutcomes in acute respiratory distress syndrome. Am J RespirCrit Care Med 2005;171:340–7

6. Hopkins RO, Jackson JC. Long-term neurocognitive functionafter critical illness. Chest 2006;30:869–78

7. Manns JR, Hopkins RO, Squire LR. Semantic memory and thehuman hippocampus. Neuron 2003;38:27–33

8. Hopkins RO, Kesner RP, Goldstein M. Item and order recogni-tion memory in subjects with hypoxic brain injury. Brain Cogn1995;27:180–201

9. Hopkins RO, Kesner RP, Goldstein M. Memory for novel andfamiliar spatial and linguistic temporal distance information inhypoxic subjects. J Int Neuropsychol Soc 1995;1:454–68


10. Fries M, Bickenbach J, Henzler D, Beckers S, Dembinski R,Sellhaus B, Rossaint R, Kuhlen R. S-100 protein and neurohis-topathologic changes in a porcine model of acute lung injury.Anesthesiology 2005;102:761–7

11. Parsons PE, Eisner MD, Thompson BT, Matthay MA, Ancuk-iewicz M, Bernard GR, Wheeler AP; NHLBI Acute RespiratoryDistress Syndrome Clinical Trials Network. Lower tidal volumeventilation and plasma cytokine markers of inflammation inpatients with acute lung injury. Crit Care Med 2005;33:1–6

12. Frank JA, Parsons PE, Matthay MA. Pathogenetic significance ofbiological markers of ventilator-associated lung injury in experi-mental and clinical studies. Chest 2006;130:1906–14

13. Meduri GU, Headley S, Kohler G, Stentz F, Tolley E, UmbergerR, Leeper K. Persistent elevation of inflammatory cytokinespredicts a poor outcome in ARDS. Plasma IL-1 beta and IL-6levels are consistent and efficient predictors of outcome overtime. Chest 1995;107:1062–73

14. Wolthuis EK, Choi G, Dessing MC, Bresser P, Lutter R, DzoljicM, van der Poll T, Vroom MB, Hollmann M, Schultz MJ.Mechanical ventilation with lower tidal volumes and positiveend-expiratory pressure prevents pulmonary inflammation inpatients without preexisting lung injury. Anesthesiology2008;108:46–54

15. Ungerstedt U. Microdialysis—principles and applications forstudies in animal and man. J Intern Med 1991;230:365–73

16. Arner P, Bolinder J. Microdialysis of adipose tissue. J InternMed 1991;230:381–6

17. Muller M. Science, medicine, and the future: microdialysis. BMJ2002;324:588–91

18. Magnoni S, Ghisoni L, Locatelli M, Caimi M, Colombo A,Valeriani V, Stochetti N. Lack of improvement in cerebralmetabolism after hyperoxia in severe head injury: a microdialy-sis study. J Neurosurg 2003;98:952–8

19. Lachmann B, Robertson B, Vogel J. In vivo lung lavage as anexperimental model of the respiratory distress syndrome. ActaAnaesthesiol Scand 1980;24:231–6

20. Dembinski R, Max M, Lopez F, Kuhlen R, Kurth R, Rossaint R.Effect of inhaled prostacyclin in combination with almitrine onventilation-perfusion distributions in experimental lung injury.Anesthesiology 2001;94:461–8

21. Schulz MK, Wang LP, Tange M, Bjerre P. Cerebral microdialysismonitoring: determination of normal and ischemic cerebralmetabolisms in patients with aneurysmal subarachnoid hemor-rhage. J Neurosurg 2000;93:808–14

22. Hoffman WE. Measurement of intracerebral oxygen pressure:practicalities and pitfalls. Curr Opin Anaesthesiol 1999;12:497–502

23. Martinez-Tica JF, Berbarie R, Davenport P, Zornow MH. Moni-toring PO2, PCO2, and pH during graded levels of hypoxemia inrabbits. J Neurosurg Anesthesiol 1999;11:260–3

24. Starr JL, Whalley LJ. Drug induced dementia. Drug Saf1994;11:310–7

25. Gattinoni L, Caironi P, Carlesso E. How to ventilate patientswith acute lung injury and acute respiratory distress syndrome.Curr Opin Crit Care 2005;11:69–76

26. Ranieri VM, Giunta F, Suter PM, Slutsky AS. Mechanicalventilation as a mediator of multisystem organ failure in acuterespiratory distress syndrome. JAMA 2000;284:43–4

27. Imai Y, Parodo J, Kajikawa O, de Perrot M, Fischer S, EdwardsV, Cutz E, Liu M, Keshavjee S, Martin TR, Marshall JC, RanieriVM, Slutsky AS. Injurious mechanical ventilation and end-organ epithelial cell apoptosis and organ dysfunction in anexperimental model of acute respiratory distress syndrome.JAMA 2003;289:2104–12

28. Zassler B, Weis C, Humpel C. Tumor necrosis factor-alphatriggers cell death of sensitized potassium chloride-stimulatedcholinergic neurons. Brain Res Mol Brain Res 2003;113:78–85

29. Rolfe DF, Brown GC. Cellular energy utilization and molecularorigin of standard metabolic rate in mammals. Physiol Rev1997;77:731–58

30. Rosengarten B, Hecht M, Auch D, Ghofrani HA, Schermuly RT,Grimminger F, Kaps M. Microcirculatory dysfunction in thebrain precedes changes in evoked potentials in endotoxin-induced sepsis syndrome in rats. Cerebrovasc Dis 2007;23:140–7

31. Valtysson J, Persson L, Hillered L. Extracellular ischemia mark-ers in repeated global ischemia and secondary hypoxaemiamonitored by microdialysis in rat brain. Acta Neurochir1998;140:387–95

32. Ronne-Englstrom E, Carlson H, Liu Y, Ungerstedt U, Hillered L.Influence of perfusate glucose concentration on dialysate lac-tate, pyruvate, aspartate, and glutamate levels under basal andhypoxic conditions: a microdialysis study in rat brain. J Neuro-chem 1995;65:257–62

33. Landolt H, Langemann H. Cerebral microdialysis as a diagnos-tic tool in acute brain injury. Eur J Anaesthesiol 1996;13:269–78

34. Hillered L, Persson L, Nilsson P, Ronne-Englstrom E, Enblad P.Continuous monitoring of cerebral metabolism in traumaticbrain injury: a focus on cerebral microdialysis. Curr Opin CritCare 2006;12:112–8

35. Ungerstedt U, Rostami E. Microdialysis in neurointensive care.Curr Pharm Des 2004;10:2145–52

36. Zoremba N, Homola A, Rossaint R, Sykova E. Brain metabolismand extracellular space diffusion parameters during and aftertransient global hypoxia in the rat cortex. Exp Neurol2007;203:34–41

37. Hutchinson PJ, Gupta AK, Fryer TF, Al-Rawi PG, Chatfield DA,Coles JP, O’Connell MT, Kett-White R, Minhas PS, Aigbirhio FI,Clark JC, Kirkpatrick PJ, Menon DK, Pickard JD. Correlationbetween cerebral blood flow, substrate delivery, and metabo-lism in head injury: a combined microdialysis and triple oxygenpositron emission tomography study. J Cereb Blood Flow Metab2002;22:735–45

38. Hemphill JC III, Knudson MM, Derugin N, Morabito D, ManleyGT. Carbon dioxide reactivity and pressure autoregulation ofbrain tissue oxygen. Neurosurgery 2001;48:377–83

39. Akca O, Doufas A, Morioka N, Iscoe S, Fisher J, Sessler DI.Hypercapnia improves tissue oxygenation. Anesthesiology2002;97:801–6

40. O’Hara JA, Hou H, Demidenko E, Springett RJ, Khan N, SwartzHM. Simultaneous measurement of rat brain cortex PtO2 usingEPR oximetry and a fluorescence fiber-optic sensor duringnormoxia and hyperoxia. Physiol Meas 2005;26:203–13

41. Akca O, Liem E, Suleman M, Doufas AG, Galandiuk S, SesslerDI. Effect of intra-operative end-tidal carbon dioxide partialpressure on tissue oxygenation. Anaesthesia 2003;58:536–42

42. Iadecola C, Nedergaard M. Glial regulation of the cerebralmicrovasculature. Nat Neurosci 2007;10:1369–76

43. Bottiger BW, Mobes S, Glatzer R, Bauer H, Gries A, Bertsch P,Motsch H, Martin E. Astroglial protein S-100 is an early andsensitive marker of hypoxic brain damage and outcome aftercardiac arrest in humans. Circulation 2001;103:2694–8

44. Fassbender K, Schmidt R, Schreiner A, Fatar M, Muhlhauser F,Daffertshofer M, Hennerici M. Leakage of brain-originatedproteins in peripheral blood: temporal profile and diagnosticvalue in early ischemic stroke. J Neurol Sci 1997;148:101–5

45. Romner B, Ingebrigtsen T, Kongstad P, Borgesen SE. Traumaticbrain damage: serum S-100 protein measurements related toneuroradiological findings. J Neurotrauma 2000;17:641–7

46. Fries M, Kunz D, Gressner AM, Rossaint R, Kuhlen R. Procal-citonin serum levels after out-of-hospital cardiac arrest. Resus-citation 2003;59:105–9

47. Rosen H, Rosengren L, Herlitz J, Blomstrand C. Increased serumlevels of the S-100 protein are associated with hypoxic braindamage after cardiac arrest. Stroke 1998;29:473–7

48. Krieter H, Denz C, Janke C, Bertsch T, Luiz T, Ellinger K, VanAckern K. Hypertonic-hyperoncotic solutions reduce the releaseof cardiac troponin I and S-100 after successful cardiopulmo-nary resuscitation in pigs. Anesth Analg 2002;95:1031–6

49. Routsi C, Stamataki E, Nanas S, Psachoulia C, Stathopoulos A,Koroneos A, Zervou M, Jullien G, Roussos C. Increased levels ofserum S100B protein in critically ill patients without braininjury. Shock 2006;26:20–4

50. Semmler A, Hermann S, Mormann F, Weberpals M, Paxian SA,Okulla T, Schafers M, Kummer MP, Klockgether T, Heneka MT.Sepsis causes neuroinflammation and concomitant decrease ofcerebral metabolism. J Neuroinflammation 2008;5:38


Pressure Support Ventilation and Biphasic PositiveAirway Pressure Improve Oxygenation by Redistribution ofPulmonary Blood Flow

Alysson R. Carvalho, PhD*†

Peter M. Spieth, MD*

Paolo Pelosi, MD, PhD‡

Alessandro Beda, PhD*

Agnaldo J. Lopes, MD, DSc†

Boriana Neykova, MD§

Axel R. Heller, MD, PhD*

Thea Koch, MD, PhD*

Marcelo Gama de Abreu, MD,MSc, PhD, DEAA*

BACKGROUND: Spontaneous breathing (SB) activity may improve gas exchangeduring mechanical ventilation mainly by the recruitment of previously collapsedregions. Pressure support ventilation (PSV) and biphasic positive airway pressure(BIPAP) are frequently used modes of SB, but little is known about the mechanismsof improvement of lung function during these modes of assisted mechanicalventilation. We evaluated the mechanisms behind the improvement of gas ex-change with PSV and BIPAP.METHODS: Five pigs (25–29.3 kg) were mechanically ventilated in supine position,and acute lung injury (ALI) was induced by surfactant depletion. After stabiliza-tion, BIPAP was initiated with lower continuous positive airway pressure equal to5 cm H2O and the higher continuous positive airway pressure titrated to achieve atidal volume between 6 and 8 mL/kg. The depth of anesthesia was reduced, andwhen SB represented �20% of total minute ventilation, PSV and BIPAP � SB wereeach performed for 1 h (random sequence). Whole chest helical computedtomography was performed during end-expiratory pauses and functional variableswere obtained. Pulmonary blood flow (PBF) was marked with IV administeredfluorescent microspheres, and spatial cluster analysis was used to determine theeffects of each ventilatory mode on the distribution of PBF.RESULTS: ALI led to impairment of lung function and increase of poorly andnonaerated areas in dependent lung regions (P � 0.05). PSV and BIPAP � SBsimilarly improved oxygenation and reduced venous admixture compared withcontrolled mechanical ventilation (P � 0.05). Despite that, a significant increase ofnonaerated areas in dependent regions with a concomitant decrease of normallyaerated areas was observed during SB. In five of six lung clusters, redistribution ofPBF from dependent to nondependent, better aerated lung regions were observedduring PSV and BIPAP � SB.CONCLUSIONS: In this model of ALI, the improvements of oxygenation and venousadmixture obtained during assisted mechanical ventilation with PSV and BIPAP �SB were explained by the redistribution of PBF toward nondependent lung regionsrather than recruitment of dependent zones.(Anesth Analg 2009;109:856–65)

Controlled mechanical ventilation may be neces-sary to achieve adequate gas exchange and reduce thework of breathing in patients with acute lung injury(ALI).1–3 However, clinical and experimental studieshave shown that spontaneous breathing (SB) activity

may improve gas exchange and lung function duringmechanical ventilation, as well as reduce the need forsedation, cardio-circulatory drug support,4–6 andeven mitigate atrophy of diaphragm myofibers.7

Controlled mechanical ventilation with deep sedationand/or muscle paralysis also modifies the displace-ment pattern of the diaphragm.8,9 The unopposedincrease of intraabdominal pressure may reduce thetranspulmonary pressure in dependent lung regions,promoting lung collapse5,8 and redistributing tidalventilation toward nondependent regions.10,11 In thiscontext, SB activity may contribute to restoring thephysiological displacement of the diaphragm, improv-ing regional ventilation of dependent lung regions12

and enhancing hemodynamics through decreased in-trathoracic pressure.2,13–15 The recruitment of dorsaland usually better perfused lung regions throughinspiratory efforts is considered the main mechanismbehind the improvement in gas exchange during

From the *Clinic of Anesthesiology and Intensive Care Medicine,University Clinic Carl Gustav Carus, Dresden, Germany; †Univer-sity Augusto Motta, Rio de Janeiro, Brazil; ‡Department of Ambient,Health and Safety, University of Insubria, Varese, Italy; and §Insti-tute of Radiology, University Clinic Carl Gustav Carus, TechnicalUniversity Dresden, Dresden, Germany.

Accepted for publication May 4, 2009.Supported, in part, by a research grant from the European

Society of Anaesthesiology, Brussels, Belgium.Address for correspondence and reprint requests to Dr. Marcelo

Gama de Abreu, Clinic of Anesthesiology and Intensive CareMedicine, University Clinic Carl Gustav Carus, Technical Univer-sity Dresden, Fetscherstr. 74, 01307 Dresden, Germany. Addresse-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181aff245


assisted ventilation,5,8,12 but this concept was chal-lenged recently.16

Pressure support ventilation (PSV) and biphasicpositive airway pressure with SB (BIPAP � SB), bothcharacterized by decelerating inspiratory flow pat-terns, are frequently used modes of mechanical venti-lation in the clinical arena. Although PSV supportsevery triggered breath with positive pressure, BIPAPallows SB without support at two different airwaypressure levels. This may lead to enhanced ventilationand perfusion of dependent lung regions, makingBIPAP � SB superior to PSV.3,17 However, morerecent works have suggested that PSV and BIPAP �SB similarly improve gas exchange when comparedwith controlled mechanical ventilation in experimen-tal ALI.16,18

The main objective of this study was to identify themechanisms behind the improvement in lung functionduring PSV and BIPAP � SB. For this purpose, weassessed the distribution of lung aeration and thespatial distribution of changes in pulmonary perfu-sion, so-called clusters, during PSV and BIPAP � SB inexperimental ALI. We hypothesized that redistribu-tion of pulmonary blood flow (PBF) toward betteraerated regions plays an important role in theimprovement of oxygenation during PSV andBIPAP � SB.

METHODSExperimental Protocol

The protocol of this study was approved by thelocal animal care committee and the Government ofthe State of Saxony, Germany. Figure 1 shows thesequence of interventions performed, which are de-scribed in detail in this section. Five female pigs wereanesthetized and mechanically ventilated withvolume-controlled mode with inspiratory square flowwaveform using a tidal volume (VT) � 12 mL/kg,I:E � 1:1, inspired oxygen fraction (Fio2) � 0.5,positive end-expiratory pressure � 5 cm H2O, andrespiratory rate (RR) set to achieve an arterial pressureof carbon dioxide (Paco2) between 30 and 45 mm Hg.

Measurements of Functional VariablesAirway (Paw) and esophageal (Pes) pressures as

well as airflow (V) were continuously recorded.19 Theproduct of Pes versus time (PTP) was calculated

during inspiration, taking the first value at the beginningof the inspiratory cycle as offset. Respiratory drive (P0.1)was assessed as the difference between Paw at thebeginning of inspiration and 100 ms thereafter.16 Meansystemic and pulmonary arterial pressures as well ascentral venous and pulmonary artery wedge pressureswere measured. Cardiac output, venous admixture, andoxygen delivered and consumption were calculated us-ing standard formulas.20

Computed TomographyHelical computed tomography (CT) scans of the

whole lung were obtained with a Somatom Sensation16 (Siemens, Erlangen, Germany) during controlledmechanical ventilation, before and after the inductionof ALI, as well as during assisted mechanical ventila-tion with PSV and BIPAP � SB. Scans were obtainedduring breath-hold maneuvers at end-expiratory pres-sure and with simultaneous clamping of the endotra-cheal tube. The CT scanner was set as follows: collimation,16 � 0.75 mm; pitch, 1.35; bed speed, 38.6 mm/s;voltage, 120 kV; and tube current-time product, 120mAs. Images were reconstructed with slices of 5 mmthickness, without gaps between slices, yielding im-ages with 512 � 512 pixels with a surface of 0.443 �0.443 mm2 (voxel size � 0.98 mm3).

The radiograph attenuation of each pixel, expressedin Hounsfield units (HU), was primarily determinedby the density (mass/volume ratio) of the tissue andexpressed as the CT number, i.e., CT/(�1000) �(volume of gas/[volume of gas � volume of tissue]).The attenuation scale arbitrarily assigns to bone avalue of 1000 HU (complete absorption), to air a valueof �1000 HU (no absorption), and to water a value of0 HU; blood and lung tissue have a density rangingbetween 20 and 40 HU.21,22 After manual segmenta-tion of the region of interest, images were analyzed forcalculation of total lung and total gas volumes as wellas total lung mass and percentages of hyperaerated(�1000 to �900 HU), normally aerated (�900 to �500HU), poorly aerated (�500 to �100 HU), and nonaer-ated (�100 to �100 HU) compartments in total lungvolume, as suggested elsewhere.21,22

The lung volume (i.e., the sum of gas plus tissuevolume) was calculated as follows: ([size of thepixel]2 � slice thickness � total number of pixels ofthe region of interest for the whole lung). Weight of

Figure 1. Time course of interventions. Therapy 1 and 2 correspond to the sequence of spontaneous breathing (pressure supportventilation [PSV] or biphasic positive airway pressure [BIPAP] � spontaneous breathing [SB]) after the randomization.


lungs was calculated as: ([1 � CT/�1000] � [size ofthe pixel]2 � slice thickness � total number of pixelsof the region of interest for the whole lung).22

To assess the regional distribution of aeration innoninjured and injured lungs as well as in controlledand assisted ventilation, the whole lung was dividedinto 10 zones in the cranio-caudal and also the ventro-dorsal axes. The median CT-scan attenuation and thevolume of each zone were calculated.

Three-dimensional volume meshes were created bymasking the lung boundary of each compartment witha routine written in Matlab (MathWorks) by one of theauthors (ARC). Color mapping was used to representlung aeration compartments.

Distribution of PBFRegional PBF was marked with IV administered

fluorescent, color-labeled 15-�m diameter micro-spheres before and after induction of lung injury incontrolled mechanical ventilation as well as duringassisted mechanical ventilation with PSV and BIPAP � SB.The colors used were blue-green, carmine, crimson,red, orange, scarlet, and yellow-green. A differentcolor was assigned randomly and administered ateach timepoint to mark regional perfusion undereach experimental condition. Immediately beforeinjection, the microspheres were vortexed, sonicatedfor 90 s, and drawn into a 2-mL syringe. Allinjections were performed over 60 s to averageblood flow over several cardiac cycles and VTs.During injection, approximately 1.5 � 106 micro-spheres were administered.

Postmortem processing of lungs was performed aspreviously described.23 Briefly, lungs were flushedwith 50 mL/kg of a hydroxyethyl starch 130/0.4solution (Voluven, Fresenius Kabi, Bad Homburg,Germany) and air-dried by continuous tracheal air-flow for 7 days (continuous pressure of 25 cm H2O).The lungs were then coated with a one-componentpolyurethane foam (BTI Befestigungstechnik, Ingelfin-gen, Germany), suspended vertically in a square box,and embedded in rapidly setting urethane foam(polyol and isocyanate, Elastogran, Lemforde, Ger-many). The foam block was cut into cubes of 1.3 cm3.Each cube was weighed and assigned a three-dimensional coordinate. The samples were thensoaked for 2 days in 2 mL of 2-ethoxyethyl acetate(Aldrich Chemical, Milwaukee, WI) to retrieve thefluorescent dye. The fluorescence was read in a lumi-nescence spectrophotometer (LS-50B; Perkin-Elmer,Beaconsfield, UK). The measured intensity of fluores-cence in each probe was normalized according to itsown weight using Eq. 1:

Qrel,i � xi/��xi�/n (1)

where Qrel,i is the weight-normalized relative PBF ofthe probe i; xi is the obtained fluorescence divided bythe weight of the probe i, and n is the number of

probes. The mean normalized relative flow wastherefore 1.0.

The distribution of PBF along the cranio-caudal andventro-dorsal axes under each experimental conditionwas assessed by means of linear regression. Addition-ally, a three-dimensional reconstruction of the lungwas performed, considering the spatial coordinates ofeach lung piece and the PBF at each of the x, y, and zcoordinates. Color mapping was used to identify theregional distribution of PBF based on Qrel,i. The colormap was then normalized by the maximum Qrel undereach experimental condition, resulting in a color scaleranging from dark blue (0.0, lowest perfusion) to darkred (1.0, highest perfusion). Thereafter, the lungs weredivided into 10 zones of equal heights along thecranio-caudal and ventro-dorsal axes, as described, forCT analysis. The relative blood flow content (Qrel

content) of each zone was calculated taking the sum ofQrel,i in that zone divided by the sum of Qrel in thewhole lung. The volume of each zone was also com-puted by the simple arithmetical sum of each lungpiece in that zone.

The spatial representation of the lung volumemeshes and the distribution of PBF were obtainedusing a routine written in Matlab (MathWorks) by oneof the authors (ARC).

Experimental ProtocolAfter instrumentation, animals were allowed to

stabilize for 15 min (baseline). ALI was induced byrepetitive lung lavage until the Pao2/Fio2 ratio de-creased to �200 mm Hg and did not spontaneouslyrecover during a 30-min period.24 The endotrachealtube was disconnected from the ventilator andwarmed isotonic saline solution (30 mL/kg, 37°C–39°C) was instilled (height of approximately 40 cmabove the endotracheal tube). After that, the fluid wasretrieved passively by gravity drainage. Further la-vages were performed if Pao2/Fio2 ratio exceeded 200mm Hg. The countdown of 30 min was restarted inthis case. After injury stabilization, the ventilator wasswitched to BIPAP with lower continuous positiveairway pressure (CPAPlow) � 5 cm H2O, higher CPAP(CPAPhigh) titrated to obtain VT between 6 and 8mL/kg, and RR to achieve Paco2 between 50 and 60mm Hg without SB. The depth of anesthesia wasreduced (0.5–1.5 mg � kg�1 � h�1, midazolam; 4–6mg � kg�1 � h�1, ketamine; and 0.1–0.3 �g � kg�1 � h�1,remifentanil), and when SB represented more than20% of total minute ventilation, the ventilatory modewas switched to PSV or BIPAP � SB. During PSV,pressure support was set to obtain VT between 6 and8 mL/kg, the flow trigger was 2.0 L/min, and thecycling-off criteria was 25% of peak flow. DuringBIPAP � SB, the I:E ratio was adjusted to obtain meanPaw in the range of 8–10 cm H2O to permit compara-bility with the PSV mode. The animals’ lungs werethen ventilated for a period of 1 h with each mode(random sequence).

858 PSV and BiPAP � Spontaneous Breathing Redistribute Pulmonary Blood Flow ANESTHESIA & ANALGESIA

CT-scan images, fluorescent microspheres injection,and functional variables measurements were per-formed under each experimental condition (Fig. 1).Animals were then killed by IV administration of 2 gof thiopental and 50 mL of KCl (1 M), and lungs wereextracted for determination of PBF distribution.

Postmortem Lung ProcessingLungs were air-dried at 25 cm H2O for 7 days and

cut into pieces of approximately 1.33 mm3. The inten-sity of fluorescence in each piece was measured andnormalized for its own weight.23 A three-dimensionalreconstruction of the lung was performed, consideringthe spatial coordinates of each lung piece and the PBFat each of the x, y, and z coordinates. Thereafter, lungswere divided into 10 zones along the cranio-caudaland ventro-dorsal axes and the relative blood flowcontent of each zone was calculated.

Cluster AnalysisFor each animal, lung pieces sharing similar char-

acteristics of change in PBF were grouped into clus-ters. In addition, meta-cluster analysis was used toidentify stereotypical changes in PBF that were com-mon to all animals.25 For this purpose, the pieces fromall animals were merged into one dataset and thenonhierarchical clustering method was used to iden-tify clusters that have the same pattern across allanimals. Accordingly, clustering of pieces from indi-vidual animals shows whether changes in flow overeach experimental condition occur in different parts ofthe lung, and the meta-clustering demonstrates

whether the pattern of change is common acrossanimals.

To verify if a single dominant animal influenced theclustering processing in the meta-cluster, the amountof each animal’s pieces in each respective cluster wascalculated. Because five animals were studied, weexpected that the ideal cluster from the meta-clusterprocedure should be composed of a fraction of 20% ofpieces per animal. However, values between 20% �10% were accepted.

The clusters were created without reference to thespatial location of pieces within the lung. To displayand assess spatial clustering using data from meta-clusters, a “meta-lung” was created by linear transfor-mations (stretching and compressing) along the x, y,and z axes of the coordinates for each animal, aspreviously proposed.25

Statistical AnalysisValues are presented as median and interquartiles

(1st quartile–3rd quartile). Comparisons were per-formed using Wilcoxon’s test for paired data (Soft-ware package SPSS, version 12.0, Chicago, IL), and theBonferroni-Holm procedure was used to adjust formultiple tests. Statistical significance was set at P�0.05.

RESULTSSurfactant depletion increased Paw (Table 1), im-

paired oxygenation, and worsened venous admixture(Table 2). Furthermore, increases in total lung volume,

Table 1. Respiratory Variables

Controlled ventilation (squareinspiratory flow pattern)

Assisted ventilation (deceleratinginspiratory flow pattern)

Baseline Injury PSV BIPAP � SBMV

Total (L/min) 4.5 (3.3–6.8) 3.6 (3.3–4.6) 6.8† (5.8–7.1) 7.1† (4.9–7.3)Controlled (L/min) 4.5 (3.3–6.8) 3.6 (3.3–4.6) — 1.5† (1.3–1.6)Spontaneous (L/min) — — — 5.3 (3.6–5.6)

VTTotal (mL) 324.7 (320.7–333.4) 332.0 (313.5–333.2) 160.1† (130.4–165.1) 109.9†‡ (91.0–113.4)Controlled (mL) 324.7 (320.7–333.4) 332.0 (313.5–333.2) — 157.8 (141.4–169.2)Spontaneous (mL) — — — 93.2 (86.5–109.4)

RRTotal (/min) 14(10–20) 12 (10–13) 35† (31–52) 55† (49–66)Controlled (/min) 14 (10–20) 12 (10–13) — 10 (6–12)Spontaneous (/min) — — — 45 (39–60)

PpeakTotal (cm H2O) 18.9 (18.8–19.2) 31.7* (30.1–32.6) 22.1† (21.8–22.5) 10.5† (9.8–11.6)Controlled (cm H2O) 18.9 (18.8–19.2) 31.7* (30.1–32.6) — 22.3† (22.0–22.5)

Paw mean (cm H2O) 10.7 (10.5–10.8) 14.9* (13.3–15.3) 7.8† (7.6–8.9) 9.4†‡ (9.1–9.8)P0.1 (cm H2O) — — 0.43 (0.4–0.6) 4.9‡ (2.2–5.2)PTP (cm H2O � s � min�1) — — 30.8 (15.3–39.7) 168.6‡ (106.4–192.2)Values provided as median (interquartile ranges).PSV � pressure support ventilation; BIPAP � SB � biphasic positive airway pressure � spontaneous breathing; MV � minute ventilation; VT � tidal volume; RR � respiratory rate; Ppeak �peak airway pressure; Paw mean � mean airway pressure; P0.1 � airway pressure gradient measured at 100 ms after start of inspiration; PTP � inspiratory pressure time product of esophagealpressure; —, not applicable.* P � 0.05 versus baseline; † P � 0.05 versus injury; ‡ P � 0.05 versus PSV.


total lung mass, and volume of nonaerated areas wereobserved (Table 3).

As shown in Table 1, total minute ventilationincreased with both modes of assisted mechanicalventilation (P � 0.05). The reduction of VT during PSVand BIPAP � SB was accompanied by an increase inthe total RR (P � 0.05). Additionally, a significantreduction of total gas volume and the volume ofnormally aerated areas were observed (P � 0.05, Table3). Despite this, oxygenation increased and venousadmixture decreased with both modes of assistedcompared with controlled mechanical ventilation (P �0.05), whereas P0.1 and PTP were higher during BIPAP �SB than PSV. No significant differences between PSVand BIPAP � SB were observed with regard to gasexchange and distribution of aeration (Table 3).

Regional Distribution of Aeration and PBFFigure 2 shows the three-dimensional representa-

tion of the distribution of lung aeration and PBF forone representative animal. At baseline, nonaeratedareas were constrained to the most caudal regions.After induction of ALI, nonaerated areas increased inthe dorsal lung zones, whereas normally aerated areascould be observed mainly in ventral and cranialregions. During PSV and BIPAP � SB, the amount ofnonaerated areas in dorsal parts of the lungs increasedfurther (Figs. 2 and 3A, left panels). Similarly, afterALI, PBF shifted from caudal and dorsal to cranial andventral lung regions, respectively (P � 0.05). DuringPSV and BIPAP � SB, PBF further decreased in dorsaland caudal areas, but no differences were observedbetween modes (Figs. 2 and 3A, right panels).

Table 2. Gas Exchange, Hemodynamics, and Oxygen Transport/Consumption

Controlled ventilation (square flowwaveform)

Assisted ventilation (decelerating flowpattern)

Baseline Injury PSV BIPAP � SBGas exchange

Pao2/Fio2 (mm Hg) 533.2 (517.6–536.8) 126.0* (102.0–141.4) 262.8† (243.2–290.4) 218.8† (198.2–229.4)QVA/Qt (%) 5.5 (5.1–6.9) 26.1* (25.2–33.1) 16.7† (9.8–17.4) 19.2† (13.5–19.7)Paco2 (mm Hg) 33.1 (30.9–36.7) 37.2 (35.4–37.8) 55.0† (49.6–55.8) 66.2† (65.9–68.0)

HemodynamicsCO (L/min) 2.5 (2.2–3.2) 2.0* (2.0–3.0) 2.8 (2.7–3.3) 3.3† (3.2–3.9)HF (/min) 72 (72–76) 67 (57–79) 86 (79–103) 96†‡ (91–113)MAP (mm Hg) 77 (69–90) 69 (69–74) 76† (71–83) 69 (68–76)MPAP (mm Hg) 22 (16–23) 30* (28–32) 30 (29–35) 35 (30–36)CVP (mm Hg) 10 (7–12) 10 (10–11) 8 (7–10) 7 (7–8)PCWP (mm Hg) 13 (12–14) 15 (13–16) 12 (11–14) 12 (8–12)PVR (dyn � s � cm�5) 260.5 (125.8–288) 627.5* (333.3–800.0) 407.2 (388.1–690.6) 509.1 (456.0–573.3)SVR (dyn � s � cm�5) 1994.2 (1711.6–2414.4) 1594.6 (1547.6–2313.7) 1628.7 (1552.2–2303.0) 1285.0† (1236.4–1719.9)

Oxygen transport andconsumption

DO2 (mL/min) 356.8 (281.6–391.4) 274.4* (237.3–287.3) 419.0† (326.9–465.1) 450.6† (381.1–468.5)

VO2 (mL/min) 105.3 (86.4–138.2) 135.6 (106.7–142.7) 153.4 (124.5–158.5) 104.0 (99.7–107.7)

Values provided as median (interquartile ranges).PSV � pressure support ventilation; BIPAP � SB � biphasic positive airway pressure � spontaneous breathing; PaO2/FIO2 � ratio between arterial pressure of oxygen and inspired oxygenfraction; QVA/Q t � venous admixture; PaCO2 � arterial pressure of carbon dioxide; CO � cardiac output; HF � heart frequency; MAP � mean arterial blood pressure; MPAP � mean pulmonaryarterial pressure; CVP � central venous pressure; PCWP � pulmonary artery wedge pressure; PVR � pulmonary vascular resistance; SVR � systemic vascular resistance; DO2 � oxygen delivery;VO2 � oxygen consumption.* P � 0.05 versus baseline; † P � 0.05 versus injury; ‡ P � 0.05 versus PSV.

Table 3. Computed Tomography Data

Controlled ventilation (squareinspiratory flow pattern)

Assisted ventilation (deceleratinginspiratory flow pattern)

Baseline Injury PSV BIPAP � SBTotal lung volume (mL) 1015.1 (809.8–1161.9) 1025.9* (947.2–1295.5) 797.7† (706.6–974.1) 832.2† (825.1–948.2)Total gas volume (mL) 718.4 (518.9–800.5) 621.0 (524.7–753.2) 320.5† (237.0–324.4) 310.7† (290.7–436.0)Total lung mass (g) 296.7 (290.9–361.5) 495.5* (422.4–542.3) 560.7 (382.2–566.9) 522.8 (389.1–541.5)Hyperinflated (% Vol) 3.0 (1.4–3.5) 2.3 (1.7–3.1) 0.9 (0.5–2.4) 0.9 (0.8–2.1)Normally aerated (% Vol) 81.9 (77.0–83.1) 63.3* (61.2–69.0) 42.4† (33.0–49.0) 43.5† (34.9–54.6)Poorly aerated (% Vol) 11.5 (10.8–14.0) 20.0 (17.5–22.8) 29.5 (24.3–29.8) 24.6 (20.2–26.1)Nonaerated (% Vol) 2.6 (2.4–3.3) 11.5* (10.4–14.6) 32.7† (25.2–34.6) 28.7† (25.3–29.9)Values provided as median (interquartile ranges). Hyperaerated, normally aerated, poorly aerated, and nonaerated compartments were computed according to references.21,22

PSV � pressure support ventilation; BIPAP � SB � biphasic positive airway pressure � spontaneous breathing.* P � 0.05 versus baseline; † P � 0.05 versus injury; ‡ P � 0.05 versus PSV.


Cluster AnalysisFigure 4 shows the results of the cluster analysis for

the same animal. Lung pieces could be grouped intosix main clusters in that animal (Fig. 4A, left panels).Cluster A presented an almost constant distribution ofPBF. Cluster B presented a pattern of increase of PBFthrough all experimental interventions, whereas Clus-ter C presented the opposite pattern. Cluster D pre-sented a decrease of PBF from controlled to assistedventilation with PSV and BIPAP � SB, whereas Clus-ter F presented the opposite pattern. Cluster E pre-sented a pattern of increase of PBF from baseline toinjury, with a decrease of PBF from injury to PSV andBIPAP � SB.

The spatial distribution of clusters (Fig. 4A, rightpanel) evidenced a reduction of PBF in caudal anddorsal regions between baseline and injury (ClusterC), with a concomitant increase in the cranial andventral regions (Clusters B and E). During PSV andBIPAP � SB, a further reduction of PBF in caudaland dorsal regions was observed (Clusters C, D, andE), as well as an increase in PBF to cranial and ventralregions (Clusters B and F).

Figure 4B shows the six clusters of the meta-clusteranalysis (Fig. 4B, left panel). Cluster A presented analmost constant pattern of PBF under all experimentalconditions. Cluster B presented an increase of PBFafter SB was resumed, whereas Cluster F presentedthe opposite pattern. Cluster C presented a decreaseof PBF throughout the experimental conditions,whereas Cluster D presented the reverse pattern.Cluster F presented an increase of PBF from baselineto injury and a decrease of PBF from controlled

ventilation to SB. Figure 4B (middle panels) showsthe percentages of the number of pieces of eachanimal related to the total amount of pieces of themeta-lung. Note that the clustering process wasquite representative of the overall behavior. Figure4B (right panels) shows the spatial distribution ofmeta-clusters. As can be observed, the clusters thatpresented a reduction in PBF were located in dorsaland caudal regions, whereas the clusters that pre-sented an increase in PBF were located in ventraland cranial regions of lungs.

DISCUSSIONThe main findings of this study were that: 1) in a

surfactant depletion model of ALI, PSV and BIPAP �SB led to similar improvement in oxygenation andreduction in venous admixture compared with con-trolled mechanical ventilation; 2) P0.1 and PTP werehigher with BIPAP � SB than with PSV; 3) neither PSVnor BIPAP � SB resulted in increased aeration ofdependent lung regions compared with controlledmechanical ventilation; 4) during PSV and BIPAP �SB, pulmonary perfusion shifted from dependent tonondependent lung regions.

Regional Distribution of Aeration and PBF DuringControlled Mechanical Ventilation

Controlled mechanical ventilation with muscleparalysis modifies the displacement pattern of thediaphragm.8,9 Accordingly, normally aerated and hy-peraerated areas are usually located in nondependentregions, whereas poorly aerated and nonaerated areas

Figure 2. Three-dimensional representation of the distribution of aeration assessed by static computed tomography (CT), and thespatial distribution of weight-normalized relative pulmonary blood flow (PBF) in one representative animal. CT images wereobtained at the end of expiration. The x, y, and z axes represent the spatial orientation of lungs. Two different projections are shown:the upper row presents a frontal plan projection and the lower row presents the same lungs rotated by 120° around the vertical axis(z). Red represents hyperaerated (�1000 to �900 Hounsfield units [HU]); blue, normally aerated (�900 to �500 HU); gray, poorlyaerated (�500 to �100 HU); and pink, nonaerated areas (�100 to �100 HU). Color mapping was used to illustrate PBF, with thecolor intensity normalized by the maximum PBF at each experimental condition. The normalized color bar is presented with darkblue and red, representing the lowest and highest perfusion levels, respectively. Note the increase of poorly and nonaerated areasfrom the caudal to cranial and dorsal to ventral areas after induction of acute lung injury, as well as during assisted spontaneousbreathing with pressure support ventilation (PSV) and with biphasic positive airway pressure and spontaneous breathing (BIPAP� SB). Also note the redistribution of PBF toward better aerated cranial and ventral lung regions.


are seen in dependent lung regions.10 Our results arein agreement with these observations.

The meta-cluster analysis showed a consistent pat-tern of changes in regional distribution of PBF acrossanimals. Although PBF decreased in dorsal regions, anincrease of blood flow in ventral regions occurred.However, no differences in the regional distribution ofPBF were observed in more central parts of the lungsafter induction of ALI, even though these regionspresented large amounts of poorly or nonaerated lungtissue. The reduced but still present blood flowthrough the dorsal and caudal regions likely explainsthe increased venous admixture and the reducedPao2/Fio2 ratio under controlled ventilation after in-duction of ALI.

Regional Distribution of Aeration and PBF During PSVand BIPAP � SB

SB activity has been proposed as an alternative toimprove respiratory function and reduce sedation andcirculatory drug support during ALI.3 Although it

cannot be considered a “gold standard,” PSV is themost frequently used form of assisted mechanicalventilation in the clinical setting.26 During PSV, everyflow- or pressure-triggered breath is assisted withpositive pressure, helping to unload the respiratorymuscles and to reduce the work of breathing, as wellas to enhance the synchrony between subject andmechanical ventilator. However, depending on thesettings of the mechanical ventilator, excessive un-loading of respiratory muscles can also lead to loss ofmovement of the diaphragm, especially in the poste-rior muscular sections, which would reduce thetranspulmonary pressure in dependent lung regionsand mimic-controlled ventilation.5,8,11

On the other hand, BIPAP � SB supports inspira-tion only if it begins simultaneously with the changefrom CPAPlow to CPAPhigh, but nonsupported breath-ing is possible in both levels. Although nonsupportedbreaths are associated with increased work of breath-ing, they may be useful to improve ventilation of

Figure 3. Left column: Regional distribution of computed tomography (CT) attenuation, expressed in Hounsfield units (HU),in 10 zones of lungs along the cranio-caudal (upper panels) and ventro-dorsal (lower panels) axes at Baseline and Injury (A)as well as at institution of pressure support ventilation (PSV) and biphasic positive airway pressure (BIPAP), respectively (B).The horizontal lines marked the ranges for each compartment in the CT attenuation plot. Symbols represent the median ateach measurement condition, with circles, triangles, stars, and squares representing Baseline, Injury, assisted ventilation withPSV, and assisted ventilation with BIPAP, respectively. Right column: Regional distribution of the weight-normalized relativepulmonary blood flow content (PBF) in 10 zones along the cranio-caudal (upper panels) and ventro-dorsal (lower panels)axes. Vertical bars represent 1st and 3rd quartiles. *P � 0.05, Baseline versus Injury (controlled ventilation).


dependent lung areas by means of contraction of theposterior muscular sections of the diaphragm and alsoincrease lung perfusion through reduction of intratho-racic pressure. Accordingly, different authors havesuggested that BIPAP � SB leads to an improvementin lung function when compared with PSV, as aconsequence of the better matching of ventilation/perfusion ratio in dependent regions.17,18 However, thedistribution of PBF is influenced by different factors,such as gravity, the fractal structure of pulmonary cap-illaries, trans-capillary pressure gradients, and, mostimportantly, hypoxic pulmonary vasoconstriction.27–30

Our findings are in line with previous studiesshowing that PSV and BIPAP � SB improve oxygen-ation and reduce venous admixture compared withcontrolled ventilation.16–18 Additionally, our results

showed a significant increase in the respiratory driveand in PTP, which reflects the respiratory effort andthe oxygen consumption of the respiratory muscles,31

during BIPAP � SB compared with PSV. Thus, weexpected that the respiratory muscles, and more par-ticularly the diaphragm, would generate highertranspulmonary pressures in dependent zones duringBIPAP � SB, resulting in recruitment and improvedventilation/perfusion matching in those zones. How-ever, the improvement in pulmonary function couldnot be attributed to increased end-expiratory lung gasvolumes or normally aerated areas. This result issomewhat surprising, given that the surfactant deple-tion model is believed to be a very recruitable modelof ALI.32,33 However, we cannot exclude the possibil-ity that SB may have influenced the distribution of

Figure 4. A, Patterns of changes in the residuals of the weight-normalized pulmonary blood flow of the pig presented in Figure1, at each experimental intervention (B � baseline; I � injury; PSV � pressure support ventilation; Bi � biphasic positiveairway pressure, left panels). Changes in flow for a piece at each specified experimental condition was calculated as thedifference between the Qrel at that condition and the mean Qrel throughout all experimental interventions. Six patterns ofchanges in pulmonary blood flow (clusters) were identified by the nonhierarchical analysis. Each cluster is depicted withdifferent colors (left panels, Clusters A–F). The number of pieces in each cluster and the percentage of each cluster in the totallung are also exhibited above each panel. Right: Three-dimensional representation of the spatial distribution of the sixcolor-coded clusters. B, Clusters identified through the nonhierarchical clustering method throughout all experimentalconditions in all animals (meta-cluster analysis). The number of pieces in each cluster and the percentage of each cluster inthe total meta-lung are also exhibited above each panel. The bold lines represent the mean value of the respective color-codedcluster. Middle panels: Percentage (number of occurrences) of pieces from each animal (A1–A5) in the respective clusters;horizontal lines mark the range of 20% � 10%. Right: Three-dimensional representation of the spatial distribution of the sixcolor-coded clusters (meta-lung). Two different projections are shown. The upper right panel presents a frontal planprojection and the lower right panel presents the same picture rotated by 120° along the vertical axis (z). The x, y, and z axesrepresent the spatial orientation of the meta-lung.


regional ventilation or that intratidal lung recruitmentoccurred.

It is worth noting that the redistribution of intrapul-monary gas with PSV and BIPAP � SB was followedby the same pattern of the redistribution of PBF. Twoclusters representing 33% of the total lung tissue andsituated in ventral areas revealed an increase of PBFwith PSV and BIPAP � SB. In contrast, two otherclusters representing 14% of lung tissue and situatedin dorsal areas showed a decrease of PBF. Thesefindings support the hypothesis that improved re-gional aeration/perfusion matching occurred duringassisted ventilation with PSV and BIPAP � SB. On theother hand, the regional distribution of aeration andPBF did not differ between PSV and BIPAP � SB, aswe expected. The most likely explanation for redistri-bution of PBF toward nondependent lung regions isthat peak and mean Paw were lower during PSV andBIPAP � SB than during controlled mechanical ven-tilation. Thus, lung capillaries in nondependent lungzones probably had lower impedance to perfusion,allowing more efficient hypoxic pulmonary vasocon-striction in dependent areas. Because both PSV andBIPAP � SB used decelerating inspiratory flow,whereas controlled ventilation used square inspira-tory flow, we also cannot exclude that redistributionof airway-alveolar flow improved ventilation in nonde-pendent zones during assisted compared with con-trolled mechanical ventilation. In addition, it is possiblethat the rapid shallow breathing pattern and hypercap-nia observed during assisted mechanical ventilation fur-ther contributed to a shift of ventilation to nondependentzones.

In contrast to our study, other authors have re-ported increased oxygenation and reduced venousadmixture with BIPAP � SB compared with PSV.17

This is possibly explained by the fact that thoseauthors did not match assisted ventilation modes forboth mean Paw and minute ventilation simulta-neously, as performed in this work. Our findings alsodiffer from the clinical reports by Cereda et al.34 andPutensen et al.17 One possible explanation is thatpatients investigated in those studies may have pre-sented more severe lung injury. Another possiblereason is that patients with ALI/acute respiratorydistress syndrome may exhibit blunted hypoxic pul-monary vasoconstriction35 because of the inhibitoryeffects of proinflammatory mediators, nitric oxide,and endotoxin itself.36–39

Possible Clinical ImplicationsOur findings contribute to further understand the

physiological mechanisms leading to improvement ofPao2 and reduction of venous admixture when switch-ing from controlled to assisted spontaneous mechani-cal ventilation. According to our data, redistributionof PBF from dependent toward nondependent, betteraerated regions, which is closely related to preserved

hypoxic pulmonary vasoconstriction, may play a piv-otal role in improvement of oxygenation during as-sisted mechanical ventilation. Consequently, lack ofimprovement of Pao2 after resuming SB in mechani-cally ventilated patients may suggest impairment ofhypoxic pulmonary vasoconstriction and/or diffuseloss of lung aeration.

LimitationsThis study has several limitations. First, we used a

relatively low positive end-expiratory pressure level(5 cm H2O), which possibly precluded the moredependent alveolar units from being kept open at theend of expiration, even if they may have openedduring inspiration (intratidal recruitment). Second, wedid not use a crossover design for controlled andassisted ventilation, which may have somewhat bi-ased our analysis. We decided for the fixed sequenceof controlled followed by assisted mechanical ventila-tion because it more closely reflects clinical practice.Moreover, if we had included controlled ventilation inthe randomization, redistribution of PBF during PSVand BIPAP � SB could have “contaminated” con-trolled ventilation (carryover effect). Third, we evalu-ated only immediate physiological effects of PSV andBIPAP � SB. Thus, we cannot exclude that thesemodes may lead to recruitment of dependent lungzones over the long term. Fourth, depth of sedationwas increased during controlled compared withassisted mechanical ventilation. However, the drugswe used, namely midazolam, ketamine and remifen-tanil, seem not to influence the tonus of pulmonaryvasculature.40,41 Fifth, it must be kept in mind thatour evaluation was performed in a model of ALIthat does not reproduce all features of the morecomplex human ALI/acute respiratory distress syn-drome. Because PSV and BIPAP � SB seem to bemore likely to result in improved lung functionwhen the hypoxic vasoconstriction reflex is pre-served, extrapolation of our results to the clinicalscenario must consider this fact.

We conclude that in a surfactant depletion model ofALI, PSV and BIPAP � SB improve oxygenation andreduce venous admixture to similar extents comparedwith controlled ventilation. Such effects are betterexplained by redistribution of lung perfusion towardnondependent lung zones than recruitment of depen-dent lung regions.

REFERENCES

1. Hering R, Zinserling J, Wrigge H, Varelmann D, Berg A, KreyerS, Putensen C. Effects of spontaneous breathing during airwaypressure release ventilation on respiratory work and muscleblood flow in experimental lung injury. Chest 2005;128:2991–8

2. Putensen C, Hering R, Muders T, Wrigge H. Assisted breathingis better in acute respiratory failure. Curr Opin Crit Care2005;11:63–8

3. Putensen C, Muders T, Varelmann D, Wrigge H. The impact ofspontaneous breathing during mechanical ventilation. CurrOpin Crit Care 2006;12:13–8


4. Putensen C, Zech S, Wrigge H, Zinserling J, Stuber F, Von ST,Mutz N. Long-term effects of spontaneous breathing duringventilatory support in patients with acute lung injury. Am JRespir Crit Care Med 2001;164:43–9

5. Putensen C, Hering R, Wrigge H. Controlled versus assistedmechanical ventilation. Curr Opin Crit Care 2002;8:51–7

6. Wrigge H, Zinserling J, Neumann P, Defosse J, Magnusson A,Putensen C, Hedenstierna G. Spontaneous breathing improveslung aeration in oleic acid-induced lung injury. Anesthesiology2003;99:376–84

7. Levine S, Nguyen T, Taylor N, Friscia ME, Budak MT, Rothen-berg P, Zhu J, Sachdeva R, Sonnad S, Kaiser LR, Rubinstein NA,Powers SK, Shrager JB. Rapid disuse atrophy of diaphragmfibers in mechanically ventilated humans. N Engl J Med2008;358:1327–35

8. Froese AB, Bryan AC. Effects of anesthesia and paralysis ondiaphragmatic mechanics in man. Anesthesiology 1974;41:242–55

9. Froese AB. Anesthesia-paralysis and the diaphragm: in pursuitof an elusive muscle. Anesthesiology 1989;70:887–90

10. Puybasset L, Cluzel P, Gusman P, Grenier P, Preteux F, RoubyJJ. Regional distribution of gas and tissue in acute respiratorydistress syndrome. I. Consequences for lung morphology. CTScan ARDS Study Group. Intensive Care Med 2000;26:857–69

11. Duggan M, Kavanagh BP. Pulmonary atelectasis: a pathogenicperioperative entity. Anesthesiology 2005;102:838–54

12. Wrigge H, Zinserling J, Neumann P, Muders T, Magnusson A,Putensen C, Hedenstierna G. Spontaneous breathing with air-way pressure release ventilation favors ventilation in dependentlung regions and counters cyclic alveolar collapse in oleic-acid-induced lung injury: a randomized controlled computed tomog-raphy trial. Crit Care 2005;9:R780–9

13. Putensen C, von ST, Hering R, Stuber F, Zinserling J. Effect ofdifferent ventilatory support modalities on the ventilation toperfusion distributions. Acta Anaesthesiol Scand Suppl 1997;111:119–22

14. Hering R, Viehofer A, Zinserling J, Wrigge H, Kreyer S, Berg A,Minor T, Putensen C. Effects of spontaneous breathing duringairway pressure release ventilation on intestinal blood flow inexperimental lung injury. Anesthesiology 2003;99:1137–44

15. Varelmann D, Wrigge H, Zinserling J, Muders T, Hering R,Putensen C. Proportional assist versus pressure support venti-lation in patients with acute respiratory failure: cardiorespira-tory responses to artificially increased ventilatory demand. CritCare Med 2005;33:1968–75

16. Gama de Abreu M, Spieth PM, Pelosi P, Carvalho AR, Walter C,Schreiber-Ferstl A, Aikele P, Neykova B, Hubler M, Koch T.Noisy pressure support ventilation: a pilot study on a newassisted ventilation mode in experimental lung injury. Crit CareMed 2008;36:818–27

17. Putensen C, Mutz NJ, Putensen-Himmer G, Zinserling J. Sponta-neous breathing during ventilatory support improves ventilation-perfusion distributions in patients with acute respiratory distresssyndrome. Am J Respir Crit Care Med 1999;159:1241–8

18. Henzler D, Pelosi P, Bensberg R, Dembinski R, Quintel M,Pielen V, Rossaint R, Kuhlen R. Effects of partial ventilatorysupport modalities on respiratory function in severe hypoxemiclung injury. Crit Care Med 2006;34:1738–45

19. Gama de Abreu M, Quelhas AD, Spieth P, Brauer G, Knels L,Kasper M, Pino AV, Bleyl JU, Hubler M, Bozza F, Salluh J,Kuhlisch E, Giannella-Neto A, Koch T. Comparative effects ofvaporized perfluorohexane and partial liquid ventilation inoleic acid-induced lung injury. Anesthesiology 2006;104:278–89

20. Bleyl JU, Ragaller M, Tscho U, Regner M, Kanzow M, Hubler M,Rasche S, Albrecht M. Vaporized perfluorocarbon improves oxy-genation and pulmonary function in an ovine model of acuterespiratory distress syndrome. Anesthesiology 1999;91:461–9

21. Vieira SR, Puybasset L, Richecoeur J, Lu Q, Cluzel P, GusmanPB, Coriat P, Rouby JJ. A lung computed tomographic assess-ment of positive end-expiratory pressure-induced lung overd-istension. Am J Respir Crit Care Med 1998;158:1571–7

22. Gattinoni L, Caironi P, Pelosi P, Goodman LR. What hascomputed tomography taught us about the acute respiratorydistress syndrome? Am J Respir Crit Care Med 2001;164:1701–11

23. Hubler M, Souders JE, Shade ED, Polissar NL, Schimmel C,Hlastala MP. Effects of vaporized perfluorocarbon on pulmo-nary blood flow and ventilation/perfusion distribution in amodel of acute respiratory distress syndrome. Anesthesiology2001;95:1414–21

24. Lachmann B, Robertson B, Vogel J. In vivo lung lavage as anexperimental model of the respiratory distress syndrome. ActaAnaesthesiol Scand 1980;24:231–6

25. Hlastala MP, Lamm WJ, Karp A, Polissar NL, Starr IR, GlennyRW. Spatial distribution of hypoxic pulmonary vasoconstrictionin the supine pig. J Appl Physiol 2004;96:1589–99

26. Esteban A, Ferguson ND, Meade MO, Frutos-Vivar F, Apezteg-uia C, Brochard L, Raymondos K, Nin N, Hurtado J, Tomicic V,Gonzalez M, Elizalde J, Nightingale P, Abroug F, Pelosi P, ArabiY, Moreno R, Jibaja M, D’Empaire G, Sandi F, Matamis D,Montanez AM, Anzueto A. Evolution of mechanical ventilationin response to clinical research. Am J Respir Crit Care Med2008;177:170–7

27. Glenny RW, Robertson HT. Fractal modeling of pulmonaryblood flow heterogeneity. J Appl Physiol 1994;70:1024–30

28. Glenny RW, Lamm WJ, Bernard SL, An D, Chornuk M, Pool SL,Wagner WW Jr, Hlastala MP, Robertson HT. Selected contribu-tion: redistribution of pulmonary perfusion during weightless-ness and increased gravity. J Appl Physiol 2000;89:1239–48

29. Altemeier WA, McKinney S, Glenny RW. Fractal nature ofregional ventilation distribution. J Appl Physiol 2000;88:1551–7

30. Starr IR, Lamm WJ, Neradilek B, Polissar N, Glenny RW,Hlastala MP. Regional hypoxic pulmonary vasoconstriction inprone pigs. J Appl Physiol 2005;99:363–70

31. McGregor M, Becklake MR. The relationship of oxygen cost ofbreathing to respiratory mechanical work and respiratory force.J Clin Invest 1961;40:971–80

32. Van der Kloot TE, Blanch L, Youngblood AM, Weinert C,Adams AB, Marini JJ, Shapiro RS, Nahum A. Recruitmentmaneuvers in three experimental models of acute lung injury.Effect on lung volume and gas exchange. Am J Respir Crit CareMed 2000;161:1485–94

33. Luecke T, Meinhardt JP, Herrmann P, Weiss A, Quintel M,Pelosi P. Oleic acid vs saline solution lung lavage-induced acutelung injury: effects on lung morphology, pressure-volume rela-tionships, and response to positive end-expiratory pressure.Chest 2006;130:392–401

34. Cereda M, Foti G, Marcora B, Gili M, Giacomini M, SparacinoME, Pesenti A. Pressure support ventilation in patients withacute lung injury. Crit Care Med 2000;28:1269–75

35. Schuster DP, Anderson C, Kozlowski J, Lange N. Regionalpulmonary perfusion in patients with acute pulmonary edema.J Nucl Med 2002;43:863–70

36. Schuster DP, Haller J. Regional pulmonary blood flow duringacute pulmonary edema: a PET study. J Appl Physiol 1990;69:353–61

37. Spohr F, Cornelissen AJ, Busch C, Gebhard MM, Motsch J, MartinEO, Weimann J. Role of endogenous nitric oxide in endotoxin-induced alteration of hypoxic pulmonary vasoconstriction in mice.Am J Physiol Heart Circ Physiol 2005;289:H823–31

38. Ichinose F, Zapol WM, Sapirstein A, Ullrich R, Tager AM,Coggins K, Jones R, Bloch KD. Attenuation of hypoxic pulmo-nary vasoconstriction by endotoxemia requires 5-lipoxygenasein mice. Circ Res 2001;88:832–8

39. Caironi P, Ichinose F, Liu R, Jones RC, Bloch KD, Zapol WM.5-Lipoxygenase deficiency prevents respiratory failure duringventilator-induced lung injury. Am J Respir Crit Care Med2005;172:334–43

40. Nakayama M, Murray PA. Ketamine preserves and propofolpotentiates hypoxic pulmonary vasoconstriction compared withthe conscious state in chronically instrumented dogs. Anesthe-siology 1999;91:760–71

41. Bjertnaes L, Hauge A, Kriz M. Hypoxia-induced pulmonaryvasoconstriction: effects of fentanyl following different routes ofadministration. Acta Anaesthesiol Scand 1980;24:53–7


The Success of Emergency Endotracheal Intubation inTrauma Patients: A 10-Year Experience at a Major AdultTrauma Referral Center

Christopher T. Stephens, MD

Stephanie Kahntroff, MD

Richard P. Dutton, MD, MBA

BACKGROUND: Emergency airway management is a required skill for many anesthe-siologists. We studied 10 yr of experience at a Level 1 trauma center to determinethe outcomes of tracheal intubation attempts within the first 24 h of admission.METHODS: We examined Trauma Registry, quality management, and billing systemrecords from July 1996 to June 2006 to determine the number of patients requiringintubation within 1 h of hospital arrival and to estimate the number requiringintubation with the first 24 h. We reviewed the medical record of each patient ineither cohort who underwent a surgical airway access procedure (tracheotomy orcricothyrotomy) to determine the presenting characteristics of the patients and thereason they could not be orally or nasally intubated.RESULTS: All intubation attempts were supervised by an anesthesiologist experi-enced in trauma patient care. Rapid sequence intubation with direct laryngoscopywas the standard approach throughout the study period. During the first hour afteradmission, 6088 patients required intubation, of whom 21 (0.3%) received a surgicalairway. During the first 24 h, 10 more patients, for a total of 31, received a surgicalairway, during approximately 32,000 attempts (0.1%). Unanticipated difficultupper airway anatomy was the leading reason for a surgical airway. Four of the 31patients died of their injuries but none as the result of failed intubation.CONCLUSIONS: In the hands of experienced anesthesiologists, rapid sequence intu-bation followed by direct laryngoscopy is a remarkably effective approach toemergency airway management. An algorithm designed around this approach canachieve very high levels of success.(Anesth Analg 2009;109:866–72)

Hemodynamic instability, time pressure, lack of pa-tient cooperation, risk of aspiration, the need for cervicalspine protection, and facial injuries all contribute to thedifficulty of airway management in trauma patients. Thepast decades have seen the development and promulga-tion of standard techniques (especially the AmericanSociety of Anesthesiologists’ difficult airway algo-rithm1), new “rescue” devices, such as the laryngealmask airway (LMA), and a gradual shift in the UnitedStates away from anesthesiologists and toward emer-gency medicine physicians as the primary airway man-agers in the emergency department (ED). Publishedreports suggest a high level of success with emergencyintubation, but few studies have examined a large seriesof patients and none in recent years.

Endotracheal intubation is considered definitiveairway management in the trauma patient,1 because itallows for deep sedation and analgesia, controlledmechanical ventilation, and protection of the airwayfrom aspiration. A review of the literature suggeststhat anesthetized rapid sequence intubation (RSI) isthe most common method of securing the airway.2–8

This method has been shown to result in higher ratesof success in first-pass attempts, speed of placement,and fewer complications. Before 1990, trauma patientswere intubated by medics in the field and in transport,by surgeons and generalist physicians in the ED, or byanesthesia providers summoned to the ED. Pharma-cologic options and technology for rescuing a lostairway were limited. Rapid sequence approaches wereused but led to a relatively high surgical airway rate.Harrison et al.9 reported the need for a surgical airwayin 2% (6 of 302) of patients intubated during prehos-pital transport. In the past 2 decades, there have beensubstantial changes in airway management equip-ment. The use of intubating stylets has become morecommon, and rescue devices, such as the Combi-tube™ (Tyco-Kendall, Mansfield, MA) and the LMA™(Vitaid, Toronto, Ontario, Canada), are now available.

The development of Emergency Medicine as arecognized specialty has meant that most emergency

From the Division of Trauma Anesthesiology, Department ofAnesthesiology, University of Maryland School of Medicine, Balti-more, Maryland.

Accepted for publication March 30, 2009.Address correspondence and reprint requests to Richard P.

Dutton, MD, MBA, Division of Trauma Anesthesiology, Universityof Maryland Medical System, 22 South Greene St., Baltimore, MD21201. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181ad87b0


airway management in the United States now occurswithout the involvement of an anesthesiologist. Arecent study evaluated the need for a surgical airwaywith the use of a defined airway algorithm in a Level1 trauma center, where emergency physicians areprimarily responsible for airway management.10 Thisstudy reported a surgical airway rate of 2.6% and acomplication rate of 9.8%. A European study of“anesthesia-trained” prehospital providers docu-mented a failure rate (surgical airway) of 3.9% in apopulation of trauma patients.10,11

We undertook a retrospective review of emergencyairway management at our center to establish ourcurrent success rate and identify risk factors associ-ated with difficult airway management. We describethe management algorithm used, the overall successrate, and the factors associated with the need for asurgical airway.

METHODSWith the approval of the IRB, we conducted a

retrospective review of all patients who underwentattempted intubation within 24 h of arrival betweenJuly 1, 1996, and June 30, 2006, a period of 10 yr. Wechose to focus on the first hour of care to capture thosepatients intubated on an emergent basis. We excludedpatients transferred from other hospitals, many ofwhom were already intubated. We also examinedoutcomes in the broader group of patients intubated

within the first 24 h after admission, on the assump-tion that, although less time pressured, these caseswould still require the elements of an emergent RSI,including cricoid pressure and manual in-line cervicalstabilization.

The R Adams Cowley Shock Trauma Center (STC)of the University of Maryland Medical System, locatedin downtown Baltimore, is the primary adult resourcecenter for trauma in the state of Maryland and annu-ally receives more than 5500 primary admissions andanother 1000 patients transferred from other hospitalswith critical injuries. Patients arriving at the STC areassessed by a multidisciplinary team. Initial airwayassessment and management is the responsibility ofthe attending anesthesiologist, a trauma specialist,who is typically supervising one or more residents(anesthesia or emergency medicine).

The emergency airway management algorithm inuse at the STC for the period of study is shown inFigure 1.12 This is a simplification of the standardAmerican Society of Anesthesiologists algorithm1

adopted for use in this specialized setting, where theoption to reverse the anesthetic and awaken the pa-tient is seldom practical. This algorithm is followed atthe discretion of the attending anesthesiologist, inaccordance with the circumstances of the case. Inter-mittent positive pressure ventilation via facemask isused to support the patient if desaturation occurs, andcricoid pressure and in-line cervical stabilization may

Figure 1. Emergency airway management algorithm at the R Adams Cowley Shock Trauma Center. It is assumed that anairway is absolutely required and that patients cannot be reawakened electively. LMA � laryngeal mask airway.


be relaxed if they are preventing successful intubation.Failure in three attempts at direct laryngoscopy leadsto preparations for a surgical airway and an attempt tomanage the situation with placement of a LMA, withcontinued cricoid pressure. If LMA placement allowsacceptable oxygenation and ventilation, then a variety ofoptions are available at the discretion of the anesthesi-ologist. These include renewed attempts at intubationwith different equipment or positioning, fiberoptic intu-bation through the LMA, or a surgical airway undersemicontrolled conditions (cricothyrotomy or trache-otomy). If LMA placement is not successful, then acricothyrotomy or tracheotomy is performed immedi-ately by the surgical team.

Trauma anesthesiology billing records, qualitymanagement (QM) records, and the Trauma Registrydatabase were used to identify patients who under-went emergency airway management during thestudy period. Maintenance of a Trauma Registry is arequirement for certification as a trauma center in theUnited States. Data are entered during daily review ofeach patient’s records by a specialty-trained and cer-tified group of registrars (who also enter billing infor-mation), and information is periodically updated andreviewed by supervisors, before our reporting it to thestate Trauma System. The quality of Registry data isaudited internally, and again by the state certifyingauthority, as part of the trauma center designationprocess. Billing records are similarly scrutinized byboth insurers and the state rate-setting commission.Billing records were used to approximate the numberof patients intubated within 24 h of admission. Be-cause electronic billing records could not identifypatients presenting to the operating room (OR) forgeneral anesthesia who had a definitive airway al-ready in place, this number is necessarily an estimate.Trauma Registry and anesthesia QM records werethen used to identify all patients who had a cricothy-rotomy or tracheotomy performed within 24 h ofadmission. These medical records were reviewed indetail. Figures 2a–c show the distribution of patientsunder study. Nine patients were intubated success-fully (three within 1 h and an additional six within24 h), but then underwent tracheotomy for long-termmanagement of severe facial injuries or brain trauma.These patients were considered “successful” airwaymanagement cases and were excluded from furtheranalysis.

Computerized medical records, paper records, andQM files were reviewed to elicit more detailed infor-mation regarding each case. These data included themechanism of injury, the indication for intubation, thecause of difficulties, and the patient’s ultimate out-come. Need for a surgical airway was a designatedQM indicator throughout the study period, meaningthat each of these cases was reviewed by an unin-volved anesthesia provider and discussed by theDivisional Quality Management (QM) Committee.

Minutes of these discussions were available for re-view. All surgical airway cases identified had originalmedical records and most had available QM docu-mentation. We also examined all QM records duringthis decade for evidence of morbidities associatedwith emergency intubation that did not result in asurgical airway: specifically, worsened neurologic in-jury or evidence of anoxic injury.

RESULTSApproximately 32,000 trauma patients required in-

tubation within 24 h of admission during the studyperiod. Of the 6088 patients in whom intubation wasattempted within 1 h, 6008 received orotracheal air-ways, 59 received nasotracheal airways, and 21 re-ceived surgical airways. Of the 21 emergency surgicalairways, 17 were cricothyrotomies and 4 were trache-otomies (Fig. 2b). The rate of surgical airway access inemergencies was 0.3%. For patients requiring airwaymanagement between 1 and 24 h of admission, therewere 10 additional surgical airways placed in approxi-mately 26,000 attempts (estimated from OR billingrecords as described above), for a surgical airway rateof approximately 0.04% in these less urgent cases. The31 patients receiving surgical airways within 24 h ofadmission are enumerated in Table 1. The studymethodology did not permit us to identify how oftenan intubating stylet (gum elastic bougie) was used tofacilitate intubation (anecdotally, this is common) or

Figure 2. a–c, Trauma admission and outcomes of urgentand emergency airway management.

868 Experience with Emergency Intubations ANESTHESIA & ANALGESIA

an LMA was placed and then followed by successfuloral intubation (a rare event).

Overall this cohort included 26 men and 5 women,which is consistent with the demographics of traumapatients. Seven different mechanisms of injury wereidentified in this cohort: gunshot wound, motorcyclecollision, motor vehicle collision, chemical explosion,pedestrian struck, fall from a height, and struck by afalling object. The average age was 44.7 yr (range,18–86 yr). In the 25 patients for whom an admissionGlasgow Coma Scale score was available, the median

score was 13 (range, 3–15). The majority of patientswere suffering from severe, multisystem injury.

Five different causes for failed endotracheal intuba-tion were identified: foreign material in the pharynxor larynx, direct injury to the head or neck with loss ofnormal upper airway anatomy and airway edema, apharyngeal mass, laryngospasm, and difficult premor-bid anatomy. The distribution of causes is shown inFigure 3. Emesis, blood, and broken teeth were theidentified foreign materials preventing intubation.Three patients had disruption of airway anatomy

Table 1. Patients Requiring Surgical Airway Management Within 24 h of Trauma Center Admission

N � 31 Sex Age

Emergency(within 1 h of

admission) Cric or trach Reason GCS Disposition

1 M 63 Yes C Self-inflicted GSW to the mid and upper face. 7 Died2 M 19 Yes C GSW to chest and back. Arrived in full cardiac arrest. 3 Died3 F 24 Yes C MVC head-on collision. Cardiac arrest at the scene. 3 Died4 M 25 Yes C Multiple GSW to chest, neck, back. Cardiac arrest in the field.

Copious emesis from mouth.3 Died

5 M 29 Yes T GSW with injury to trachea and thyroid gland.Cricothyrotomy unsuccessful by resident. Tracheotomyplaced by surgical attending.

15 Lived

6 M 18 Yes C GSW to mandible. Copious bloody secretions in airway. 13 Lived7 M 59 Yes C Fall down stairs. Blood noted in airway. Bradycardia and

desaturations during attempt at intubation.3 Lived

8 M 41 Yes C MVC with resulting facial trauma. 15 Lived9 F 86 Yes C Fell at nursing home. Edema of true vocal cords and polyps.

Trismus noted.13 Lived

10 M 47 Yes T Boulder to head. Sedated for fracture reduction, withbradycardia and desaturations requiring emergencyintubation. LMA was placed.

Lived

11 F 79 Yes C MVC. Unable to visualize vocal cords. 15 Lived12 M 47 Yes C Chemical explosion to face. Unable to visualize vocal cords

secondary to blood and anterior anatomy.15 Lived

13 F 44 Yes C MCC. Broken teeth. Unable to visualize vocal cords. 15 Lived14 M 48 Yes C Pedestrian struck by a motor vehicle, with multiple facial

injuries.11 Lived

15 M 32 Yes T MCC. Unable to visualize vocal cords. 13 Lived16 M 49 Yes C MVC. Blood in oropharynx, which made visualization

difficult.11 Lived

17 M 73 Yes C MVC. Failed awake fiberoptic intubation secondary to airwayedema.

15 Lived

18 M 33 Yes C Intraoral GSW. Failed airway secondary to tongue edema. 7 Lived19 M 66 Yes T Patient found down. Subdural hematoma. Unable to visualize

vocal cords secondary to large epiglottis.12 Lived

20 M 70 Yes C MVC. Patient was seizing. Unable to visualize vocal cords. Unknown Lived21 M 63 Yes C MVC. Supraglottic edema. Ecchymosis around posterior

pharynx, base of tongue and floor of mouth. Tongue tipnecrosis.

15 Lived

22 F 36 No T Self-inflicted GSW to neck and cheek. Deep penetratinginjuries to submental area. Free segment of mandiblemissing. Difficult visualization. There was significantbleeding, broken teeth, and a dental plate, which made theintubation difficult.

11 Lived

23 M 69 No C MVC patient to operating room for orthopedic procedure.Undiagnosed adenocarcinoma with tracheal compression.Rigid neck secondary to metastatic disease.

15 Lived

24 M 50 No T Fall with brachial artery injury. Unable to visualize vocalcords.

15 Lived

25 M 32 No C MCC. Intubation failed with desaturation and vomiting. 15 Lived26 M 66 No C Fall with C3-C7 fractures. Failed awake fiberoptic in OR with

desaturation.Lived

27 M 60 No T Fall with pelvic fracture. Vocal cords were not visualized. 15 Lived28 M 58 No T Pedestrian struck, with multiple facial bone fractures. Vocal

cords were not visualized.Lived

29 M 41 No T MVC. Difficult laryngeal visualization. Lived30 M 24 No T GSW to leg. Difficult laryngeal visualization. 15 Lived31 M 40 No C Hit by a jet ski in the mandible. Initial intubation successful.

Patient extubated after surgery, developed laryngospasm,and could not be reintubated.

15 Lived

Cric � cricothyrotomy; Trach � tracheotomy; GCS � Glasgow Coma Scale score; GSW � gunshot wound; MVC � motor vehicle collision; MCC � motorcycle collision; LMA � laryngeal maskairway; OR � operating room.


because of gunshot wounds to the face or neck; onepatient who was a pedestrian struck by a motorvehicle had massive facial distortion. Edema prevent-ing intubation was at the supraglottic, laryngeal, orsubglottic level and was the result of airway burns,facial fractures, or chemical toxicity. “Anatomic varia-tion” was noted as the primary cause of difficulty inpatients who were found to have difficult laryngo-scopic views without obvious injury to the head orneck. This category included variations such as obe-sity, limited mouth opening, short thyromental dis-tance, limited neck mobility, and anterior larynx. Infive of these cases, no specific variation was noted,and the inability to visualize the larynx was describedas “surprising” by the attending anesthesiologist.

Remarkably, 87% (27/31) of the patients requiring asurgical airway survived to hospital discharge, andnone of the four deaths appeared to be the primaryresult of failed airway management. Two of the fourdeaths had already suffered cardiac arrest at the sceneof injury, with subsequent transient recovery of circu-lation but ongoing hemodynamic instability, and oneother was brought to the trauma resuscitation unit infull arrest. These three patients were all judged by theQM review process to have died of exsanguinatinghemorrhage that was not preventable, although anexacerbating effect of hypoxia cannot be excluded. Thefourth death occurred 3 days after admission in apatient who sustained a gunshot wound to the faceresulting in a carotid artery dissection and middlecerebral artery stroke.

A review of QM records revealed only one patientwith the suggestion of exacerbation of an occult cer-vical spine injury during intubation, although focusedreview of this case suggested that the neurologicdeficit identified after intubation may have beenpresent earlier, but inadequately documented. Nonew changes in neurologic status as the result ofhypoxia during intubation efforts were identified,although the impact of transient hypoxia on patientswith traumatic brain injury cannot be excluded. Nopatients died of a hypoxic cardiac arrest during air-way management efforts.

DISCUSSIONRisk factors for poor outcome from airway manage-

ment include the potential for aspiration of gastriccontents, exacerbation of occult cervical spine injuries,hemodynamic instability, and traumatic brain injury.This retrospective study describes outcomes of emer-gency airway management in a group of 32,000 adulttrauma patients during the decade from July, 1996, toJune, 2006. All patients were managed using a stan-dard protocol adapted directly from the AmericanSociety of Anesthesiologists’ Difficult Airway algo-rithm,1,12 and all airway management occurred underthe direction of an anesthesiologist with specialtyexpertise in trauma. Our aim was to review ourexperience with emergency airway management intrauma patients, to assess the effectiveness of theprotocol used, and to categorize our “failed” effortsin an attempt to better predict potentially difficultairways.

One limitation of our study is its retrospectivenature. Although we were able to examine medicalrecords of the patients who required surgical airways,we could not individually review all 57,000 admis-sions during this time period. We were thus forced toestimate the number of patients requiring intubationwithin 24 h of admission from OR billing records.Emergency intubations performed in the Trauma Re-suscitation Unit are billed separately, with a specifictime recorded in the Trauma Registry, and thus couldbe exactly counted. It was not possible for us toretrospectively determine intrinsic details of the suc-cessful intubations, including number of attempts,number of operators, equipment used, and lowestoxygen saturation. This detail would have allowed acloser analysis. It is possible that some of the patientsin this series should have received a surgical airwaysooner, for example, to mitigate the effects of hypoxiaor hypercarbia on traumatic brain injury. It was alsonot possible to assess the contribution of micro- ormacroaspiration on the development of subsequentrespiratory distress in a population of patients withmany risk factors for respiratory failure, includingpremorbid conditions, prehospital aspiration, trau-matic brain injury, acute and chronic intoxication,hemorrhagic shock, transfusion, long bone fractures,and direct pulmonary injury.

Another limitation is the data collected on the needfor a surgical airway. Although we can identify thecauses with reasonable accuracy, because of the con-temporaneous QM review of these high-profile cases,we cannot identify how often similar patients weremanaged successfully. We are unable to assess thespecific impact of “attending discretion” in avoidingor mitigating difficult airway management. It is likelythat some patients with observable risk factors fordifficult intubation were managed differently thanroutine patients: earlier hands-on involvement of theattending anesthesiologist is one possibility; another

Figure 3. Causes of the need for surgical airway access.


might be the decision to use an awake fiberopticapproach in cooperative patients. This is one area inwhich the involvement of anesthesiologists, as op-posed to emergency medicine physicians, may haveplayed an important role.

Our success in emergent airway management(99.7%) compares favorably with previously pub-lished series. In a consensus paper from the EasternAssociation for the Surgery of Trauma, Dunham etal.13 describe an overall failure to intubate with RSI intrauma centers to be 1.7% in a population of 943patients. A review of other literature reports surgicalairway rates ranging from 0.3% to 5.6% at major Level1 trauma centers. Of these studies, the majority ofinstitutions report a failed intubation rate of1%–2%.14–24

Although premorbid anatomic variations were theleading cause of failed oral intubation in our series,head and neck injuries were also an important riskfactor. Thirteen of our 31 patients who required sur-gical airways had injuries involving the head, face,neck, upper chest, or a combination. This is consistentwith prior studies of emergency airway managementin which many of the difficulties encountered were inpatients with trauma to the face or neck. The citedreport by Dunham et al.13 describes the evidence basesupporting techniques for emergency intubation intrauma patients. The group reported that many pa-tients with severe neck injury required immediateairway intervention secondary to cervical hematomasand laryngotracheal injury. Fourteen percent (3 of 21)of our failed emergency intubation group had a sig-nificant neck injury.

This retrospective survey, the largest reported, con-firms an overall high rate of success in emergencyairway management. Although secondary effects ofhypoxia could not be assessed in this review, the factthat no patients died of acute hypoxia is encouraging.Having intubations supervised by a small group ofspecialist anesthesiologists is likely beneficial, as is theimmediate presence of surgical support when difficul-ties arise. Others have reported that training is impor-tant to increase the percentage of successful airwayplacements.25,26 One previous study reported on se-nior Emergency Medicine residents rotating as thetrauma airway manager for 2 mo in addition to ORtraining throughout their residency, with a combinedexperience of 70–80 intubations.6 This is comparablewith the 50–80 intubations, many urgent, that anaverage resident performs in 1 mo in our practice. Webelieve that this level of experience and trainingcontributes strongly to good outcomes.

Using a small selection of adjunctive technologies,only the intubating stylet (bougie) and the LMA keepsour protocol simple and allows for practice and famil-iarity for all providers. Although many other adjunc-tive devices have been recommended for emergencyairway management, it is likely that practice andexperience are important when using the device in

an emergency.27 It is possible that the video laryn-goscope (Glidescope�, Verathon, Bothell, WA),which has entered our practice in the past year, willfurther improve our experience, or that simulatortraining, now routine at our site, will improveperformance in emergencies.

In summary, it is possible to achieve a high rate ofsuccess in emergency airway management. The needfor a surgical airway in our practice is primarily theresult of premorbid anatomic variation, althoughtrauma to the face or neck also contributes. Thecornerstones of effective airway management in ourseries were a simple protocol based on rapid sequenceinduction of anesthesia, judicious use of selected ad-junctive devices, and an experienced anesthesia fac-ulty present at each admission.

REFERENCES

1. American Society of Anesthesiologists Task Force on Manage-ment of the Difficult Airway. Practice guidelines for manage-ment of the difficult airway: an updated report by the AmericanSociety of Anesthesiologists Task Force on Management of theDifficult Airway. Anesthesiology 2003;98:1269–77

2. Committee on Trauma, American College of Surgeons. Ad-vanced trauma life support for doctors. Chicago: AmericanCollege of Surgeons, 2004

3. Graham CA, Beard D, Henry JM, McKeown DW. Rapid se-quence intubation of trauma patients in Scotland. J Trauma2004;56:1123–6

4. Walls RM. Management of the difficult airway in the traumapatient. Emerg Med Clin North Am 1998;16:45–61

5. Sakles JC, Laurin EG, Rantapaa AA, Panacek EA. Airwaymanagement in the emergency department: a one-year study of610 tracheal intubations. Ann Emerg Med 1998;31:325–32

6. Omert L, Yeaney W, Mizikowski S, Protetch J. Role of theemergency medicine physician in airway management of thetrauma patient. J Trauma 2001;51:1065–8

7. Bushra JS, McNeil B, Wald DA, Schwell A. A comparison oftrauma intubations managed by anesthesiologists and emer-gency physicians. Acad Emerg Med 2002;9:404–5

8. McBrien ME, Pollok AJ, Steedman DJ. Advanced airway controlin trauma resuscitation. Arch Emerg Med 1992;9:177–80

9. Harrison T, Thomas SH, Wedel SK. In-flight oral endotrachealintubation. Am J Emerg Med 1997;6:558–61

10. Casey ZC, Smally AJ, Grant RJ, McQuay J. Trauma intubations:can a protocol-driven approach be successful? J Trauma2007;63:955–60

11. Timmermann A, Eich C, Russo SG, Natge U, Brauer A, Rosen-blatt WH, Braun U. Prehospital airway management: a prospec-tive evaluation of anaesthesia trained emergency physicians.Resuscitation 2006;70:179–85

12. Dutton RP, McCunn M. Anesthesia for trauma. In: Miller RD,ed. Miller’s anesthesia. 6th ed. Philadelphia: Elsevier ChurchillLivingstone, 2005: 2451–95

13. Dunham CM, Barraco RD, Clark DE, Daley BJ, Davis FE, GibbsMA, Knuth T, Letarte PB, Luchette FA, Omert L, Weireter LJ,Wiles CE. Guidelines for emergency tracheal intubation imme-diately after traumatic injury. J Trauma 2003;55:162–79

14. Mulder DS, Marelli D. The 1991 Fraser Gurd lecture: evolutionof airway control in the management of injured patients.J Trauma 1992;33:856–62

15. Talucci RC, Shaikh KA, Schwab CW. Rapid sequence inductionwith oral endotracheal intubation in the multiply injured pa-tient. Am Surg 1988;54:185–7

16. Bogetz M, Katz J. Airway management of the trauma patient.Semin Anesth 1985;4:114–23

17. Mandavia DP, Qualls S, Rokos I. Emergency airway manage-ment in penetrating neck injury. Ann Emerg Med 2000;35:221–5

18. Pierre EJ, McNeer RR, Shamir MY. Early management of thetraumatized airway. Anesthesiol Clin 2007;25:1–11


19. Salvino CK, Dries D, Gamelli R, Murphy-Macabobby M, Mar-shall W. Emergency cricothyroidotomy in trauma victims.J Trauma 1993;34:503–5

20. DeLaurier GA, Hawkins ML, Treat RC, Mansberger AR. Acuteairway management: role of cricothyroidotomy. Am Surg1990;56:12–5

21. Wright MJ, Greenberg DE, Hunt JP, Madan AK, McSwain NE.Surgical cricothyroidotomy in trauma patients. South Med J2003;96:465–7

22. Bair AE, Panacek EA, Wisner DH, Bales R, Sakles JC. Cricothy-roidotomy: a 5-year experience at one institution. J Emerg Med2003;24:151–6

23. Levitan RM, Rosenblatt B, Meiner EM, Reilly PM, Hollander JE.Alternating day emergency medicine and anesthesia residentresponsibility for management of the trauma airway: a study oflaryngoscopy performance and intubation success. Ann EmergMed 2004;43:48–53

24. Levitan RM, Everett WW, Ochroch EA. Limitations of difficultairway prediction in patients intubated in the emergency de-partment. Ann Emerg Med 2004;44:307–13

25. Hawkins ML, Shapiro MB, Cue JI, Wiggins SS. Emergencycricothyrotomy: a reassessment. Am Surg 1995;61:52–5

26. Shearer V. Modern airway management for the trauma patient.Curr Opin Anaesthesiol 2000;13:135–9

27. Smith CE, DeJoy SJ. New equipment and techniques for airwaymanagement in trauma. Curr Opin Anaesthesiol 2001;14:197–209


The Effects of Endotracheal Suctioning on the Accuracyof Oxygen Consumption and Carbon Dioxide ProductionMeasurements and Pulmonary Mechanics Calculated bya Compact Metabolic Monitor

George Briassoulis, MD, PhD*

Panagiotis Briassoulis, MD†

Evi Michaeloudi, MD*

Diana-Michaela Fitrolaki, MD*

Anna-Maria Spanaki, MD*

Efrossini Briassouli, MD‡

BACKGROUND: Open endotracheal suctioning (ETS), which is performed regularlyin mechanically ventilated patients to remove obstructive secretions, can cause animmediate decrease in dynamic compliance and expired tidal volume and result ininadequate or inaccurate sidestream respiratory monitoring, necessitating pro-longed periods of stabilization of connected metabolic monitors. We investigatedthe immediate effect of open ETS on the accuracy of oxygen consumption (VO2)and carbon dioxide production (VCO2) measurements and calculated lung me-chanics, respiratory quotient, and resting energy expenditure in mechanicallyventilated children without severe lung pathology, when using a compact modularmetabolic monitor (E-COVX) continuously recording patient spirometry and gasexchange measurements.METHODS: Open ETS was performed when clinically indicated in 11 childrenmechanically ventilated for sepsis or head injury. A total of 2800 pulmonary 1-mingas exchange measurements were recorded in 28 ETS instances for 50 consecutiveminutes before and 50 min after the standardized procedure.RESULTS: Pulmonary mechanics and indirect calorimetry did not differ between pre-and postsuction sets of measurements. Pre- and postsuction VO2, VCO2, dynamicairway resistance, dynamic compliance, and expiratory minute ventilation remainedstable from 5 to 55 min after tracheal suctioning and did not differ among differentventilatory modes. Average paired differences of sequential pre- and postsuction VO2,VCO2, respiratory quotient, and resting energy expenditure were �0.6%, �1%, �0.1%,and �0.3%. Ratio differences between the first and the second periods of measure-ments (1–25 vs 26–50 sets of 1-min measurements) did not differ in the two groups.CONCLUSIONS: Pulmonary mechanics and indirect calorimetry measurements are notinfluenced after uneventful open ETS in well-sedated patients. The E-COVX is ableto reliably record spirometry and metabolic indices as early as 5 min aftersuctioning at different ventilator modes.(Anesth Analg 2009;109:873–9)

The most accurate method for determining restingenergy expenditure (REE) in hospitalized patients isindirect calorimetry.1,2 Metabolic monitoring devicesused in the critical care setting, however, are subject toa range of conditions that may compromise theiraccuracy.3 More specifically, metabolic monitors’ er-rors were shown to be significantly affected by oxygenconcentration and minute ventilation4 and when used

during inhaled anesthesia.5 Additionally, older sys-tems like Deltatrac II (Datex Ohmeda 2000, Helsinki,Finland), which measure gas volume in a mixing cham-ber, are relatively expensive, require a high level oftechnical expertise, and are time consuming to calibrate.6

New compact modular metabolic monitors like theE-COVX™ (formerly M-COVX™, GE Healthcare/Datex-Ohmeda), which use a breath-by-breath methodto analyze oxygen consumption (VO2) and carbon diox-ide production (VCO2), are less expensive and simpler touse, perform calibration automatically, and are muchsmaller in size.7 Using such a simple monitor in certainventilation modes and in nonsedated patients, however,may not provide measurements within a clinically ac-cepted range.8

Open endotracheal suctioning (ETS) is performedregularly in mechanically ventilated children to removeobstructive secretions. It was shown that ETS can causean immediate decrease in dynamic compliance andexpired tidal volume in ventilated children intubated

From the *Pediatric Intensive Care Unit, University Hospital,University of Crete, Heraklion, Greece; †Department of Anaesthe-siology, School of Medicine, University of Athens; and ‡The 1stDepartment of Internal Medicine-Propaedeutic, University of Ath-ens, Athens, Greece.

Accepted for publication May 4, 2009.Address correspondence and reprint requests to George Brias-

soulis, MD, Pediatric Intensive Care Unit, University Hospital ofHeraklion, 71110 Heraklion, Crete, Greece. Address e-mail [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181b018ee


with small endotracheal tubes (ETs), probably indicatingloss of lung volume caused by the suctioning procedure.9

Such a change, which might be followed by markeddecrease in SaO2, can be prevented by positive pressureoxygen administration or by using a closed system ofETS to maintain lung volume and minute ventilation.10

Especially in patients with lung injury, suctioning-induced lung derecruitment could be prevented byperforming recruitment maneuvers during suctioningand minimized by avoiding disconnection.9 However,the effect of the frequently needed ETS on accuracy oflung mechanics and VO2 and VCO2 measurementsusing a simple compact modular metabolic monitor isnot known. We aimed to determine the immediate effectof open ETS on the accuracy of VO2 and VCO2 measure-ments and calculated dynamic lung compliance, airwayresistance, minute ventilation, respiratory quotient (RQ),and REE, when using the E-COVX by means of aprospective observational clinical study in critically illchildren without severe lung pathology.

METHODSPatient Population

Eleven pediatric intensive care unit patients withoutsevere lung pathology, mechanically ventilated for sepsisor head injury, were studied. Patients with primary(asthma, bronchiolitis, and pneumonia) or severe (acuterespiratory distress syndrome) lung pathology wereexcluded. Patients with sepsis or trauma and anymild-to-moderate pulmonary complication, such asatelectasis, ventilator-associated pneumonia, contu-sion (excluding air leaks), or acute lung injury, wereonly included if 1) not desaturated more than 10% 1–3min after any ET disconnection and 2) not meeting anyof the other exclusion criteria. The investigation wasapproved by and conducted according to the localethics committee guidelines, and informed consentwas obtained from each patient’s relative.

All patients were hemodynamically stable and inthe supine position with a 30° head lift inclination.Mechanical ventilation was performed through acuffed ET, and only patients with a fractional inspiredoxygen (Fio2) �60%, a respiratory rate below 35 bpm,and an ET leak below 10% (inspiratory tidal volume �expiratory tidal volume/inspiratory tidal volume � 100)were included in the study. Patients ventilated withHeliox/nitric oxide mixture, on the oscillator ventilator,receiving renal replacement therapy, and those receivingbolus enteral feeds or expected to be extubated within24 h of admission were excluded from the study. Themake of the ventilator (Servo i, Marquet, Solna, Sweden)was documented, in addition to the ventilation modeand settings at the time of the measurement.

Suctioning ProcedureSuctioning for study purposes coincided with the

nursing staff’s planned time of ETS as clinically indi-cated, so that patients experienced no additional discom-fort. The patients were well sedated but not paralyzed

and were able to breathe spontaneously. The suction-ing procedure was performed as follows. The patientswere administered 100% inspired oxygen for �30 sbefore suctioning. They were disconnected from theventilator, a suction catheter was passed down 2 cmbelow the distal end of the ET tip, continuous suctionwas applied, and the catheter withdrawn while rotat-ing slightly. The trachea was suctioned two times for�10 s with an interval of 10 s between each suctioning,during which the catheter was changed. Brief handventilation was used for lung recruitment betweenand after suctioning. The patient was then immedi-ately reconnected to the ventilator circuit. This re-sulted in a 30-s period of disconnection from theventilator. Any adverse events were documented. Weused a range of catheter sizes, according to availabilityand the ET size. The suction apparatus was set on“medium,” corresponding to a vacuum pressure ofapproximately �250 mm Hg (�33 kPa or �4.8 psi),measured at the source with tubing clamped. Aftersuctioning was completed, the Fio2 was immediatelychanged to presuction settings unless desaturationoccurred, in which case Fio2 was gradually turneddown as SaO2 improved. The nurse in charge per-formed all the suctioning procedures in each patient.Throughout the observation and suctioning periods,there was continuous electrocardiological and pulseoximetry monitoring. During and for 90 min before thisprocess, no changes were made to the ventilator settingsand physiotherapy was not allowed.

ApparatusThe new compact modular metabolic monitor

E-COVX™ (GE Healthcare/Datex-Ohmeda, also knownas M-COVX) has been marketed as the replacementfor the Deltatrac II (Datex Ohmeda 2000) for completesidestream respiratory monitoring with patient spi-rometry and gas exchange measurement. The mode ofaction of the system has been described in detail.8 Thisdevice relates flow measurements made at the mouthby pneumotachograph to measurements of inspiredand expired gas composition by matching the twowave forms, thereby allowing continuous, breath-by-breath monitoring of an intubated patient’s VO2 andVCO2. The pneumotachograph derives the tidal vol-ume from the pressure difference across a fixed orificeand is therefore potentially influenced by acutechanges of resistance in the spirometry tubing andundetected leaks in the system. In the P-Lite (15–300mL) or D-Lite (�300 mL) flow sensor, selected accord-ing to the patient’s recorded tidal volume and locatedproximal to the Y-piece to the patients’ ET, the flowmeasurement is based on the pressure decrease acrossa special proprietary turbulent flow restrictor. It usesmathematical integration of flow and time-synchronizedcontinuous gas sampling to provide data. The gassample is continuously drawn from the connector to thegas analyzer unit of the E-COVX. Both O2 and CO2

874 Suction and Gas Exchange Measurements ANESTHESIA & ANALGESIA

measures are based on the sidestream principle. Detec-tion through the D-Lite or Pedi-Lite flow sensor and gassampler is achieved at respiration rates of 4–35 bpm and4–50 bpm, respectively.

Lung Mechanics and Metabolic GasExchange Measurements

Breath-by-breath values were averaged over eachminute of recording and used for analysis. Pulmonary1-min gas exchange measurements were recorded for50 consecutive minutes before (presuction) and 50 minafter the standardized suctioning procedure, starting 5min postsuction. (A steady-state condition must bepresent to ensure that the gas exchange measurementis equivalent to the tissue gas exchange. According tothe manufacturer, a steady state can be defined as aperiod of time after the patient has stabilized from anychanges [about 5 min] and will not incur furtherchanges in his/her treatment that may affect gasexchange or increase metabolism.) Measurements fromthe E-COVX were collected after a 5-min warm-upperiod which included automatic calibration. Steadystate was defined by five consecutive 1-min measure-ments of VO2 and VCO2 having �10% variation.Throughout the study, measurements took place onlywhen the patient was in steady state. We consistentlyused a heat- and moisture-exchange filter alone,avoiding heated water bath humidification, followedby regular checks on the spirometry tubing and checksfor tidal volume consistency between the E-COVXmodule and the ventilator.

Measurements of ventilation (dynamic lung com-pliance, dynamic expiratory airway resistance, me-chanical and spontaneous expired tidal volume, andtotal respiratory rate) and gas exchange (VO2, VCO2,RQ) were simultaneously recorded pre- and post-ETS.Expired tidal volume recordings were used ratherthan inspired tidal volume to minimize errors due toany ET leaks. The machine uses inspiratory volumes,as these are the more reliable measurements; expira-tory volumes are dependent upon assumptions ofexpired temperature (assumed to be 35°C) and humid-ity (assumed to be 100%), and the modified Weirformula for converting VO2 and VCO2. The monitordisplays a 5-min average for REE, but we obtained the1-min averages with the S5 software. Because not all1-min variables could be collected through the S5software, the 5-min recorded means (of the 1-minmeasurements and calculations) were ultimately ana-lyzed and compared over the 50-min periods beforeand after suctioning.

Statistical AnalysisData were tested for normality using the Kolmogorov-

Smirnov and Lilliefors tests. Normally distributeddata were analyzed using descriptive statistics andt-tests for paired differences. The level of bias betweenmeasurements before and after suctioning was evalu-ated using Bland-Altman limits of agreement analysis.

The mean difference between the two sets of measure-ments represents the performance bias. On average,the bias indicates how far off an individual VCO2 orVO2 measurement or calculated RQ or REE will beafter suctioning compared with a presuction recordedvalue. Furthermore, to examine whether the ETSmight have influenced the accuracy of the measure-ments closer to the intervention (after 5 min) morethan the later ones (after 50 min), we compared thewithin-groups ratio differences between the first andthe second periods of measurements (1–25 vs 26–50sets of 1-min measurements). Statistical significancewas defined as P � 0.05. SPSS version 15.0 (SPSS,Chicago, IL) was used for all data entry and statisticalprocedures except the Bland-Altman plot, which wasconstructed using the MedCalc version 9.3.1 (MedCalcSoftware, Belgium).

RESULTSA total of 2800 pulmonary 1-min gas exchange

measurements were recorded in 28 ETS instances in 11patients, producing 560 records of means of fivesuccessive 1-min measurements (5-min means). Ofthose, 1400 pulmonary sets of 1-min gas exchangemeasurements (or 280 5-min means) were recordedbefore and the same (1400 1-min or 280 5-min means)

Table 1. Clinical Characteristics of Patients Enrolled in theStudy (n � 11)

Frequency(%)

Mean� sd(range)

Age (yr) 9.5 � 4.6 (6–17)Body weight (kg) 30 � 18 (15–80)Sex

Male 73Female 27

DiagnosisSepsis 73Head injury 27

PeLoad 9 � 4.2 (2–13)PRISM 11.5 � 6.2 (6–27)TISS 37 � 7.5 (22–48)Ventilatory mode

PRVC 64SIMV 18PS 18

Fio2 (%) 45 � 10 (30–60)SaO2 (%) 99 � 1 (97–100)Heart rate (bpm) 99 � 31 (58–159)Blood pressure

(mm Hg)103 � 8 (82–116)

Temperature (°C) 37.3 � 0.65 (36.1–38)Energy intake (kcal/d) 676 � 240 (240–1000)Midazolam

(mg � kg�1 � h�1)0.57 � 0.35 (0–1)

Fentanyl (�g � kg�1 � h�1) 1.82 � 1.5 (0–4)Length of stay (d) 26.7 � 29.5 (4–98)Duration of mechanical

ventilation (d)20.7 � 26.5 (3–95)

PeLoad � pediatric logistic organ dysfunction score; PRISM � pediatric risk of mortality;TISS � therapeutic intervention scoring system; PRVC � pressure-regulated controlledventilation; SIMV � synchronized intermittent mandatory ventilation; PS � pressure supportventilation; FIO2 � fractional inspired oxygen; SaO2 � saturation of arterial oxygen.


repeated after the 28 ETS instances. Different ETSinstances in the same patient were only performed ifthey could be done on different days, especially whenclinical and respiratory variables had been changed,therefore producing new (different ventilator settings)study cases. The first comparisons of before/aftersuctioning per patient measurements in the 11 indi-vidual patients were 1) analyzed separately; and 2)pooled with all repeated discrete timepoint measure-ments performed subsequently. Because no differenceswere found between the 11 initial sets of measurements

in each patient versus the 28 total sets of measurements(including second or third repeated ETS events in someof the 11 patients) indicating potential biases introducedby repeated measurements, all results were pooled forthe final analysis of different cases of varying clinicalsituation and ventilator support. Patient demographicdata are summarized in Table 1. Pulmonary mechanicsand indirect calorimetry did not differ between pre- andpostsuction sets of measurements (Table 2). Measureddynamic airway resistance, dynamic compliance, andexpiratory minute ventilation remained stable from 5 to55 min after tracheal suctioning (Fig. 1). The series of50-min measurements of VO2, VCO2 (Fig. 2), and REE(Fig. 3) did not change after the procedure and remainedstable 55 min later. Pre- and postsuction spirometrymeasurements and VO2 and VCO2 did not differ amongthe different ventilatory modes (pressure-regulated con-trolled ventilation, synchronized intermittent mandatoryventilation, and pressure support ventilation) used inthis series (Fig. 4).

The Bland-Altman plot comparing the means ofsequential pre- and postsuctioning VO2, VCO2, RQ,and REE indicated that the average paired differenceswere �0.6%, �1%, �0.1%, and �0.3%, respectively,showing no influence of suctioning on accuracy ofmeasurements. This nonsignificant difference was fur-ther verified by calculating the paired REE ratiodifferences (paired t-tests) and the Bland-Altman bi-ases of REE ratio means between the first 1-min sets ofmeasurements (1–25 min) and the second sets (26–50min) of measurements during both periods, beforeand after suctioning. These two subcohorts (halves) ofthe within-groups sets of measurements (1–25 vs26–50 sets of 1-min measurements) were equallyshown not to differ during either the presuctioning(�1.2%; 95% confidence intervals �14.9% to 12.6%) orthe postsuctioning (�0.3%; 95% confidence intervals

Figure 1. Comparison of measured airway resistance, com-pliance, and minute ventilation before and after suctioning.The box-whisker plots show the median (horizontal linewithin the box) and the 10th and 90th percentiles (whiskers).The box length is the interquartile range. Rawa � dynamicexpiratory airway resistance after suctioning; Rawb � dy-namic expiratory airway resistance before suctioning; Com-pla � dynamic lung compliance after suctioning; Complb �dynamic lung compliance before suctioning; Mvexpa �mechanical and spontaneous expired minute ventilationafter suctioning; Mvexpb � mechanical and spontaneousexpired minute ventilation before suctioning.

Table 2. Comparison of 50-min Pulmonary Mechanics and Indirect Calorimetry Values Measured by the E-COVX Compact MetabolicMonitor Before and 5 min (Stabilization Period) After Suctioning (n � 280 5-min Means of 1-min Measurements)

E-COVX spirometry

Beforesuctioning

Aftersuctioning

95%Confidence

interval of thedifference Paired

differences sig(two-tailed)Mean sd Mean sd Lower Upper

End-tidal CO2 (mm Hg) 37.1 3.5 37.3 4.5 �0.75 0.41 0.56VO2 (mL/min) 126.2 43.3 126.9 43.7 �1.9 0.43 0.207VCO2 (mL/min) 108.6 30.5 109.9 32.6 �2.7 0.28 0.108Respiratory quotient 0.88 0.1 0.88 0.1 �0.01 0.01 0.87Resting energy expenditure (kcal/d) 885.5 279 887.7 281 �8.9 4.8 0.5Expiratory minute volume (L/min) 4.7 1.3 4.6 1.2 �0.06 0.15 0.36Total respiratory rate (bpm) 27 8 26.8 8.3 �0.69 1.04 0.68Peak inspiratory pressure (cm H2O) 22.6 7.8 22.3 7.4 �0.06 0.58 0.106Extrinsic positive end-expiratory pressure

(cm H2O)6.5 1.6 6.5 1.6 �0.18 0.06 0.315

Expired tidal volume (mL) 191 88 186.9 88 �0.3 8.4 0.07Dynamic airway resistance (cm H2O � L�1 � s�1) 21.3 11 21.2 10.5 �0.25 0.4 0.65Dynamic compliance (mL/cm H2O) 15.6 6.7 14.7 6.7 �0.006 0.83 0.054


�13.6% to 13%) period (Fig. 5). Hemodynamic mea-surements and SaO2 remained stable throughout thestudy.

DISCUSSIONWe showed that in critically ill children without

lung pathology, pulmonary mechanics and indirectcalorimetry measurements are not influenced afteruneventful open ETS for the early period extendingfrom 5 min to 1 h after the procedure. We also showedthat the new compact modular metabolic monitorE-COVX is able to reliably and correctly measure,record, and calculate continuous spirometry and met-abolic indices 5 min after uneventful suctioning asaccurately as before suctioning, without the previ-ously described need for extra calibrations or pro-longed waiting periods for stabilization.6 Provided the

patient is kept well sedated, the accuracy of measure-ments is ascertained at different ventilator modalitiesand at different timepoints before or after suctioning,during an earlier or later period.

Using the brief intervention of ETS and disconnec-tion of the ventilator, we did not demonstrate signifi-cant changes in lung mechanics in children withoutsevere or primary lung pathology. Unavoidably, pa-tients with secondary mild-to-moderate lung inflam-mation, complicating sepsis, or head injury were alsoincluded in our study. However, these patients didnot have any significant pulmonary mechanics pa-thology and tolerated ETS uneventfully. Similarly, inventilated children with variable lung pathology,

Figure 2. Bland-Altman plots of average paired differences of means of oxygen consumption (VO2) (mL/min) (a) and carbondioxide production (VCO2) (mL/min) (b) measured by E-COVX before and after suctioning in 28 individual suctioning episodes(n � 280 pre- and 280 postendotracheal suctioning (ETS) 5-min means of 1400 � 1400 1-min paired measurements, respectively).

Figure 3. Series of 50-min means (bars) of resting energyexpenditure (REE) (kcal/d) calculated by E-COVX beforeand after suctioning in 28 individual suctioning episodes,showing an impressive similarity over a wide range ofvalues. Patients’ age and body mass explain the differentvalues recorded between individual suctioning episodes(age range, 6–17 yr).

Figure 4. Comparison of measured oxygen consumption(VO2) (mL/min) and carbon dioxide production (VCO2)(mL/min) before and after suctioning in different ventila-tory modes. The box-whisker plots show the median (hori-zontal line within the box) and the 10th and 90th percentiles(whiskers). The box length is the interquartile range.PRVC � pressure-regulated controlled ventilation; SIMV �synchronized intermittent mandatory ventilation; PS �pressure support ventilation.


there was no evidence that uneventful suctioningreduces airway resistance.11 Additionally, in a smallersample size study of 10 mechanically ventilated adultswith mild-to-moderate acute respiratory failure, lungvolume returned to baseline within 10 min of suction-ing with an open system. Again, in patients withoutsevere lung disease, these changes were transient andrapidly reversible.12

Research data suggest that the duration of ETS andthe size of ETs might have a significant impact onmeasurement results.13 In a randomized controlledtrial there was no difference in dynamic compliance,expired airway resistance, or oxygen saturation be-tween the experimental group receiving a single stan-dardized suctioning procedure followed 5 min laterby a standardized recruitment maneuver and thecontrol group receiving only the single suctioningprocedure, either immediately after the recruitmentmaneuver or after 25 min.14 In our study, we usedbrief hand ventilation for lung recruitment, and anychanges that might have occurred immediately aftersuctioning (stabilization period, data not shown) hadbeen reliably reversed by the start of (5 min) themonitoring period and throughout the monitoringperiod. In a randomized crossover study comparingoutcomes after physiotherapy and suctioning in chil-dren on full ventilatory support, no significant groupchanges in expired tidal volume or respiratory com-pliance after either treatment were recorded, but onlya tendency for resistance to decrease after physio-therapy but not ETS.15 In agreement with our results,other researchers, measuring airway and pulmonaryresistances according to the end-inspiratory and end-expiratory occlusion methods before and after ETS,found that both resistances increased transiently only,but returned to baseline values at 1 min after ETSwithout exhibiting any change thereafter16 or affectingthe physiological and alveolar dead space.17

The accuracy of metabolic measurements in ourstudy may have been related to the circulatory and

ventilatory stability of our patients, indirectly indi-cated by the postsuctioning stability of the heart rate,arterial blood pressure, total respiratory rate, minuteventilation, and ETco2 values. It has been previouslyshown in predicting the 24-h energy expenditure that30-min indirect calorimetry was within 20% of 24-hmeasurements for 89% of intervals, but its accuracywas maximized if a 30-min study was performedwhen minute ventilation, heart rate, systolic bloodpressure, and respiratory rate were near the day’saverage.18 In a prospective simultaneous clinical com-parison study, poor agreement exceeding a possibleclinical acceptability of 20% was found between theDeltatrac II and E-COVX or Evita 4 metabolic moni-tors, leading to the conclusion that the E-COVX pro-vides less accurate measurements of metabolic gasexchange in stable ventilated patients.19 This study,however, was criticized for performing simultaneousmeasurements with sampling volumes of 150–200mL/min, affecting the VO2 and VCO2 accuracy ofmeasurements, which varied according to the minutevolume.20 Additionally, it has been previously shownthat the Deltatrac II measures VO2 with a mean errorof 9.4% and the VCO2 with 1.2%, which are higherthan the �0.6% and �1% respective mean errors of theearly postsuctioning accuracy in our E-COVX study.4

In a study in ventilated adult patients, averaging ofcontinuous VO2 data with the E-COVX module re-sulted in only small errors, mainly related to inaccuratetidal volume measurements because of the water accu-mulation in the pneumotachograph with water bathhumidifiers.21 Although in a previous report using waterbath humidifiers in lightly sedated adults, the E-COVXmonitor did not provide measurements within a clini-cally accepted range when compared with the DeltatracII8; in this study performed in well-sedated childrenonly, we avoided periods of “invalid data” by only usingheat- and moisture-exchange filters (excluding heatedwater bath humidification). Similarly, we avoided addi-tional “inaccuracies” by carefully recording patients’

Figure 5. Bland-Altman plot of average paired differences of ratio means of resting energy expenditure (REE) between the first1-min sets of measurements (1–25 min) and the second sets (26–50 min) before (a) and after (b) suctioning (n � 140 5-minmeans of 700 1-min paired measurements for each semiperiod).


tidal volumes on the ventilator, thereby selecting themost appropriate flow sensor (P-Lite 15–300 mL, D-Lite�300 mL).

This study has some limitations. First, it includespatients without lung injury, whose lungs are moreeasily rerecruited, so that we cannot extrapolatethese results to patients with acute lung injury.Second, the patients were sedated or well synchro-nized to the ventilator. Therefore we cannot predictwhat differences might occur in an awake patientbreathing on his own but ineffectively triggering theventilator. Although the similarity of the resultsobtained in this study to results of studies includingpatients with pulmonary diseases and/or requiringrecruitment maneuvers might suggest that thesefindings could be generalizable to other populationsof critically ill patients,11,13–16 such a hypothesisshould definitely be tested in future studies.

In conclusion, our results show that in well-sedatedchildren without lung pathology, pulmonary mechan-ics, and gas exchange measurements are not influ-enced after uneventful open ETS as early as 5 min afterthe procedure. The E-COVX is able to reliably recordspirometry and metabolic indices after uneventfulsuctioning as accurately as before suctioning, at dif-ferent ventilator modalities, and at different time-points before or after suctioning, and does not needprolonged waiting periods for stabilization.

REFERENCES

1. Boullata J, Williams J, Cottrell F, Hudson L, Compher C.Accurate determination of energy needs in hospitalized pa-tients. J Am Diet Assoc 2007;107:393–401

2. Briassoulis G. Nutritional assessment in the critically ill child.Curr Pediatr Rev 2006;2:233–43

3. Joosten KF, Jacobs FI, van Klaarwater E, Baartmans MG, HopWC, Merilainen PT, Hazelzet JA. Accuracy of an indirectcalorimeter for mechanically ventilated infants and children: theinfluence of low rates of gas exchange and varying FIO2. CritCare Med 2000;28:3014–8

4. Melendez JA, Veronesi M, Barrera R, Ferri E, Miodownik S.Determination of metabolic monitor errors and precision underclinical conditions. Clin Nutr 2001;20:547–51

5. Scheeren TW, Krossa M, Merilainen P, Arndt JO. Error inmeasurement of oxygen and carbon dioxide concentrations bythe DeltatracII metabolic monitor in the presence of desflurane.Br J Anaesth 1998;80:521–4

6. McClave SA, Snider HL, Ireton-Jones C. Can we justify contin-ued interest in indirect calorimetry? Nutr Clin Pract 2002;17:133–6

7. McLellan S, Walsh T, Burdess A, Lee A. Comparison betweenthe Datex-Ohmeda M-COVX metabolic monitor and the Deltat-rac II in mechanically ventilated patients. Intensive Care Med2002;28:870–6

8. Meyer R, Briassouli E, Briassoulis G, Habibi P. Evaluation of theM-COVX metabolic monitor in mechanically ventilated adultpatients. e-SPEN 2008;3:e232–9

9. Maggiore SM, Lellouche F, Pigeot J, Taille S, Deye N, Durrm-eyer X, Richard JC, Mancebo J, Lemaire F, Brochard L. Preven-tion of endotracheal suctioning-induced alveolar derecruitmentin acute lung injury. Am J Respir Crit Care Med 2003;167:1215–24

10. Cereda M, Villa F, Colombo E, Greco G, Nacoti M, Pesenti A.Closed system endotracheal suctioning maintains lung volumeduring volume-controlled mechanical ventilation. IntensiveCare Med 2001;27:648–54

11. Morrow B, Futter M, Argent A. Effect of endotracheal suction onlung dynamics in mechanically-ventilated paediatric patients.Aust J Physiother 2006;52:121–6

12. Fernandez MD, Piacentini E, Blanch L, Fernandez R. Changes inlung volume with three systems of endotracheal suctioning withand without pre-oxygenation in patients with mild-to-moderatelung failure. Intensive Care Med 2004;30:2210–5

13. Moriyama S, Utoh J, Okamoto K, Tanaka M, Kunitomo R, HaraM, Kitamura N. Direct expiratory gas analysis after hypother-mic cardiopulmonary bypass. Ann Thorac Cardiovasc Surg1999;5:150–5

14. Morrow B, Futter M, Argent A. A recruitment manoeuvreperformed after endotracheal suction does not increase dynamiccompliance in ventilated paediatric patients: a randomisedcontrolled trial. Aust J Physiother 2007;53:163–9

15. Main E, Castle R, Newham D, Stocks J. Respiratory physio-therapy vs. suction: the effects on respiratory function inventilated infants and children. Intensive Care Med 2004;30:1144–51

16. Main E, Stocks J. The influence of physiotherapy and suction onrespiratory deadspace in ventilated children. Intensive CareMed 2004;30:1152–9

17. Guglielminotti J, Desmonts JM, Dureuil B. Effects of trachealsuctioning on respiratory resistances in mechanically ventilatedpatients. Chest 1998;113:1335–8

18. Smyrnios NA, Curley FJ, Shaker KG. Accuracy of 30-minuteindirect calorimetry studies in predicting 24-hour energy expen-diture in mechanically ventilated, critically ill patients. JPEN JParenter Enteral Nutr 1997;21:168–74

19. Singer P, Pogrebetsky I, Attal-Singer J, Cohen J. Comparison ofmetabolic monitors in critically ill, ventilated patients. Nutrition2006;22:1077–86

20. Meyer R, Habibi P. Comparing methods for measuring energyexpenditure in the critically ill. Nutrition 2007;23:281

21. Donaldson L, Dodds S, Walsh TS. Clinical evaluation of acontinuous oxygen consumption monitor in mechanically ven-tilated patients. Anaesthesia 2003;58:455–60


Long-Acting Local Anesthetics Attenuate FMLP-inducedAcute Lung Injury in Rats

Marcus T. Schley, MD*†

Matthias Casutt, MD*

Christoph Haberthur, PhD*

Martin Dusch, MD†

Roman Rukwied, PhD†

Martin Schmelz, MD, PhD†

Joachim Schmeck, MD, PhD‡

Guido K. Schupfer, MD, PhD*

Christoph J. Konrad, MD, PhD*

BACKGROUND: Endothelin-1 (ET-1) is a mediator of lung diseases and a potentpulmonary vasoconstrictor. In addition to thromboxane A2, it participates in theformation of lung edema. Both lidocaine and mepivacaine attenuate the increase ofpulmonary arterial pressure (PAP) and lung edema development. We examinedthe effects of procaine, bupivacaine, and ropivacaine on experimentally evokedPAP increase and ET-1 release.METHODS: PAP and lung weight were measured in isolated rat lungs duringperfusion with Krebs-Henseleit hydroxyethyl starch buffer. Bupivacaine, ropiva-caine, or procaine was added to the solution at concentrations of 10�2–10�7 mg/kg.ET-1 levels were measured in the perfusate by enzyme-immunoassay, and throm-boxane A2 levels were assayed by radioimmunoassay. N-formyl-l-leucine-methionyl-l-phenylalanine was used to activate human polymorphonuclearneutrophils.RESULTS: Bupivacaine, ropivacaine, and procaine significantly attenuated increasesof PAP (P � 0.05) and resulted in a reduction of lung weight in these treatmentgroups compared with the sham group (P � 0.05). The long-acting anestheticsbupivacaine and ropivacaine (P � 0.05), but not procaine, reduced ET-1 levels,produced low inflammation rates, and did not affect lung structures at doses from10�3 to 10�6 mg/kg.CONCLUSION: Bupivacaine and ropivacaine attenuated N-formyl-l-leucine-methionyl-l-phenylalanine-induced PAP, reduced lung edema, and diminished ET-1release. Lidocaine and mepivacaine are more effective in reducing PAP andedema formation, but long-acting local anesthetics also inhibit ET-1 depletionand therefore have increased anti-inflammatory properties.(Anesth Analg 2009;109:880 –5)

Major surgical procedures are performed underregional anesthesia, either alone or as a supplement togeneral anesthesia. The use of regional anesthesialeads to reduced postoperative mortality, particularlyby improving pulmonary function and also decreas-ing cardiac or ileus complications.1–3

In animal experiments, endothelin-1 (ET-1), a potentpulmonary vasoconstrictor, and thromboxane A2 (TXA2)have been shown to contribute to lung edema.4–6 Thelong-acting local anesthetic (LA) ropivacaine decreased theTXA2 stable analog U46619-evoked pulmonary arterialpressure (PAP). In addition, bupivacaine attenuated the

TXA2-induced contraction of aortic rings, increased theactivated clotting time, and prolonged the effects of theTXA2-receptor antagonist SQ29548.7–9 LAs also inhibitedTXA2-mediated platelet aggregation but this particularantithrombotic effect still has to be verified.10 Neutrophilfunction, however, was not altered by bupivacaine,whereas ropivacaine dose-dependently suppressed theCa2� response in human neutrophils and had an inhibitoryeffect on the formation of oxygen radicals, hydrogenperoxides, and hydroxides.11 Conversely, ropivacainedid not impair chemotaxis or phagocytosis and failedto decrease protein kinase C activity.11 Inhibition ofprotein kinase C, for instance by systemic administra-tion of LAs, has been found to excite N-methyl-d-aspartate receptor activation, thereby preventing painand hyperalgesia.12

Anti-inflammatory properties of both bupivacaineand ropivacaine have been indicated by their inhibitingeffect on lipopolysaccharide (LPS)-evoked release ofproinflammatory cytokines (tumor necrosis factor-�,interleukin [IL]-1beta, IL-6) from macrophages, theirattenuation on LPS-induced mRNA upregulation forintercellular adhesion molecule 1, and their blockade ofLPS-evoked increase of neutrophils in rat lungs.13–15

The functional impact of long-acting LAs on lungperfusion, however, is still unclear. As shown by our

From the *Department of Anaesthesiology and Operative Inten-sive Care Medicine, Kantonsspital, Lucerne, Switzerland; †Depart-ment of Anaesthesiology and Intensive Care Medicine, Universityof Heidelberg, Heidelberg, Germany; and ‡Department of Anaes-thesiology, University of Mainz, Mainz, Germany.

Accepted for publication April 7, 2009.The first two authors equally contributed to this work.Supported by a grant from the Medical Faculty Mannheim,

University of Heidelberg.Address correspondence and reprints requests to Dr. Christoph

J. Konrad, Department of Anesthesiology and Operative IntensiveCare Medicine, Kantonsspital Lucerne, CH-6000 Lucerne 16, Swit-zerland. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181ae5ef1


previous experiments, the short-acting LAs lidocaineand mepivacaine attenuated the N-formyl-l-leucine-methionyl-l-phenylalanine (FMLP)-induced increaseof PAP and lung edema. Intriguingly, lidocaine had adistinct dose-dependent effect on PAP but mepivacainedid not show this effect.16 In the FMLP-induced lunginjury model, we examined the dose-dependent inhibi-tory effects of the long-acting LAs bupivacaine andropivacaine on PAP increase. Previous studies havedemonstrated that the increase in PAP can be attenuatedby inhibiting ET-1 receptor binding.5 Therefore, weadditionally investigated the anti-inflammatory potencyof bupivacaine and ropivacaine by quantifying ET-1 andTXA2 levels in the lung perfusate as major mediatorscontributing to lung edema development. Finally, theresults obtained for long-acting LAs were comparedwith effects gained by the administration of a short-acting LAs of the ester type.

METHODSThe study protocol and experimental procedure

were approved by the animal subject protection com-mittee of the University of Heidelberg, as well as bythe responsible regional governmental committee. TheCouncil of the American Physiology Society principlesguiding the care, handling, and use of the animalswere followed.

Isolated Ventilation Lung PerfusionSprague-Dawley rats (Charles River Laboratories,

Kent, UK) of both sexes weighing 320–375 g wereused. Anesthetized lung donors (ketamine/xylazine80/10 mg/kg) were intubated through a tracheostomywith a 16-gauge cannula and the lungs were venti-lated with atmospheric air containing 4% CO2 at 25breaths/min, 7 mL/kg tidal volume, and 0.5–1 cmH2O positive end-expiratory pressure (Statham, PD23, Hato Rey, Puerto Rico). After laparotomy, alldonors were given heparin sodium (1000 IE/kg) foranticoagulation through a renal artery. After mediansternotomy, the pleurae and pericardium were openedand the thymus excised. A ligature was passed throughthe transverse sinus to encircle the aorta and pulmonaryartery trunk. A primed, blunt cannula (1.0/1.8 mm innerdiameter/outer diameter) was passed into the pulmo-nary artery trunk and secured with the previouslyplaced ligature. The inferior vena cava was clamped, theleft atrial appendage excised, and the right ventricularoutflow tract opened. The tracheal cannula was thenclamped and the lung block excised. Isolated lungs wereplaced on an electronic scale (Hottinger; BaldwinMesstechnik Type U1, Darmstadt, Germany) in atemperature-controlled (37°C) and humidified chamberand perfused with cell-free and plasma-free Krebs-Henseleit hydroxyethyl starch buffer (KHHB) solution(Haes-steril 10%, 200/0.5; Fresenius AG, Bad Homburg,Germany) in a recirculating system (circulating volume20 mL). Colloid osmotic pressure was maintained at23–25 mm Hg and flow rate kept constant at 15 mL/min.

Assessment of Lung Weight and PulmonaryArterial Pressure

PAP and weight of the isolated lungs were recordedcontinuously by means of pressure (R-10 Series, Rika-denki, Freiburg, Germany) and weight (KWS3073,Hottinger-Baldwin, Darmstadt, Germany) transduc-ers. Relative changes of weight, analyzed before, dur-ing, and after lung injury, determined lung edemaformation. A circuit system connected to a reservoirwas used to exclude impact of perfusion pressurechanges caused by the injection of the tested fluids.Because of the constant perfusion flow rate, anyalteration in perfusion pressure directly reflects alter-ations in pulmonary vascular resistance. The finalcomponent concentrations in the buffer were starch 50g/L; Na� 138 mmol/L; K� 4.5 mmol/L; Mg2� 1.33mmol/L; Ca2� 2.38 mmol/L; Cl� 135 mmol/L, HCO3

�

12 mmol/L, and glucose 12 mmol/L. The osmolalitywas approximately 330 mOsm/kg (Mikro-Osmometer;Roebling Messtechnik, Berlin, Germany). The pH of theperfusate was adjusted to 7.4 using 1 M NaHCO3.Intermittently, perfusate samples were taken for mea-surements of Po2, Pco2, and O2 saturation (ABL 330;Radiometer Copenhagen, Copenhagen, Denmark). Theimpact of Pco2 was investigated at both physiologic andpathophysiologic concentrations before the study, andvalues of Pco2 were kept constant in physiologic rangesthroughout the experiment to avoid an influence of Pco2changes on PAP.

Measurement of Endothelin-1ET-1 was measured by a commercially available

enzyme-linked immunoassay test kit with a detectionlimit of 0.05 fmol/mL (Amersham, Braunschweig,Germany). The cross-reactivity of the ET-1 antibodywas 100% with ET-1, 100% with ET-2, �0.001% withET-3, 0.07% with big ET-1, and �0.0006% with sarafo-toxin 6b. Materials were purchased from Roth, Sigmaand Biozym, Germany.

Radioimmunoassay of TX A2Thromboxane B2 is the stable hydrolysis metabolite

of TXA2 and was assayed serologically from 100 �L ofrecirculating KHHB by radioimmunoassay (detectionlimit 10 pg/mL). Rat anti-TX was purchased fromPaesel (Frankfurt, Germany), [3H]-labeled thrombox-ane B2 from New England Nuclear (Dreieich, Ger-many), and precipitating goat anti-rat antibodies fromCalbiochem-Behring (Frankfurt, Germany).

Isolation, Preparation, and Stimulation ofHuman Granulocytes

Human polymorphonuclear neutrophils (PMN)were obtained from healthy donors. As describedpreviously, human granulocytes were isolated from100 mL of heparinized human blood by Percoll den-sity gradient (55% Percoll: D � 1.77 g/mL; 69%Percoll: D � 1.095 g/mL).17 The cells were countedand incubated in a bouillon solution (RPMI/fetal calf


serum 5%) after final separation and washing for 90min. The granulocytes were isolated after incubationand rewashed as follows: 190 � 106 (110 � 106–250 � 106).The viability in the trypan blue exclusion test wasmore than 95%. Percoll/HEPES (Sigma, Munich,Germany) and Hanks balanced salt solution (GIBCO,Paisley, Scotland) were used for cell isolation. FMLP wasused as chemoattractant peptide to activate humangranulocytes.

Histological PreparationAfter pretreatment with liquid nitrogen, lungs were

fixed in formalin (10%) and embedded in paraffin. The4-mm slices were stained with hematoxylin and eosinand analyzed with light microscopy (Leica, Wetzlar,Germany). Image processing was performed withLeica Qwin� Software, Version May 1997 (Leica, Wet-zlar, Germany). Examinations were performed by twoindependent observers, who analyzed leukocytessemiquantitatively in the lung tissue by microscopy.

Experimental ProtocolA total of 114 isolated lung preparations were

randomly assigned to three groups, i.e., a procaine, abupivacaine, and a ropivacaine group. LAs wereadded at final concentrations of 10�7, 10�6, 10�5, 10�4,10�3, and 10�2 mg/kg to the KHHB solution used forthe lung perfusion, which covers the range of clini-cally analyzed LA plasma concentrations of about 1�g/mL.18,19 In addition to each drug concentration, asham group was investigated in six lungs. After thepreparation of the lungs, an equilibration period of30-min KHHB perfusion was performed to ensure aconsistent vascular tone and permeability. Thereafter,LAs were perfused for 10 min, which was followed bya 60-min stimulation period performed by FMLP (1�M) perfusion to activate PMN, as described previ-ously.20 The duration of FMLP-induced lung injury,however, was limited to a maximum FMLP perfusionperiod of 120 min (data not shown). LAs were inves-tigated at increasing concentrations. Before each LAconcentration increase, during the 30-min equilibra-tion period, human granulocytes (190 � 106 cells)were added to the KHHB perfusate.

TXA2 and ET-1 concentrations were determined inthe perfusate samples at 5, 15, 30, and 60 min aftergranulocyte activation.

StatisticsFor statistical analysis, data are presented as

mean � se of the mean. Normally distributed data(Shapiro-Wilks test) were analyzed by one-way anal-ysis of variance (ANOVA) followed by the Scheffemultiple-range test (STATISTICA™ Version 5.1 forWindows). For paired samples, t-tests were used toanalyze differences within the groups. A value of P �0.05 was considered statistically significant.

RESULTSBupivacaine, ropivacaine, and procaine attenuated

the FMLP-induced increase of PAP (P � 0.05). At thelowest concentrations of 10�7 mg/kg, the short-actinganesthetic procaine was most effective in mitigatingthe FMLP-induced PAP increase (P � 0.05, ANOVA).Bupivacaine and ropivacaine required higher concen-trations, i.e., a minimum of 10�5 mg/kg (P � 0.05,ANOVA), to attenuate a PAP increase (Fig. 1).

Administration of bupivacaine, ropivacaine, andprocaine resulted in a significant reduction of lungweight compared with the sham treatment (P � 0.05,ANOVA). All administered LAs were equally effec-tive in evoking weight loss (Fig. 2), and a dose-dependent effect was not observed (data not shown).

Figure 1. The effect of long-acting (bupivacaine and ropi-vacaine) and short-acting (procaine) local anesthetics onpulmonary arterial pressure (PAP) after N-formyl-l-leucine-methionyl-l-phenylalanine (FMLP)-induced activation ofhuman granulocytes. Under sham conditions (native Krebs-Henseleit hydroxyethyl starch buffer solution [KHHB], withFMLP-activated human granulocytes) in six lung preparations,PAP almost increased to 8.2 mm Hg � 1.11 (gray rectangle). Asignificant dose-dependent attenuation of PAP increase couldbe observed in all local anesthetics above a concentration of10�5 mg/kg (P � 0.05, analysis of variance [ANOVA]),whereas procaine already showed a significant effect at 10�7

mg/kg (P � 0.05, ANOVA).

Figure 2. All local anesthetics used caused a significantattenuation of the weight gain after N-formyl-l-leucine-methionyl-l-phenylalanine (FMLP)-induced activation (P �0.05, analysis of variance [ANOVA]). Data are presented asmean � sem of all dosages in each group. A dose depen-dency was not observed (data not shown).

882 Local Anesthetics and Inflammation ANESTHESIA & ANALGESIA

Bupivacaine and ropivacaine reduced the FMLP-provoked release of ET-1 (P � 0.05, ANOVA) to asimilar extent, whereas procaine had no effect on ET-1levels (Fig. 3). TXA2 release was not inhibited byeither short-acting or long-acting LAs (Fig. 4).

FMLP activation of the human granulocytes resultedin a compact invasion in the lung tissue followed by anacute granulocytic alveolitis. We observed PMN accu-mulated nearly ubiquitously in the tissue and edema ofall alveolar structures. Furthermore, the number andform of lung alveoli or lung ducts were altered. Also, theinterstitial space was infiltrated with granulocytes andmacrophages (Fig. 5A).

Both long- and short-acting LAs were able to at-tenuate granulocyte invasion in the lung tissue. Al-though the granulocyte invasion was still moderate inthe procaine group (Fig. 5B), the inflammation rate wasvery slow, and lung structures remained unaffected inthe bupivacaine and ropivacaine groups (Figs. 5C and5D). This protective effect could be observed by usingconcentrations of 10�3–10�6 mg/kg.

DISCUSSIONLAs contribute to reduction of inflammation by

reducing the release of proinflammatory mediators,

such as tumor necrosis factor-�, prostaglandins, orILs.13–15 The present results obtained in a rat acutelung injury model demonstrate a reduction of themetabolite ET-1. No change of the mediator TXA2,however, was observed in the presence of the long-acting LAs bupivacaine and ropivacaine. Further-more, these LAs in the rat lung attenuated both theFMLP-induced increase of PAP and the developmentof edema formation. Direct comparison with otherLAs revealed that the short-acting procaine appar-ently was more effective but the long-acting LAs alsosignificantly attenuated lung injury.

Anti-inflammatory Properties of LAsIn general, these data support the previously

assumed suggestion that LAs interfere with inflamma-tory defense systems by inhibiting granulocytic adher-ence and attenuating granulocytes’ migration intoinflamed sections.21,22 Long- and short-acting LAsobviously differ in their anti-inflammatory propertiesin a dose-dependent manner. This was shown by thechemoattractant and priming agents FMLP and LPS inhuman PMNs, in which both short- and long-actingLAs inhibited PMNs interaction at clinically relevantconcentrations.23,24 These findings support the hy-pothesis that LAs have anti-inflammatory properties.25

The present results obtained in rat lungs corroboratethe anti-inflammatory role of LAs in the context offacilitated lung ventilation under pathophysiologicconditions. In particular, pathophysiologic conditionsimply major pneumonia risks that are promoted andmaintained by high pulmonary ventilation pressures.These may cause increased endothelial leakage andenhanced lung edema formation.1,2 Increased lungedema consequently enhances pulmonary resistance,which again would require enhanced pulmonary

Figure 3. Effect of long-lasting and short-lasting local anestheticson endothelin-1 (ET-1) level determined after N-formyl-l-leucine-methionyl-l-phenylalanine (FMLP)-induced granulo-cyte activation (mean values at all dosages). Bupivacaine andropivacaine both reduced the ET-1 level (P � 0.05, analysis ofvariance [ANOVA]).

Figure 4. Thromboxane A2 (TXA) levels (as stable metabolitethromboxane B2 [TXB2]) were also determined after granu-locyte activation. No significant changes could be observedin TXA release compared with the sham group. Mean valuesat all dosages are shown.

Figure 5. A compact accumulation of polymorphonuclearneutrophils (PMN) and extravasation of perfusate is identi-fiable in the sham group (A). Pretreatment with localanesthetics attenuated the invasion of PMN in the procaine(B), bupivacaine (C), and ropivacaine (D) groups. Histolog-ical samples of bupivacaine and ropivacaine were obtainedafter pretreatment with a concentration of 10�3 kg/mg, andthe sample of procaine after treatment with 10�4 mg/kg.Magnification �25, hematoxylin/eosin staining.


pressures for ventilation. Thereby, the risk of endothe-lial damage is increased, lung edema formation isfacilitated, and thus predictors that determine pulmo-nary morbidity are increased.1,2 To overcome thisvicious cycle, the pressure of ventilation should bekept at low levels. This can be achieved by the preven-tion of edema formation or by inhibiting endothelialdamage. The present experimental study demonstratesin an animal ex vivo model that pretreatment with LAsreduces edema formation, endothelial damage, andpulmonary resistance. These data indicate that septicpulmonary risk factors may be diminished by LAs.

Pulmonary Hypertension and Lung EdemaThe mechanisms of LAs action on pulmonary hy-

pertension remain largely unknown; however, there isevidence that LAs specifically activate transient recep-tor potential V1 (TRPV1) channels.26 Even thoughinvolvement of TRPV1 channels has not been dem-onstrated in this study, these channels play a majorrole in blood flow regulation. For instance, TRPV1activation might reduce pulmonary resistance via releaseof vasodilatory neuropeptides, such as calcitonin gene-related peptide, from nociceptive afferent nerve fibers.27

Moreover, mRNA for TRPV1 has been detected ingranulocytes; interestingly, it does not mediate calciumincrease or inward currents as in nociceptors.28

In contrast to the putative mechanisms mentionedearlier, ET-1, a peptide produced primarily by vascu-lar endothelial cells, was found to be the most potentand long-lasting endogenous vasoconstrictor sub-stance yet discovered.5 Elevated ET-1 levels have beendetected in various states of lung pathology, such asprimary pulmonary hypertension, asthma, and sepsis,and ET-1s involvement in elevating pulmonary vas-cular resistance has been found recently by selectivereceptor blocking experiments.5 Moreover, inappro-priate activation of the ET-1 system has been clearlyshown in patients with almost all types of pulmonaryarterial hypertension.

Here, we demonstrated that administration ofbupivacaine, ropivacaine, and procaine resulted inan attenuation of the FMLP-induced increase of PAPand reduced lung edema and granulocyte invasionin the lung tissue when compared with sham treat-ment. Accordingly, it can be presumed that thequantitative granulocyte invasion was mainly re-sponsible for the lung weight increase.29 In addi-tion, antagonism of ET-1 receptors in the treatmentof pulmonary arterial hypertension has been per-formed successfully previously in an animal model5

and human clinical trials.30 However, the impact ofcontinuous epidural regional anesthesia with LAson ET-1 release has not been conclusively shownand is still the subject of controversy. For instance,continuous epidural anesthesia with bupivacaine0.125% performed in 20 patients during abdominalaortic surgery did not have beneficial effects onET-1 levels.31

Thromboxane A2 ReleaseSimilarly, the long-acting LAs bupivacaine and

ropivacaine did not change FMLP-induced TXA2 re-lease. However, TXA2 may be involved in the media-tion of ET-1–induced vasoconstriction. Pretreatmentwith type A endothelin receptor antagonist LU135252significantly reduced the pressure reaction and gen-eration of TXA2 after air embolism.5

Clinical Implications and LimitationsHigh plasma concentrations of LAs may be toxic for

the central nervous system and heart tissue. Of these, forinstance, bupivacaine was more cardiotoxic than ropiva-caine, an effect that could not be alleviated withclonidine.32 In contrast, patients receiving epiduralanesthesia during major surgery are less likely tosuffer from thromboembolic complications thanpatients receiving general anesthesia.33 LAs abolishhypercoagulability without impairing normal aggre-gation or coagulation processes, thus demonstratingprofound anti-inflammatory properties.22 Accordi-ngly, in the present experimental study, we foundthat both short- and long-acting LAs lead to anti-inflammatory effects in the lung. The FMLP-inducedpulmonary arterial hypertension was attenuated, lungedema ameliorated, and ET-1 release reduced. Thus,LAs may provide an additional clinical tool for lungprotection. However, the clinical implication of suchan experimental ex vivo animal study is limited andshould not be overstated. Additional clinical in vivotrials are needed to confirm the role of LAs in reduc-ing pneumonia risks.

ACKNOWLEDGMENTSWe thank I. Rossbach, Experimental Pain Research, De-

partment of Anesthesiology, for her editorial assistance, andM. Lehma and A. Hagebeuker, Department of Anesthesiology,Theresia Hospital Mannheim, and J. Christophel, Center forMedical Research Mannheim, for their technical assistance.The molecular biological analyses were performed by Prof. M.Bauer, University of Jena.

REFERENCES

1. Ballantyne JC, Carr DB, deFerranti S, Suarez T, Lau J, ChalmersTC, Angelillo IF, Mosteller F. The comparative effects of post-operative analgesic therapies on pulmonary outcome: cumula-tive meta-analyses of randomized, controlled trials. AnesthAnalg 1998;86:598–612

2. Rodgers A, Walker N, Schug S, McKee A, Kehlet H, vanZundert A, Sage D, Futter M, Saville G, Clark T, MacMahon S.Reduction of postoperative mortality and morbidity with epi-dural or spinal anaesthesia: results from overview of random-ised trials. BMJ 2000;321:1493

3. Kehlet H, Holte K. Effect of postoperative analgesia on surgicaloutcome. Br J Anaesth 2001;87:62–72

4. Nakano J, Takizawa H, Ohtoshi T, Shoji S, Yamaguchi M, IshiiA, Yanagisawa M, Ito K. Endotoxin and pro-inflammatorycytokines stimulate endothelin-1 expression and release byairway epithelial cells. Clin Exp Allergy 1994;24:330–6

5. Schmeck J, Koch T, Patt B, Heller A, Neuhof H, van Ackern K.The role of endothelin-1 as a mediator of the pressure responseafter air embolism in blood perfused lungs. Intensive Care Med1998;24:605–11

884 Local Anesthetics and Inflammation ANESTHESIA & ANALGESIA

6. Schmeck J, Heller A, Groschler A, Recker A, Neuhof H,Urbaschek R, Koch T. Impact of endothelin-1 in endotoxin-induced pulmonary vascular reactions. Crit Care Med2000;28:2851–7

7. Hahnenkamp K, Nollet J, Strumper D, Halene T, Rathman P,Mortier E, Van Aken H, Knapp J, Durieux ME, Hoenemann CW.Bupivacaine inhibits thromboxane A2-induced vasoconstrictionin rat thoracic aorta. Anesth Analg 2004;99:97–102

8. Fischer LG, Honemann CW, Patrie JT, Durieux ME, Rich GF.Ropivacaine attenuates pulmonary vasoconstriction induced bythromboxane A2 analogue in the isolated perfused rat lung. RegAnesth Pain Med 2000;25:187–94

9. Kohrs R, Hoenemann CW, Feirer N, Durieux ME. Bupivacaineinhibits whole blood coagulation in vitro. Reg Anesth Pain Med1999;24:326–30

10. Lo B, Honemann CW, Kohrs R, Hollmann MW, Polanowska-Grabowska RK, Gear AR, Durieux ME. Local anesthetic actionson thromboxane-induced platelet aggregation. Anesth Analg2001;93:1240–5

11. Mikawa K, Akamarsu H, Nishina K, Shiga M, Obara H, Niwa Y.Effects of ropivacaine on human neutrophil function: compari-son with bupivacaine and lidocaine. Eur J Anaesthesiol 2003;20:104–10

12. Hahnenkamp K, Durieux ME, Hahnenkamp A, Schauerte SK,Hoenemann CW, Vegh V, Theilmeier G, Hollmann MW. Localanaesthetics inhibit signalling of human NMDA receptors re-combinantly expressed in Xenopus laevis oocytes: role of proteinkinase C. Br J Anaesth 2006;96:77–87

13. Zhang XW, Thorlacius H. Inhibitory actions of ropivacaine ontumor necrosis factor-alpha-induced leukocyte adhesion andtissue accumulation in vivo. Eur J Pharmacol 2000;392:R1–3

14. Huang YH, Tsai PS, Huang CJ. Bupivacaine inhibits COX-2expression, PGE2, and cytokine production in endotoxin-activated macrophages. Acta Anaesthesiol Scand 2008;52:530–5

15. Blumenthal S, Borgeat A, Pasch T, Reyes L, Booy C, Lambert M,Schimmer RC, Beck-Schimmer B. Ropivacaine decreases inflam-mation in experimental endotoxin-induced lung injury. Anes-thesiology 2006;104:961–9

16. Konrad CJ, Schuepfer GK, Neuburger M, Schley M, Schmelz M,Schmeck J. Reduction of pulmonary edema by short-acting localanesthetics. Reg Anesth Pain Med 2006;31:254–9

17. Hjorth R, Jonsson AK, Vretblad P. A rapid method for purifi-cation of human granulocytes using percoll. A comparison withdextran sedimentation. J Immunol Methods 1981;43:95–101

18. Groeben H, Schwalen A, Irsfeld S, Stieglitz S, Lipfert P, HopfHB. Intravenous lidocaine and bupivacaine dose-dependentlyattenuate bronchial hyperreactivity in awake volunteers. Anes-thesiology 1996;84:533–9

19. Tuominen M, Pitkanen M, Rosenberg PH. Postoperative painrelief and bupivacaine plasma levels during continuous inter-scalene brachial plexus block. Acta Anaesthesiol Scand 1987;31:276–8

20. Hammerschmidt S, Wahn H. Comparable effects of HOCl andof FMLP-stimulated PMN on the circulation in an isolated lungmodel. Am J Respir Crit Care Med 1997;156:924–31

21. Eriksson AS, Sinclair R, Cassuto J, Thomsen P. Influence oflidocaine on leukocyte function in the surgical wound. Anes-thesiology 1992;77:74–8

22. Hollmann MW, Durieux ME. Local anesthetics and the inflam-matory response: a new therapeutic indication? Anesthesiology2000;93:858–75

23. Tsai PS, Buerkle H, Huang LT, Lee TC, Yang LC, Lee JH.Lidocaine concentrations in plasma and cerebrospinal fluidafter systemic bolus administration in humans. Anesth Analg1998;87:601–4

24. Takao Y, Mikawa K, Nishina K, Maekawa N, Obara H. Lido-caine attenuates hyperoxic lung injury in rabbits. Acta Anaes-thesiol Scand 1996;40:318–25

25. Fischer LG, Bremer M, Coleman EJ, Conrad B, Krumm B, GrossA, Hollmann MW, Mandell G, Durieux ME. Local anestheticsattenuate lysophosphatidic acid-induced priming in humanneutrophils. Anesth Analg 2001;92:1041–7

26. Leffler A, Fischer MJ, Rehner D, Kienel S, Kistner K, Sauer SK,Gavva NR, Reeh PW, Nau C. The vanilloid receptor TRPV1 isactivated and sensitized by local anesthetics in rodent sensoryneurons. J Clin Invest 2008;118:763–76

27. Inoue R, Jensen LJ, Shi J, Morita H, Nishida M, Honda A, Ito Y.Transient receptor potential channels in cardiovascular functionand disease. Circ Res 2006;99:119–31

28. Heiner I, Eisfeld J, Luckhoff A. Role and regulation of TRPchannels in neutrophil granulocytes. Cell Calcium 2003;33:533–40

29. Clavijo LC, Carter MB, Matheson PJ, Wills-Frank LA, WilsonMA, Wead WB, Garrison RN. Platelet-activating factor andbacteremia-induced pulmonary hypertension. J Surg Res2000;88:173–80

30. Leuchte HH, Meis T, El Nounou M, Michalek J, Behr J. Inhala-tion of endothelin receptor blockers in pulmonary hypertension.Am J Physiol Lung Cell Mol Physiol 2008;294:L772–7

31. Piper SN, Boldt J, Schmidt CC, Maleck WH, Brosch C, Kumle B.Hemodynamics, intramucosal pH and regulators of circulationduring perioperative epidural analgesia. Can J Anaesth2000;47:631–7

32. Gulec S, Aydin Y, Uzuner K, Yelken B, Senturk Y. Effects ofclonidine pre-treatment on bupivacaine and ropivacaine cardio-toxicity in rats. Eur J Anaesthesiol 2004;21:205–9

33. Hollmann MW, Wieczorek KS, Smart M, Durieux ME. Epiduralanesthesia prevents hypercoagulation in patients undergoingmajor orthopedic surgery. Reg Anesth Pain Med 2001;26:215–22


Obstetric AnesthesiologySection Editor: Cynthia A. Wong

Intraoperative Awareness During General Anesthesiafor Cesarean Delivery

Kay Robins, FRCA*

Gordon Lyons, FRCA, MD†

Intraoperative awareness is defined as the spontaneous recall of an event occurringduring general anesthesia. A move away from rigid anesthetic protocols, whichwere designed to limit drug transmission across the placenta, has reduced theincidence of awareness during cesarean delivery to approximately 0.26%. Never-theless, it remains an undesirable complication with potential for the developmentof posttraumatic stress disorder. Assessing depth of anesthesia remains a challengefor the anesthesia provider as clinical signs are unreliable and there is no sensitiveand specific monitor. Bispectral Index monitoring with the goal of scores �60 hasbeen recommended to prevent awareness. Induction drugs vary in their ability toproduce amnesia and the period of hypnotic effect is affected by the rate at whichthey are redistributed. After initiation of anesthesia, volatile anesthetics should beadministered to a target of 0.7 minimum alveolar anesthetic concentration, whichhas been shown to consistently achieve mean Bispectral Index scores �60. Becauseof its rapid uptake, nitrous oxide remains an important adjunct to reduce the riskof awareness during emergency cesarean delivery. In the absence of fetal compro-mise, there is no rationale for an inspired oxygen concentration above 0.33. Deeperlevels of anesthesia reduce the incidence of awareness; current evidence does notsuggest an increased risk of tocolysis or fetal morbidity.(Anesth Analg 2009;109:886–90)

THE DILEMMA OF OBSTETRIC ANESTHESIAThe objectives of general anesthesia for cesarean

delivery are to keep mother and fetus adequately oxy-genated, while limiting fetal drug transmission andmaintaining maternal comfort. Crawford1 called thisconflict “the dilemma of obstetric anesthesia and anal-gesia” and said it epitomized the challenge and theattraction of the specialty. The balance of this conflict haschanged over the years. Intraoperative recall duringgeneral anesthesia was unreported with the spontaneousbreathing and ether of Mendelson’s day, but thischanged with the introduction of succinylcholine in thelate 1950s when endotracheal intubation and musclerelaxation were popularized. Initially, anesthesia wasprovided largely by thiopental and nitrous oxide2 andwas associated with an incidence of awareness up to26%.3 A reluctance to load with a volatile anesthetic, andconcern about lack of care for an anesthetized newborn

from an undeveloped neonatal service, might havehelped make this frequent incidence of recall seem anacceptable side effect.

The addition of halothane 0.5% (0.66 minimum alveo-lar anesthetic concentration [MAC]) to the anestheticmoved the balance further in the maternal direction,reducing awareness to around 1%,4 and throughout the1970s, this was widely regarded as an acceptable inci-dence. The balance shifted further toward maternalcomfort when it was demonstrated that awareness atcesarean delivery could be reduced by more generousdoses of thiopental and more liberal use of a volatileanesthetic.5 This practice became more widely dissemi-nated in the 1990s, a time in which access to neonatalresuscitation support became more widely available.Additionally, anesthesia providers were taking advan-tage of the electronic monitoring revolution (includingmeasurement of end-tidal gas concentrations), which of-fered a dynamic alternative to the traditional recipeapproach. Today, the incidence of awareness duringanesthesia in the United States is believed to be between0.1% and 0.2% of all patients undergoing general anes-thesia, representing 20,000–40,000 cases per year.6 Therisk appears to be higher when muscle relaxants areused and during cesarean delivery.7 In Australia andNew Zealand, the Australian and New Zealand Collegeof Anesthesia (ANZCA) Trial studied 1095 cesarean

From the *Department of Anaesthesia, York Hospital, York; and†Department of Obstetric Anaesthesia, St. James’ University Hospi-tal, Leeds, UK.

Accepted for publication April 24, 2009.Address correspondence and reprint requests to Kay Robins,

FRCA, Department of Anaesthesia, York Hospital, York YO61 1PS,UK. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181af83c1

Focused Reviews


deliveries and interviewed 763 women postoperatively;two women had recall giving an incidence of 0.26%.8

DEFINITIONS AND SCOPEAwareness is defined as the spontaneous postop-

erative recall of an event that occurred during generalanesthesia (Table 1).9 One difficulty with explicitmemory of perioperative events is distinguishing be-tween recall of genuine intraoperative events andemergence phenomena, because voices, the baby cry-ing, and wound pain are part of the postoperativeexperience. A wider definition of recall takes in aspectrum that ranges from dreams, through recall ofspecific events, to full consciousness with paralysisand pain. Dreaming is often thought to be indicativeof light anesthesia but more likely occurs duringemergence from anesthesia and recovery.10 Crawford1

took the view that unpleasant dreams did reflectawareness and that the two should always be linked.Anecdotal reports have shown that, even when thecontent can be linked to intraoperative events, dreamsare not necessarily unpleasant.5

INDUCTION OF ANESTHESIAMonitoring cerebral function to detect awareness

has advanced considerably in recent years, but theperfect monitor has yet to be developed. The mostwidely studied brain function monitor, Bispectral In-dex (BIS) monitoring, is easy to initiate but even rapidapplication may delay delivery of the fetus in anemergency cesarean delivery. A BIS monitor was usedin 32% of 1095 general anesthetics studied as part ofthe ANZCA trial. Of note, 30% of Category 1* and 37%of Category 4* cesarean deliveries were monitored.8

Clearly, the limiting factor in the use of monitoring

was not the urgency of the procedure. Another con-sideration is whether, within the context of an emer-gency cesarean delivery, a BIS score target �60 isattainable predelivery. When the target anestheticconcentration is 0.8 MAC or above, it seems that meanBIS scores �60 can be achieved,11,12 but without acommitment to this level of volatile anesthetic deliv-ery at the outset, the rationale for BIS monitoring islost. Intraoperative brain function monitoring duringcesarean delivery has yet to become a mandatoryrequirement by any governing or regulatory agency.

The risk of recall is increased with a rapid sequenceinduction of anesthesia as tracheal intubation andsurgical incision follow in rapid sequence. There maybe insufficient time to allow adequate uptake anddistribution of volatile anesthetic to prevent aware-ness12 before redistribution causes brain levels of theinduction drug to decrease. The choice and dose ofinduction drug then becomes critical. Many regardthiopental as the drug of choice but a single inductiondose is soon redistributed with rapid recovery ofconsciousness. Recommended doses range from 3 to 7mg/kg; in the ANZCA Trial the mean dose was 4.9mg/kg.8,13–17 Not surprisingly, larger doses of hyp-notic drug result in a lower incidence of recall.5 Thewide variation in recommended dose may reflect howanesthesiologists view their role in the conflict be-tween fetal drug transmission and maternal comfort.There is general agreement that doses �4 mg/kg areunlikely to lead to fetal depression, and that doses inexcess of 7 mg/kg are liable to do so.1 The degree ofconcern for maternal awareness might be expected todecide where, between those limits, the choice lies. Atlow doses, thiopental is mildly amnesic18 but it doesnot produce retrograde amnesia.19

Although thiopental remains the drug of choice, anew generation of anesthesiologists is largely un-trained in its use. Propofol is now the most widelyused IV drug in anesthesia but there are concerns overits capacity to produce neonatal depression and ad-equate depth of anesthesia. Celleno et al. examined thematernal electroencephalogram with either thiopental5 mg/kg or propofol 2.4 mg/kg. Half of the propofolgroup had rapid low voltage (8–9 Hz) waves on theirelectroencephalogram suggestive of a light plane ofanesthesia compared with 10% of the thiopentalgroup.20 Another disadvantage of propofol is its longeffect-site equilibration time, which slightly prolongsthe period from injection to hypnosis. Other studieshave provided no evidence for the superiority ofthiopental compared with propofol.21 However, se-vere maternal bradycardia has been reported withpropofol combined with succinylcholine.22 Propofolhas a greater amnesic effect than thiopental23 throughinterference with long-term memory.24 Althoughthere are no data on which dose is best to avoidawareness, 2.5 mg/kg is commonly used.25 World-wide, there is little doubt that propofol is used for

*Category 1: emergency cesarean delivery indicated because ofpresence of condition which is of immediate threat to the life of thewoman or fetus; Category 4: elective procedure, cesarean deliverycan be scheduled to suit the woman and staff.

Table 1. Terminology of Awareness37,44

Consciousness State in which information frompatient’s surroundings can beprocessed

Recall Ability to retrieve stored memoriesAmnesia Absence of recall. Event not

retained in long-term memoryWakefulness/

responsivenessUnequivocal communication with

an anesthetized patient withoutsubsequent recall

Explicit memory Recall of specific intraoperativeclinical events

Priming Presentation of material to ananesthetized patient

Learning Evidence of communication ordetection of priming throughpostoperative tests but withoutrecall

Implicit memory Postoperative evidence of primingbut without recall


cesarean delivery despite these concerns and, to date,without the accumulation of adverse reports.8,23

Ketamine is used as an induction drug �2% of thetime.8 It is associated with less responsiveness andrecall than thiopental when used at a dose of 1mg/kg,26 but the sympathomimetic effects limit itsuse in preeclampsia, and when there are concernsabout hypertension. The associated hallucinations andemergence phenomena are another problem, althoughboth are dose related and possibly occur less fre-quently in obstetric patients.27 Ketamine may be of useto reduce hypotension at induction in the setting ofhemodynamic instability.

Benzodiazepines are used infrequently as sole induc-tion drugs, although they may be used occasionally tosupplement an induction sequence.8 Midazolam pro-duces more profound amnesia than propofol,28 impair-ing both explicit and implicit memory,29 but the onset ofhypnosis is slow and neonatal depression is slow toresolve. It does not produce retrograde amnesia.28

MAINTENANCE OF ANESTHESIAThe rapid redistribution of induction drugs under-

lines the importance of introducing an adequate vola-tile anesthetic as soon after induction as is practical. Insome centers, the skin is prepared and the drapesapplied before induction of anesthesia. Although thismight be in the best interests of a fetus in need ofimmediate delivery, emergency surgery and inad-equate uptake of the volatile anesthetic are known riskfactors for awareness.12 Depth of anesthesia can beconsidered in terms of the MAC that is required toachieve anesthesia in 50% of the patients. MAC may bereduced in pregnancy by 25%–40%, possibly because ofincreased pain thresholds or analgesia administered inlabor. Lower BIS scores were observed for similar anes-thetic concentrations in pregnant compared with non-pregnant patients.† A comparison between parturientswith and without prior labor undergoing cesarean de-livery found that prior labor was associated with lowerintraoperative BIS values during sevoflurane/nitrousoxide general anesthesia.30

The rapid uptake of nitrous oxide makes it a usefuladjunct despite being a weak anesthetic. The choice ofconcentration is secondary to that of the inspiredoxygen requirement. The administration of 100% oxy-gen may improve 1-min Apgar scores31 but oxygen-free radicals have been detected in newborns aftermaternal administration of high oxygen concentra-tions,32 and resuscitation of neonates with oxygen wasassociated with poorer Apgar scores than air.33 Acommon recommendation is that 50% oxygen shouldbe given,13,15–17 but 33% has been shown to result insimilar outcome provided there is no fetal compro-mise.34 Nitrous oxide has little influence on monitors

of cerebral function35,36 but a concentration of 70%contributes around 0.5 MAC and, if less is given, acorresponding increase in volatile anesthetic is neededto compensate.

Several textbooks recommend that the MAC ofvolatile drug administered predelivery should be ap-proximately 0.51,15 despite evidence that this policy isassociated with an incidence of awareness close to1%.5 This finding is consistent with predelivery BISscores at 0.5 MAC in 50% nitrous oxide that rangebetween 57 and 64.12 In a small sample, anesthesiawith 0.2% end-tidal isoflurane in 50% nitrous oxidegave BIS scores between 70 and 80 with evidence oflearning but not spontaneous recall.37 When MAC wasincreased to 0.8 in nonobstetric patients, BIS scoresbetween 40 and 60 were achieved but the incidence ofawareness was still 0.21%.38 One point to consider iswhether the target MAC should represent the MACfor the volatile drug alone or include the contributionof nitrous oxide. Because the effect of nitrous oxide onmemory is uncertain, prudent advice would be toregard the target MAC as that of the volatile drugalone.39 However, increasing the concentration of thevolatile drug introduces a new conflict as all volatiledrugs are tocolytic and uterine contractility and tonedecrease in a dose-dependent manner. The uterus willcontract in response to oxytocin, however, providedMAC is �0.8–1.0.40 These operational limits shouldprovide sufficient scope for adequate anesthesia with-out penalty.

In pregnancy, reduced functional residual capacityand increased minute ventilation increase the rate ofequilibration of blood and inspired concentration ofthe volatile anesthetic, although the pregnancy-induced increase in cardiac output counteracts this tosome degree. Equilibration between inspired andbrain concentrations may take 4–12 min depending onthe volatile anesthetic. Uptake of volatile anesthetictherefore needs to be accelerated. McCrirrick et al.41

described an overpressure technique with initialvaporizer settings in excess of MAC to speed equili-bration, but measurement of end-tidal vapor concen-trations has offered a more dynamic approach. Indeed,investigators found no difference in the incidence ofrecall when noncesarean patients were randomized toadjustment of the vaporizer setting to deliver a targetend-tidal concentration or BIS monitoring with atarget BIS score �60.38 Unfortunately, because thisstudy was underpowered, equivalence between thetwo techniques cannot be assumed. Isoflurane andsevoflurane are favored because of rapid uptake; forthe former, the target end-tidal concentration shouldbe in excess of 0.7%,11 and for the latter, an end-tidalconcentration of 1.5% achieved mean predelivery BISscores of �60.12

After delivery, the concentration of nitrous oxidemay be increased and opioids may be administered.This will result in a reduction in reflex activity but notnecessarily a reduction in the incidence of recall. The

†Gin T, Chan MTV. Pregnancy reduces the bispectral indexduring isoflurane anesthesia (abstract). Anesthesiology 1997;87:A305.

888 Awareness During Cesarean Delivery ANESTHESIA & ANALGESIA

volatile anesthetic should be continued until comple-tion of the operation, but in the event of uterine atony,it can be reduced and a small dose of midazolam orketamine substituted. Suggested techniques to reducethe risk of awareness during cesarean delivery aresummarized in Table 2.

BRAIN FUNCTION MONITORINGRoutine brain function monitoring of patients under-

going general anesthesia is controversial, although inone study, it was shown to result in an 82% reduction inthe incidence of awareness in patients undergoing pro-cedures considered at high risk for awareness, includingcesarean delivery.9 However, a low BIS score does notguarantee unconsciousness.42 Whether routine monitor-ing of brain function in the specific setting of generalanesthesia for cesarean delivery can reduce the incidenceof awareness has not been studied.

THE FETUSCatecholamine secretion during light anesthesia

promotes uterine vasoconstriction and tocolysis. De-pressant effects from transplacental drug transmissionare usually responsible for a lower 1-min Apgar scorein neonates after general anesthesia compared withneuraxial techniques, but by 5 min, differences havelargely disappeared. Provided neonatal resuscitativesupport is available, the effects of general anesthesiaare wholly reversible and the uterine incision todelivery time is more important than the induction todelivery time for good neonatal outcome. Evidence islacking that an awareness avoidance approach togeneral anesthesia has untoward neonatal effects be-yond the first few minutes of life.

AVOIDING LITIGATIONIntraoperative awareness is one of several major

patient concerns when undergoing general anesthesia;Klafta and Roizen43 showed that up to 54% of patientsworry about the possibility of pain, paralysis, andmental distress during surgery. Current advice is thatpatients considered to be high risk should be informedof the possibility of awareness, when circumstancespermit.44 It may not be appropriate to do this beforean emergency cesarean delivery when anxiety can beextreme. When possible, a preoperative discussion

may help align expectation with experience and re-duce the risk of litigation.45

When awareness occurs, a full account with precisedetails should be recorded in the medical record forfuture reference. An apology costs nothing and mightavert legal proceedings; denial is unhelpful. Symp-toms consistent with posttraumatic stress disorder,sleep disturbance, nightmares, irritability, and lack ofconcentration that can interfere with work, may fol-low. Counseling is recommended, but its efficacy isunknown. The anesthesiologist may also be distressedby the incident.46

Hull and Thorburn47 believe that awareness cannotoccur without negligence and equated light anesthesiawith inadequate anesthesia. An analysis of 81 inci-dents of awareness found that 32 occurred because ofavoidable drug and equipment errors.46 The alterna-tive view is that a low incidence of awareness duringgeneral anesthesia for cesarean delivery is unavoid-able, but the difficulty of mounting a successful de-fense is acknowledged.47

REFERENCES

1. Crawford JS. Principles and practice of obstetric anaesthesia. 5thed. Oxford: Blackwell Science, 1984

2. Hamer Hodges RJ, Bennet JR, Tunstall ME, Knight RF. Generalanaesthesia for operative obstetrics. Br J Anaesth 1959;31:152–63

3. Crawford JS. Awareness during operative obstetrics undergeneral anaesthesia. Br J Anaesth 1971;43:179–82

4. Moir DD. Anesthesia for Caesarean section: an evaluation of amethod using low concentration of halothane and 50 percent ofoxygen. Br J Anaesth 1970;42:136–42

5. Lyons G, Macdonald R. Awareness during Caesarean section.Anaesthesia 1991;46:62–4

6. Sebel PS. The incidence of awareness during anesthesia: amulticenter United States study. Anesth Analg 2004;99:833–9

7. Sandin R, Enlaund G, Samuelson P, Lennmarken C. Awarenessduring anaesthesia: a prospective case study. Lancet 2000;355:707–11

8. Paech MJ, Scott KL, Clavisi O, Chua S, McDonnell N. TheANZCA Trials Group. A prospective study of awareness andrecall associated with general anaesthesia for caesarean section.Int J Obstet Anesth 2008;17:298–303

9. Myles PS, Leslie K, McNeil J, Forbes A, Chan MTV. Bispectralindex monitoring to prevent awareness during anaesthesia: theB-Aware randomised controlled trial. Lancet 2004;363:1757–63

10. Leslie K, Skrzypek H, Paech MJ, Kurowski I, Whybrow T.Dreaming during anesthesia and anesthetic depth in electivesurgical patients: a prospective cohort study. Anesthesiology2007;106:33–42

11. Yeo SN, Lo WK. Bispectral index in assessment of adequacy ofgeneral anaesthesia for lower segment caesarean section. An-aesth Intensive Care 2002;30:36–40

12. Chin K, Yeo S. Bispectral index values at sevoflurane concen-trations of 1% and 1.5% in lower segment cesarean delivery.Anesth Analg 2004;98:1140–4

13. Malinow AM. General anesthesia for cesarean delivery. In:Norris MC, ed. Obstetric anesthesia. 2nd ed. Philadelphia:Lippincott Williams & Wilkins 1998;375–98

14. Kuczkowski KM, Reisner LS, Liu D. Anesthesia for cesareansection. In: Chestnut DH, ed. Obstetric anesthesia, principlesand practice. 3rd ed. Philadelphia: Mosby Elsevier 2004;421–46

15. Biribo MA. Anesthesia for cesarean section. In: Birnbach D, GattS, Datta S, eds. Textbook of obstetric anesthesia. Philadelphia:Churchill Livingstone 2000;239–44

16. Paech MJ General anesthesia for cesarean section. In: PalmerCM, D’Angelo R, Paech MJ, eds. Handbook of obstetric anes-thesia. Oxford: Bios 2002;105–13

17. Yentis S, May A, Malhotra S. Analgesia, anaesthesia and preg-nancy. 2nd ed. Cambridge: Cambridge University Press, 2007

Table 2. Techniques to Avoid Awareness

Beware drug and equipment errorsBrain function monitoring (e.g., Bispectral Index

monitoring to achieve scores �60)Thiopental dose 5–7 mg/kgTarget end-tidal volatile anesthetic monitoring to achieve

concentration �0.8 MACa

Highest concentration of nitrous oxide compatible withmaternal and fetal oxygen requirements

Opioid analgesia after deliveryConsider benzodiazepines after deliverya There is no evidence of fetal morbidity with increased depth of anesthesia.


18. Veselis RA, Reinsel R, Feschenko VA, Wronski M. The compara-tive amnesic effects of midazolam, propofol, thiopental andfentanyl at equisedative concentrations. Anesthesiology 1997;87:749–64

19. Dundee JW, Pandit SK. Studies on drug induced amnesia withintravenous anaesthetic agents in man. Br J Clin Pract 1972;26:164–6

20. Celleno D, Capogna G, Tomassetti M, Costantino P, Di Feo G,Nisini R. Neurobehavioural effects of propofol on the neonatefollowing elective caesarean section. Br J Anaesth 1989;62:649–54

21. Gin T, O’Meara ME, Kan AF, Leung RKW, Tan P, Yau G. Plasmacatecholamines and neonatal condition after induction of anaes-thesia with propofol or thiopentone at Caesarean section. Br JAnaesth 1993;70:311–6

22. Baraka A. Severe bradycardia following propofol-suxamethoniumsequence. Br J Anaesth 1988;61:482–3

23. Duggal K. Propofol should be the induction agent of choice forcaesarean section under general anaesthesia. Int J Obstet Anesth2003;12:275–9

24. Polster MR, Gray PA, O’Sullivan G, McCarthy RA, Park GR.Comparison of the amnesic effects of midazolam and propofol.Br J Anaesth 1993;70:612–6

25. Dailland P, Cockshott ID, Lirzin JD, Jacquinot P, Jorrot JC,Devery J, Harmey JL, Conseiller C. Intravenous propofol duringcesarean section: placental transfer, concentrations in breastmilk and neonatal effects. A preliminary study. Anesthesiology1989;71:827–34

26. Baraka A, Louis F, Noueihid R, Diab M, Dabbous A, Sibai A.Awareness following different techniques of general anesthesiafor Caesarean section. Br J Anaesth 1989;62:645–8

27. Shulterus R, Hill C, Dharamraj C, Banner T, Berman L. Wake-fulness during cesarean section after anesthetic induction withketamine, thiopental, or ketamine and thiopentone combined.Anesth Analg 1986;65:723–8

28. Ghoneim MM, Block RI, Sum Ping ST, El-Zahaby HM, HinrichsJV. The interactions of midazolam and flumazenil on humanmemory and cognition. Anesthesiology 1993;79:1183–92

29. Bulach R, Myles PS, Russnak M. Double-blinded randomizedcontrolled trial to determine extent of amnesia with midazolamgiven immediately before general anaesthesia. Br J Anaesth2005;94:300–5

30. Yoo KY, Jeong CW, Kang MW, Kim SJ, Chung ST, Shin MH, LeeJ. Bispectral index values during sevoflurane-nitrous oxidegeneral anesthesia in women undergoing cesarean delivery: acomparison between women with and without prior labor.Anesth Analg 2008;106:1827–32

31. Piggott SE, Bogod DG, Rosen M, Rees GAD. Isoflurane witheither 100% oxygen or 50% nitrous oxide in oxygen for caesar-ean section. Br J Anaesth 1990;61:255–62

32. Khaw KS, Wang CC, Ngan Kee W, Pang CP, Rogers MS. Theeffects of high inspired oxygen fraction during elective caesar-ean section under spinal anaesthesia on maternal and fetaloxygenation and lipid peroxidation. Br J Anaesth 2002;88:18–23

33. Saugstad OM, Rootwelt T, Aalen O. Resuscitation of asphyxi-ated newborn infants with room air or oxygen: an internationalcontrolled trial: the Resair 2 Study. Pediatrics 1998;102:e1

34. Lawes EG, Newman B, Campbell MJ, Irwin M, Dolenska S,Thomas TA. Maternal inspired oxygen concentration and neo-natal status for caesarean section under general anaesthesia.Comparison of effects of 33% or 50% oxygen in nitrous oxide.Br J Anaesth 1988;61:250–4

35. Barr G, Jakobsson JG, Owall A, Anderson RE. Nitrous oxidedoes not alter bispectral index: a study with nitrous oxide assole agent and as adjunct to intravenous anaesthesia. Br JAnaesth 1999;82:827–30

36. Anderson RE, Jakobsson J. Entropy of EEG during anaestheticinduction: a comparative study with propofol or nitrous oxideas sole agent. Br J Anaesth 2004;92:167–70

37. Lubke G, Kerssens C, Gershon R, Sebel P. Memory formationduring general anesthesia for emergency cesarean sections.Anesthesiology 2000;92:1029–34

38. Avidan MS, Zhang L, Burnside BA, Finkel J, Searleman AC,Selvidge JA, Saager L, Turner MS, Rao S, Bottros M, Hantier C,Jacobsohn E, Evers AS. Anesthesia awareness and the bispectralindex. N Engl J Med 2008;358:1097–108

39. Sneyd JR, Mathews DM. Memory and awareness during anaes-thesia. Br J Anaesth 2008;100:742–3

40. Yildiz K, Dogru K, Dalgic H, Serin IS, Sezer Z, Madenoglu H,Boyad A. Inhibitory effects of desflurane and sevoflurane onoxytocin-induced contractions of isolated pregnant humanmyometrium. Acta Anaesthesiol Scand 2005;49:1355–9

41. McCrirrick A, Evans GH, Thomas TA. Overpressure isofluraneat caesarean section: a study of arterial isoflurane concentra-tions. Br J Anaesth 1994;72:122–4

42. Mychaskiw G, Horowitz M, Sachdev V, Heath BJ. Explicitintraoperative recall at a bispectral index of 47. Anesth Analg2001;92:808–9

43. Klafta JM, Roizen M. Current understanding of patients’ atti-tudes toward and preparation for anaesthesia: a review. AnesthAnalg 1996;83:1314–21

44. American Society of Anesthesiologists Task Force on Intraopera-tive Awareness. Practice advisory for intraoperative awarenessand brain function monitoring. Anesthesiology 2006;104:847–64

45. Guerra F. Awareness during anaesthesia. Can Anaesth Soc J1980;27:178

46. Bergman IJ, Kluger MT, Short TG. Awareness during generalanaesthesia: a review of 81 cases from the Anaesthetic IncidentMonitoring Study. Anaesthesia 2002;57:549–56

47. Hull C, Thorburn J. Controversies: awareness is due to negli-gence during general anaesthesia for Caesarean section. Int JObstet Anesth 1997;6:178–80

890 Awareness During Cesarean Delivery ANESTHESIA & ANALGESIA

Economics, Education, and PolicySection Editor: Franklin Dexter

Anesthesiologists with Substance Use Disorders: A 5-YearOutcome Study from 16 State Physician Health Programs

Gregory E. Skipper, MD*

Michael D. Campbell, PhD†

Robert L. DuPont, MD†

BACKGROUND: Anesthesiologists have a higher rate of substance use disorders than otherphysicians, and their prognoses and advisability to return to anesthesiology practice aftertreatment remain controversial. Over the past 25 yr, physician health programs (PHPs),created under authority of state medical regulatory boards, have become primary re-sources for management and monitoring of physicians with substance abuse and othermental health disorders.METHODS: We conducted a 5-yr, longitudinal, cohort study involving 904 physiciansconsecutively admitted to 1 of 16 state PHPs between 1995 and 2001. This report analyzeda subset of the data involving the 102 anesthesiologists among the subjects and comparedthem with other physicians. The main outcome measures included relapse (defined as anyunauthorized addictive substance use, including alcohol), return to anesthesiology prac-tice, disciplinary actions, physician death, and patient harm.RESULTS: Anesthesiologists were significantly less likely to enroll in a PHP because ofalcohol abuse (odds ratio [OR] 0.4 [confidence interval {CI}: 0.2–0.6], P � 0.001) and muchmore likely to enroll because of opioid abuse (OR 2.8 [CI: 1.7–4.4], P � 0.001). Anesthesi-ologists had a higher rate of IV drug use, 41% vs 10% (OR 6.3 [CI: 3.8–10.7], P � 0.001).During similar periods of monitoring, anesthesiologists received more drug tests, 101 vs 82(mean difference � 19 [CI: 3–35], P � 0.02); however, anesthesiologists were less likely tofail at least one drug test during monitoring, 11% vs 23% (OR 0.4 [CI: 0.2–0.9], P � 0.02).There was no statistical difference among rates of program completion, disciplinaryactions, return to practice, or deaths, and there was no report of significant patient harmfrom relapse in any record.CONCLUSIONS: Anesthesiologists in our sample treated and monitored for substancedisorders under supervision of PHPs had excellent outcomes similar to other physicians,with no higher mortality, relapse rate, or disciplinary rate and no evidence in their recordsof patient harm. It is postulated that differences of study design account for contradictoryconclusions from other reports.(Anesth Analg 2009;109:891–6)

Among physicians, anesthesiologists have an un-usually high incidence of substance use disorders. Forexample, a survey of 260 anesthesiologists from theMedical College of Wisconsin graduating between1958 and 1988 reported that 32% used drugs to “get

high” and 15.8% had been drug dependent.1 Physicianhealth programs (PHPs) are specialized programsgranted authority in most states by regulatory boards tomanage and monitor physicians after treatment for sub-stance use disorders and other problems.2 Anesthesiolo-gists are consistently overrepresented (approximately 2.5times the rate of the average physician) in reports fromthese programs3,4 and similarly over-represented in sub-stance abuse treatment centers that specialize in treat-ment of physicians.5 Underwriters have identified suchhigh rates of substance abuse among anesthesiologiststhat some disability insurance companies no longerinsure anesthesiologists.6

Most physicians managed and monitored by PHPshave reported 75%–90% success rates 5 or more yearsafter treatment for substance use disorders;7,8 how-ever, there is controversy regarding anesthesiologists’prognoses, especially concerning risk of returning toanesthesiology practice.9 A recent editorial suggestedthat substance-abusing anesthesiologists should notbe permitted to return to anesthesiology practice aftertreatment for substance use disorders even with strictmonitoring.10 This attitude springs in part from asurvey by Menk et al.,9 which reported poor outcomes

From the *Departments of Medicine and Psychiatry, Universityof Alabama School of Medicine, Montgomery, Alabama; and†Institute for Behavior and Health, Rockville, Maryland.

Supported by the Robert Woods Johnson Foundation.All authors participated in study design, implementation, and

writing and editing the article. Skipper had full access to all of the datain the study and takes responsibility for the integrity of the data andthe accuracy of the data analysis. Skipper and DuPont were paid asCo-Principal Investigators and Campbell was paid by the Institute forBehavior and Health to assist in study design, statistical analysis, andreview. Skipper is the medical director of the Alabama PhysicianHealth Program. Neither DuPont nor Campbell have any affiliationwith Physician treatment or Physician Health Programs. A. ThomasMcLellon, PhD, was the recipient of the grant and contributed signifi-cantly to development and implementation of the larger study. Asteering committee of the Federation of State Physician Health Pro-grams oversaw the larger study design, implementation, and interpre-tation and reviewed this article for comment.

Address correspondence and reprint requests to Gregory E.Skipper, MD, 19 S Jackson St., Montgomery, AL 36117. Addresse-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181adc39d


for substance-abusing anesthesiology residents: only a34% successful reentry for those using parenteralopioids and 26 deaths (14% of the 180 reported cases),half attributed to drug relapse. A similarly designedbut more recent survey of anesthesiology trainingprogram directors regarding substance-abusing resi-dents between 1991 and 2001 reported comparablypoor findings, noting a lower but still significant deathrate (9%).11 In contrast are studies from PHPs report-ing good outcomes for anesthesiologists, comparablewith other physicians, with low risk of suicide andlow risk of patient harm.2,3,12

This study is the first long-term outcome reportbased on actual data from records of anesthesiologistsfrom a cross-section of 16 state monitoring programsreviewed 5 or more years after treatment for substanceuse disorders.

METHODSDesign

The study used the dataset from a 5-yr, longitudi-nal, cohort study reported previously, involving 904physicians with diagnoses of substance abuse or de-pendence consecutively admitted to 1 of 16 state PHPsbetween 1995 and 2001.13 The characteristics andoutcomes of a subset of 83 anesthesiologists werecompared with those of nonanesthesiologists. We re-stricted the comparisons with objective data fromofficial records (for example, treatment services, atten-dance, sanctions by the program, reports to licensingboards) and from laboratory records (urine tests andother specimens). To protect the confidentiality of thephysicians, members of each program’s medicalrecords department collected the data. Data werecollected between November 2006 and January 2007under training, supervision, and monitoring by theauthors. All components of this study were reviewedand approved by the IRB of the Treatment ResearchInstitute.

Participant SampleOf the 904 participants in the original study, 42

(4.6%) were residents, all of whom were excludedfrom this study because they constituted a populationof physicians who were both younger than the aver-age practicing physician and therefore at higher risk ofsubstance abuse; although there were no significantdifferences between residents and practicing physi-cians (including anesthesiology residents) on any out-come variables measured, their numbers were deemedtoo small to be conclusive. Residents excluded fromthe study included 6 in anesthesiology training pro-grams and 36 in other specialties.

Of the remaining 862 participants, 96 (11.1%) wereanesthesiologists. At the time these participants en-rolled in PHPs, anesthesiologists comprised 4.1% ofthe approximately 749,000 physicians (excluding resi-dents) providing patient care in the United States.14

The overrepresentation of anesthesiologists in theparticipant sample (odds ratio [OR] 2.9 [confidenceinterval {CI}: 2.4–3.6], P � 0.001) is consistent withfindings from previous studies of physician enroll-ment in substance abuse treatment programs.5

Lost to Follow-UpDuring the study period, 82 of the 862 participants

(9.5%) moved out of their state program’s jurisdiction.We had no access to any continuing records for thoseparticipants and so they were not included in theanalyses for this study. Those lost to follow-up in-cluded 13 anesthesiologists and 69 nonanesthesiolo-gists.* We therefore performed analyses comparing 83anesthesiologists with 697 nonanesthesiologists forwhom 5 yr of follow-up data were available.

Statistical AnalysisSPSS for Windows version 15 was used for the

analyses. Demographic and outcome variables foranesthesiologists and nonanesthesiologists were ana-lyzed using �2 and t-test statistics for comparisons ofproportions and means, respectively. Univariate (un-adjusted) ORs with 95% CIs were computed to com-pare the two physician groups on selected binomialcharacteristics and outcomes. In addition, binary lo-gistic regression analysis was used to produce ad-justed multivariate ORs for the two groups on thesame variables, controlling for the effects of year ofenrollment and program location. Because the CIs forthe adjusted and unadjusted ORs were essentiallyunchanged, it was concluded that there was effectivehomogeneity by time and location. Therefore, the ORspresented in the Results section are the unadjustedunivariate ORs, and the P values are by Fisher’s exacttest. The adjusted multivariate ORs and P values areprovided in Table 3.

RESULTSThe study was based on treatment records from 16

programs that had previously participated in a surveyof 42 PHPs conducted by the authors. That originalstudy described the structure, function, funding, andoverall characteristics of the PHPs as well as theintervention, evaluation, referral for treatment, andmonitoring activities after the treatment was pro-vided. The 26 PHPs that did not participate in recordreview were contacted, and all claimed lack of re-sources and/or regulatory impediments as the reasonfor declining to participate. The programs that did anddid not participate in the follow-up study were not

*Comparisons between those lost to follow-up and those retainedin the study revealed no significant differences between groups ongender, age, primary substance of abuse at admission, history of priortreatment, or treatment participation status (mandatory versus volun-tary). Among those lost to follow-up, there were no significant differ-ences between anesthesiologists and nonanesthesiologists on thesesame variables. Over half of the anesthesiologists (54%) and thenonanesthesiologists (68%) who could not be followed for 5 yr hadtransferred in good standing to PHPs in other states.

892 Anesthesiologists with Substance Use Disorders ANESTHESIA & ANALGESIA

statistically or clinically significantly different forevaluation, referral, treatment, supervision, support,and monitoring practices. The 16 participating pro-grams tended to be large: 31% were in the largestquarter of programs. The mean number of physiciansin each program was 56 (range, 11–119). Althoughthese 16 programs may not be considered nationallyrepresentative, they showed no obvious clinical, ad-ministrative, or organizational differences from thosenot participating.

The 780 participants in this study (83 anesthesiologistsand 697 other physicians) were distributed among the 16programs so that, on average, there were 5 anesthesiolo-gists (range, 1–12) and 44 nonanesthesiologists (range,6–95) per PHP. Anesthesiologists did not constitutemore than 17% of the participants in any of the 16programs.

Descriptive characteristics of anesthesiologists andnonanesthesiologists are presented in Table 1. Onaverage, program enrollees were in their forties withmales comprising 86% of each group. The majority ofphysicians in both groups, approximately 58%, weremandated to participate in the program. According tointake records, 30% of anesthesiologists and 39% of

the other physicians had a history of treatment forsubstance use when they enrolled in the program. Ineach group, about 90% of enrollees signed a 5-yrdependence agreement, indicating that a diagnosis ofsubstance dependence had been made and the physi-cian agreed to be monitored for at least 5 yr. Theothers signed a diagnostic monitoring agreement,which is a more limited and shorter-duration agree-ment used when a diagnosis of substance dependencewas not made.

The two groups differed regarding the primarysubstance of abuse as recorded in their intake records:the majority of nonanesthesiologists (52%) were en-rolled because of alcohol-related problems, whereasfor most anesthesiologists (55%) the primary drug ofabuse was an opioid. Thus, anesthesiologists weresignificantly less likely than their peers to enroll in aPHP because of alcohol abuse (OR 0.4 [CI: 0.2–0.6],P � 0.001) and much more likely to enroll because ofabuse of opioids (OR 2.8 [CI: 1.7–4.4], P � 0.001).Another significant difference between the groupswas that 41% of the anesthesiologists had a history ofIV drug use compared with 10% of the nonanesthesi-ologists (OR 6.3 [CI: 3.8–10.7], P � 0.001).

Table 1. Characteristics of Anesthesiologists and Other Physicians Participating in State Physician Health Programs for SubstanceUse Disordersa

Characteristic Anesthesiologists (n � 83) Other physicians (n � 697) P*Age at enrollment

Mean � sd 42 � 6 45 � 9 �0.01Range 26–60 27–75

GenderMale 71 (86) 599 (86) 0.87Female 12 (14) 95 (14)

Enrollment statusMandatory 49 (59) 393 (57) 0.73Voluntary 34 (41) 303 (43)

History of treatmentYes 25 (30) 273 (39) 0.12No 58 (70) 422 (61)

Type of agreementDependence (5 yr) 76 (92) 611 (88) 0.37Diagnosis/abuse 7 (8) 86 (12)

Primary drug of abuseAlcohol 23 (28) 361 (52)Opioids 46 (55) 217 (32)Stimulants 7 (8) 50 (7) �0.01Sedatives 2 (2) 25 (4)Other 5 (6) 36 (5)

IV drug use historyYes 32 (41) 64 (10) �0.001No 46 (59) 584 (90)

Number of substancesSingle 43 (52) 339 (49) 0.63Multiple 40 (48) 358 (51)

Months in testing periodMean � sd 49 � 22 47 � 26 0.50Range 2–82 0–155

Number of testsMean � sd 101 � 72 82 � 68 0.02Range 2–384 1–435

a Values are number (percentage) unless otherwise indicated.* From t-test for independent means or �2 test for comparison of proportions (two-tailed) as appropriate.


Random drug testing was required of the physi-cians participating in the programs. Data presented inTable 1 show that both the anesthesiologists and theother physicians were subject to testing for an averageperiod of about 48 mo. During this time, the meannumber of tests (101) administered to anesthesiolo-gists was higher than the number (82) administered tononanesthesiologists; however, because the CI for themean difference between the groups was large (meandifference � 19 [CI: 3–35], P � 0.02), it cannot beconcluded that anesthesiologists were routinely testedmore frequently than other physicians.

Table 2 compares anesthesiologists and nonanes-thesiologists on primary outcome measures examinedin this study: positive drug tests during monitoring,physicians reported to the licensing board, programstatus at 5-yr follow-up, occupational status at follow-up, and deaths. The PHP records, which chronicledeach instance in which a program participant testedpositive for drugs, revealed that 11% of anesthesiolo-gists had at least one positive test compared with 23%of nonanesthesiologists. Although this difference wasstatistically significant, examination of the OR indi-cated a wide CI with the upper bound approaching 1(OR 0.4 [CI: 0.2–0.9], P � 0.02). Therefore, we cannotreport with confidence that anesthesiologists were lesslikely than other physicians to test positive for drugs.Approximately 20% of the participants in both groupswere reported to their state licensing agencies becauseof noncompliance with the terms of the PHP agree-ment or relapse.

At the end of the 5-yr follow-up period, 71% ofanesthesiologists and 64% of nonanesthesiologists hadcompleted their contracts and were no longer required tobe monitored (OR 1.4 [CI: 0.9–2.3], P � 0.23). Another18% of anesthesiologists and 16% of nonanesthesiolo-gists had their contracts extended beyond the initialmonitoring period (OR 1.2 [CI: 0.6–2.1], P � 0.64). The

reasons for continued monitoring included relapse,failure to comply with requirements, such as groupattendance or therapy, or, in some cases, voluntarycontinuance to help prevent relapse and/or demonstratecontinued recovery to others. Although a larger propor-tion of nonanesthesiologists (20%) failed to complete theprogram than anesthesiologists (9%), the odds of failingto complete were not significantly smaller for anesthesi-ologists (OR 0.5 [CI: 0.2–1.0], P � 0.05). These resultsindicate that anesthesiologists were no more likely thanother physicians to complete the program, to fail tocomplete, or to extend the monitoring period beyond theoriginal 5 yr specified in their agreements.

The final outcome examined was participants’ occu-pational status at follow-up. As shown in Table 2, therewere no overall differences between the two groups inthe distribution of participants among the various occu-pational status categories used in the study. A primarycategory of interest was the extent to which physicianswho had participated in the programs were licensed andpracticing medicine at the 5-yr follow-up. The studyfound that the proportion of anesthesiologists (76%)continuing their medical practice was not significantlydifferent than that for nonanesthesiologists (73%) (OR1.2 [CI: 0.7–2.0], P � 0.60). Additionally, there were nostatistically significant differences between anesthesiolo-gists and nonanesthesiologists in regard to the percent-age who had their licenses revoked or the percentagereported to have died (Table 3).

The record review sought evidence of any patientharm associated with relapse. None was detected inthis cohort of anesthesiologists.

DISCUSSIONAs in other studies, anesthesiologists were signifi-

cantly overrepresented, further documenting a re-ported higher rate of substance abuse of 2–2.7 times

Table 2. Drug Testing Outcomes and Program and Occupational Status of Anesthesiologists and Other Physicians at 5-yr or MoreFollow-Up from Signing a Monitoring Contract with a State Physician Health Program for Substance Use Disordersa

Outcome Anesthesiologists (n � 83) Other physicians (n � 697) P*Positive drug test

Yes 9 (11) 156 (23) 0.02No 74 (89) 534 (77)

Reported to boardYes 15 (18) 140 (20) 0.77No 68 (82) 556 (80)

Program statusCompleted contract 59 (71) 445 (64) 0.09Contract extended 15 (18) 112 (16)Failed to complete 9 (11) 140 (20)

Occupational statusLicensed or practicing medicine 63 (76) 508 (73) 0.21Licensed or working (not clinical) 1 (1) 38 (6)Retired or left practice voluntarily 4 (5) 27 (4)License revoked 6 (7) 78 (11)Died 5 (6) 24 (3)Unknown 4 (5) 22 (3)

a Values are number (percentage).* From �2 test for comparison of proportions (two-tailed).


compared with other physicians. This finding hasbeen consistent throughout all reports.

Exploring the contradictory reports regarding prog-nosis for substance-abusing anesthesiologists, earlierstudies were essentially of two designs: survey studies oftraining program directors versus longitudinal studies ofanesthesiologists in monitoring by individual statePHPs. The survey studies,9,11 which reported muchpoorer outcomes, surveyed training program directorsregarding the number of residents encountered withsubstance disorders over the preceding 10 yr and theiroutcomes. Considering the tendency for confidentialhandling of this type of information, the data from thesereports were likely skewed toward poor outcomes, suchas relapse or death, which would less likely remainconfidential and more likely to be remembered. It wasalso noted in one of the survey studies that many of thetraining program directors’ tenure was less than the10-yr study period for which they were being asked torecall cases.

The reported numbers themselves from these sur-vey studies suggest that reports were not complete.For example, 31 of 230 physicians in the Collins et al.survey were “currently in active treatment” leading totheir finding of a 0.89% point prevalence of activeaddiction. Because drug treatment seldom lasts more

than 4 mo, it is reasonable to expect, from the cohort ofmore than 100 training programs, that approximately93 residents per year, or 930 per 10 yr, would betreated. Because only 230 cases were identified, thisrepresents only approximately 25% of the total ex-pected cases. In the Menk et al. survey of the 159anesthesia training programs in the United States, 113responded reporting 180 cases, an average of 1.6 casereports per responding program for a 10-yr period,clearly a smaller number than would be expected,again suggesting under-reporting.

Our data demonstrating similar or better outcomes(survival, total abstinence, completion of monitoring,return to work in profession, and retention of medicallicense) for anesthesiologists compared with otherspecialties are consistent with other outcome studiesfrom single PHP.3,4,12 Anesthesiologists received simi-lar treatment as other physicians under PHP care;however, their monitoring often had the followingadded features. 1) Witnessed naltrexone administra-tion. 2) Regular periodic hair testing, which is moreeffective than urine testing because fentanyl and simi-lar compounds are extremely short lived and are verydifficult to detect (a fact well known to anesthesiolo-gists). It is also more difficult to cheat on a hair test,adding to its value testing in a high-risk population.

Table 3. Selected Characteristics and Outcomes of Anesthesiologists and Other Physicians in State Physician Health Programs forSubstance Use Disorders, with Adjusted and Unadjusted Odds Ratiosa

Characteristic/outcomeAnesthesiologists

(n � 83)

Otherphysicians(n � 697)

Unadjustedunivariate odds

ratios

Adjustedmultivariate odds

ratios*

OR(95% CI) P

OR(95% CI) P

GenderMale 71 (86) 599 (86) 1.1 (0.6–2.0) 0.87 1.1 (0.5–2.0) 0.88

Primary drug of abuseAlcohol 23 (28) 361 (52) 0.4 (0.2–0.6) �0.001 0.4 (0.2–0.6) �0.001Opioids 46 (55) 217 (32) 2.8 (1.7–4.4) �0.001 2.9 (1.8–4.6) �0.001

IV drug use historyYes 32 (41) 64 (10) 6.3 (3.8–10.7) �0.001 5.7 (3.4–9.8) �0.001

Number of substancesMultiple 40 (48) 358 (51) 0.9 (0.6–1.4) 0.63 0.9 (0.6–1.4) 0.61

Prior treatmentYes 25 (30) 273 (39) 0.7 (0.4–1.1) 0.12 0.7 (0.4–1.1) 0.15

Enrollment statusMandatory 49 (59) 393 (57) 1.1 (0.7–1.8) 0.73 1.2 (0.8–2.0) 0.76

Positive drug testYes 9 (11) 156 (23) 0.4 (0.2–0.9) 0.02 0.4 (0.2–0.8) 0.01

Reported to boardYes 15 (18) 140 (20) 0.9 (0.5–1.6) 0.77 0.8 (0.5–1.5) 0.72

Program statusCompleted contract 59 (71) 445 (64) 1.4 (0.9–2.3) 0.23 1.5 (0.9–2.5) 0.17Contract extended 15 (18) 112 (16) 1.2 (0.6–2.1) 0.64 1.1 (0.6–2.1) 0.69Failed to complete 9 (11) 140 (20) 0.5 (0.2–1.0) 0.05 0.5 (0.2–0.9) 0.05

Occupational statusLicensed or practicing medicine 63 (76) 508 (73) 1.2 (0.7–2.0) 0.60 1.2 (0.7–2.1) 0.57License revoked 6 (7) 78 (11) 0.6 (0.3–1.5) 0.35 0.6 (0.2–1.4) 0.28Died 5 (6) 24 (3) 1.8 (0.7–4.8) 0.22 1.7 (0.6–4.7) 0.30

OR � odds ratio; CI � confidence interval.a Values are number (percentage); all odds ratios are anesthesiologists/other physicians.* Adjusted for year of enrollment and program location; Wald test P values for year and location were not significant at P � 0.05.


Periodic hair testing may more effectively discouragedrug use because those being monitored with hairtests know that any drug use will more likely bedetected. 3) Enhanced security measures in andaround the operating room to prevent diversion. (Be-ing careful with drug access and disposal by usingwitnesses, automated distribution devices, and moni-toring cameras, and spectrometric scanning of discardwastage.)

The earlier more pessimistic studies regardingthe ability of anesthesiologists to remain drug-freedid not note which, if any, subjects were in activePHP monitoring. Our study, in contrast, was limitedto the experiences of physicians in active PHP caremanagement, which included active monitoring us-ing more sophisticated means of detecting anyreturn to alcohol or other drug use and high qualityaddiction treatment, factors that possibly accountfor better outcomes. Additionally, the articles ofMenk and Collins involved anesthesiology residentsexclusively, whereas our study excluded residents.

We found no evidence indicating patient harm hadoccurred associated with any relapse. Although thevalue of this finding may be limited because data wererestricted to a review of anesthesiologist’s records, it isconsistent with the Domino et al. study, which foundno evidence of patient harm among 33 anesthesiolo-gists over 10 yr in Washington state.12 Sivarajan et al.15

examined data from the American Society of Anesthe-siology malpractice database seeking evidence of pa-tient harm from substance abuse. Of the 2715 closedanesthesia claims, in only 7 was substance abuse orchemical dependence noted by the anesthesiologyreviewer in the claim summary. Two of the sevencases involved nurse anesthetists who were abusingsubstances under the supervision of anesthesiologists.Three of the five claims in which a substance-abusinganesthesiologist delivered anesthesia care involvedserious patient harm (brain damage or death) becauseof lack of vigilance or judgment during anesthesia.Two of these three claims involved anesthesiologistswho were alcoholics and the third involved an anes-thesiologist who left the care of the patient to smoke acigarette. The two alcoholic anesthesiologists had beenunavailable to provide care: one because of alcoholintoxication and the other who left to attend rehabili-tation without providing backup care for a chronicpain patient. In summary, of 2715 malpractice claimsagainst anesthesiologists 5 involved substance-abusinganesthesiologists, 4 of whom were alcoholics and theother a smoker. No closed claims involving drug-addicted anesthesiologists were noted. This indi-cates a remarkably low rate of patient harm fromsubstance-abusing anesthesiologists. The special

stigma directed toward opiate-addicted anesthesi-ologists, especially those using IV opiates, does notappear to be warranted.

CONCLUSIONThis study supports the finding that anesthesiolo-

gists have a significantly higher rate of substanceabuse by a factor of 2.7–1 when compared with otherphysicians. Programs to prevent and/or detect sub-stance use in this relatively high-risk group wouldtherefore seem especially justified but have been al-most nonexistent.16

Although any incidence of overdose death or suicideis unacceptable, the rates of these phenomena were smalland not higher among anesthesiologists compared withother physicians. There is now considerable evidence,corroborated by this study, that anesthesiologists man-aged by PHPs have good prognoses.

REFERENCES

1. Lutsky I, Hopwood M, Abram SE, Jacobson GR, Haddox JD,Kampine JP. Psychoactive substance use among Americananesthesiologists: a 30-year retrospective study. Can J Anaesth1993;40:915–21

2. Available at: http://www.fsmb.org/pdf/1995_grpol_Physician_Impairment.pdf. Accessed June 1, 2009

3. Pelton C, Ikeda RM. The California Physicians Diversion Pro-gram’s experience with recovering anesthesiologists. J Psycho-active Drugs 1991;23:427–31

4. Paris RT, Canavan DI. Physician substance abuse impair-ment: anesthesiologists vs. other specialties. J Addict Dis1999;18:1–7

5. Talbott GD, Gallegos KV, Wilson PO, Porter TL. The MedicalAssociation of Georgia’s Impaired Physicians Program. Reviewof the first 1000 physicians: analysis of specialty. JAMA1987;257:2927–30

6. Guadagnino C. MDs challenged on disability insurance. Physi-cian News Digest. Jan 2002. Available at: http://physiciansnews.com/cover/102.html. Accessed June 1, 2009

7. Pelton C. Physician diversion program: California’s experiencewith successful graduates. J Psychoactive Drugs 1993;25:159–64

8. Shore JH. The Oregon experience with impaired physicians onprobation. JAMA 1987;257:2931–4

9. Menk EJ, Baumgarten RK, Kingsley CP, Culling RD, Middaugh R.Success of reentry into anesthesiology training programs by resi-dents with a history of substance abuse. JAMA 1990;263:3060–2

10. Berge KH, Seppala MD, Lanier WL. The Anesthesiology Com-munity’s approach to opioid- and anesthetic-abusing personnel:time to change course. Anesthesiology 2008;109:762–4

11. Collins GB, McAllister MS, Jensen M, Gooden TA. Chemicaldependency treatment outcomes of residents in anesthesiology:results of a survey. Anesth Analg 2005;101:1457–62

12. Domino KB, Hornbein TF, Polissar NL, Renner C, Johnson J,Alberti S, Hankes L. Risk factors for relapse in health care profes-sionals with substance use disorders. JAMA 2005;293:1453–60

13. McLellan T, Skipper GE, Campbell M, DuPont R. Five yearoutcomes in a cohort study of physicians treated for substanceuse disorders in the United States. BMJ 2008;337:a2038

14. American Medical Association. Physician Characteristics andDistribution in the US, 2002–2003 Edition. Chicago, IL: AMAPress, 2002:15

15. Sivarajan M, Posner KI, Caplan RA, Gild WM, Cheney FW.Substance abuse among anesthesiologists. Anesthesiology 1994;80:704

16. Fitzsimmons MG, Baker KH, Lowenstein E, Zapol WM. Ran-dom drug testing to reduce the incidence of addiction inanesthesia residents: preliminary results from one program.Anesth Analg 2008;107:630–5


Brief Report

Seventh and Eighth Year Follow-Up on Workforce andFinances of the United States Anesthesiology TrainingPrograms: 2007 and 2008

Sachin Kheterpal, MD, MBA

Kevin Tremper, PhD, MD

Amy Shanks, MS

Michelle Morris, MS

We sent follow-up financial and workforce surveys to 121 United States anesthe-siology training programs in 2007 and 2008. Seventy-four respondents (61%)demonstrated a continued increase in the institutional support for faculty andstabilization in the number of open positions. Institutional support per faculty fulltime equivalent with certified nurse anesthetist support removed averages$109,000. A 7% open faculty position rate is characterized by a preponderance ofgeneralists (31%) and pediatric (21%) anesthesiologists.(Anesth Analg 2009;109:897–9)

Because of a decrease in interest of medical studentsin anesthesiology in the mid 1990s, there were fewerresident graduates starting in the year 2000.1–3 When theresulting decrease in the number of anesthesiologistsavailable for the workforce was combined with increas-ing faculty salaries, the financial status of academicanesthesia programs worsened.4–6 For the past 8 yr,surveys have been sent to the United States anesthesiol-ogy training programs. These surveys have demon-strated a progressive increase in institutional financialsupport for anesthesiology training departments: from amean of $34,000/faculty full time equivalent (FTE)/yr inthe year 2000 to a mean of $120,000/FTE/yr in the year2006.4 At the same time, the percent of open facultypositions in academic departments has been progressivelydecreasing from a high of approximately 10% in the year2000 to a low of 5% in 2006.4 We sought to update surveydata for the academic years 2007 and 2008.

METHODSThis survey has been presented in detail in previ-

ous publications.4 For the year 2008, the survey wasmodified to also request which type of faculty anes-thesiologist positions were unfilled: generalist, pedi-atric, cardiac, critical care, pain, regional, ambulatory,obstetric, or neuro. The electronic mail surveys weresent starting in the Fall of each year, and remindersurveys were sent to nonresponders every 2 wk for thenext 8 wk. Mean, median, 25th percentile, and 75th

percentile values were calculated as descriptive datausing SPSS Version 15 (SPSS, Chicago, IL) and Med-Calc Version 10 (Mariakerke, Belgium). The 95% con-fidence intervals for the 25th percentile and 75thpercentile value (without transformation) were com-pared with the median value for each data point toidentify any overlaps. Confidence intervals were de-rived using the nonparametric order statistics tech-nique first described by Wilks.7

RESULTSThe surveys were distributed to 121 chairs who are

members of the Society of Academic AnesthesiologyAssociations. The response rates for 2007 and 2008were 60% and 61%, respectively. The descriptive sta-tistics are presented in Tables 1–7. The 95% confidenceintervals (data not shown) for the 25th and 75thpercentiles did not overlap with the means or mediansreported in these tables.

The average academic anesthesiology department has53 faculty, 8 fellows, 44 residents, 7 interns (66% of thedepartments offer internships), and 32 certified regis-tered nurse anesthetists (CRNA) (95% of the depart-ments have CRNAs). In the departments which hadopen faculty positions in 2008 (56 of 74 responders �76%), there was an average of five open positions (95%confidence interval of 4–6). This translates to an overall 7%national open position rate in the sampled departments,defined as: (average number of reported open positions atinstitutions reporting open positions/average number ofpositions at all institutions) � (percentage of institutionsreporting open positions). The most sought-after spe-cialty was a generalist followed by pediatric, cardiac,and critical care, respectively (Table 3). In 2008, therewere four open CRNA positions per department, trans-lating to a national average open percentage of 13%

From the Department of Anesthesiology, University of MichiganHealth System, Ann Arbor, Michigan.

Accepted for publication May 1, 2009.Address correspondence and reprint requests to Sachin Kheter-

pal, MD, MBA, Department of Anesthesiology, University of Michi-gan Health System, 1500 E. Medical Center Dr., Ann Arbor, MI48109. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181b0fef6


(Table 2). For the fiscal year ending June 2008, thedepartments averaged total revenue of $595,000/FTE(Table 4). This total revenue was composed of clinicalrevenue ($430,000/FTE), research revenue ($29,000/FTE),and institutional support ($136,000/FTE) (Table 4).When the portion of institutional support used forCRNA salaries is removed, the overall support is$109,000/FTE. This is a progressive increase for 2007 and2008 (Table 5). The departments billed an average of11,400 units/faculty FTE in 2008, and the average unitcharge increased to $96.00 in 2008. The average dollarscollected per unit billed was $35 (Table 6).

DISCUSSIONThe 2007 and 2008 surveys seem to follow the same

trend as the previous surveys. The observed openfaculty position percentage compares well with thedata received from the yearly Society of AcademicAnesthesiology Chairman Salary Survey distributedby the University of Florida, which demonstrated 6%

open positions in 2008 (personal communication withRebecca Lovely, University of Florida, Gainesville,Florida). The number of faculty open positions, al-though decreasing from the year 2000, has stabilizedat approximately 7% (Table 2). Faculty support perFTE (with CRNA support removed) is still increasing,reaching a new high of $109,000/FTE in 2008. A concur-rent decrease in reimbursement rate and anesthesia unitsbilled/FTE is observed and confirms recent MedicalGroup Management Association data (Table 6).8 Withthe recent increase in Medicare funding for anesthesiolo-gists and the recent revision of the Medicare Teaching

Table 1. 2008 Faculty, Fellows, Residents, and CertifiedRegistered Nurse Anesthetists (CRNAs) Staffing

Mean Median 25% 75%Faculty 53 45 30 68Fellows 8 5 2 11Residents (CA-1,2,3) 44 39 26 59Internsa 11 10 7 12CRNAsa 34 21 12 39a 66% of programs have interns and 95% of programs have CRNAs. These data reflectprograms that have interns and CRNAs, respectively.

Table 2. Open Faculty Position Data and Open CertifiedRegistered Nurse Anesthetist (CRNA) Positions

2007 2008Number of faculty 45 53Open faculty positions (N � 56)a 4 5Departments with open positions (%) 76 76Open faculty positionsb (%) 7 7Number of CRNA 23 32Open CRNA positions 4 4Departments with open positions (%) 75 68Open CRNA positionsb (%) 14 13Data are presented as means.a For those that have open positions.b These percentages are overall and include the departments with no open positions.

Table 3. Open Faculty Position by Subspecialty (2008)

Type Open positions (%)Generalist 31Pediatric 21Cardiac 12Critical care 11Regional 6Pain 6Ambulatory 4Obstetric 4Neuro 4Because of rounding, the percentages do not add up to 100%.

Table 4. Revenue: Sources and Total

2007 2008

Clinical revenue n � 71 n � 7225th percentile $11,700,000 $13,000,000Mean $19,000,000 $23,000,000Median $18,000,000 $20,000,00075th percentile $24,300,000 $31,900,000

Clinical revenue/FTE n � 71 n � 7225th percentile $317,000 $370,000Mean $413,000 $430,000Median $412,000 $427,00075th percentile $464,000 $490,000

Research revenue n � 71 n � 7225th percentile $34,000 $71,500Mean $1,800,000 $2,000,000Median $237,000 $520,00075th percentile $2,100,000 $2,650,000

Research revenue/FTE n � 71 n � 7225th percentile $1000 $1700Mean $28,000 $29,000Median $9500 $11,00075th percentile $34,000 $43,600

Institutional support n � 70 n � 7225th percentile $2,300,000 $3,000,000Mean $5,200,000 $6,400,000Median $4,900,000 $5,800,00075th percentile $7,500,000 $8,800,000

Institutional support/FTE n � 70 n � 7225th percentile $56,000 $56,000Mean $126,000 $136,000Median $103,000 $109,00075th percentile $183,000 $202,500

Total revenue n � 70 n � 7225th percentile $15,500,000 $17,800,000Mean $26,000,000 $32,000,000Median $21,000,000 $26,000,00075th percentile $34,000,000 $40,000,000

Total revenue/FTE n � 70 n � 7225th percentile $464,000 $491,000Mean $566,000 $595,000Median $524,000 $570,00075th percentile $627,000 $660,000

Total expenses n � 69 n � 7225th percentile $15,200,000 $17,900,000Mean $25,800,000 $32,300,000Median $22,000,000 $26,100,00075th percentile $33,700,000 $41,000,000

Total expenses/FTE n � 69 n � 7225th percentile $460,000 $516,000Mean $555,000 $605,000Median $520,000 $588,00075th percentile $620,000 $682,000

Data are in actual dollars. Medical inflation rates for years 2000–2006 were 4.1%, 4.6%,4.7%, 4.0%, 4.4%, 4.2%, 4.0%, and 4.4% based upon the Medical Care subset of theConsumer Price Index-Urban published by the United States Bureau of Labor and Statistics,data series CUUR0000SAM. $10,000 in 2000 medical care dollars would be $13,414 in2007 and $14,000 in 2008 medical care dollars based upon these inflation rates.FTE � faculty full time equivalent.

898 Brief Report ANESTHESIA & ANALGESIA

Rule, the charge-reimbursement gap may shrink in up-coming years as those new laws go in effect.9 These tworevisions of Medicare payment may have a positiveeffect on academic training departments. However,Medicare is not the majority payor at most facilities.2 Inaddition, this increase in departmental support appearsto parallel the increasing salaries provided to academicanesthesiology faculty. The most recent salary data dem-onstrate that the 50th percentile for an assistant professorhas increased to $288,000/yr (2008 Society of AcademicAnesthesiology Chairman Salary Survey, personal com-munication with Rebecca Lovely, University of Florida,Gainesville, Florida).

Our data suffer from the potential errors associatedwith the survey methodology itself and have beendescribed earlier.1,3–6 A skewed response populationor errors in the respondents’ understanding the sur-vey questions are the two most common errors thatmay affect accuracy.

REFERENCES

1. Tremper KK, Barker SJ, Gelman S, Reves JG, Saubermann AJ,Shanks AM, Greenfield MLVH, Anderson ST. A demographic,service, and financial survey of anesthesia training programs inthe United States. Anesth Analg 2003;96:1432–46

2. Tremper KK, Reves JG, Barker SJ, Saubermann AJ, Gelman S.Financial environment of acadamic anesthesia. In: Lake, CL JohnsonJO, eds. Advances in anesthesia. Carlsbad, CA: Mosby, Inc., 2001:1–35

3. Tremper KK, Shanks A, Sliwinski M, Barker SJ, Hines R, Tait AR.Faculty and finances of United States anesthesiology trainingprograms: 2002–2003. Anesth Analg 2004;99:1185–92

4. Kheterpal S, Tremper KK, Shanks A, Morris M. Six-year follow-up onwork force and finances of the United States anesthesiology trainingprograms: 2000 to 2006. Anesth Analg 2009;108:263–72

5. Tremper KK, Shanks A, Morris M. Trends in the financial statusof United States anesthesiology training programs: 2000 to 2004.Anesth Analg 2006;102:517–23

6. Tremper KK, Shanks A, Morris M. Five-year follow-up on thework force and finances of United States anesthesiology trainingprograms: 2000 to 2005. Anesth Analg 2007;104:863–8

7. Wilks S. Order statistics. Bull Am Math Soc 1948;54:6–508. Abouleish A. The fallacy of the field of dreams business plan: a

downward trend in anesthesiology productivity. ASA Newsl 2007;71:30–1

9. Medicare Teaching Rule. Text of H.R. 6331: Medicare improve-ments for patients and providers act of 2008. Available at:http://www.govtrack.us/congress/billtext.xpd?bill�h110–6331.Accessed 28 Dec 2008

Table 6. Anesthesia Units, Charges, and Collections

2007(n � 71)

2008(n � 70)

Anesthesia units/FTE n � 66 n � 6325th percentile 9900 9000Mean 12,100 11,400Median 11,300 10,80075th percentile 14,000 13,300

Anesthesia value charge25th percentile $75 $80Mean $89 $96Median $85 $9275th percentile $100 $106

Dollars collected per anesthesia unit25th percentile $27 $27Mean $32 $35Median $32 $3475th Percentile $37 $40

Medicaid payment per unit25th percentile $12 $14Mean $16 $16Median $15 $1675th percentile $18 $18

Table 7. Clinical Anesthetizing Locations

2007 2008Operating rooms 34 39Nonoperating room sites 6 7Faculty assigned/day

Labor and delivery 1.3 1.4Intensive care unit 1.4 1.7Acute pain service 1.1 1.1Pain clinic 1.7 1.9Preoperative clinic 0.9 0.9

Total 46.4 53Faculty/clinical site 1.0 1.0Research revenue/faculty $28,000 $29,000Data are presented as means. Totalling the number of operating room sites and the numberof faculty assigned to nonoperating room sites is presented only as a crude way of comparingfaculty full time equivalent numbers among departments and clinical locations covered. Itdoes not account for how operating rooms are covered, or any faculty requirements associatedwith call, or other clinical, academic, or administrative commitments.

Table 5. Itemized Institutional Support

Year2007

(n � 72)2008

(n � 74)Total support n � 70 n � 72

25th percentile $2,300,000 $3,000,000Mean $5,200,000 $6,400,000Median $4,800,000 $5,700,00075th percentile $7,500,000 $8,800,000

Support/FTE n � 70 n � 7225th percentile $56,000 $56,000Mean $126,000 $136,000Median $103,000 $109,00075th percentile $183,000 $202,000

Total support lessCRNA $

n � 70 n � 70

25th percentile $2,000,000 $2,700,000Mean $4,200,000 $4,900,000Median $3,700,000 $4,000,00075th percentile $6,100,000 $7,100,000

Total support lessCRNA $/FTE

n � 70 n � 70

25th percentile $49,000 $48,500Mean $100,000 $108,600Median $88,000 $101,00075th percentile $127,000 $150,000

Hospital support n � 70 n � 7225th percentile $1,800,000 $2,000,000Mean $4,000,000 $5,000,000Median $3,500,000 $4,500,00075th percentile $5,700,000 $7,100,000

Medical schoolsupport

n � 70 n � 72

25th percentile $88,000 $0Mean $800,000 $720,000Median $600,000 $470,00075th percentile $1,400,000 $1,100,000

Other support n � 70 n � 7225th percentile $0 $0Mean $400,000 $500,000Median $0 $075th percentile $330,000 $600,000

Total support $5,200,000 (n � 70) $6,400,000 (n � 72)Data are in actual dollars.FTE � faculty full time equivalent; CRNA � certified registered nurse anesthetist.


Numbers of Simultaneous Turnovers Calculated fromAnesthesia or Operating Room Information ManagementSystem Data

Franklin Dexter, MD, PhD*

Eric Marcon, PhD†

John Aker, MS, CRNA‡

Richard H. Epstein, MD§

BACKGROUND: More personnel are needed to turn over operating rooms (ORs)promptly when there are more simultaneous turnovers. Anesthesia and/or ORinformation management system data can be analyzed statistically to quantifysimultaneous turnovers to evaluate whether to add an additional turnover team.METHODS: Data collected for each case at a six OR facility were room, date ofsurgery, time of patient entry into the OR, and time of patient exit from the OR. Thenumber of simultaneous turnovers was calculated for each 1 min of 122 4-wkperiods. Our end point was the reduction in the daily minutes of simultaneousturnovers exceeding the number of teams caused by the addition of a team.RESULTS: Increasing from two turnover teams to three teams reduced the mean dailyminutes of simultaneous turnovers exceeding the numbers of teams by 19 min. Theratio of 19 min to 8 h valued the time of extra personnel as 4.0% of the time of OR staff,surgeons, and anesthesia providers. Validity was suggested by other methods ofanalyses also suggesting staffing for three simultaneous turnovers. Discrete-eventsimulation showed that the reduction in daily minutes of turnover times from theaddition of a team would likely match or exceed the reduction in the daily minutes ofsimultaneous turnovers exceeding the numbers of teams. Confidence intervals fordaily minutes of turnover times achieved by increasing from two to three teams werecalculated using successive 4-wk periods. The distribution was sufficiently close tonormal that accurate confidence intervals could be calculated using Student’s tdistribution (Lilliefors’ test P � 0.58). Analysis generally should use 13 4-wk periods asincreasing the number of periods from 6 to 13 significantly reduced the coefficient ofvariation of the averages but not increasing the number of periods from 6 to 9 or from9 to 13.CONCLUSION: The number of simultaneous turnovers can be calculated for each1 min over 1 yr. The reduction in the daily minutes of simultaneous turnoversexceeding the number of teams achieved by the addition of a turnover team can beaveraged over the year’s 13 4-wk periods to provide insight as to the value (or not)of adding an additional team.(Anesth Analg 2009;109:900–5)

Neither anesthesiologists nor surgeons desire pro-longed operating room (OR) turnover times.1,2 Oneeffective way to reduce turnover times is to use addi-tional personnel (e.g., extra anesthesia techniciansand/or postanesthesia care unit nurses).3–5 In the UnitedStates, such personnel must usually be paid for by thefacility due to regulatory issues.6 Anesthesiologists havean incentive to persuade administrators to increase theOR nursing budget to include more turnover personnel,

as reducing excessive idle time can increase anesthesiagroup productivity.7 Because quantitative analysis en-hances the persuasiveness of arguments,8 we studiedhow OR and/or anesthesia information managementsystem data can be analyzed statistically to quantifysimultaneous turnovers to evaluate whether to add anadditional turnover team (e.g., housekeeper and anes-thesia technician). We studied simultaneous turnoversbeing as the number of personnel needed to turn over

From the *Division of Management Consulting, Departments ofAnesthesia and Health Management and Policy, University of Iowa,Iowa; †Department of Manufacturing System Management andMaintenance, Jean Monnet University of Saint Etienne, France;‡Department of Anesthesia, University of Iowa, Iowa; and §Depart-ment of Anesthesiology, Jefferson Medical College, Philadelphia,Pennsylvania.

Accepted for publication May 19, 2009.Franklin Dexter is Section Editor of Economics, Education, and

Policy for the Journal. This manuscript was handled by Steve Shafer,Editor-in-Chief, and Dr. Dexter was not involved in any way withthe editorial process or decision.

FD receives no funds personally other than his salary from theState of Iowa, including no travel expenses or honoraria; has tenurewith no incentive program; and owns no health care stocks otherthan indirectly through mutual funds. RHE is President of MedicalData Applications, Ltd., whose CalculatOR™ software includes theanalyses considered in this article.

Address correspondence and reprint requests to Franklin Dexter,MD, PhD, Division of Management Consulting, Department of Anes-thesia, University of Iowa, Iowa City, IA 52242. Address e-mail [email protected] or web site www.FranklinDexter.net.

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181b08855


ORs promptly is positively correlated with the numberof simultaneous turnovers (Figs. 1 and 2). We developedthe statistical method using 9 yr of data from an outpa-tient facility with six staffed ORs, validated the method,and then applied the method to a large tertiary suitewith several months of data.

METHODSThere were 53,716 cases performed at the outpa-

tient facility during its 2345 workdays from December20, 1998, to April 26, 2008. All procedures wereelective. No cases were performed on holidays orweekends. Data used for each case were, room, date ofsurgery, time of patient entry into the OR, and time ofpatient exit from the OR, entered into an Excel spread-sheet (Microsoft, Redmond, WA). Using Visual Basic

for Applications, turnover times were calculated foreach case and set equal to 90 min when longer than 90min.9,10 The resulting 37,282 turnovers totaled 799,787min. Turnovers were considered to be simultaneousif they overlapped in time by at least 1 min. Thenumber of simultaneous turnovers was calculated foreach 1 min over the 122 studied 4-wk periods. Inroutine practice, we use 13 4-wk periods (see Results).

An array stored in 1 min increments was createdthat stored the number of simultaneous turnovers, asdescribed previously for studies of staffing in postan-esthesia care units.11 The daily minutes with thenumber of simultaneous turnovers exceeding athreshold number of teams was calculated. By this wemean, precisely, the daily minutes of simultaneousturnovers during which there were more ORs to beturned over than there were turnover teams available.For example, if the threshold were three teams, and iffor 1 min there were five simultaneous turnovers, thenthat minute contributed 2 min to the measured value,because there were two ORs without assistance forthat 1 min interval. Depending on a facility’s organi-zation, a turnover team may not be needed for theentire turnover. Results are proportional if a turnoverteam is needed for only a fraction of the turnover time.

Two-sided 95% confidence intervals (CIs) werecalculated for the reduction in the daily minutes forwhich the number of simultaneous turnovers ex-ceeded a specified number of teams, with reductionscalculated for additions of one turnover team. Thisapproach of studying incremental differences wasdescribed previously for studying anesthesia staffingin afternoons.12,13 The averages of 4-wk periods ofdaily differences were treated as following a normaldistribution such that CI were calculated using Stu-dent’s t-distribution. Lilliefors’ test was used to con-firm this assumption.14

As a potential alternative end point, we calculatedthe percentage of turnover time attributable to turn-overs occurring when the number of simultaneousturnovers exceeded the number of teams. To calculatethese percentages, we used larger bin sizes of 8-wkperiods to have no bins with zero in the numerator. Thesum over each 8-wk period of the minutes of simulta-neous turnovers exceeding the number of turnover timeswas divided by the total minutes of turnover timeduring the period. Two-sided 95% CI were calculatedby taking the Freeman-Tukey transformation of thecounts from each 8-wk period, applying the Student’st-distribution to the transformed values, and thentaking the inverse.15,16 The percentages were pooledbecause personnel responsible for turnovers gener-ally work 8 h shifts, 5 days a week, corresponding towhen most turnovers occur.10 The percentages werepooled also because successive turnovers timeswere correlated.10

As another potential alternative end point, the dailypeak number of simultaneous turnovers was calcu-lated by using bin sizes of 1 day. The Clopper-Pearson

Figure 1. Gantt charts showing that the effect of adding aturnover team on daily minutes of surgeon experienced turn-over times can be predicted by minutes of simultaneousturnovers exceeding the number of teams. In the schematic,time is plotted along the horizontal axis. Each row representsan operating room (OR). The panes show turnover times forthree turnover teams, two teams, and one team. The longlight gray bars represent times that patients are in ORs. Thedark gray bars are the cleanup and setup times. The whitebars represent delays contributing to turnover times (i.e.,nothing is happening in the OR because the turnover team iselsewhere). With three teams, the minutes of simultaneousturnovers exceeding the threshold of three teams � 0 min.With two teams, the minutes of simultaneous turnovers ex-ceeding the threshold of two teams � 10 min. Thus, an increasefrom two teams to three teams results in a 10 min reduction inthe daily minutes for which the number of simultaneousturnovers exceeds the numbers of teams, where 10 min � 10 �0 min. In comparison, an increase from two turnover teams tothree teams reduces the total surgeon experienced turnovertime by 10 min. The two end points match. With one team, theminutes of simultaneous turnovers exceeding the threshold ofone team � 40 min. An increase from one team to two teamsresults in a 30 min reduction in the daily minutes of simulta-neous turnovers exceeding the numbers of teams, where 30min � 40 � 10 min. In comparison, an increase from oneturnover team to two teams reduces the total minutes ofsurgeon experienced turnover time by 30 min. For this ex-ample, the two end points match.


method was used to calculate one-sided 95% CI for thecumulative distribution of the percentage of days withthe peak number of simultaneous turnovers exceedinga threshold number of simultaneous turnovers.17,18

We will show, below, that our recommendedmethod of analysis is two-sided 95% CI for the reduc-tion in the daily minutes for which the number ofsimultaneous turnovers exceeds the number of turn-over teams, as achieved by the addition of one extrateam. We considered the appropriate number of 4-wkperiods for use in routine monitoring. Deciding toincrease staffing, hiring the additional personnel, andtraining can typically take around half a year. Budget-ing usually is reevaluated annually. Thus, 6 and 134-wk periods (i.e., 24 and 52 wk, respectively) serve asthe minimum and maximum intervals. We calculatedthe coefficient of variation (CV) of the moving averageover the n � 122 4-wk periods using 6 periods (n �117), using 9 periods (n � 114), and using 13 periods(n � 110). Comparison of coefficients of variationbetween different numbers of 4-wk periods was per-formed asymptotically using two-group analyses.19

Finally, discrete event simulation was used to studythe influence of the numbers of turnover teams onboth our recommended end point and the reduction inthe total daily minutes of turnovers at the suite,matching the comparison showed in Figure 1. The53,716 cases studied were performed in 14,070 combi-nations of six ORs and 2345 workdays. The mean �standard deviations of OR times � 1.41 � 0.95 h andof turnover times � 0.32 � 0.28 h. ARENA (v8.0,Rockwell Software, Sewickley, PA) was used to simu-late 14,070 identical OR workdays. For each OR on

each workday, an OR time was simulated using alog-normal distribution with the observed mean andstandard deviation.20 If �9 h, a turnover time andanother OR time were simulated. If the sum of the threewas �9 h, then all three are performed. Another turn-over time and OR time were simulated. If adding thosetwo to the preceding three exceeded 9 h, then onlythe first three were used. If the sum of the fiveevents did not exceed 9 h, then all five events wereincluded. The process was continued until 9 h wasexceeded. The resulting duration of the simulatedworkday was 7.71 � 0.53 h.

The simulation model was used for testing the fivescenarios in which the maximum number of turnoverteams working in the surgical suite was specified. Forthe first scenario, six turnover teams were assumedalways to be available, equal to the number of ORs.Thus, no OR ever waited for cleanup or setup, andthese times were considered to be the turnover time.Simulations were repeated with five teams reducedstepwise to one team. With fewer teams, ORs some-times waited for cleaning to start, and the turnovertime was increased, as shown in Figure 1. For ex-ample, without an anesthesia technician, cleaning andsetup of anesthesia equipment may wait until theanesthesia provider returns from the postanesthesiacare unit. The result was that the OR finished later inthe workday, increasing the work hours of the surgeons,anesthesia providers, and OR nurses. This increase in“makespan” (a term used in the field of operationsresearch/industrial engineering), measured in minutes,quantified the increased waiting experienced by sur-geons. The number of simulated OR-day combinations

Figure 2. Simulated reductions in daily minutes of surgeon experienced turnover times from the addition of a turnover teammatch or exceed the reduction in daily minutes of simultaneous turnovers exceeding threshold of the number of teams. Themethodology is described in the last two paragraphs of the Methods. The figure is presented in the same format as Figure 3for comparison, with dark boxes in both representing our recommended study end point. The comparisons between adjacentbars are analogous to the comparisons made in Figure 1. The light boxes in this figure show the extra time experienced bythe physicians, called “makespan” in the operations research/industrial engineering fields. Unlike Figures 3–5, there is no boxaround three turnover teams, because with simulation, any number of turnover teams can be studied. The figure shows thatthe reduction in total turnover time of the suite (e.g., as experienced by surgeons) from the addition of one team will be atleast the reduction in minutes of simultaneous turnovers achieved by an increase in the threshold number of teams by oneteam. As explained in the second to last paragraph of the Results, the reduction in total turnover time will be no more thanthat achieved by increasing the number of teams to one team per operating room. Consequently, as the numbers of teams isincreased, the absolute accuracy of the method of Figure 3 is improved.

902 Staffing for Simultaneous Turnovers ANESTHESIA & ANALGESIA

was sufficient for widths of 95% CIs for all reported endpoints to be �0.6% of the value of the end point. Being sonarrow, these CIs are not displayed.

RESULTSFigure 3 shows the average reduction in minutes of

turnovers per day from each unit increase in the numberof teams. Increasing from 1 to 2 teams reduced the dailyminutes for which the number of simultaneous turn-overs exceeded the numbers of teams by 82 min/day.Increasing from 2 to 3 teams reduced the daily minutesby 19 min. Increasing from 3 to 4 teams reduced the dailyminutes by 2.8 min/day.

Figure 4 provides further insight into the largechanges resulting from each incremental increase in thenumbers of teams in Figure 3. The number of simulta-neous turnovers exceeded two teams for 6.2% of turn-over times. In contrast, one team was exceeded for much(30%) of the turnover time, whereas three teams wereexceeded for little (0.8%) of the turnover time.

Figure 5 shows that if 6.2% were acceptable, theconsequence would be that on most days (81%) therewould be at least one event when the number ofsimultaneous turnovers exceeds the number of teams.If a manager wanted to reduce this rate of exceedanceto below 1 event/week (20% of days) or even 1event/3 weeks (6.7%), four teams would be required.

We examined further how to analyze statisticallythe incremental reduction in minutes for which thenumber of simultaneous turnovers exceeds the num-ber of teams by the addition of another team.

First, Figure 6 shows a histogram of the n � 122averages over 4-wk periods of the reduction in the

daily minutes of turnover times achieved by increas-ing the threshold of exceeded turnovers from 2 to 3teams. The distribution was sufficiently close to nor-mal for Student’s t-distribution to give accurate CIs(Lilliefors’ test P � 0.58).

Second, the number of 4-wk periods for use in routinemonitoring was considered. The CV of the movingaverage using six 4-wk periods was 27%, using 9 periodswas 25%, and using 13 periods was 22%. The improve-ment in the CV was significant between 6 and 13 periods(P � 0.039, Z � 2.06) but not between 6 and 9 periods(P � 0.36, Z � 0.92) or between 9 and 13 periods (P �

Figure 3. Average reduction in minutes of simultaneous turnovers per day exceeding the threshold number of turnover teams.For example, (A) calculate the total minutes of simultaneous turnovers exceeding the threshold of two turnover teams. A5-min period with four simultaneous turnovers would contribute 10 min, where 10 min � (5 min) � (4 simultaneousturnovers � 2 teams). (B) Repeat using three turnover teams. The value of 19 min in the figure equals the average of A–B.The error bars are 95% confidence intervals. The figure shows that each increase in the threshold by one team is associatedwith large decreases in the incremental reduction in turnover time resulting from a further 1 increase in the number of teams.However, the data were measured with 2–3 teams, analogous to the situation described in Figures 1 and 2. This is indicatedby the value of 19 min labeled with a bold box. The facility had 2–3 anesthesia technicians during the study period.

Figure 4. Percentages of overall minutes of turnover timesattributable to minutes of turnovers occurring when the num-ber of simultaneous turnovers exceeded the threshold numberof teams on the horizontal axis. For example, when the numberof simultaneous turnovers exceeded two teams, there was atotal of 6.2% of all turnover time. The datum for three turnoverteams is listed with a square because the facility had 2–3anesthesia teams and results of the analyses (e.g., Fig. 3)suggest that three turnover teams is appropriate. Two-sided95% confidence intervals are present but are sufficiently nar-row to be obscured by the circles.


0.25, Z � 1.15). Therefore, we recommend the use of 1 yrof data.

Third, discrete-event simulation was performedusing the raw data’s parameter values. Figure 2 showsthat the reduction in daily minutes of turnover timesfrom the addition of a turnover team matches orexceeds the daily minutes for which the number ofsimultaneous turnovers exceeds the number of teams.In the example in Figure 1, the two match. Themaximum potential reduction in total turnover timeequals the reduction in daily minutes of simultaneousturnovers achieved by increasing the number of teams

to the number of ORs. We describe the relevance byreferring to Figure 3.

First, when the number of teams is relatively low,the reduction in the minutes for which the number ofsimultaneous turnovers exceeds the number of turn-over teams as achieved by increasing the number ofteams by 1 underestimates the reduction in the totaldaily minutes of turnover time. However, the under-estimation is not sufficiently large to alter the mana-gerial decision as to whether to add a team. When thenumber of turnover teams is relatively high, com-pared with the numbers of ORs, the reduction inminutes during which the number of simultaneousturnovers exceeds the numbers of teams achieved byincreasing by one team is an accurate estimate.

Second, the maximum potential reduction in totalturnover time of the suite can be calculated from theobserved data without simulation because there is anupper and lower limit to the potential benefit of increas-ing the number of teams. For example, suppose theanesthesia group were sharing analysis results withhospital administration showing the potential value inhiring another anesthesia technician and housekeeper toincrease from 2 turnover teams to 3 teams. There was a19 min reduction in the minutes for which the number ofsimultaneous turnovers exceeded the number of teams(Figure 3). The corresponding increases from three turn-over teams to four teams was 2.8 min, from four turn-over teams to five teams was 0.23 min, and from fiveturnover teams to six teams was 0.01 min (Fig. 3).Further increases in the number of teams would result insavings of 0 min, because there are six ORs. Summingthese values (using the raw data to avoid rounding)gives 24 min. The corresponding saving of extra minutesof turnover time from the addition of one team is at leastthe observed 19 min but no more than 24 min.

Table 1 gives an example of application of thestatistical method to a larger suite using 1 yr of data, asdisplayed for regular use. We expect a 27 min reduc-tion per day in times when the number of simulta-neous turnovers exceeds the number of turnover

Figure 5. Percentage of workdays with at least 1 min for whichthe number of simultaneous turnovers exceeded the listednumber of teams. The datum for three turnover teams is listedwith a square because the facility had two to three anesthesiateams, and results of the analyses (e.g., Fig. 3) suggest that threeturnover teams is appropriate. One-sided 95% upper confi-dence bounds are given for the cumulative distribution of thepercentage of days with the peak number of simultaneousturnovers exceeding the number of turnover teams.

Figure 6. Histogram of the averages over 4-wk periods of dailydifferences of turnover times achieved by increasing the num-ber of turnover teams from 2 to 3. The difference correspondsto the middle bar labeled 19 min in Figure 3. The dotted verticalline shows 19 min. The best fit normal probability densitycurve is overlaid (P � 0.58, n � 122 4-wk periods).

Table 1. Application of Method to 24 Operating Room TertiarySurgical Suite

3 vs 4 4 vs 5 5 vs 6Reduction in minutes per day of simultaneous turnovers

exceeding number of turnover teamsMean 66 27 9Lower 95% CI 61 23 7Upper 95% CI 71 31 12

Maximum potential reduction in minutes of turnover timeper day by increasing number of turnover teams

Mean 102 36 9The “Lower 95% CI” and “Upper 95% CI” values refer, respectively, to lower and upper 95%confidence bounds for the mean calculated using 13 4-wk periods of data. The maximumpotential reduction in minutes of turnover times achieved by a unit increase in the number ofteams was calculated by summing the successive decreases in the mean reduction to the rightof the baseline turnover team level. For example, an increase in the number of teams from 3to 4 can directly reduce total turnover time by at most 102 min, where 102 min � 66 �27 � 9. An increase in the number of teams from 4 to 5 can directly reduce total turnovertime by at most 36 min, where 36 min � 27 � 9.CI � confidence interval.

904 Staffing for Simultaneous Turnovers ANESTHESIA & ANALGESIA

teams by an increase from four to five teams. Themaximum potential direct reduction in turnover timeexperienced by the surgeons, anesthesia providers,and nurses would be 36 min.

DISCUSSIONThe methodology we propose to decide whether to

add one turnover team is straightforward and can easilybe implemented using the steps listed in the first threeparagraphs of the Methods. Any vendor’s spreadsheetsupporting addition of programming code can be usedfor this purpose.

Figure 3’s mean 19 min reduction in minutes ofsimultaneous turnovers by adding one turnover teamshould be balanced against increases in working timesof staff who participate in the team. An 8 h day has 480min. The ratio of 19 to 480 min values the time of extrapersonnel as 4.0% of the time of OR staff, surgeons,and anesthesia providers, since 4.0% � 19 min/480min. In other words, the facility would be paying for480 min of work by the extra turnover team member tosave 19 min of idle OR time. The value of 4.0% can becompared with thresholds for ORs and physicianswaiting for patients. Applying national compensationdata, the value of patients’ time averages 5.3% that ofOR and physicians.21 At a tertiary suite, patientsentered the holding area after the OR was ready 5.0%of the time.22 Exceeding 3 teams at a 4.0% rate is closeto these referenced values of 5.3% and 5.0%.

Our methodology does not differentiate amongtimes of the day. Most turnovers occur in the middleof the workday (e.g., 10:00 am to 2:00 pm) not at theend. If part-time people were to be hired to improveturnover times, their work hours can best be deter-mined by calculating which hours of the day havethe largest numbers of prolonged turnovers. Themethodology is described in Ref. 10 and reviewed inRef. 23.

An alternative approach to our analysis of Figure 3would be to use the discrete-event simulation ofFigure 2 under routine circumstances to evaluate theimpact of adding turnover teams.24 However, devel-oping such models tends to be expensive and needsspecial software and expertise. Detailed data on work-flow and processes would be needed to evaluate theimpact of adding individual members of a team (e.g.,one anesthesia technician). Thus, we recommenddiscrete-event simulation for research as used in thecurrent article but not for routine use.10,11,16,24

REFERENCES

1. Vitez TS, Macario A. Setting performance standards for ananesthesia department. J Clin Anesth 1998;10:166–75

2. Eappen S, Flanagan H, Lithman R, Bhattacharyya N. Theaddition of a regional block team to the orthopedic operatingrooms does not improve anesthesia-controlled times and turn-over time in the setting of long turnover times. J Clin Anesth2007;19:85–91

3. Cendan JC, Good M. Interdisciplinary work flow assessmentand redesign decreases operating room turnover time andallows for additional caseload. Arch Surg 2006;141:65–9

4. Smith MP, Sandberg WS, Foss J, Massoli K, Kanda M, BarsoumW, Schubert A. High-throughput operating room system forjoint arthroplasties durably outperforms routine processes.Anesthesiology 2008;109:25–35

5. Heslin MJ, Doster BE, Daily SL, Waldrum MR, Boudreaux AM,Smith AB, Peters G, Ragan DB, Buchalter S, Bland KI, Rue LW.Durable improvements in efficiency, safety, and satisfaction inthe operating room. J Am Coll Surg 2008;206:1083–9

6. Semo JJ. Ambulatory surgical centers: a manual for anesthesi-ologists. Washington, DC: American Society of Anesthesiolo-gists, 2006:44, 81

7. Masursky D, Dexter F, Nussmeier NA. Operating room nursingdirectors’ influence on anesthesia group operating room pro-ductivity. Anesth Analg 2009;107:1989–96

8. Kadous K, Koonce L, Towry KL. Quantification and persuasionin managerial judgment. Contemp Account Res 2005;22:643–86

9. Dexter F, Abouleish AE, Epstein RH, Whitten CW, LubarskyDA. Use of operating room information system data to predictthe impact of reducing turnover times on staffing costs. AnesthAnalg 2003;97:1119–26

10. Dexter F, Epstein RH, Marcon E, Ledolter J. Estimating theincidence of prolonged turnover times and delays by time ofday. Anesthesiology 2005;102:1242–8

11. Marcon E, Dexter F. Observational study of surgeons’ sequenc-ing of cases and its impact on post-anesthesia care unit andholding area staffing requirements at hospitals. Anesth Analg2007;105:119–26

12. Dexter F, Traub RD. Determining staffing requirements for asecond shift of anesthetists by graphical analysis of data fromoperating room information systems. AANA J 2000;68:31–6

13. Dexter F, Epstein RH. Optimizing second shift OR staffing.AORN J 2003;77:825–30

14. Sprent P. Applied nonparametric statistical methods. NewYork: Chapman and Hall, 1989:49–58

15. Mosteller F, Youtz C. Tables of the Freeman-Tukey transforma-tions for the binomial and Poisson distributions. Biometrika1961;48:433–40

16. Dexter F, Marcon E, Epstein RH, Ledolter J. Validation ofstatistical methods to compare cancellation rates on the day ofsurgery. Anesth Analg 2005;101:465–73

17. Clopper CJ, Pearson ES. The use of confidence or fiducial limitsillustrated in the case of the binomial. Biometrika 1934;26:404–13

18. Newcombe RG. Two-sided confidence intervals for the singleproportion: comparison of seven methods. Stat Med 1998;17:857–72

19. Miller GE. Asymptotic test statistics for coefficients of variation.Commun Statist Theory Meth 1991;20:3351–63

20. Dexter F, Macario A, Manberg PJ, Lubarsky DA. Computersimulation to determine how rapid anesthetic recovery proto-cols to decrease the time for emergence or increase the phase Ipost anesthesia care unit bypass rate affect staffing of anambulatory surgery center. Anesth Analg 1999;88:1053–63

21. Dexter F, Traub RD. Statistical method for predicting whenpatients should be ready on the day of surgery. Anesthesiology2000;93:1107–14

22. Wachtel RE, Dexter F. Simple method for deciding what timepatients should be ready on the day of surgery withoutprocedure-specific data. Anesth Analg 2007;105:127–40

23. McIntosh C, Dexter F, Epstein RH. Impact of service-specificstaffing, case scheduling, turnovers, and first-case starts on anes-thesia group and operating room productivity: tutorial using datafrom an Australian hospital. Anesth Analg 2006;103:1499–516

24. Albert F, Marcon E. How to combine transversal staff skills inoperating rooms? Information control problems in manufactur-ing, Proceedings of the 12th International Federation of Auto-matic Control Symposium on Information Control Problems inManufacturing 2006;3:677–82


Neurosurgical Anesthesiology and NeuroscienceSection Editor: Adrian W. Gelb

The Effect on Cerebral Tissue Oxygenation Index ofChanges in the Concentrations of Inspired Oxygen andEnd-Tidal Carbon Dioxide in Healthy Adult Volunteers

Martin M. Tisdall, MD*

Christopher Taylor, FRCA*

Ilias Tachtsidis, PhD†

Terence S. Leung, PhD†

Clare E. Elwell, PhD†

Martin Smith, FRCA*†

BACKGROUND: A variety of near-infrared spectroscopy devices can be used to makenoninvasive measurements of cerebral tissue oxygen saturation (ScO2). The ScO2measured by the NIRO 300 spectrometer (Hamamatsu Photonics, Japan) is calledthe cerebral tissue oxygenation index (TOI) and is an assessment of the balancebetween cerebral oxygen delivery and utilization. We designed this study toinvestigate the effect of systemic and intracranial physiological changes on TOI.METHODS: Fifteen healthy volunteers were studied during isocapneic hyperoxia andhypoxemia, and normoxic hypercapnea and hypocapnea. Absolute cerebral TOIand changes in oxy- and deoxyhemoglobin concentrations were measured using aNIRO 300 spectrometer. Changes in arterial oxygen saturation (Sao2), ETco2, heartrate, mean arterial blood pressure (MBP), and middle cerebral artery blood flowvelocity (Vmca) were also measured during these physiological challenges. Changesin cerebral blood volume (CBV) were subsequently calculated from changes in totalcerebral hemoglobin concentration.RESULTS: Baseline TOI was 67.3% with an interquartile range (IQR) of 65.2%–71.9%.Hypoxemia was associated with a median decrease in TOI of 7.1% (IQR �9.1% to�5.4%) from baseline (P � 0.0001) and hyperoxia with a median increase of 2.3%(IQR 2.0%–2.5%) (P � 0.0001). Hypocapnea caused a reduction in TOI of 2.1% (IQR�3.3% to �1.3%) from baseline (P � 0.0001) and hypercapnea an increase of 2.6%(IQR 1.4%–3.7%) (P � 0.0001). Changes in Sao2 (P � 0.0001), ETco2 (P � 0.0001),CBV (P � 0.0003), and MBP (P � 0.03) were significant variables affecting TOI.Changes in Vmca (P � 0.7) and heart rate (P � 0.2) were not significant factors.CONCLUSION: TOI is an easy-to-monitor variable that provides real-time, multisite,and noninvasive assessment of the balance between cerebral oxygen delivery andutilization. However, TOI is a complex variable that is affected by Sao2 and ETco2,and, to a lesser extent, by MBP and CBV. Clinicians need to be aware of thesystemic and cerebral physiological changes that can affect TOI to interpretchanges in this variable during clinical monitoring.(Anesth Analg 2009;109:906–13)

Cerebral oxygenation monitoring is widely used toassess the balance between cerebral metabolic supplyand demand but standard bedside methods of measur-ing cerebral oxygenation have significant limitations.Jugular venous oxygen saturation is a global, flow-weighted measure that may miss regional ischemia,1

whereas intraparenchymal brain tissue oxygen tension isa hyperfocal measure and its ability to identify ischemiais dependent on the location of the probe.2 In addition tobeing invasive, these techniques are also associated with

a degree of technical difficulty and are not widelyavailable outside specialist centers.3 There is therefore aneed for a noninvasive, bedside measure of cerebraloxygenation that can provide real-time data from severalregions of the brain simultaneously.

Near-infrared spectroscopy (NIRS) is a noninvasivetechnique based on the transmission and absorption ofnear-infrared light (700–1000 nm) at multiple wavelengthsas it passes through tissue. NIRS allows interrogation of thecerebral cortex using reflectance spectroscopy via op-todes, light transmitting and detecting devices, placed

From the *Department of Neuroanaesthesia and NeurocriticalCare, The National Hospital for Neurology and Neurosurgery, Uni-versity College London Hospitals; and †Department of Medical Phys-ics and Bioengineering, University College London, London, UK.

Accepted for publication April 20, 2009.Supported by the Wellcome Trust (Grant no. 075608) (to MT), the

Engineering Physical Science Research Council (Grant no. GR/N14248/01) (to IT), and Hamamatsu Photonics, KK (to TL). Thiswork was undertaken at University College London Hospitals andpartially funded by the Department of Health’s NIHR BiomedicalResearch Centres funding scheme. The work was also made possible inpart by a donation in memory of Karolyn Margaret Jones.

Professor Clare E. Elwell has received lecture honoraria and Dr.Terence S. Leung salary funding from Hamamatsu Photonics, KK,Japan.

Address correspondence and reprint requests to Martin Smith,FRCA, Department of Neuroanaesthesia and Neurocritical Care,Box 30, The National Hospital for Neurology and Neurosurgery,Queen Square, London WC1N 3BG, UK. Address e-mail [email protected].


DOI: 10.1213/ane.0b013e3181aedcdc


on the scalp.4 Oxygenated hemoglobin (O2Hb) anddeoxygenated hemoglobin (HHb) have different ab-sorption spectra, and cerebral oxygenation and hemo-dynamic status can be determined by their relativeabsorption of near-infrared light. Biological tissue is ahighly scattering medium but if the average pathlength of light through tissue is known, the modifiedBeer-Lambert law (MBL), which assumes constant scatter-ing losses, allows calculation of absolute changes in chro-mophore concentration.5 Earlier NIRS methodologywas predominantly limited to differential spectros-copy methods that provide trend monitoring of thechanges in tissue chromophore concentration (e.g.,O2Hb and HHb).5 These variables are generally unfa-miliar to clinicians, even if the changes are quantifiedin micromolar units. Technical developments, for ex-ample, the use of spatially resolved spectroscopy(SRS), have allowed the introduction of clinical moni-tors that incorporate an absolute measure of cerebraltissue hemoglobin oxygen saturation (ScO2), an easilyaccessible and continuous measure of the balancebetween cerebral tissue oxygen delivery and utiliza-tion.6 There are a variety of NIRS instruments avail-able that measure ScO2 in some form.7 The NIRO 300spectrometer (Hamamatsu Photonics, Japan) uses fourwavelengths (778, 813, 850, and 913 nm) and the MBL tomeasure changes in O2Hb and HHb concentrations, andthe SRS technique to measure absolute ScO2, which isexpressed as the cerebral tissue oxygenation index (TOI)and is displayed as a simple percentage value.8 Theapplication of SRS and the validity of TOI have beendescribed in normal adult volunteers9,10 and in clinicalscenarios.11–13 The depth sensitivity of TOI has also beenevaluated by selective internal and external carotid ar-tery clamping during carotid surgery and shows highsensitivity and specificity to intracerebral changes inadults.11 Furthermore, because NIRS interrogates arte-rial, venous, and capillary blood within the field of view,the derived saturation represents a “tissue” oxygensaturation measured from these three compartments6

and can be used to identify tissue hypoxia/ischemia.14

The development of indices such as TOI has beenmotivated in part by the desire to provide clinicianswith an easily accessible measure of cerebral tissueoxygenation. The optical measurement of TOI is de-rived from the proportion of O2Hb relative to total Hb(HbT) concentration in the field of view.8 However,exactly what TOI represents in physiological terms iscomplex and likely to be influenced by a number ofinputs. These have been summarized as15:

TOI � Sao2 � � Vv

Va � Vv� � � CMRO2

k � CBF � [Hb]�� 100 (1)

where Sao2 � arterial oxyhemoglobin saturation, Vv andVa � venous and arterial blood volume, respectively,CMRO2 � cerebral metabolic rate for oxygen, k �

oxygen carrying ability of hemoglobin, CBF � cerebralblood flow, and [Hb] � blood Hb concentration.

Most of these variables affect either cerebral oxygendelivery or utilization, and TOI should therefore be areasonable measure of the balance between the two.However, when interpreting TOI, or other NIRS mea-sures of Sco2, it is important to understand howphysiological variables might affect the measuredsaturation. From Eq. 1 it is clear that changes in Sao2will affect TOI and, although of fundamental impor-tance, this relationship has not previously been stud-ied. Because NIRS interrogates arterial, venous, andcapillary blood, TOI will also be affected by variationin the cerebral arterial:venous volume ratio (AVR).While the AVR is typically 1:3 (25% arterial and 75%venous),16 the actual ratio depends on individualanatomy, local physiology, and pathological states.17

Changes in arterial Paco2 also induce changes incerebral AVR18 and Paco2 is therefore similarly likelyto affect TOI. This study was designed to investigatethese relationships by observing the effects on cerebralTOI of changes in cerebral oxygen delivery duringisocapneic hyperoxia and hypoxemia, and normoxichypercapnea and hypocapnea, in healthy volunteers.

METHODSThe study was approved by the Joint Research

Ethics Committee of the National Hospital for Neu-rology and Neurosurgery and the Institute of Neurol-ogy, University College London.

NIRS MeasurementsAfter obtaining informed written consent, a NIRO

300 monitor was used to measure absolute TOI usingSRS and changes in HbO2 and HHb concentrationsusing the MBL during a variety of physiologicalchallenges in 15 healthy adult volunteers. The source-detector optode pair was fixed in a black rubberholder with a source-detector separation of 5 cm overthe right side of the forehead in the midpupillary line,avoiding the sinuses. The optode holder was securedto the head using an elasticated crepe bandage toprevent optode movement and covered with a light-absorbing cloth to eliminate stray light. NIRS datawere collected at 6 Hz.

Other MeasurementsSao2 was measured using a pulse oximeter, modi-

fied to provide beat-to-beat recording (NovametrixMedical Systems, Wallingford, CT), with the probeattached to the subject’s left ear. Mean arterial bloodpressure (MBP) and heart rate (HR) were measurednoninvasively using a Portapress and finger probe(Biomedical Instrumentation, TNO Institute of Ap-plied Physics, Belgium). MBP was recorded from theanalog output of the Portapress continuously at 100Hz and the signal was later resampled to 6 Hz. Bloodflow velocity in the right middle cerebral artery (Vmca)was measured by the same experienced operator (MT)


using 2 MHz transcranial Doppler ultrasonography(TCD) (Nicolet, UK), as a surrogate of CBF.19 MeanVmca was calculated from the CBF velocity envelopeusing a trapezoidal integration function (MatLab,Mathworks, USA). Inspired oxygen fraction (Fio2) andETco2 were measured using an in-line gas analyzer(Hewlett Packard, UK) and a CO2SMO optical sensor(Novametrix Medical Systems), respectively.

Study ProtocolA modified anesthetic machine delivered inspired

gas to the subjects via a Mapelson E (Ayres T-piece)breathing system incorporating a mouthpiece and 50cm expiratory limb. The study was divided into fourchallenge periods with a rest period between each.Each challenge period was preceded by 5 min of datacollection at normoxia and normocapnea. Three cyclesof the following physiological challenges were per-formed in each volunteer.

HypoxemiaNitrogen was added to the inspired gas to induce a

gradual decrease in Sao2 to 80% and, immediately afterthis was achieved, Fio2 was returned to baseline (nor-moxia) for 5 min. ETco2 was continuously fed back tothe subjects so that they could adjust their minuteventilation and maintain normocapnea throughout thispart of the study.

HyperoxiaFio2 was increased to 100% for 5 min and then

returned to normoxia for 5 min. The subjects againadjusted their minute ventilation using the ETco2feedback system to maintain normocapnea.

HyperventilationThe subjects hyperventilated to reduce ETco2 by

1.5 kPa below baseline. This was maintained for 5min and then a normal breathing rate was resumed,allowing ETco2 to return to baseline over approxi-mately 5 min.

HypercapneaApproximately 6% CO2 was added to the in-

spired gas and titrated to induce an increase inETco2 of 1.5 kPa. This was maintained for 5 min andthe inspired CO2 fraction was then returned to zerofor another 5 min.

At the end of the study, a venous blood sample wasobtained and the Hb concentration measured using acoximeter (ABL 700, Radiometer Copenhagen, Denmark).

Data AnalysisAbsolute change in O2Hb and HHb concentrations

was calculated from changes in light attenuation usingthe MBL and the UCL4 algorithm, assuming a differen-tial pathlength factor of 6.26.20 Changes in HbT concen-tration were subsequently calculated (�[HbT] � �[HbO2]� �[HHb]) and converted to changes in cerebral bloodvolume (CBV) using the formula:

�CBV ��[HbT] � MWHb � 100

[Hb] � CSLVH � �brain

(2)

where �CBV � change in CBV (mL/100g of brain),�[HbT] � change in total hemoglobin concentration(mol/L), MWHb � molecular weight of hemoglobin(64 500 g/mole), [Hb] � the large vessel hemoglobinconcentration (g/L), CSLVH � the cerebral smallvessel to large systemic vessel hematocrit, and � � thebrain density (1.05 g/mL).

The start and end of each challenge period wasidentified from the Sao2, Fio2, or ETco2 data accordingto the phase of the study. To enable comparisonbetween subjects and across physiological challenges,8 points were selected within each individual periodof alteration of Fio2 or ETco2 (the challenge period) sothat the time between adjacent points represented aneighth of the total time course of the challenge period.This produced 9 timepoints with Point 1 representingthe point just before the start and Point 9 the end of thechallenge period (Fig. 1). The recovery period wassimilarly divided, producing Points 9 (just before startof recovery) to 17 (end of recovery period). At eachtimepoint, the mean of the preceding 10 s of data wascalculated and used for analysis. Data from the threeexperimental cycles of each physiological challenge

Figure 1. Schematic of data analysis for hypoxemia paradigmusing Sao2 data to define data windows for summaryanalysis.

Table 1. Median and Interquartile Range (IQR) for BaselineValues of Measured Variables Before the Start of Hypoxemias(n � 15)

Median IQRFio2 (%) 21.0 21.0–21.0SaO2 (%) 99.2 98.2–99.2ETco2 (kPa) 5.4 5.2–5.7HR (min�1) 62.5 60.0–71.5MBP (mm Hg) 77.6 70.3–88.8Vmca (cm/s) 43.2 37.9–51.1Hb (g/dL) 14.7 13.75–14.95TOI (%) 68.3 65.2–71.9FiO2 � inspired oxygen fraction; SaO2 � arterial oxygen saturation; ETCO2 � end-tidal carbondioxide tension; HR � heart rate; MBP � mean arterial blood pressure; Vmca � middlecerebral artery blood flow velocity; Hb � hemoglobin; TOI � tissue oxygenation index.

908 Cerebral Tissue Oxygen Saturation ANESTHESIA & ANALGESIA

were averaged to give a single course for each subject.For each of the challenges, a mean of the variablesfrom the two NIRS channels was calculated. Groupmedian changes from baseline at each timepoint wereproduced.

Statistical analysis was performed using SAS soft-ware (v9.1, SAS Institute, USA). Percentage changesfrom baseline for Vmca and absolute changes frombaseline for other measured variables were comparedusing nonparametric analysis of variance with post hocpairwise comparisons.21 P values �0.05 were consid-ered significant. Multiple regression analysis was per-formed using change in TOI as the dependent variableand changes in other variables as regression variables.Regression variables which were not significant werethen removed and the regression analysis repeated.

RESULTSFifteen adult volunteers (10 male and 5 female)

with median age 31 (range, 27–39) yr were recruitedinto the study. Baseline values for the measuredvariables are shown in Table 1.

The Sao2 of all subjects reached 80% at the nadir ofthe hypoxemic challenge, with a median reduction inSaO2 of 15.8% (interquartile range [IQR] �18.4% to�14.1%). The median increase in Fio2 at the mouth-piece during hyperoxia was 72% and all subjectsresponded with a significant increase in Sao2 frombaseline (P � 0.0001) with a median increase of 0.7%(IQR 0.5%–0.9%). During hyperventilation, the me-dian reduction in ETco2 was 1.5 kPa (IQR �1.7 to �1.4kPa), and during hypercapnea, the median increase inETco2 was 1.7 kPa (IQR 1.5–1.9 kPa).

Hypoxemia was associated with a median decreasein TOI of 7.1% (IQR �9.1% to �5.4%) from baseline

(P � 0.0001) and hyperoxia with a median increase of2.3% (IQR 2.0%–2.5%) (P � 0.0001). Hypocapnea causeda reduction in TOI of 2.1% (IQR �3.3% to �1.3%) frombaseline (P � 0.0001) and hypercapnea an increase of2.6% (IQR 1.4%–3.7%) (P � 0.0001). Figures 2–5 show thegroup data for the measured variable values during thefour physiological challenges.

Multiple regression analysis confirmed that changesin Sao2 (P � 0.0001), ETco2 (P � 0.0001), CBV (P �0.0003), and MBP (P � 0.03) were significant variablesaffecting TOI. Percentage changes in Vmca (P � 0.7)and HR (P � 0.2) were not significant factors. Theregression analysis was repeated using only the sig-nificant regression variables to determine the regres-sion � values:

�TOI � 0.53 � �Sao2 � 1.13 � �EtCo2

� 2.35 � �CBV � 0.01 � �MBP (3)

The overall adjusted r value was 0.82 (P � 0.0001).The standardized � coefficients and P values for eachvariable are shown in Table 2.

DISCUSSIONHyperoxia and hypercapnea resulted in an increase

in cerebral TOI, whereas TOI was reduced duringhypoxemia and hyperventilation. TOI is predomi-nantly affected by Sao2 and ETco2 and, to a lesserextent, by CBV and MBP.

There was a large variation in TOI among individu-als in this study. The median baseline TOI was 68.3%with an IQR of 65.2%–71.9%. This variability has beenreported previously.22,23 The “normal” range for TOIvaries between 60% and 75%, with a coefficient of

Figure 2. Median and interquartilerange (n � 15) for variable values dur-ing hypoxemia (*P � 0.05, †P � 0.01,‡P � 0.001, §P � 0.0001 for changefrom baseline).


variation for absolute baseline values of almost 10%,and this might limit the usefulness of isolated mea-surements of TOI.23 Rasmussen et al.24 estimatedcapillary Hb oxygen saturation as the mean of arterialand jugular bulb oxygen saturation and compared thisderived value with TOI during changes in inspiredoxygen and carbon dioxide fractions. Although thesevariables were correlated, there was a wide variationbetween TOI and the modeled capillary oxygen satu-ration, also suggesting that the potential for usingabsolute TOI values to define ischemic thresholds or

guide targeted therapy in the clinical environmentmight be limited. Al-Rawi and Kirkpatrick12 at-tempted to determine the reduction in TOI that isassociated with cerebral ischemia by studying theeffect of carotid artery clamping during carotid sur-gery. Electroencephalography was used to define thepresence of cerebral ischemia, and no patient with apercentage reduction in TOI �13% showed electroen-cephalography evidence of ischemia. The potential ap-plication of TOI and other NIRS measures of ScO2 astrend monitors of incipient cerebral hypoxia/ischemia is

Figure 3. Median and interquartilerange (n � 15) for variable values dur-ing hyperoxia (*P � 0.05, †P � 0.01,‡P � 0.001, §P � 0.0001 for changefrom baseline).

Figure 4. Median and interquartilerange (n � 15) for variable values dur-ing hyperventilation (*P � 0.05, †P �0.01, ‡P � 0.001, §P � 0.0001 for changefrom baseline).


therefore attractive but, for their interpretation to beclinically valid, clinicians must understand which sys-temic and cerebral physiological variables affect themeasured cerebral saturation.

In our study, hypoxemia (Sao2 approximately 80%),was associated with a median decrease in TOI of 7.1%from a median baseline of 68.3%. Although it is likelythat the reduction in TOI was related to the reductionin Sao2, it is important to exclude other causes. Therewas a small (0.2 kPa) but statistically significant re-duction in median ETco2 at the nadir of hypoxemia.This was likely because of the hypoxemic stimulus tohyperventilate despite the application of an ETco2biofeedback loop. However, multiple regression anal-ysis demonstrates that this magnitude of change inETco2 in isolation would induce a reduction in TOI ofonly 0.2% and it is therefore unlikely to be contribut-ing to the large reduction in TOI that we observed. Inagreement with other investigators,25 we observed asignificant increase in HR and small change in MBPduring hypoxemia, but these are also unlikely to haveaffected TOI. There was an increase in Vmca and CBVduring hypoxemia and this finding is in keeping withprevious studies that identified the threshold for hy-poxic vasodilatation in healthy volunteers occurring atSao2 of around 90%.25

The small increase in Sao2 (median 0.7%) duringhyperoxia was associated with a median increase in

TOI of 2.3%. Although this degree of change in TOI isunlikely to be of clinical significance, it warrants anexplanation from a physiological perspective. Despitesubjects attempting to maintain isocapnea, there was asmall but statistically significant decrease in ETco2

(median 0.3 kPa) that was likely related to two linkedeffects. Increasing oxyhemoglobin saturation de-creases the affinity of Hb for carbon dioxide (theHaldane effect),26 thereby reducing carbon dioxideuptake from tissue. This is likely to translate to areduction in Paco2 and therefore in ETco2. It has alsobeen suggested that the Haldane effect-mediated CO2

retention in the respiratory centers of the brain mightinduce a hyperventilatory response that would in turnresult in decreased Paco2 and ETco2.27 Hyperoxiacaused a reduction in Vmca and CBV and this might inpart be related to the small reduction in Paco2. How-ever, arterial-spin-labeled magnetic resonance imag-ing studies indicate that normobaric hyperoxia has adirect cerebral vasoconstrictive effect and an indirecteffect mediated via the reduced Paco2.27 Reductions inCBV and Vmca would tend to reduce TOI, but, duringhyperoxia, we observed the opposite, i.e., an increasein TOI that was of greater magnitude (median increase2.3%) than the associated increase in Sao2 (medianincrease 0.7%). This might, in part, be related to anincrease in dissolved blood oxygen. However, this isunlikely to be the only explanation because of themodest increase in dissolved oxygen that occurs dur-ing hyperoxia. Assuming a constant CMRO2, our datasuggest that the combined effect of the small increasein arterial oxygen content and reduced CBV and Vmca

(and therefore presumably of CBF) is an overall in-crease in cerebral oxygen delivery. The increase in TOIthat we observed therefore seems to indicate that thereduction in CBF during hyperoxia was small and

Figure 5. Median and interquartilerange (n � 15) for variable valuesduring hypercapnea (*P � 0.05, †P �0.01, ‡P � 0.001, §P � 0.0001 forchange from baseline).

Table 2. Standardized Regression Estimates (standard �) and PValues for Multiple Regression Analysis Variables Shown in Eq. 1

Variable �Sao2 �ETco2 �CBV �MBPStandard � 0.71 0.37 0.09 0.04P � 0.0001 � 0.0001 0.0005 0.03CBV � cerebral blood volume; MBP � mean arterial blood pressure.


compensated for by the increase in dissolved bloodoxygen. Alternatively, our results could be explainedby a decrease in CMRO2 during hyperoxia, althoughwe believe that this is unlikely during the short timecourse of the study.

Hyperventilation caused a reduction in TOI inassociation with a small increase in Sao2 and reductionin CBV. The latter is presumably related to the knowncerebral arteriolar vasoconstrictive effects of reducedPaco2

28 because we also observed a simultaneousreduction in Vmca. Despite the small increase in Sao2during hyperventilation, TOI was reduced and this islikely to be explained by a reduction in CBV and CBF.It is of note that the CBV and Vmca responses haddifferent time courses during this phase of the study.Vmca returned to baseline during the recovery period,whereas CBV returned toward, but did not reach,baseline by the end of the study. This suggests that theautoregulatory processes which attempt to maintain astable CBF might entail mechanisms beyond changesin arteriolar calibre.

Hypercapnea resulted in an increase in TOI inassociation with a small increase in SaO2. The latter islikely to be related to the tendency of the subjects tohyperventilate in the presence of a high Paco2 despitethe application of the biofeedback mechanism. Duringthe early part of the hypercapneic challenge, there wasan increase in Vmca that returned toward baselinebefore the end of the challenge period, again suggest-ing the presence of autoregulatory mechanisms inaddition to carbon dioxide effects on arteriolar caliber.CBV increased during hypercapnea and returned to-ward, but did not reach, baseline values during therecovery period. The time course of the hypercapnea-induced increase in TOI suggests that the TOI changeswere more likely to be related to the increase in CBVthan the increase in Vmca because TOI also returnedtoward, but did not reach, baseline by the end of therecovery period. A similar increase in cerebral tissueoxygen tension in response to hypercapnea whichoutlasts the CO2 changes has also been demonstratedin a rat model.29

The high temporal resolution of the noninvasivetechniques used in this study offers a unique oppor-tunity to investigate the relative time courses ofchanges in cerebral oxygenation and hemodynamicvariables. Such an analysis is beyond the scope of thisstudy, and to fully understand how the complexinteractions between changes in Pao2, Paco2, and CBFinteract to produce changes in TOI, we are undertak-ing further analysis within the context of a recentlypublished mathematical model that was specificallydeveloped to aid the interpretation of cerebral NIRSdata.30

Assuming constant CMRO2 and Hb concentrationduring the challenge periods, our data indicate thatseveral variables can affect the value of TOI. Changein Sao2 is the most important and ETco2 the secondmost important. Although changes in CBV and MBP

were statistically significant, their standardized � val-ues were an order of magnitude lower than that forSao2 (0.09 and 0.04 respectively, vs 0.71) and theireffects are unlikely to have major clinical relevance. Itis of note that CBV was a significant variable affectingTOI, whereas percentage change in Vmca was not.Regression analysis confirmed that the changes inETco2 alone can account for the observed changes inVmca and this is likely to explain why Vmca was not asignificant independent variable affecting TOI. Whenwe performed multiple regression analysis withchanges in ETCO2 omitted, changes in Vmca became asignificant factor affecting TOI (analysis not shown)and this tends to confirm this hypothesis.

There are several limitations to our study. Becausewe wished to avoid the placement of arterial lines forblood gas analysis in volunteers, we used Sao2 as ameasure of arterial oxygenation and ETco2 as a sur-rogate for Paco2. Measurement of Sao2 does notaccount for dissolved oxygen, but the consequence ofthis is likely to be negligible during normoxia andhypoxia. It might, however, become relevant duringhyperoxia and impact on the results of that part of ourstudy. Changes in ETco2 are accurate surrogates ofchanges in Paco2 in healthy subjects and the use ofETco2 is therefore unlikely to have affected our re-sults.31 We used TCD-derived Vmca as a surrogate forCBF and this relationship relies on there being nochange in the diameter of the insonated vessel or inthe angle of insonation during the measurements.Magnetic resonance imaging studies have confirmedthat basal middle cerebral arterial diameter does notchange substantially during the type of physiologicalchallenges that we used in this study.19 Furthermore,the TCD studies were performed by an experiencedoperator (MT) using a proprietary probe head fixationsystem to minimize artifact from probe movement.Because TOI is the balance between cerebral oxygendelivery and utilization, changes in CMRO2 are likelyto affect TOI. Although it is unlikely that CMRO2changed during the physiological challenges in ourhealthy subjects, we did not measure CMRO2 andcannot therefore exclude changes in CMRO2 as aconfounding factor. Finally, our calculation of CBV,measured from MBL-derived changes in O2Hb andHHb concentrations, is likely to be prone to someerror because these variables do not exclusively mea-sure the intracerebral compartment.7,11 However, theydo not apply to the SRS measurement of TOI whichhas high sensitivity and specificity to intracerebralchanges.11

In conclusion, TOI is an easy-to-monitor variablethat provides a real-time, noninvasive assessment ofregional tissue cerebral oxygenation. The predomi-nant factors determining TOI are Sao2 and ETco2,with changes in MBP and CBV having limited effects.The variability of TOI in healthy volunteers is likely tolimit its clinical usefulness as a “one off” measure ofcerebral oxygenation, but changes in TOI have great


potential as a trend monitor for the identification ofhypoxia/ischemia. However, further studies in brain-injured patients are required to determine the magni-tude of the reduction in TOI that is associated withincipient cerebral hypoxia/ischemia. Importantlythough, clinicians need to be aware of the systemicand cerebral physiological changes that can affect TOI,in order to interpret changes in this variable duringclinical monitoring.

REFERENCES

1. Schell RM, Cole DJ. Cerebral monitoring: jugular venous oxim-etry. Anesth Analg 2000;90:559–66

2. Gupta AK, Hutchinson PJ, Al-Rawi P, Gupta S, Swart M,Kirkpatrick PJ, Menon DK, Datta AK. Measuring brain tissueoxygenation compared with jugular venous oxygen saturationfor monitoring cerebral oxygenation after traumatic brain in-jury. Anesth Analg 1999;88:549–53

3. Tisdall MM, Smith M. Multimodal monitoring in traumaticbrain injury: current status and future directions. Br J Anaesth2007;99:61–7

4. Okada E, Delpy DT. Near-infrared light propagation in an adulthead model. II. Effect of superficial tissue thickness on thesensitivity of the near-infrared spectroscopy signal. Appl Opt2003;42:2915–22

5. Delpy DT, Cope M, van der Zee P, Arridge S, Wray S, Wyatt J.Estimation of optical pathlength through tissue from direct timeof flight measurement. Phys Med Biol 1988;33:1433–42

6. Smith M. Perioperative uses of transcranial perfusion monitor-ing. Neurosurg Clin N Am 2008;19:489–502

7. Owen-Reece H, Smith M, Elwell CE, Goldstone JC. Near infra-red spectroscopy. Br J Anaesth 1999;82:418–26

8. Suzuki S, Takasaki S, Ozaki T, Kobayashi Y. A tissue oxygen-ation monitor using NIR spatially resolved spectroscopy. ProcSPIE 1999;3597:582–92

9. Tisdall MM, Tachtsidis I, Leung TS, Elwell CE, Smith M.Near-infrared spectroscopic quantification of changes in theconcentration of oxidized cytochrome c oxidase in the healthyhuman brain during hypoxemia. J Biomed Opt 2007;12:024002

10. Quaresima V, Sacco S, Totaro R, Ferrari M. Noninvasive mea-surement of cerebral hemoglobin oxygen saturation using twonear infrared spectroscopy approaches. J Biomed Opt 2000;5:201–5

11. Al-Rawi PG, Smielewski P, Kirkpatrick PJ. Evaluation of anear-infrared spectrometer (NIRO 300) for the detection ofintracranial oxygenation changes in the adult head. Stroke2001;32:2492–500

12. Al-Rawi P, Kirkpatrick P. Tissue oxygen index: thresholds forcerebral ischemia using near-infrared spectroscopy. Stroke2006;37:2720–5

13. McLeod AD, Igielman F, Elwell C, Cope M, Smith M. Measuringcerebral oxygenation during normobaric hyperoxia: a compari-son of tissue microprobes, near-infrared spectroscopy, andjugular venous oximetry in head injury. Anesth Analg2003;97:851–6

14. Kurth CD, Levy WJ, McCann J. Near-infrared spectroscopycerebral oxygen saturation thresholds for hypoxia-ischemia inpiglets. J Cereb Blood Flow Metab 2002;22:335–41

15. Tachtsidis I, Tisdall M, Delpy DT, Smith M, Elwell CE. Mea-surement of cerebral tissue oxygenation in young healthyvolunteers during acetazolamide provocation: a transcranialDoppler and near-infrared spectroscopy investigation. Adv ExpMed Biol 2008;614:389–96

16. An H, Lin W. Cerebral venous and arterial volumes can beestimated separately in humans using magnetic resonanceimaging. Magn Reson Med 2002;48:583–8

17. Watzman HM, Kurth CD, Montenegro LM, Rome J, Steven JM,Nicolson SC. Arterial and venous contributions to near-infraredcerebral oximetry. Anesthesiology 2000;93:947–53

18. Ito H, Ibaraki M, Kanno I, Fukuda H, Miura S. Changes in thearterial fraction of human cerebral blood volume during hyper-capnia and hyocapnia measured by positron emission tomog-raphy. J Cereb Blood Flow Metab 2005;25:852–7

19. Valdueza JM, Balzer JO, Villringer A, Vogl TJ, Kutter R,Einhaupl KM. Changes in blood flow velocity and diameter ofthe middle cerebral artery during hyperventilation: assessmentwith MR and transcranial Doppler sonography. Am J Neurora-diol 1997;18:1929–34

20. Duncan A, Meek JH, Clemence M, Elwell CE, Tyszczuk L, CopeM, Delpy DT. Optical pathlength measurements on adult head,calf and forearm and the head of the newborn infant usingphase resolved optical spectroscopy. Phys Med Biol 1995;40:295–304

21. Siegel S, Castellan NJ. Nonparametric statistics for the behav-ioural sciences. 2nd ed. Singapore: McGraw-Hill, 1988

22. Sorensen LC, Greisen G. Precision of measurement of cerebraltissue oxygenation index using near-infrared spectroscopy inpreterm neonates. J Biomed Opt 2006;11:054005

23. Thavasothy M, Broadhead M, Elwell C, Peters M, Smith M. Acomparison of cerebral oxygenation as measured by the NIRO300 and the INVOS 5100 Near-Infrared Spectrophotometers.Anaesthesia 2002;57:999–1006

24. Rasmussen P, Dawson EA, Nybo L, van Lieshout JJ, Secher NH,Gjedde A. Capillary-oxygenation-level-dependent near-infraredspectrometry in frontal lobe of humans. J Cereb Blood FlowMetab 2007;27:1082–93

25. Gupta AK, Menon DK, Czosnyka M, Smielewski P, Jones JG.Thresholds for hypoxic cerebral vasodilation in volunteers.Anesth Analg 1997;85:817–20

26. Dash R, Bassingthwaighte J. Blood HbO2 and HbCO2 dissocia-tion curves at varied O2, CO2, pH, 2,3-DPG and temperaturelevels. Ann Biomed Eng 2004;32:1676–93

27. Floyd TF, Clark JM, Gelfand R, Detre JA, Ratcliffe S, Guvakov D,Lambertson CJ, Eckenhoff RG. Independent cerebral vasocon-strictive effects of hyperoxia and accompanying arterial hypo-capnia at 1 ATA. J Appl Physiol 2003;95:2453–61

28. Greenberg J, Alavi A, Reivich M, Kuhl D, Uzzell B. Localcerebral blood volume response to carbon dioxide in man. CircRes 1978;43:324–31

29. Hare G, Kavanagh B, Mazer C, Hum K, Kim S, Coackley C, BarrA, Baker AJ. Hypercapnia increases cerebral tissue oxygentension in anesthetized rats. Can J Anaesth 2007;50:1061–8

30. Banaji M, Mallet A, Elwell CE, Nicholls P, Cooper CE. A modelof brain circulation and metabolism: NIRS signal changesduring physiological challenges. PLoS Comput Biol 2008;4:e10000212

31. Whitesell R, Asiddao C, Gollman D, Jablonski J. Relationshipbetween arterial and peak expired carbon dioxide pressureduring anesthesia and factors influencing the difference. AnesthAnalg 1981;60:508–12


Deep Hypothermia Attenuates Microglial ProliferationIndependent of Neuronal Death After Prolonged CardiacArrest in Rats

Tomas Drabek, MD*†

Samuel A. Tisherman, MD, FACS,FCCM*‡§

Lauren Beuke*

Jason Stezoski*

Keri Janesko-Feldman*

Manuella Lahoud-Rahme, MD*�

Patrick M. Kochanek, MD,FCCM*‡

INTRODUCTION: Conventional resuscitation of exsanguination cardiac arrest (CA)victims is generally unsuccessful. Emergency preservation and resuscitation is anovel approach that uses an aortic flush to induce deep hypothermia during CA,followed by delayed resuscitation with cardiopulmonary bypass. Minocycline hasbeen shown to be neuroprotective across a number of brain injury models viaattenuating microglial activation. We hypothesized that deep hypothermia andminocycline would attenuate neuronal death and microglial activation and im-prove outcome after exsanguination CA in rats.METHODS: Using isoflurane anesthesia, rats were subjected to a lethal hemorrhagicshock. After 5 min of no flow, hypothermia was induced with an aortic flush. Threegroups were studied: ice-cold (IC) flush, room-temperature (RT) flush, and RT flushfollowed by minocycline treatment (RT-M). After 20 min of CA, resuscitation wasachieved via cardiopulmonary bypass. Survival, Overall Performance Category (1 �normal, 5 � death), Neurologic Deficit Score (0%–10% � normal, 100% � max deficit),neuronal death (Fluoro-Jade C), and microglial proliferation (Iba1 immunostaining) inhippocampus were assessed at 72 h.RESULTS: Rats in the IC group had lower tympanic temperature during CA versusother groups (IC, 20.9°C � 1.3°C; RT, 28.4°C � 0.6°C; RT-M, 28.3°C � 0.7°C; P �0.001). Although survival was similar in all groups (RT, 6/9; IC, 6/7; RT-M, 6/11),neurological outcome was better in the IC group versus other groups (OverallPerformance Category: IC, 1 � 1; RT, 3 � 1; RT-M, 2 � 1; P � 0.05; NeurologicDeficit Score: IC, 8% � 9%; RT, 55% � 19%; RT-M, 27% � 16%; P � 0.05).Histological damage assessed in survivors showed selective neuronal death in CA1and dentate gyrus, similar in all groups (P � 0.15). In contrast, microglialproliferation was attenuated in the IC group versus all other groups (P � 0.01).CONCLUSIONS: Deeper levels of hypothermia induced by the IC versus RT flushresulted in better neurological outcome in survivors. Surprisingly, deep hypother-mia attenuated microglial activation but not hippocampal neuronal death. Mino-cycline had modest benefit on neurologic outcome in survivors but did notattenuate microglial activation in brain. Our findings suggest a novel effect of deephypothermia on microglial proliferation during exsanguination CA.(Anesth Analg 2009;109:914–23)

Currently, the outcomes from traumatic exsangui-nation cardiac arrest (CA) show that more than 50% ofdeaths caused by trauma occur at the scene1–3 where

medical care is limited. Less than 10% of the patientswho become pulseless from trauma survive.2 How-ever, in an appropriate setting, some of those trau-matic injuries could be surgically repairable.4

Emergency preservation and resuscitation (EPR) isa novel approach for resuscitation of exsanguinationCA victims.5 EPR uses cold aortic flush to induce deephypothermic preservation for prolonged CA to buytime for transport, damage control surgery, and de-layed resuscitation with cardiopulmonary bypass(CPB). In prior studies of EPR, we used a dog model tomaximize clinical relevance. Because of the lack ofmolecular tools available for use in dogs, we recentlydeveloped a rat EPR model to study the cellular andmolecular mechanisms underlying deep hypothermicneuroprotection. Understanding cellular and molecu-lar mechanisms of secondary damage in ischemia-reperfusion injury after CA and the impact of deep

From the *Safar Center for Resuscitation Research, University ofPittsburgh; Departments of †Anesthesiology, ‡Critical Care Medi-cine, §Surgery, University of Pittsburgh School of Medicine; and�Children’s Hospital of Pittsburgh, Pittsburgh, Pennsylvania.

Accepted for publication April 16, 2009.Supported by a Starter Grant from the Society of Cardiovascular

Anesthesiologists (to TD), the Laerdal Foundation for Acute Medi-cine (to TD), and a Seed Grant from the Department of Anesthesi-ology, University of Pittsburgh (to TD).

Drs. Kochanek and Tisherman are co-patent holders with theUniversity of Pittsburgh on Emergency Preservation and Resuscitation.

Address correspondence and reprint requests to Tomas Drabek,MD, Safar Center for Resuscitation Research, 3434 Fifth Ave.,Pittsburgh, PA 15260. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181b0511e


hypothermia on these cascades would allow us todefine specific targets for future interventions, assessmarkers of reversibility, and screen novel therapies.

Although the early brain injury in CA is initiated byenergy failure and resultant neuronal death cascades,microglial activation has been suggested to be anadditional mechanism of delayed neuronal death,most likely through releasing neurotoxic substances.6

Pharmacological modulation of microglial prolifera-tion may help to improve outcome after CA. Recently,studies in several central nervous system insults haveshown benefit from treatment with minocyline, a drugthat attenuated microglial activation and proliferation.7

We hypothesized that deeper levels of intraarresthypothermia would improve functional outcome, at-tenuate neuronal death, and attenuate microglial prolif-eration compared with more moderate hypothermia.We also hypothesized that minocycline would furtheraugment the hypothermic protection via attenuatingmicroglial activation, neuronal death, and improveoutcome.

METHODSWe used the rat EPR model described in detail

previously.8 All rats received humane care in compli-ance with the “Guide for the Care and Use of LaboratoryAnimals” (www.nap.edu/catalog/5140.html). The studyprotocol has been approved by the Institutional AnimalCare and Use Committee of the University of Pittsburgh.

Adult male Sprague-Dawley rats (350–375 g) wereobtained from Hilltop Lab Animals (Scottdale, PA)and housed for at least 3 days before the experimentunder 12-h light/dark cycle with unrestricted accessto food and water. On the day of the experiment, ratswere anesthetized with 4% isoflurane in a transparentacrylic jar. After tracheal intubation with a 14-gaugeIV catheter (Becton Dickinson, Sandy, UT), rats weremechanically ventilated using a piston ventilator(Harvard Ventilator Model 683; Harvard Rodent Ap-paratus, South Natick, MA) with a tidal volume of 0.8mL/100 g and a frequency of 20–24/min to maintainnormocapnia, and a positive end-expiratory pressureof 4 cm H2O. Anesthesia was maintained with1.5%–2% isoflurane in Fio2 0.5. After shaving andprepping with povidone iodine, bilateral femoral andright jugular cutdowns were performed. The leftfemoral artery and vein were cannulated for arterialblood pressure monitoring and blood sampling. Elec-trocardiogram, respiration, and arterial and centralvenous pressure were continuously monitored andrecorded (Polygraph; Grass Instruments, Quincy,MA). The right femoral artery was cannulated with a20-gauge catheter (Becton Dickinson, Sandy, UT) thatserved as an arterial CPB cannula. The right jugularvein was cannulated with a modified 5-hole 14-gaugeIV cannula advanced to the right atrium to be used forvenous drainage during the hemorrhage phase andlater as a venous CPB cannula. Rectal and tympanic

probes were used to monitor the temperature. Base-line blood samples were obtained, and hemodynamicvalues were recorded. Removed blood volume wasreplaced with an electrolyte-balanced crystalloidPlasma-Lyte A (Baxter, Deerfield, IL) in a ratio 1:3.Heparin sodium was administered to achieve acti-vated clotting time �400 s (Hemochron Jr. Signature,ITC, Edison, NJ).

Three groups were studied: 1) ice-cold (IC) flushgroup (n � 7), 2) room-temperature (RT) flush group(n � 9), and 3) room-temperature flush group fol-lowed by minocycline treatment, 20 mg/kg 1 h afterresuscitation and 90 mg/kg IP at 24 and 48 h (RT-M, n �11). Rats in the RT and IC groups received the samevolume of vehicle (phosphate buffered saline [PBS]).

After instrumentation, intubated rats were weanedto spontaneous ventilation of isoflurane 2% at Fio20.25 via a nose cone mask. After 5-min equilibrationperiod, rapid exsanguination (12.5 mL of blood over 5min) was performed via the internal jugular catheter.The shed blood was collected. After the rapid exsan-guination phase, CA was ensured with IV administra-tion of 9 mg of esmolol (0.9 mL) and 0.2 mEq ofpotassium chloride (0.1 mL). After 5 min of CA, 270mL of either an RT or an IC flush solution (Plasma-Lyte A) was instilled via the right femoral arterycatheter at 50 mL/min. The flush was drained fromthe jugular vein catheter.

After 20 min of CA, resuscitation was started withCPB. Heating and cooling were achieved with acirculating water bath around the oxygenator and aforced-air blower blowing air over the rat covered bya transparent semi-closed lid. Blood samples for bio-chemistry and hematology were obtained at 5, 15, 30,45, and 60 min CPB time and processed immediatelyusing a point-of-care blood analyzer (Stat Profile,Nova Biomedical, Waltham, MA).

Arterial blood gas management followed �-statprinciples. pH and electrolyte values outside of thenormal range were corrected during CPB and inten-sive care unit phases by adjustments in ventilationand/or administration of sodium bicarbonate, calciumchloride, and potassium chloride. Additional bloodobtained from an isoflurane-anesthetized donor ratwas used to maintain hematocrit �25%. CPB supportwas gradually weaned after 60 min. Mechanical ven-tilation with a Fio2 of 1.0 was continued while main-taining normocapnia for additional 2 h.

Using a midline laparotomy incision, a Mini-mitterprobe (Mini-Mitter, Sunriver, OR) was introduced intothe peritoneal cavity to allow postoperative tempera-ture control and continuous monitoring of heart rateand movement. Surviving rats were tracheally extu-bated 2 h later after removal of catheters and placedseparately in a temperature-controlled cage (34.5°C for4 h) with supplemental oxygen for 18 h and free accessto food and water. Weight and neurologic status wereassessed daily, using Overall Performance Category(OPC; 1 � normal, 2 � mild disability, 3 � moderate


disability, 4 � severe disability, and 5 � death or braindeath) and a modified Neurologic Deficit Score9 (NDS;0%–10% � normal, 100% � maximum deficit). Post-operatively, the rats that did not resume normal eatingand drinking habits received supplemental subcuta-neous injections of 0.45NS/D5W (10 mL twice daily).

At 72 h after resuscitation, blood samples were ob-tained, and the rats were euthanized with an isofluraneoverdose and perfused via the left ventricle with normalsaline followed by 10% neutral buffered formalin.

HistologyThe tissue samples were processed for embedding

in paraffin. The resulting paraffin blocks were sequen-tially sectioned at 5 �m. All sections were stained withFluoro-Jade C (F-JC).10 For the Iba-1 staining, sectionswere washed in PBS, incubated in 0.3% H2O2 inmethanol for 30 min to inhibit endogenous peroxidaseactivity, washed in PBS, and blocked in PBS contain-ing 1.5% normal goat serum and 1% bovine serumalbumin for 2 h at RT. The sections were thenincubated with a rabbit anti-Iba1 polyclonal anti-body (1:500, Serotec) overnight at 4°C, washed inPBS, and incubated with a fluorescein isothiocyanate-conjugated goat antirabbit IgG antibody (Invitrogen) for2 h at RT. For control staining, normal rabbit IgG wasused as the primary antibody. After the reaction, thesections were counterstained with 4�,6-diamidino-2-phenylindole, dehydrated in ethanol steps, andmounted.

Adjacent sections obtained at approximately 4.3mm from bregma were used for assessing neuronaldeath and microglial activation within the selectivebrain regions. A photograph of representative sectionsof dentate gyrus and CA1 region was taken under 10�magnification. F-JC positive neurons and Iba-1-positive activated microglia (characterized by ame-boid cell body and retracted processes without thinramifications)11 were then counted using NationalInstitutes of Health Image-J software by an observermasked to the treatment group.

Statistical AnalysisRepeated measures analysis of variance was per-

formed, followed by Student–Newman–Keuls post hoctests, to identify differences in hemodynamic andarterial blood gas parameters and temperature amonggroups. One-way analysis of variance was used tocompare histologic damage among groups. The �2 testwas used to test the differences in proportions of OPCamong groups. Kruskal–Wallis H test was used tocompare NDS among groups. Mann–Whitney U-testwas used to compare two groups if Kruskal–Wallis Htest indicated there were differences between groups.Pearson and Spearman correlations between variableswere determined as appropriate. A P value �0.05 wasconsidered statistically significant.

RESULTSBaseline body weight before the experiment was

similar in all groups (RT, 387 � 3 g; IC, 385 � 1 g,RT-M, 386 � 10 g; P � 0.05). The surgical time did notdiffer among groups (RT, 98 � 7 min; IC, 99 � 19 min;RT-M 99 � 12 min, P � 0.05).

After cooling, rats in the IC group had significantlylower temperature during CA versus other groups(tympanic, 21°C vs 28°C; rectal, 20°C-25°C vs 27°C-30°C, P � 0.001) (Fig. 1). Rats in the IC group hadhigher mean arterial blood pressure during flush(35 � 5 vs 27 � 6 mm Hg, P � 0.05). Retained volume,i.e., the amount of flush that was not drained from thejugular catheter, was also lower in the IC group versusRT and RT-M groups combined (29 � 7 vs 42 � 4 mL,P � 0.001). Heart rate increased more slowly duringresuscitation in the IC versus RT group (P � 0.01) (Fig.2, Panel A). Mean arterial pressure was higher in theIC group versus RT group over time (P � 0.05; Fig. 2,Panel B). After discontinuation of temperature control,body core temperature increased more rapidly in theIC group. This steady increase reached statisticalsignificance versus the RT group but not the RT-Mgroup (P � 0.05 IC versus RT group, Fig. 3). However,all groups achieved normothermia at 24 h after resus-citation. While pH and base excess were similar at 5min after the start of resuscitation, lactate was lower inthe IC group versus other groups (P � 0.05) (Table 1).The survival rate was not different among groups.Neurological outcome was significantly better in theIC versus other groups (P � 0.05) (Table 2, Fig. 4). Themarkers of microglial activation but not neuronaldeath were attenuated in the IC versus other groups(Figs. 5–7). Selective vulnerability of CA1 neurons andhilar neurons in the dentate gyrus was observed (Figs.6 and 7), with proliferated microglial cells withameboid-shaped cell bodies and shortened, retractedprocesses. Microglial activation was attenuated in theIC group (Figs. 6 and 7, Panel E). There was a positivecorrelation between OPC and neuronal death (r � 0.566,P � 0.018). Similarly, there was a correlation betweenF-JC and Iba-1 (r � 0.513, P � 0.035). In contrast, therewas only a trend for a correlation between Iba-1 andneurologic outcome (Iba-1 versus OPC, r � 0.345, P �0.176; Iba-1 versus NDS, r � 0.393, P � 0.119).

We performed a formal necropsy on all rats thatdied before completion of the study. However, wewere not able to determine the cause of death in allrats. The common findings were pulmonary edemaand/or pulmonary hemorrhage. The time of death wasbetween 15 and 45 h of resuscitation in all the groups(RT, 29.5 � 14.1 h; IC, 13.1 h; RT-M, 24.0 � 7.5 h).

DISCUSSIONExsanguination CA is a relatively unexplored form

of CA. Resuscitation of exsanguination CA victims withconventional cardiopulmonary resuscitation techniquehas a poor prognosis because of a volume-depleted and

916 Hypothermia Attenuates Microglia ANESTHESIA & ANALGESIA

trauma-disrupted circulatory system. In the civilian set-ting, 50% of deaths caused by trauma occur at thescene and another 30% within hours from injury.12

More aggressive treatments with thoracotomy andaortic cross-clamping have also not improved thepoor outcome in these patients.2 The surgeon cannotobtain hemostasis and resuscitation before vitalorgans (particularly brain and heart) have sufferedirreversible ischemic damage. However, in an ap-propriate setting, many of those injuries would betechnically repairable.

Traditionally, deep hypothermic circulatory arrest(DHCA) has been used in cardiac surgery to provide abloodless field and enable repair of the congenitalcardiac malformations or acquired pathologies withconsiderable success. Hypothermia for deep hypo-thermic circulatory arrest (DHCA) is used in a protec-tive rather than a therapeutic fashion; the use ofhypothermia in EPR is a much more challenging

situation. In resuscitation of exsanguination CA, in-cluding EPR, the rapid onset of cooling can only beinitiated after a period of normothermic CA. Adjunctsto hypothermia would thus be of great potentialbenefit. Recently, we modified the rat EPR model toproduce a screening tool to study mechanisms ofneuronal death and evaluate novel therapeutic ad-juncts to hypothermia. Also it should be recognizedthat the use of a normothermic control group is notfeasible because the rats would not survive the insultif maintained normothermic throughout the period ofemergency preservation.

In our paradigm, we use 5 min of hemorrhagicshock followed by ice-cold or room-temperature flushinitiated 5 min after CA. This is a clinically relevantdelay that would allow cannulation of a large vessel.13

Flushing with either IC or RT saline resulted in a braintemperature of 21°C or 28°C, respectively. Better pro-tection achieved after IC flush was likely reflected by

Figure 1. Tympanic and rectal tem-peratures during cardiac arrest (CA).P � 0.001 ice-cold (IC) flush groupversus other groups.


lower lactate levels at 5 min after reperfusion andbetter neurologic function in survivors at 72 h. Thelatter was not affected by minocycline treatment.Despite the functional benefit with IC flush, neuronaldeath seen in traditionally selectively vulnerable brainregions did not differ among groups. We also notedrobust microglial activation surrounding the dyingneurons. Surprisingly, deep hypothermia (21°C) wasable to attenuate microglial activation but not neuro-nal damage. It is possible that hypothermia-inducedattenuation of microglial activation contributed to theimproved neurologic outcome in the IC group.

After discontinuation of the postoperative hypo-thermia, rats in the IC group spontaneously rewarmedmore quickly than rats in other groups. The attenua-tion of microglial activation in the IC group thus couldnot be explained by unintentional prolonged postop-erative hypothermia.

While the early brain injury in CA is believed toresult from release of excitatory mediators, energy

failure, oxidative stress, damage to mitochondria andendoplasmic reticulum, and cell signaling pathwaydisturbances in neurons, secondary damage couldalso be triggered by microglia, that transform intophagocytes. Microglial activation starts immediatelyafter ischemia and thus precedes the morphologicallydetectable neuronal damage.

Microglial activation has been suggested to contributeto delayed neuronal death, most likely through releasingneurotoxic substances, including reactive oxygen radi-cals, nitric oxide, and proinflammatory cytokines.6 Mi-croglial activation could contribute to neuronal death ormicroglial-mediated synaptic injury and/or neuronaldysfunction, which could mediate cognitive deficitseven in the absence of overt neuronal death. Additionalstudies focused on these secondary injury mechanismsin our model are warranted. Microglia could also have aprotective role,14–18 possibly in delayed repair afterinjury via elaboration of growth factors. Thus, there maybe a specific time window for benefit from inhibition of

Figure 2. Heart rate (top panel) andmean arterial blood pressure (bottompanel). a � P � 0.05 room-temperature(RT) flush versus room-temperatureflush followed by minocycline (RT-M)group; b � P � 0.05 ice-cold (IC) versusRT and RT-M groups; c � P � 0.05 RTversus IC group. BL � baseline; HS �end of hemorrhagic shock; CA � car-diac arrest; CPB � cardiopulmonarybypass; ICU � intensive care.


the early microglial contribution to damage. Recentstudies also suggested that the severity of neuronalinjury determines microglial release of “toxic” versus“protective” effectors.15 To visualize microglia, we choseto use anti-Iba-1 staining. Iba-1 is a calcium-bindingprotein expressed specifically in activated microglia,19

with its peak occurring at 4–7 days after injury.20 Whileresident microglia exist in a ramified state, after brain

injury they migrate toward the lesion, their cell bodybecomes ameboid-shaped, the processes shorten, andbecome virtually indistinguishable from macrophages.

Minocycline is a widely used antibiotic with anti-inflammatory and antiapoptotic properties which hasbeen tested in several models of neurologic injury,including global21–23 and focal brain ischemia,24–27

traumatic brain injury,28,29 spinal cord injury,30,31 and

Figure 3. Postoperative body coretemperature within the first 24 h. P �0.05 room-temperature (RT) versusice-cold (IC) group.

Table 1. Biochemical and Hematological Values After 20 min Cardiac Arrest Treated by Emergency Preservation and Resuscitation

BL1 BL2 CPB5 CPB60 ICU120 FINALpHa

RT 7.37 � 0.04 7.45 � 0.03* 6.99 � 0.05 7.41 � 0.05 7.40 � 0.04 7.46 � 0.06IC 7.40 � 0.04 7.40 � 0.05 7.00 � 0.08 7.36 � 0.12 7.45 � 0.04 7.49 � 0.06RT-M 7.39 � 0.04 7.36 � 0.06 6.95 � 0.07 7.42 � 0.03 7.40 � 0.04 7.48 � 0.03

Pao2RT 246 � 29 119 � 17† 454 � 32 386 � 31 273 � 97 497 � 96IC 328 � 111 271 � 52 536 � 49† 382 � 51 351 � 126 379 � 138RT-M 262 � 83 244 � 85 474 � 33 374 � 33 349 � 154 529 � 51

Paco2RT 47 � 6 30 � 4 34 � 3 42 � 7 48 � 7 33 � 6IC 42 � 6 37 � 6 37 � 9 40 � 9 44 � 1 33 � 8RT-M 44 � 3 43 � 6† 38 � 4 44 � 7 48 � 7 27 � 3

BERT 1 � 2 �1.9 � 2.4 �21 � 1.4 2.7 � 3.2 4.9 � 2.7 0.6 � 3.0IC 1.0 � 2.8 �0.7 � 2.1 �20.7 � 2.0 0.9 � 2.4 6.9 � 2.2 �0.6 � 1.6RT-M 1.1 � 2.2 �0.6 � 1.8 �21.8 � 1.5 2.2 � 2.6 6.3 � 3.3 �1.1 � 3.0

LactateRT 1.1 � 0.9 1.6 � 0.6 7.0 � 0.9 6.7 � 1.2 2.5 � 0.7 2.5 � 1.4IC 1.1 � 0.6 1.7 � 0.8 5.3 � 1.0† 5.7 � 2.0 4.2 � 2.6 3.6 � 1.4RT-M 1.2 � 1.1 1.8 � 1.0 6.9 � 0.8 6.5 � 1.6 3.1 � 2.1 4.3 � 1.5

HctRT 38 � 3 32 � 3 25 � 2 29 � 3 30 � 3 28 � 3IC 37 � 3 34 � 2 26 � 4 29 � 3 32 � 4 28 � 5RT-M 37 � 3 34 � 1 26 � 1 30 � 2 32 � 2 26 � 3

GlucoseRT 227 � 51 224 � 62 210 � 20 225 � 52 152 � 29 149 � 33IC 208 � 42 232 � 49 213 � 27 255 � 75 177 � 51 207 � 38RT-M 228 � 18 241 � 54 223 � 35 248 � 84 175 � 64 132 � 33

IC � ice-cold flush group; RT � room-temperature flush group; RT-M � RT flush followed by minocycline treatment group; BL � baseline; CPB � cardiopulmonary bypass; CPB5 � 5 min afterstart of CPB; CPB60 � at the end of CPB; ICU � intensive care unit; ICU120 � 2 h after CPB; FINAL � at 72 h; pHa � arterial pH; BE � base excess; Hct � hematocrit.* P � 0.05 RT versus RT-M group.† P � 0.05 IC versus RT and RT-M groups.


intracerebral hemorrhage.32 Most recently, minocy-cline showed favorable results in a clinical trial inacute stroke patients.33 It penetrates the blood-brainbarrier,34 reduces tissue injury, and improves functionalrecovery.21,35,36 The primary effect of minocycline isprobably inhibition of activation of microglia.21,22,24,30,37

Surprisingly, minocycline was also reported to bemore protective than brief hypothermia after focalcerebral ischemia.26,27 Specifically, inhibition of p38mitogen-activated protein kinase activation in mi-croglia has been suggested as a key mechanismunderlying minocycline antiinflammatory effects,although other mechanisms may also be involved.

In preliminary studies, we did not observe a ben-eficial effect with a lower dose of minocycline (3mg/kg IV followed by 45 mg/kg IP; data not shown).Thus, we chose to use the high-dose minocycline (20mg/kg IV followed by 90 mg/kg IP), which waspreviously used by others in similar settings.

In our study, hypothermia attenuated microglialactivation. Temperatures used in our study (21°C-28°C) were generally lower than those used in otherstudies of mild-to-moderate hypothermia. Postisch-emic hypothermia (32°C for 24 h) suppressed micro-glial activation after hypoxic-ischemic injury in thedeveloping brain.38 Even a brief period of hypother-mia (33°C for 2 h) attenuated neuroinflammation afterexperimental stroke and brain inflammation inducedby IV injection of lipopolysaccharide.39 A similar effectof hypothermia was observed in microglial cell cul-tures stimulated by lipopolysaccharide.40

Although many studies used minocycline as a drugsuppressing microglial activation, we did not see anyeffect of minocycline on microglia activation or neu-ronal death. This striking lack of effect could bepotentially explained by the fact that minocycline wasadded to augment the protective effects of preexistingmoderate hypothermia (28°C). It is possible that mi-nocycline could not add further benefit to hypother-mia. Moderate hypothermia in the 28°C group waslimited to the intraischemic time, followed by mildhypothermia for 6 h. Previous studies suggested thatthe onset of microglial activation starts at 24 h andpeaks at 4–7 days.20 In our study, we administeredminocycline up to 72 h. However, we cannot rule outthat hypothermia delayed or modified the course ofmicroglial activation, and therefore the dosing regi-men or assessment time were not optimal.

The lack of effect of minocycline in our EPR para-digm is not entirely surprising. Previously, we tested14 pharmacological adjuncts to hypothermia. Usingour similar moderate hypothermia canine model with20-min CA, only the antioxidant tempol showed somebenefit.41

Figure 4. Neurologic Deficit Score after20-min cardiac arrest treated by emer-gency preservation and resuscitation.Boxes represent interquartile ranges.The line across each box indicates themedian, and the whiskers are the high-est and lowest values. *P �0.05, room-temperature (RT) versus ice-cold (IC)group.

Table 2. Overall Performance Categories (OPC) After 20-minCardiac Arrest Treated by Emergency Preservation andResuscitation

OPC

No. of ratsa

RT IC RT-M5 � Death ••• • •••••4 � Severe disability3 � Moderate disability •••• ••2 � Mild disability •• •• •••1 � Normal •••• •a Each dot represents one rat.No differences among groups in survival rate (P � 0.05). Favorable neurological outcome(assessed by OPC) was significantly better in the IC group versus other groups (P � 0.05).IC � ice-cold flush group; RT � room-temperature flush group; RT-M � RT flush followed byminocycline treatment group.


Recently, there has been increasing evidence sug-gesting the neuroprotective role of microglia in centralnervous system pathologies. Selective ablation of mi-croglial cells before cerebral ischemia in vivo revealeda marked neuroprotective potential of proliferating

microglia, serving as an endogenous pool of neurotro-phic molecules such as IGF-1.16 Microglia cells werealso shown to protect neurons by direct engulfment ofinvading neutrophil granulocytes that infiltrate isch-emic lesions in an in vitro model.18 Despite robustmicroglial proliferation, we have not, however, ob-served neutrophil accumulation in our model.

In our study, NDS assessments were not verytightly coupled to hippocampal cell loss. Rats in the ICgroup that achieved favorable OPC and NDS scoresstill had substantial neuronal injury. Advanced neu-robehavioral testing will be needed in a future study todefine the association between hippocampal neuronalloss, microglial activation, and neurocognitive out-come. Our exploratory study was focused on thehistological markers of injury. Previously we haveshown that motor deficits observed in this complexmodel persist up to Day 7.42 This would requiredelaying the period of water maze tests until after Day7. The time of completion of water maze tasks wouldthen occur outside of the peak microglial activity.

We have observed a significant correlation betweenneuronal death and neurological outcome. A largernumber of animals would be necessary to appropriatelytest the hypothesis that microglial activation contributesto neurologic deficits. We cannot exclude that injuries inother brain regions or extracerebral injuries played a roleand influenced the neurologic outcome.

In conclusion, deeper levels of hypothermia com-pared with moderate hypothermia (21°C vs 28°C) in-duced by aortic flush resulted in better neurologicoutcome in survivors. Surprisingly, hypothermia attenu-ated microglial activation but not hippocampal neuronaldeath. Minocycline did not improve either neurologicoutcome or attenuate microglial activation in brain. Ourpreliminary findings suggest a potentially novel effect of

Figure 5. Neuronal death and microglial activation after20-min cardiac arrest (CA) treated by emergency preserva-tion and resuscitation (EPR) with either room-temperature(RT) flush, ice-cold (IC) flush, or room-temperature flushfollowed by minocycline treatment (RT-M) in the dentategyrus region of hippocampus. The line across each boxindicates the median, and the whiskers are the highest andlowest values. The round marker and the asterisk representoutliers of the respective groups.

Figure 6. Neuronal death and microglial proliferation after exsanguination cardiac arrest and emergency preservation andresuscitation with either room-temperature (RT) or ice-cold (IC) flush in the CA1 region of hippocampus. Blue staining is4�,6-diamidino-2-phenylindole, identifying neurons, and green staining is Fluoro-Jade C, Panels A–C, identifying dyingneurons, or anti-Iba-1 staining visualizing microglia (Panels D–F). Microglial activation is attenuated in the IC group.Representative samples from each group are shown. A, 10�: Hippocampal neuronal loss in a rat from the RT group. Full CA1loss. B, 10�: CA1 region in a rat from the IC group. Intensive neuropil staining between CA1 and dentate gyrus (DG). C, 10�:Hippocampal neuronal loss in a rat from RT-M group. D, 10�: Microglial activation in CA1-CA2 regions of hippocampus ina rat from the RT group. E, 10�: Microglial activation was attenuated in a rat from the IC group. F, 10�: Microglial activationwas marked in a rat from RT-M group despite high dose minocycline treatment. Scale bar in Panel A � 80 �m.


hypothermia on microglial activation during deep hypo-thermia. Further studies with comprehensive neurobe-havioral testing will be needed to further elucidate therole of microglia on functional outcome.

REFERENCES

1. Bellamy R, Safar P, Tisherman SA, Basford R, Bruttig SP,Capone A, Dubick MA, Ernster L, Hattler BG Jr, Hochachka P,Klain M, Kochanek PM, Kofke WA, Lancaster JR, McGowan FXJr, Oeltgen PR, Severinghaus JW, Taylor MJ, Zar H. Suspendedanimation for delayed resuscitation. Crit Care Med 1996;24:S24–47

2. Rhee PM, Acosta J, Bridgeman A, Wang D, Jordan M, Rich N.Survival after emergency department thoracotomy: review ofpublished data from the past 25 years. J Am Coll Surg 2000;190:288–98

3. Acosta JA, Yang JC, Winchell RJ, Simons RK, Fortlage DA,Hollingsworth-Fridlund P, Hoyt DB. Lethal injuries and time todeath in a level I trauma center. J Am Coll Surg 1998;186:528–33

4. Shoemaker WC, Peitzman AB, Bellamy R, Bellomo R, BruttigSP, Capone A, Dubick M, Kramer GC, McKenzie JE, Pepe PE,Safar P, Schlichtig R, Severinghaus JW, Tisherman SA, WiklundL. Resuscitation from severe hemorrhage. Crit Care Med1996;24:S12–23

5. Safar P, Tisherman SA, Behringer W, Capone A, Prueckner S,Radovsky A, Stezoski WS, Woods RJ. Suspended animation fordelayed resuscitation from prolonged cardiac arrest that isunresuscitable by standard cardiopulmonary-cerebral resuscita-tion. Crit Care Med 2000;28:N214–8

6. Gehrmann J, Banati RB, Wiessner C, Hossmann KA, KreutzbergGW. Reactive microglia in cerebral ischaemia: an early mediatorof tissue damage? Neuropathol Appl Neurobiol 1995;21:277–89

7. Stirling DP, Koochesfahani KM, Steeves JD, Tetzlaff W. Mino-cycline as a neuroprotective agent. Neuroscientist 2005;11:308–22

8. Drabek T, Stezoski J, Garman RH, Han F, Henchir J, TishermanSA, Stezoski SW, Kochanek PM. Exsanguination cardiac arrestin rats treated by 60 min, but not 75 min, emergency preserva-tion and delayed resuscitation is associated with intact outcome.Resuscitation 2007;75:114–23

9. Neumar RW, Bircher NG, Sim KM, Xiao F, Zadach KS,Radovsky A, Katz L, Ebmeyer E, Safar P. Epinephrine andsodium bicarbonate during CPR following asphyxial cardiacarrest in rats. Resuscitation 1995;29:249–63

10. Schmued LC, Hopkins KJ. Fluoro-Jade B: a high affinity fluo-rescent marker for the localization of neuronal degeneration.Brain Res 2000;874:123–30

11. Koshinaga M, Suma T, Fukushima M, Tsuboi I, Aizawa S,Katayama Y. Rapid microglial activation induced by traumaticbrain injury is independent of blood brain barrier disruption.Histol Histopathol 2007;22:129–35

12. Trunkey D. Initial treatment of patients with extensive trauma.N Engl J Med 1991;324:1259–63

13. Bregman D, Nichols AB, Weiss MB, Powers ER, Martin EC,Casarella WJ. Percutaneous intraaortic balloon insertion. Am JCardiol 1980;46:261–4

14. Neumann J, Gunzer M, Gutzeit HO, Ullrich O, Reymann KG,Dinkel K. Microglia provide neuroprotection after ischemia.FASEB J 2006;20:714–6

15. Lai AY, Todd KG. Differential regulation of trophic and proin-flammatory microglial effectors is dependent on severity ofneuronal injury. Glia 2008;56:259–70

16. Lalancette-Hebert M, Gowing G, Simard A, Weng YC, Kriz J.Selective ablation of proliferating microglial cells exacerbatesischemic injury in the brain. J Neurosci 2007;27:2596 – 605

17. Hayashi Y, Tomimatsu Y, Suzuki H, Yamada J, Wu Z, Yao H,Kagamiishi Y, Tateishi N, Sawada M, Nakanishi H. The intra-arterial injection of microglia protects hippocampal CA1 neu-rons against global ischemia-induced functional deficits in rats.Neuroscience 2006;142:87–96

18. Neumann J, Sauerzweig S, Ronicke R, Gunzer F, Dinkel K,Ullrich O, Gunzer M, Reymann KG. Microglia cells protectneurons by direct engulfment of invading neutrophil granulo-cytes: a new mechanism of CNS immune privilege. J Neurosci2008;28:5965–75

19. Ito D, Imai Y, Ohsawa K, Nakajima K, Fukuuchi Y, Kohsaka S.Microglia-specific localisation of a novel calcium binding pro-tein, Iba1. Brain Res Mol Brain Res 1998;57:1–9

20. Ito D, Tanaka K, Suzuki S, Dembo T, Fukuuchi Y. Enhancedexpression of Iba1, ionized calcium-binding adapter molecule 1,after transient focal cerebral ischemia in rat brain. Stroke 2001;32:1208–15

21. Fan LW, Lin S, Pang Y, Rhodes PG, Cai Z. Minocyclineattenuates hypoxia-ischemia-induced neurological dysfunc-tion and brain injury in the juvenile rat. Eur J Neurosci2006;24:341–50

22. Yrjanheikki J, Keinanen R, Pellikka M, Hokfelt T, Koistinaho J.Tetracyclines inhibit microglial activation and are neuroprotectivein global brain ischemia. Proc Natl Acad Sci USA 1998;95:15769–74

Figure 7. Neuronal death and microglial activation after exsanguination cardiac arrest and emergency preservation andresuscitation with either room-temperature (RT) or ice-cold (IC) flush in the dentate gyrus (DG) region of hippocampus. Bluestaining is 4�,6-diamidino-2-phenylindole, identifying neurons, and green staining is Fluoro-Jade C, identifying dyingneurons (Panels A–C), or anti-Iba-1 staining visualizing microglia (Panels D–F). Microglial activation (Panels D–F) isattenuated in the IC group (Panel E). Representative samples from each group are shown. Hippocampal neuronal loss in DG.Hilar neurons are selectively injured in all groups (A, 10�, RT group; B, 10�, IC group; C, 10�, RT-M group, respectively).D, 10�: Microglial activation in hippocampal DG in a rat from the RT group. E, 10�: Microglial activation was attenuated ina rat from the IC group. F, 10�: Microglial activation was marked in a rat from RT-M group despite high dose minocyclinetreatment. Scale bar in Panel A � 80 �m.


23. Arvin KL, Han BH, Du Y, Lin SZ, Paul SM, Holtzman DM.Minocycline markedly protects the neonatal brain againsthypoxic-ischemic injury. Ann Neurol 2002;52:54–61

24. Yrjanheikki J, Tikka T, Keinanen R, Goldsteins G, Chan PH,Koistinaho J. A tetracycline derivative, minocycline, reducesinflammation and protects against focal cerebral ischemia witha wide therapeutic window. Proc Natl Acad Sci USA 1999;96:13496–500

25. Liu Z, Fan Y, Won SJ, Neumann M, Hu D, Zhou L, WeinsteinPR, Liu J. Chronic treatment with minocycline preserves adultnew neurons and reduces functional impairment after focalcerebral ischemia. Stroke 2007;38:146–52

26. Wang CX, Yang T, Shuaib A. Effects of minocycline alone and incombination with mild hypothermia in embolic stroke. BrainRes 2003;963:327–9

27. Wang CX, Yang T, Noor R, Shuaib A. Delayed minocycline butnot delayed mild hypothermia protects against embolic stroke.BMC Neurol 2002;2:2

28. Sanchez Mejia RO, Ona VO, Li M, Friedlander RM. Minocyclinereduces traumatic brain injury-mediated caspase-1 activation,tissue damage, and neurological dysfunction. Neurosurgery2001;48:1393–9; discussion 1399–401

29. Bye N, Habgood MD, Callaway JK, Malakooti N, Potter A,Kossmann T, Morganti-Kossmann MC. Transient neuroprotec-tion by minocycline following traumatic brain injury is associ-ated with attenuated microglial activation but no changes in cellapoptosis or neutrophil infiltration. Exp Neurol 2007,204:220–33

30. Stirling DP, Khodarahmi K, Liu J, McPhail LT, McBride CB,Steeves JD, Ramer MS, Tetzlaff W. Minocycline treatmentreduces delayed oligodendrocyte death, attenuates axonal die-back, and improves functional outcome after spinal cord injury.J Neurosci 2004;24:2182–90

31. Festoff BW, Ameenuddin S, Arnold PM, Wong A, Santacruz KS,Citron BA. Minocycline neuroprotects, reduces microgliosis,and inhibits caspase protease expression early after spinal cordinjury. J Neurochem 2006;97:1314–26

32. Power C, Henry S, Del Bigio MR, Larsen PH, Corbett D, Imai Y,Yong VW, Peeling J. Intracerebral hemorrhage induces macro-phage activation and matrix metalloproteinases. Ann Neurol2003;53:731–42

33. Lampl Y, Boaz M, Gilad R, Lorberboym M, Dabby R, RapoportA, Anca-Hershkowitz M, Sadeh M. Minocycline treatment inacute stroke: an open-label, evaluator-blinded study. Neurology2007;69:1404–10

34. Saivin S, Houin G. Clinical pharmacokinetics of doxycyclineand minocycline. Clin Pharmacokinet 1988;15:355–66

35. Hewlett KA, Corbett D. Delayed minocycline treatment reduceslong-term functional deficits and histological injury in a rodentmodel of focal ischemia. Neuroscience 2006;141:27–33

36. Yenari MA, Xu L, Tang XN, Qiao Y, Giffard RG. Microgliapotentiate damage to blood-brain barrier constituents: improve-ment by minocycline in vivo and in vitro. Stroke 2006;37:1087–93

37. Fan LW, Pang Y, Lin S, Rhodes PG, Cai Z. Minocyclineattenuates lipopolysaccharide-induced white matter injury inthe neonatal rat brain. Neuroscience 2005;133:159–68

38. Fukui O, Kinugasa Y, Fukuda A, Fukuda H, Tskitishvili E,Hayashi S, Song M, Kanagawa T, Hosono T, Shimoya K, MurataY. Post-ischemic hypothermia reduced IL-18 expression andsuppressed microglial activation in the immature brain. BrainRes 2006;1121:35–45

39. Deng H, Han HS, Cheng D, Sun GH, Yenari MA. Mild hypo-thermia inhibits inflammation after experimental stroke andbrain inflammation. Stroke 2003;34:2495–501

40. Maekawa S, Aibiki M, Si QS, Nakamura Y, Shirakawa Y,Kataoka K. Differential effects of lowering culture temperatureon mediator release from lipopolysaccharide-stimulated neona-tal rat microglia. Crit Care Med 2002;30:2700–4

41. Behringer W, Safar P, Kentner R, Wu X, Kagan VE, Radovsky A,Clark RS, Kochanek PM, Subramanian M, Tyurin VA, TyurinaYY, Tisherman SA. Antioxidant Tempol enhances hypothermiccerebral preservation during prolonged cardiac arrest in dogs.J Cereb Blood Flow Metab 2002;22:105–17

42. Drabek T, Fisk JA, Dixon CE, Garman RH, Stezoski J,Wisnewski SR, Wu X, Tisherman SA, Kochanek PM. Prolongeddeep hypothermic circulatory arrest in rats can be achievedwithout cognitive deficits. Life Sci 2007;81:543–52


General Article

The Safety of Modern Hydroxyethyl Starch in Living DonorLiver Transplantation: A Comparison with Human Albumin

Ahmed Mukhtar, MD*

Fawzia Aboulfetouh, MD*

Gihan Obayah, MD*

Maged Salah, MD*

Mohamed Emam, MD*

Yehia Khater, MD*

Ramzia Akram, MD†

Aly Hoballah, MD†

Mohamed Bahaa, MD‡

Mahmoud Elmeteini, MD‡

Alaa Hamza, MD‡

BACKGROUND: Intravascular volume replacement therapy is an important issue inthe perioperative management of liver transplantation. There is paucity of data onthe safety of hydroxyethyl starch (HES) in patients undergoing liver transplanta-tion. We evaluated the safety of a new HES 130/0.4 in the perioperative manage-ment of liver transplantation, with a special emphasis on renal function.METHODS: Forty patients undergoing living donor liver transplantation were pro-spectively randomized into two groups. Patients in the ALB group (n � 20)received 5% human albumin. Patients in the HES group (n � 20) received thirdgeneration HES (6% HES 130/0.4). Total colloid administration was limited to 50mL � kg�1 � d�1. The volume was given to maintain pulmonary artery occlusionpressure or central venous pressure between 5 and 7 mm Hg. If additional fluidswere required, balanced crystalloid solution was used. Anesthetic and surgicaltechniques were standardized. Serum creatinine and cystatin C plasma levels weremeasured from arterial blood samples after induction of anesthesia, at the end ofsurgery, and on the first 4 postoperative days.RESULTS: All 40 enrolled patients completed the study. Demographic and intraop-erative variables were comparable in both groups. Postoperatively, the mean � sdvolume was 6229 � 1140 mL and 4636 � 1153 mL in HES and ALB groups,respectively (P � 0.003). There was significantly larger net cumulative fluid balancein the ALB group 1100 � 900 mL compared with the HES group 3047 � 2000 mL,P � 0.029. Serum creatinine, creatinine clearance, and cystatin C plasma levelsshowed no significant differences between the two groups. One patient in eachgroup developed acute renal failure requiring renal replacement therapy.CONCLUSION: The use of HES 130/0.4 as an alternative to human albumin resulted inequivalent renal outcome after liver transplantation.(Anesth Analg 2009;109:924–30)

Hypovolemia is frequently encountered duringliver transplantation.1 Fluid management remains acontroversial subject in perioperative medicine andorgan transplantation. Colloids may be preferred tocrystalloids to maintain effective cardiac output andtissue oxygenation.2 The ideal colloid therapy has notbeen studied in patients undergoing liver transplant.Albumin is a naturally occurring colloid and the main-stay of therapy in many centers3 because its oncotic,antiinflammatory, and antioxidant effects have beendemonstrated in animal and experimental studies.4

Hydroxyethyl starch (HES) is a widely used, inexpen-sive alternative to human albumin for correcting hypo-volemia. HES solutions are polydisperse, comprising adistribution of molecular sizes. The polyglucose chains

closely resemble glycogen with predominant 1–4 bind-ings. The merits of HES types reside in its mean molecu-lar weight, molar substitution, and C2/C6 ratio. Its rateof metabolism and the in vivo molecular weight areprimarily determined by molar substitution and C2/C6ratio.5

Renal dysfunction is one of the most commoncomplications in the postoperative course after livertransplantation, with an incidence of 12%–70%.6 Theneed for renal replacement therapy is associated with40%–90% mortality.7 Potential risk factors for renalimpairment in the perioperative phase of liver trans-plantation include preexisting comorbidities, isch-emic, or toxic insults to the kidneys during surgery asa result of hemodynamic instability and hypovolemiaor repeated use of nephrotoxic drugs.8

Multiple authors have expressed concern aboutHES-associated renal dysfunction.9,10 Although somestudies have found HES solutions to have little effecton renal function,11,12 others have shown cause forconcern.13,14 However, neither patients with end-stageliver disease nor those with hypoalbuminemia wereincluded in these studies.

Based on these data, renal function was the primaryend point in this study. Our hypothesis was that

From the *Department of Anesthesia and Intensive Care, CairoUniversity, Giza; †Wadi-Alneel Liver Transplant Center, Cairo, Egypt;and ‡Department of Surgery, Ain Shams University, Cairo, Egypt.

Accepted for publication April 13, 2009.Supported by Wadi-Alneel Liver Transplant Center.Address correspondence and reprint requests to Ahmed M.

Mukhtar, 2 Zaafran St., Cairo, Egypt. Address e-mail to [email protected].


DOI: 10.1213/ane.0b013e3181aed54f


human albumin would preserve perioperative renalfunction better than HES.

METHODSAfter approval of the local Ethics Committee and

obtaining written informed consent, we studied 40patients with end-stage liver disease, scheduled forliving donor liver transplantation. We excluded pa-tients undergoing retransplantation, patients with ahistory of previous upper abdominal surgery, patientswith portal vein thrombosis (diagnosed with preop-erative duplex ultrasound), patients younger than18-yr-old, and patients with primary renal dysfunc-tion “diagnosed by examination of urinary sedimentand urinary chemistry, as well as appropriate ultra-sonographic and radiological investigations.”15 Pa-tients with hepatorenal disease were not excluded.

Patients were randomly allocated to receive either6% HES 130/0.4 (Voluven, Fresenius Kabi, Bad Hom-bourg, Germany) (HES group: n � 20) or albumin 5%(ALB group: n � 20) as their colloid during theintraoperative period and first 4 postoperative days,with a maximum dosage of 50 mL � kg�1 � d�1. Ran-domization was done by the attending physicianopening a sealed envelope.

Anesthesia was induced with IV propofol, fentanyl, andatracurium. Anesthesia was maintained with sevofluraneadjusted between 1% and 2% in an oxygen/air mixture, afentanyl infusion at 1–2 �g � kg�1 � h�1, and an atracuriuminfusion at 0.5 mg � kg�1 � h�1. Mechanical ventilationwas provided by a Primus anesthesia machine(Drager, Germany) using a tidal volume of 8–10mL/kg with the respiratory rate adjusted to maintainPaco2 between 30 and 35 mm Hg. All patients weremonitored for temperature, noninvasive and invasivearterial blood pressure, 5-lead electrocardiogram, pe-ripheral oxygen saturation, end-tidal carbon dioxidetension, hourly urinary output, central venous pres-sure (CVP), and pulmonary artery occlusion pressure(PAOP). A pulmonary artery catheter (OPTIQSVO2/CCO Abbott Laboratories, North Chicago, IL)was inserted into the right internal jugular vein.

In both groups, Ringer acetate solution was admin-istered routinely at 10 mL � kg�1 � h�1. The patientsreceived a 250 mL bolus of either Voluven (HESgroup) or albumin 5% (ALB group) with a maximumadministration of 50 mL � kg�1 � d�1 to maintain CVPbetween 5 and 7 mm Hg. Ringer acetate solution wasgiven if additional fluid replacement was required.Blood transfusion was given based on a hemoglobin level(�7 g/dL). Norepinephrine was administered if the meanarterial blood pressure was �70 mm Hg and if the systemicvascular resistance was �600 dyne � s�1 � cm�5. Epineph-rine was administered if the mean arterial bloodpressure was �70 mm Hg and the cardiac index was�2.5 L � min�1 � m�2, despite sufficient volume infu-sion to maintain a target cardiac index of 2.5–3.0L � min�1 � m�2.

We typically tracheally extubate transplant recipients6–8 h after admission to the intensive care unit (ICU).16

We administered propofol by continuous infusion at0.5–1 mg � kg�1 � h�1 until patients were normother-mic and hemodynamically stable. The criteria forextubation included normal neurologic status, stablehemodynamics requiring minimal vasopressors sup-port (e.g., �0.1 �g � kg�1 � min�1 norepinephrine), andadequate pulmonary function (e.g., spontaneous ven-tilation for a minimum of 30 min with respiratory ratebetween 10 and 20/min, Paco2 �50 mm Hg, pH �7.30,and Pao2 �75 mm Hg on a Fio2 �40%).

Postoperatively, intravascular volume replacement(albumin 5% or HES 130/0.4) was given to maintainthe CVP and/or PAOP between 5 and 7 mm Hg.Packed red blood cells were given if the hemoglobinwas �8 g/dL. Fresh frozen plasma was given only tomaintain hemostasis (e.g., if the international normal-ized ratio [INR] was �1.5 with evidence of increasedbleeding from the surgical drains). Platelets weretransfused if the platelet count was �20,000/cm3.Urine output was measured every hour. Furosemide20 mg was given IV if the urine output decreased to�0.5 mL � kg�1 � h�1.

Enteral feeding was initiated when there was anevidence of bowel movement. Patients were dis-charged from the ICU once they were alert andcooperative, did not require inotropic or ventilatorsupport, did not require IV intravascluar volumereplacement, and were able to maintain oral intake.

Measured VariablesHemodynamic VariablesHeart rate, mean arterial blood pressure, PAOP,

CVP, and cardiac output (using a pulmonary arterycatheter) were monitored. Hemodynamic data wererecorded after induction of anesthesia and beforevolume administration, at the end of the preanhe-patic phase, at the end of the anhepatic phase, at theend of the surgery, and on the first 4 days aftersurgery.

Assessment of Renal FunctionRenal function of all enrolled patients was moni-

tored by measuring serum creatinine, serum cystatinC, and by calculating creatinine clearance (CrCl) usinga complete 24-h urine collection. Blood samples weredrawn between 8 and 9 am. Serum creatinine wasdetermined by means of Jaffe reaction.17 The serumcystatin C concentration was measured by means oflatex-amplified nephelometry using the N Latex Cys-tatin C diagnostic kit (Dade Behring Diagnostic, Man-heim, Germany) and the BN-II system (Dade BehringDiagnostic).18 Serum creatinine and cystatin C weremeasured after induction of anesthesia, at the end ofsurgery, and on the first 4 days postoperatively. CrClwas measured on postoperative Days 1, 3, and 5. Both


creatinine and CrCl were measured at the time ofdischarge from the hospital.

Laboratory VariablesLiver function tests (aspartate aminotransferase,

alanine aminotransferase, INR, and bilirubin), serumalbumin level, and serum amylase were obtained forthe first 4 days in the ICU.

Other VariablesIntravascular volume replacement therapy, includ-

ing crystalloid and colloid infusion, and blood andplasma transfusion were recorded daily during thefirst 4 days in the ICU. Urine output, the dose ofdiuretics, and fluid balance (calculated as fluid inputminus fluid output) were collected.

The duration of mechanical ventilation (the timebetween ICU admission and tracheal extubation), startof enteral feeding, ICU stay, and hospital stay weredocumented. All complications including rejectionepisodes, renal replacement therapy, pulmonary com-plications, nosocomial infection, and reoperation wererecorded.

StatisticsPower analysis was performed using Student’s

t-test for independent samples on CrCl 24 h aftersurgery because it was the main outcome variable inthis study. Our previous study showed that the stan-dard deviation of CrCl in posttransplant patients wasnearly 20 mL/min.19 Based on the assumption that amean difference of 20 mL/min was considered aclinically significant difference between groups andtaking power 0.8 and � error 0.05, a minimum samplesize of 17 patients was calculated for each group.Twenty patients in each group were included tocompensate for possible dropouts.

Categorical variables were assessed using �2 orFischer’s exact test where appropriate. Normally dis-tributed data are presented as mean (sd) and wereanalyzed using Student’s t-test and two-way analysesof variance with repeated measures and post hocDunnett test as appropriate. Data not normally dis-tributed (tested by Kolmogorov-Smirnov test) are pre-sented as median (range) and were analyzed withMann–Whitney U-test or the Kruskal–Wallis test asappropriate. The software SPSS v15.0 for Windows(SPSS, Chicago, IL) was used for statistical analysis.

Analysis of Effect SizePost hoc power analysis was based on univariate

repeated measures analysis of variance to determinethe effects of IV fluid type on CrCl. The univariatemodel was used after establishing that the assump-tions of sphericity and compound symmetry were met(P � 0.05). Greenhouse-Geisser correction was usedfor violation of the sphericity assumption.20,21 Post hocpower calculations were performed using the com-puter program G*Power 3.0 for Windows (Franz Faul,Universitat Kiel, Germany).

RESULTSAll 40 enrolled patients completed the study. De-

mographic data were comparable in the two groups(Table 1). All three patients with severe renal impair-ment (baseline CrCl �30 mL/min) were randomizedto the HES treatment group.

Both study groups were comparable regardingischemia time, operative time, duration of postopera-tive mechanical ventilation, and the start of enteralfeeding. Comparable results were also found in ICUstay and hospital stay (Table 1). One patient in eachgroup needed renal replacement therapy during theICU stay on the sixth and seventh postoperative days.No postoperative pulmonary complications were re-corded between the study groups. Mild to moderaterejection was documented in both groups by biopsy(three in HES group and four in the ALB group).

One patient in each group died during the hospitalstay. The cause of death was sepsis and multiple organfailure 2 wk after surgery.

The mean � sd volume of the study colloid admin-istered introperatively was 3500 � 1000 mL in the ALBgroup comparable with that administered in the HESgroup, which was 3080 � 417. The mean volume was6229 � 1140 mL and 4636 � 1153 mL in the HES andALB groups, respectively, P � 0.003. This resulted insignificantly greater net cumulative fluid balance inthe HES group 3047 � 2000 mL compared with theALB group 1100 � 900 mL, P � 0.029.

The use of crystalloids, packed red blood cells, freshfrozen plasma, and urine output did not differ be-tween the two groups. However, use of diuretics was

Table 1. Demographic and Perioperative Data

ALB(n � 20)

HES(n � 20)

Age (yr) 51 � 6 55 � 5.8Gender (M/F) 16/4 19/1Body mass index 29.9 � 5.3 26.2 � 4Child classification

Child B/C 4/16 3/17Diagnosis

HCV 17 18HCV � HCC 3 2MELD 15 (12–19) 15 (8–20)Diabetes 7 8CrCl (mL/min) 77 (36–194) 100 (24–129)CrCl �50 mL/min 15 11CrCl 30–50 mL/min 5 6CrCl �30 mL/min 0 3GWR (%) 1 � 0.13 1.1 � 0.2Ischemia time (min) 104 � 14 94 � 45Operative time (min) 645 � 99 640 � 104Mechanical ventilation (h) 12.5 � 2.2 12 � 3Reoperation 3 1Start of enteral feeding (d) 2.1 � 0.4 2.2 � 0.5ICU stay (d) 4.5 � 0.5 5 � 0.2Hospital stay (d) 23 � 4 27 � 3

Data are mean � SD, median (range), or number of patients.ALB � albumin; HES � hydroxyethyl starch; CrCl � creatinine clearance; MELD � model forend-stage liver disease; GWR � graft weight ratio; ICU � intensive care unit; HCV � hepatitisC virus; HCC � hepatocellular cardinoma.

926 HES and Liver Transplantation ANESTHESIA & ANALGESIA

significantly greater in the HES group compared withthe ALB group (Table 2).

Hemodynamic variables did not differ between thetwo groups except for CVP and PAOP, which weregreater in the ALB group compared with the HESgroup on Days 1 and 2 (Tables 3 and 4).

Serum creatinine and CrCl were similar in bothgroups throughout the entire study period (Figs. 1 and2). The cystatin C plasma level tended to be higher inthe HES group on Days 2 and 3, but this difference didnot reach statistical significance (P � 0.08) (Fig. 3).

There were no significant differences in other lab-oratory data (bilirubin, alanine aminotransferase, as-pertate aminotransferase, and INR) between the twostudy groups. The serum albumin concentration washigher in the ALB group. Serum amylase was higherin the HES group (Table 5).

Effect Size AnalysisBased on the observed pooled standard deviation

in CrCl of 24.47 mL/min and the mean correlationamong the five measurements of CrCl was 0.601, ourstudy with a sample size of 40 subjects who wererandomized into a balanced within-between (mixedrepeated measures) design with an assumed � errorprobability of 0.05 and � error probability of 0.2allowed detection of a between-factor effect size of 0.38. This translates to a between-group mean CrCldifference of 18.36 mL/min, and it represents theminimum detectable mean difference, which could befound with this study by a power of 80%. Based onthese data, our study has a power of 86.3% to detect apresumed minimum clinically significant difference of20 mL/min in CrCl.

DISCUSSIONThe main result of this study was that the use of

modern HES 130/0.4 exerted no adverse effect onkidney function in living donor liver transplantationwhen compared with albumin 5%.

The incidence of postoperative renal impairment inorthotopic liver transplantation is common, as high as70%, which is still associated with considerable mor-bidity and mortality.22 Considering the effect of col-loid therapy on renal function in patients undergoingliver transplantation, it is extremely important to beable to make use of highly sensitive indicators ofglomerular filtration rate to identify renal dysfunctionearly and assess its severity. In addition to assessingserum creatinine and 24-h CrCl, we measured serumcystatin C, a protein of low molecular weight (13 kDa)that is constantly produced by all nucleated cells andis not affected by age, gender, or muscle mass.23

Several studies have found cystatin C superior tocreatinine as a marker of kidney function immediatelyafter liver transplantation.24,25

This study found no deleterious effects on renalfunction with the use of HES 130/0.4 as a primarycolloid therapy during surgery and in the early post-operative period, as measured by serum creatinine,CrCl, and plasma cystatin C. Serum cystatin C tendedto be higher in the HES group, although it did notreach a statistically significant difference, which mightbe explained by the fact that three patients with severerenal impairment were randomly assigned to the HESgroup.

In kidney transplant patients, osmotic nephrosiswas found after receiving the less-metabolizable HESspecification (HES 200/0.62).26,27 Different HES mol-ecules have different physico-chemical properties ac-cording to molecular weight, molar substitution (molehydroxyethyl residue per mole glucose subunit), andthe C2/C6 ratio. The higher the molar substitution, theslower is the breakdown and elimination of the mol-ecule. Plasma clearance of HES 130/0.4 is at least 20times faster than that of hetastarch and pentastarch.28

Hemodynamics in both groups in our study weresimilar over the entire study period. However, weneeded significantly more HES than albumin to main-tain the intravascular volume in our target population.In line with our result, Persson and Grande29 demon-strated that the plasma-expanding effects after hem-orrhage were significantly greater with 20 mL/kg of5% human albumin than with the same amount of 6%HES 130/0.4.

In our center, we did not routinely use albumin 20%to correct the serum albumin level after liver trans-plantation.19 Accordingly, patients in the HES groupexperienced a more severe degree of hypoalbumin-emia compared with the other group, with an absoluteminimum serum albumin concentration reaching 0.7g/dL in the HES group at the end of surgery. Theplasma albumin concentration is the intravascular

Table 2. Infused Volumes, Diuretics, and Urine Output DataAre Mean � SD or Median (Range)

Intraoperative PostoperativeColloids (mL)

ALB 3500 � 1000 4636 � 1153HES 3080 � 417 6229 � 1140*

Crystalloids (mL)ALB 4944 � 1261 12579 � 2054HES 4416 � 874 12221 � 2073

Urine output (mL)ALB 1360 � 681 8859 � 1730HES 1390 � 659 8607 � 1306

Furosemide (mg)ALB 80 (30–180) 20 (0–80)HES 40 (20–160) 65 (0–180)*

PRBCs (units)ALB 4 (0–6) 4 (0–8)HES 4 (0–10) 2 (0–8)

FFPALB 2 (0–8) 0 (0–6)HES 0 (0–6) 0 (0–8)

ALB � albumin; HES � hydroxyethyl starch; PRBCS � packed red blood cells; FFP � freshfrozen plasma.* Significance compared with the other group (P � 0.05).


albumin mass divided by the plasma volume. Dilutionsecondary to HES infusion and redistribution second-ary to altered vascular permeability may be the causeof the rapid reduction in serum albumin concentrationthat was observed in patients assigned to the HESgroup.

Postoperative fluid overload is a risk factor forpostoperative pulmonary complications after livertransplantation.30 In our study, the duration of me-chanical ventilation and postoperative pulmonarycomplications were the same in both study arms.

One major concern about the use of HES prepara-tions is the potential for inducing disorders in coagu-lation.31 In this study, routine coagulation tests did not

Figure 1. Change in serum creatinine throughout the studyprotocol. Values are mean � sd. HES � hydroxyethyl starch.

Figure 2. Change in creatinine clearance throughout the studyprotocol. Values are mean � sd. HES � hydroxyethyl starch.

Table 3. Intraoperative Hemodynamic Data

BaselineEnd of

preanhepaticEnd of

anhepaticEnd ofsurgery

HR (bpm)ALB 83 � 12.5 94 � 13 97 � 9 95 � 7HES 75.3 � 10.4 91 � 17 97 � 18 98 � 18

MAP (mm Hg)ALB 87.5 � 6 82 � 11 84 � 13 85.5 � 19HES 94.6 � 19.6 83 � 13 75 � 13 92 � 7

CVP(mm Hg)ALB 8 � 3 6 � 3 3.8 � 2 6 � 1.9HES 7 � 2 6 � 1 4.5 � 2.3 6 � 2.7

PAOP(mm Hg)ALB 10 � 4 10 � 3 6 � 3 10 � 3HES 11 � 3 8 � 2 7.6 � 2.8 9 � 3

CO (L/min)ALB 8.2 � 2.9 10.2 � 2.4 8.5 � 2 10 � 3.4HES 9 � 3 9.4 � 3.9 8 � 2.5 12 � 2.1

Values are mean � SD.ALB � albumin; HES � hydroxyethyl starch; HR � heart rate; MAP � mean arterial blood pressure; CVP � central venous pressure; PAOP � pulmonary artery occlusion pressure; CO � cardiacoutput.

Table 4. Postoperative Hemodynamic Data

Day 1 Day 2 Day 3 Day 4HR (bpm)

ALB 115.8 � 5.5 112 � 4 106 � 4 97 � 5HES 117 � 4 115 � 4 106 � 5 102 � 9

MAP (mm Hg)ALB 91 � 6 102 � 2.5 91 � 9 100 � 10HES 93 � 5.6 98 � 7 94 � 8 103 � 4

CVP (mm Hg)ALB 4.8 � 0.7 5.6 � 1.8 5 � 1 5.6 � 1HES 2.3 � 0.8* 2.8 � 0.7* 4 � 0.8 6.6 � 2.8

PAOP (mm Hg)ALB 8.8 � 0.7 9.6 � 1.8 8.8 � 1 9 � 1HES 6.5 � 1* 6.8 � 0.7* 9 � 2 8 � 0.8

CO (L/min)ALB 9.5 � 1 9 � 1.3 7.7 � 0.4 6.6 � 0.8HES 10 � 1.6 8.8 � 1.1 7.8 � 0.8 7.5 � 0.5

Values are mean � SD.ALB � albumin; HES � hydroxyethyl starch; HR � heart rate; MAP � mean arterial blood pressure; CVP � central venous pressure; PAOP � pulmonary artery occlusion pressure; CO � cardiacoutput.* Significance compared with the other group (P � 0.05).


differ between the two groups. Our study sample sizewas not sufficient to address whether HES 130/0.4 canalter the coagulation profile. Moreover, in vitro coagu-lation tests do not represent the balance of coagulationas it occurs in vivo, which may explain why the manyin vitro tests are not good predictors of bleeding inpatients with liver disease.32

The serum amylase level was significantly higher inthe HES group throughout our study protocol. Al-though it was judged to be clinically irrelevant, anincrease in amylase may confound the diagnosis ofacute pancreatitis, which occurs in 3% of patients afterliver transplantation.33

There were several limitations in this study. We didnot study the influence of volume therapy on the integ-rity of renal tubular function by using new sensitivemarkers, such as N-acetyl-�-d-glucosaminidase and glu-tathione transferase-�. Most of our patients had nearlynormal kidney function before transplant. We cannotconclude that HES 130/0.4 is as safe as albumin 5% inliver-transplanted patients with more severe renal im-pairment before transplant. We also did not gatherlong-term follow-up data in this study.

In conclusion, the perioperative use of HES 130/0.4up to 50 mL � kg�1 � d�1 had no impact on renalfunction or patient outcome during early hospitaliza-tion in patients undergoing orthotropic liver trans-plantation. Further, larger studies are warranted toaddress the nonrenal safety of using HES in liver-transplanted patients.

REFERENCES

1. Schrier RW. Decreased effective blood volume in edematousdisorders: what does this mean? J Am Soc Nephrol 2007;18:2028 –31

2. Funk W, Baldinger V. Microcirculatory perfusion during vol-ume therapy. A comparative study using crystalloid or colloidin awake animals. Anesthesiology 1995;82:975–82

3. Merritt WT. Practice patterns and anesthesia-related costs forliver transplantation. Liver Transpl Surg 1997;3:449–50

4. Margarson MP, Soni N. Serum albumin: touchstone or totem?Anaesthesia 1998;53:789–803

5. Treib J, Baron JF, Grauer MT, Strauss RG. An international viewof hydroxyethyl starches. Intensive Care Med 1999;25:258–68

6. Chuang FR, Lin CC, Wang PH, Cheng YF, Hsu KT, Chen YS,Lee CH, Chen CL. Acute renal failure after cadaveric relatedliver transplantation. Transplant Proc 2004;36:2328–30

7. Faenza S, Santoro A, Mancini E, Pareschi S, Siniscalchi A,Zanzani C, Pinna AD. Acute renal failure requiring renalreplacement therapy after orthotopic liver transplantation.Transplant Proc 2006;38:1141–2

8. Biancofiore G, Davis CL. Renal dysfunction in the perioperativeliver transplant period. Curr Opin Organ Transplant 2008;13:291–7

9. Dickenamm MJ, Filipovic M, Schneider MC, Brunner FP.Hydroxyethylstarch-associated transient acute renal failure af-ter epidural anaesthesia for labour analgesia and Caesareansection. Nephrol Dial Transplant 1998;13:2706

10. Wiedermann CJ. Renal impairment in cardiac surgery patientsreceiving hydroxyethyl starch. Intensive Care Med 2004;30:519–20;author reply 21

11. Boldt J, Brosch C, Ducke M, Papsdorf M, Lehmann A. Influenceof volume therapy with a modern hydroxyethylstarch prepara-tion on kidney function in cardiac surgery patients with com-promised renal function: a comparison with human albumin.Crit Care Med 2007;35:2740–6

12. Sakr Y, Payen D, Reinhart K, Sipmann FS, Zavala E, Bewley J,Marx G, Vincent JL. Effects of hydroxyethyl starch administra-tion on renal function in critically ill patients. Br J Anaesth2007;98:216–24

13. Winkelmayer WC, Glynn RJ, Levin R, Avorn J. Hydroxyethylstarch and change in renal function in patients undergoingcoronary artery bypass graft surgery. Kidney Int 2003;64:1046–9

14. Mahmood A, Gosling P, Vohra RK. Randomized clinical trialcomparing the effects on renal function of hydroxyethyl starch orgelatine during aortic aneurysm surgery. Br J Surg 2007;94:427–33

15. Arroyo V, Cardenas A, Campistol JM, Gines P. Acute renalfailure in liver disease. In: Davison A, Stewart CJ, Grunfeld JP,Kerr DNS, Ritz E, Winearls CG, eds. Oxford textbook of clinicalhepatology. London: Oxford Press, 2005:1564–79

16. Abofetouh F, Khater Y, Mukhtar A, Salah M, Khedr H, HamedH, Badawy S. Perioperative management in adult and pediatricliving related liver transplantation: an Egyptian experience. IntAnesthesiol Clin 2006;44:127–36

Figure 3. Change in serum cystatin C throughout the studyprotocol. Values are mean � sd. HES � hydroxyethyl starch.

Table 5. Postoperative Laboratory Investigation

ALB(n � 20)

HES(n � 20)

Bilirubin (mg/dL)Day 1 7.8 � 2.5 6.2 � 2.7Day 2 3.3 � 1.8 4 � 2.1Day 3 3.8 � 2.0 3.1 � 1.6Day 4 4.3 � 2.7 3.4 � 2

AST (U/L)Day 1 609 � 424 590 � 381Day 2 316 � 232 494 � 370Day 3 183 � 190 250 � 200Day 4 74 � 36 130 � 78

ALT (U/L)Day 1 611 � 472 600 � 414Day 2 548 � 400 635 � 530Day 3 425 � 300 568 � 441Day 4 288 � 200 345 � 300

INRDay 1 2.6 � 1.4 2.1 � 0.2Day 2 2.2 � 0.3 2.0 � 0.3Day 3 1.5 � 0.2 1.4 � 0.27Day 4 1.3 � 0.1 1.3 � 0.2

AmylaseDay 1 51 � 27 207 � 151*Day 2 67 � 41 147 � 105*Day 3 85 � 70 188 � 82*Day 4 53 � 25 152 � 93*

Values are mean � SD.ALB � albumin; HES � hydroxyethyl starch; AST � aspartate aminotransferase; ALT �alanine aminotransferase; INR � international normalized ratio.*Significance compared with the other group (P � 0.05).


17. Habazin-Novak V, Plestina R. A microcolorimetric determina-tion of creatinine in serum or plasma by the Jaffe’s reaction. ArhHig Rada Toksikol 1979;30:25–32

18. Finney H, Newman DJ, Gruber W, Merle P, Price CP. Initialevaluation of cystatin C measurement by particle-enhancedimmunonephelometry on the Behring nephelometer systems(BNA, BN II). Clin Chem 1997;43:1016–22

19. Mukhtar A, EL Masry A, Moniem AA, Metini M, Fayez A, KhaterYH. The impact of maintaining normal serum albumin levelfollowing living related liver transplantation: does serum albuminlevel affect the course? A pilot study. Transplant Proc 2007;39:3214–8

20. Thomas L. Retrospective power analysis. Conserv Biol 1997;11:276–80

21. Maxwell SE, Kelley K, Rausch JR. Sample size planning forstatistical power and accuracy in parameter estimation. AnnuRev Psychol 2008;59:537–63

22. Gainza FJ, Valdivieso A, Quintanilla N, Errazti G, Gastaca M,Campo M, Lampreabe I, Ortiz-de-Urbina J. Evaluation of acuterenal failure in the liver transplantation perioperative period:incidence and impact. Transplant Proc 2002;34:250–1

23. Page MK, Bukki J, Luppa P, Neumeier D. Clinical value ofcystatin C determination. Clin Chim Acta 2000;297:67–72

24. Samyn M, Cheeseman P, Bevis L, Taylor R, Samaroo B, Buxton-Thomas M, Heaton N, Rela M, Mieli-Vergani G, Dhawan A.Cystatin C, an easy and reliable marker for assessment of renaldysfunction in children with liver disease and after liver trans-plantation. Liver Transpl 2005;11:344–9

25. Biancofiore G, Pucci L, Cerutti E, Penno G, Pardini E, Esposito M,Bindi L, Pelati E, Romanelli A, Triscornia S, Salvadorini MP, StrattaC, Lanfranco G, Pellegrini G, Del Prato S, Salizzoni M, Mosca F,Filipponi F. Cystatin C as a marker of renal function immediatelyafter liver transplantation. Liver Transpl 2006;12:285–91

26. Cittanova ML, Leblanc I, Legendre C, Mouquet C, Riou B,Coriat P. Effect of hydroxyethylstarch in brain-dead kidneydonors on renal function in kidney-transplant recipients. Lancet1996;348:1620–2

27. Pillebout E, Nochy D, Hill G, Conti F, Antoine C, Calmus Y,Glotz D. Renal histopathological lesions after orthotopic livertransplantation (OLT). Am J Transplant 2005;5:1120–9

28. Jungheinrich C, Sauermann W, Bepperling F, Vogt NH. Volumeefficacy and reduced influence on measures of coagulationusing hydroxyethyl starch 130/0.4 (6%) with an optimised invivo molecular weight in orthopaedic surgery: a randomised,double-blind study. Drugs R D 2004;5:1–9

29. Persson J, Grande PO. Volume expansion of albumin, gelatin,hydroxyethyl starch, saline and erythrocytes after haemorrhagein the rat. Intensive Care Med 2005;31:296–301

30. Golfieri R, Giampalma E, Morselli Labate AM, d’Arienzo P,Jovine E, Grazi GL, Mazziotti A, Maffei M, Muzzi C, Tancioni S,Sama C, Cavallari A, Gavelli G. Pulmonary complications ofliver transplantation: radiological appearance and statisticalevaluation of risk factors in 300 cases. Eur Radiol 2000;10:1169–83

31. Treib J, Haass A, Pindur G. Coagulation disorders caused byhydroxyethyl starch. Thromb Haemost 1997;78:974–83

32. Segal JB, Dzik WH. Paucity of studies to support that abnormalcoagulation test results predict bleeding in the setting of inva-sive procedures: an evidence-based review. Transfusion 2005;45:1413–25

33. Krokos NV, Karavias D, Tzakis A, Tepetes K, Ramos E, TodoS, Fung JJ, Starzl TE. Acute pancreatitis after liver transplan-tation: incidence and contributing factors. Transpl Int 1995;8:1–7


Pain MedicineSection Editor: Spencer S. Liu

The Impact of Asynchronous ElectroacupunctureStimulation Duration on Cold Thermal Pain Threshold

Shu-Ming Wang, MD*

Eric C. Lin, BS†

Inna Maranets, MD*

Zeev N. Kain, MD, MBA‡

The durations of asynchronous electroacupuncture can affect the resultant hypoal-gesia. Healthy volunteers were randomized to receive different durations (0 min,20 min, 30 min, or 40 min) of asynchronous electroacupuncture stimulations(alternating low/high [2/100 Hz] frequency at 5 mA). Using a human experimentalcold thermal pain threshold model, we found that 30 min of asynchronous 2/100Hz stimulation resulted in the most significant hypoalgesic effect that was sustainedfor at least 60 min after stimulation compared with 0-, 20-, or 40-min stimulations (P �0.05). We conclude that the most optimal duration for asynchronous electroacupunc-ture stimulation is 30 min.(Anesth Analg 2009;109:932–5)

Acustimulations have been widely incorporatedinto a comprehensive clinical pain management pro-gram.1–9 Electroacupuncture stimulation (EAS) is atechnique that applies a small electrical current toneedles inserted into the acupuncture points.10 Thistechnique is intended to achieve synergistic or addi-tive analgesic benefits of traditional acupuncture andelectrical stimulation.6,10 The advantages of EAS overtraditional acupuncture manipulation include betterquantification of the stimulation delivered and repro-ducibility.6 Asynchronous EAS was developed basedon the findings that by alternating low and highfrequency electrical stimuli (e.g., 2 Hz of electricalstimulation alternating with 100 Hz of electrical stimu-lation) through needles into acupuncture points en-hances hypoalgesia more than either frequency alone.11,12

The duration of a single frequency of electroacupunc-ture affects the resultant hypoalgesia.3,4 We thereforeconducted the following study to determine whether

the duration of asynchronous EAS can also affect theresultant hypoalgesia using a human experimentalpain model.

METHODSAfter approval of the Human Investigation Com-

mittee of Yale School of Medicine, healthy volunteers(aged 18 yr and older) were recruited. Exclusion criteriaincluded a history of any systemic medical or psycho-logical illness, daily medication usage, illicit substanceusage, prior experience in acupuncture, and pregnancy.All volunteers were informed that the purpose of thestudy was to test whether different durations of EAS canaffect their ability to sense cold pain.

After obtaining informed consent and baseline de-mographic information, including State-Trait AnxietyInventory, education and belief in acupuncture treat-ment, all participants were positioned on a stretchercomfortably in an experimental room with the tem-perature set at 70°F. To eliminate the possibility of biasby the subjects, no watch or clock was allowed inthe study area. Using a Datex-Ohmeda portable pa-tient monitor, the changes of hemodynamic variables,which included continuous heart rate monitoring andnoninvasive arterial blood pressure measurements setat every 5 min, were recorded during the entire studyperiod. The preselected sites were marked on themedial side of the right lower leg before the initiationof cold thermal pain threshold (CTPT). CTPT wasdelivered by PATHWAY (Medoc Medical, Israel)through a 3 � 3 cm Peltier thermal stimulation probeusing advanced thermal stimulator version 2.4. Thefirst research assistant assessed the baseline CTPT atthese sites (Fig. 1) in a random order for a total of ninetimes (three times per site) as described in previous

From the *Department of Anesthesiology, Yale School of Medi-cine; †Department of Anesthesiology, The Yale Center for Advance-ment of Perioperative Health©, Yale School of Medicine, NewHaven, Connecticut; and ‡Departments of Anesthesiology, Pediat-rics, and Psychiatry and Human Behavior, University of California,Irvine School of Medicine, Irvine, California.

Accepted for publication March 27, 2009.None of the authors have any relationships with any company or

organization that has a potential or vested interest in the outcome ofthe study.

Partial data from this study were presented at the annual 2007ASA meeting in San Francisco, California.

Address correspondence and reprint requests to Shu-MingWang, MD, Department of Anesthesiology, Yale School of Medi-cine, 333 Cedar St., New Haven, CT 06520. Address e-mail [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181ad9292

Brief Report


studies.3,13 All participants were instructed to pressthe “stop” button when they sensed the cold sensationturning into pain, and the corresponding temperatureswere automatically recorded into the PATHWAY. Theparticipants were randomized into one of the fourdurations based on a computer-generated randomiza-tion table. Only the acupuncturist knew that thenumber represented a selected duration of EAS. Theacupuncturist then inserted the acupuncture needles(Siren, L type No 5 [0.25 � 40 mm], Shizuoka, Japan)into the selected acupuncture points on the left leg(Fig. 2). All participants were informed that theymight or might not feel a “de qi”* sensation and/or avibrating sensation during the intervention period.For participants assigned to the sham control group,i.e., 0 min group, the acupuncture needles were in-serted superficially without eliciting any “de qi” sensation.For participants receiving 20-, 30-, or 40-min of EAS,the acupuncture needles were placed until the acu-puncturist experienced a “de qi” sensation. The depth

of needle insertion at that point was about 0.75–1.5 cm.Once the acupuncture needles were placed, the acu-puncturist connected a pair of electrodes from a Hanstimulator (Beijing, China) to the needles. Asynchro-nous EAS (2/100 Hz) was delivered via Han stimula-tor and the intensity gradually adjusted to 5 mA overa 3-min period. For participants assigned to receive 0min of stimulation, the electrodes were connected toan inactive Han stimulator for 20 min. Only the acu-puncturist had a timer, so the EAS would be terminatedwhen the proper assigned duration of EAS was reached.None of the research assistants was present during theEAS period. Once the assigned EAS was completed,the State-Trait Anxiety Inventory-S was reassessedand the CTPT was immediately reassessed post-EAS,then subsequently every 5 min for a total of 60 min bythe second research assistant at the same premarkedsites. This procedure assured blindness of the researchassistants to prevent bias.

Statistical AnalysisThe sample size was calculated based on a previous

study14 in which the difference in mean visual analogscale scores for pain between volunteers who receivedreal EAS versus those who received sham EAS was0.65 with a standard deviation of 0.5. Based on ourcalculation, 14 subjects per group were needed toachieve a power of 90% in detecting 10% hypoalgesic

*A subjective sensation, described by subjects who receivedacupuncture treatment, as numbness, aching, soreness, or disten-sion. From the acupuncturist’s perspective, this subjective sensationcoincides with the sensation of the needle getting caught duringapplication of acupuncture needle.

Figure 1. Locations of premarked testing site and dermato-mal distributions.

Figure 2. Locations of acupuncture points and dermatomaldistributions.


differences between the treatment groups with an �value of 0.05. All hemodynamic and CTPT data weredirectly recorded into PATHWAY and exported intoSPSS 16 for Mac (SPSS, Chicago, IL) and analyzedusing repeated measure analysis with post hoc leastsignificant difference and P � 0.05 considered to bestatistically significant. Baseline demographic dataand an anxiety questionnaire were analyzed usingone-way analysis of variance.

RESULTSFifty-six subjects participated in this randomized,

controlled trial, and no subject withdrew from thetrial. There was no difference in age, education, gen-der, anxiety, and level of belief in acupuncture amongthe groups (Table 1). There were no differences in thearterial blood pressure or heart rate among the groupsbefore, during, or after EAS.

Because the durations of EAS were different, weonly compared the differences in temperature atwhich volunteers sensed cold pain among groupsbetween 40 and 80 min after the onset of intervention.As illustrated in Figure 3, participants receiving 30min of EAS had significant hypoalgesia as comparedwith those receiving 0 min (P � 0.008), 20 min (P �0.005), and 40 min (P � 0.024). The asynchronousEAS-induced hypoalgesia did not differ significantlybetween participants receiving 0 min vs 20 min (P �0.59), 0 min vs 40 min (P � 0.57), and 20 min EAS vs40 min of EAS (P � 0.69).

At 0 min post-EAS, participants in the 30-mingroup sensed cold pain at a significantly lower tem-perature than those who received 0 min (P � 0.01) and20 min (P � 0.013) but not lower than those whoreceived 40 min of EAS (P � 0.93). However, at 5 minpost-EAS, the participants who received 30 minutes of

Figure 3. Cold thermal pain thresholds (% � se) before and after asynchronous electroacupuncture stimulations.

Table 1. The Baseline Demographic Data

0 min (control) (n � 14) 20 min (n � 14) 30 min (n � 14) 40 min (n � 14) PAge 35 � 12 32 � 10 37 � 12 37 � 17 0.8Gender (M/F) 5/9 5/9 5/9 5/9 1Educationa 17 � 3 17 � 3 17 � 2 16 � 2 0.4Beliefb 74 � 13 76 � 10 75 � 14 72 � 25 0.1STAI-S 29 � 6 28 � 5 30 � 7 30 � 8 0.6STAI-T 33 � 6 28 � 6 32 � 6 32 � 9 0.2STAI-Sc 25 � 2 24 � 3 24 � 3 24 � 5 0.7Data are presented as mean� SD.STAI-S � Baseline State Anxiety Score; STAI-T � Baseline Trait Anxiety Score.a The highest education level subject received.b The level of belief regarding acupuncture treatment; 0 represents none at all and 100 represents total belief in acupuncture treatment.c Postintervention State Anxiety Score.

934 Brief Report ANESTHESIA & ANALGESIA

asynchronous EAS reported sensing cold pain at amuch lower temperature than those who received 0min (P � 0.006), 20 min (P � 0.005), and 40 min (P �0.03). The above phenomenon persisted for 60 minpost-EAS (Fig. 3).

DISCUSSIONUnder the conditions of this study, we found that

30 min of asynchronous 2/100 Hz (5 mA) EAS at ST36and SP6 resulted in significant hypoalgesia comparedwith 0 min, 20 min, or 40 min. The hypoalgesic effectwas sustained for 60 min post-EAS. Similar to previ-ous electrical stimulation studies,3,14 the asynchronousEAS-induced hypoalgesia is not restricted to segmen-tal pain inhibition. As illustrated in Figures 1 and 2,EAS at left ST36 and SP6 (L4, L5, and S2 dermatomaldistribution) and the hypoalgesia was tested at theright premarked sites (L3, L4, and S2 dermatomaldistribution). A previous manual acupuncture studydemonstrated that the peak of hypoalgesia was be-tween 20 and 40 min sustained up to 60 min,15 and thepeak hypoalgesia of single frequency EAS also oc-curred at about 30 min and was sustained up to 75 minduring stimulation.4,16 We were not able to demon-strate the similar phenomena as described in theseprevious studies.4,15,16 In our study, the temperaturesat which subjects perceived cold pain after receiving40 min of asynchronous EAS were significantly higherthan the temperatures in those who received 30 min ofthe same EAS. Future studies should explore thepotential mechanism(s) contributing to the develop-ment of this phenomenon. Interestingly, the optimalduration for alternating frequencies of EAS as demon-strated in our study is the same as the time settingused in other electrical nerve stimulators that arecommercially available to deliver alternating electricalfrequency stimulations to the target nerves.5,9 There-fore, we speculate that the analgesia resulting fromalternating frequencies of EAS, transcutaneous nervestimulation, or percutaneous nerve stimulation mayshare a similar underlying mechanism.

The limitations of this study are as follows: 1) wedid not assess the level of hypoalgesia while thestimulation was ongoing, thus we could not establishhow the hypoalgesia developed over time, and 2) wedid not have an “adequate” duration of CTPT assess-ment after stimulation. Based on a previous singlefrequency EAS study, the resulting hypoalgesic effectsgradually return to control values within 35 min aftertermination of stimulation.16 As a result, we decided

a priori to assess the CTPTs up to 60 min after EAS wasterminated. In addition, the temperatures at whichsubjects sensed a CTPT were directly recorded intoPATHWAY. Thus we did not discover that there wasany fading even at 60 min post-EAS until after thestudy was completed and at the time of data analysis.

In conclusion, the duration of asynchronous 2/100Hz EAS indeed affects the resultant hypoalgesia, and30 min of stimulation seems to be the optimal duration.

REFERENCES

1. Ghoname EA, Craig WF, White PF, Ahmed EA, Hamza MA,Gajraj NM, Vakharia AS, Noe CE. The effect of stimulusfrequency on the analgesic response to percutaneous electricalnerve stimulation in patients with chronic low back pain.Anesth Analg 1999;88:841–2

2. Ghoname EA, Craig WF, White PF, Ahmed HE, Hamza MA,Henderson, Gajraj BN, Huber PJ, Gatchel RJ. Percutaneouselectrical nerve stimulation for low back pain: a randomizedcrossover study. J Am Med Assoc 1999;281:818–23

3. Leung AY, Kim SJ, Schulteis G, Yaksh T. The effect of acupunc-ture duration on analgesia and peripheral sensory thresholds.BMC Complemt Altern Med 2008;8:18–29

4. Andersson SA, Ericson T, Holmgren E, Lindqvist G. Electro-accupuncture and pain threshold. Lancet 1973;2:564–9

5. Hamza MA, White PF, Ahmed HE, Ghoname EA. Effect of thefrequency of transcutaneous electrical nerve stimulation on thepostoperative opioid analgesic requirement and recovery pro-file. Anesthesiology 1999;91:1232–8

6. Ulett GA, Han SP, Han JS. Electroacupuncture: mechanisms andclinical application. Biol Psychiat 1998;44:129–38

7. Chen XH, Guo SF, Chang CG, Han JS. Optimal conditional forelicit maximal electroacupuncture analgesia with dense anddisperse mode stimulation. Am J Acupunct 1994;22:47–53

8. Chen L, Tang J, White PF, Sloninsky A, Wender RH, Naruse R,Kariger R. The effect of location of transcutaneous electricalnerve stimulation on postoperative opioid analgesic require-ment: acupoint versus non-acupoint stimulation. Anesth Analg1998;87:1129–34

9. Hamza MA, White PF, Craig WF, Ghoname ES, Ahmed HE,Proctor TJ, Noe CE, Vakharia AS, Gajraj J. Percutaneous electri-cal nerve stimulation: a novel analgesic therapy for diabeticneuropathic pain. Diabetes Care 2000;23:365–70

10. Wang SM, Kain ZN, White PF. Acupuncture analgesia: II.Clinical consideration. Anesth Analg 2008;106:611–21

11. Han JS. Neurochemical basis of acupuncture analgesia. AnnuRev Pharmacol Toxicol 1982;22:193–220

12. Han JS. Acupuncture and endorphins. Neurosci Lett 2004;361:258–61

13. Leung A, Khadivi B, Duann JR, Cho ZH, Yaksh T. The effectof ting point (tendinomuscular meridians) electroacupunc-ture on thermal pain: a model for studying the neuronalmechanism of acupuncture analgesia. J Altern ComplementMed 2006;12:743–50

14. Zhang WT, Jin Z, Huang J, Zhang L, Zeng YW, Luo F, ChenCAN, Han JS. Modulation of cold pain in human brain byelectric acupoint stimulation: evidence from fMRI. Neuroreport2003;14:1951–6

15. Research Group of Acupuncture Anesthesia, Peking MedicalCollege. Effect of acupuncture on the pain threshold of humanskin. Natl Med J China 1973;3:151–7

16. Andersson SA, Ericson T, Hoimgren E, Lindqvist G. Electro-acupuncture. Effect on pain threshold measured with electricalstimulation of teeth. Brain Res 1973;63:393–6


Pain MechanismsSection Editors: Tony L. Yaksh/Quinn H. Hogan

Central Administration of Minocycline and RiluzolePrevents Morphine-Induced Tolerance in Rats

Bohlool Habibi-Asl, PharmD, PhD

Kambiz Hassanzadeh, PharmD

Mohammad Charkhpour, PharmD,PhD

BACKGROUND: Long-term exposure to opiates induces tolerance to the analgesiceffect. The neurobiological mechanism of this phenomenon is not completely clear.In this study, we evaluated the effects of central administration of minocycline (atetracycline derivative) and riluzole (an antiglutamatergic drug) on morphine-induced tolerance in rats.METHODS: Groups of rats received daily morphine (10 mg/kg, IP) in combinationwith saline (10 �L/rat, intracerebroventricular [ICV]) or 1% Tween 80 (10 �L/rat,ICV) or minocycline (60, 120, and 240 �g/10 �L per rat, ICV) or riluzole (20, 40, 80�g/10 �L per rat, ICV). Nociception was assessed using hotplate apparatus(55°C � 0.5°C). Hotplate latency was recorded when the rat licked its hindpaw.Baseline latencies were determined once per day for each rat, then morphine (10mg/kg) was injected. After 20 min, the above-mentioned drugs were administeredand postdrug latency was measured 10 min after the injection of drugs or vehicles.RESULTS: Results showed that ICV administration of minocycline and riluzoledelayed morphine-induced tolerance. Morphine tolerance was complete after 8days in the control groups but was complete in the groups treated with minocycline(120 �g/10 �L per rat) and riluzole (80 �g/10 �L per rat) on the 13th day. Inaddition, our results showed that minocycline and riluzole increased the totalanalgesic effect of morphine (area under the curve of the percentage of maximalpossible effect values).CONCLUSION: The effects of minocycline on nitric oxide and the glutamatergic systemand the effect of riluzole on the glutamate system are potentially importantmechanisms in delaying morphine-induced tolerance.(Anesth Analg 2009;109:936–42)

Opioids such as morphine are the most widely useddrugs for the alleviation of moderate to severe chronicpain. Systemically administered morphine producesantinociception via actions at both spinal and su-praspinal sites.1

Repeated use of opioids induces tolerance that resultsin a loss of drug effect or the requirement for escalatingdoses to produce pain relief. The neurobiological mecha-nisms of the development of opioid tolerance are multi-faceted and only partially understood.

There are several lines of evidence that suggest thatN-methyl-d-aspartate (NMDA) glutamate receptors(NMDARs) are involved in the plasticity that arisesfrom long-term administration of morphine.2–5 Thisidea was suggested by Trujillo and Akil2 who reportedthat the NMDA receptor antagonist, MK-801 (dizo-cilpine), inhibited the development of tolerance to the

antinociceptive effect of morphine and morphinephysical dependence.

Using behavioral studies, we and others haveshown that a variety of NMDA receptor antagonistshave the ability to inhibit the development of opiatetolerance and dependence.2–8

Other studies have shown that activation ofNMDARs can lead to neurotoxicity under many cir-cumstances.9 For instance, peripheral nerve injury hasbeen shown to activate spinal cord NMDARs, whichresults in not only intractable neuropathic pain butalso neuronal cell death because of apoptosis.10–12

There are also several lines of evidence whichsuggest that activation of NMDARs leads to toxiccalcium influx, which activates numerous enzymes,including neuronal nitric oxide (NO) synthase (NOS).NO is able to further increase excitotoxicity by enhanc-ing glutamate release from presynaptic neurons andinhibiting glial glutamate transporters.13–15

Minocycline, a semisynthetic tetracycline deriva-tive, is able to provide neuroprotection against globalischemia in gerbils and focal brain ischemia in rats.16,17

Another study strongly suggested that minocyclineacts at an earlier plasmalemmal step by limitingglutamate release and the ensuing [Ca2�] elevation intarget neurons. Minocycline may prevent the activa-tion of this [Ca2�]-dependent intracellular pathway,

From the Department of Pharmacology and Toxicology, Facultyof Pharmacy, Tabriz University of Medical Sciences, Tabriz, Iran.

Accepted for publication April 13, 2009.Address correspondence and reprint requests to Kambiz Has-

sanzadeh, Department of Pharmacology and Toxicology, Faculty ofPharmacy, Tabriz University (Medical Sciences), Tabriz 51664-14766, Iran. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181ae5f13


thus inhibiting neuronal death. A decrease in neuronalexcitability, together with a marked decrease in gluta-mate release, may explain the cytoprotective proper-ties of minocycline.18–20

Many studies have indicated that the protective effectof minocycline was associated with reduced activation ofinducible NOS and interleukin-1b-converting enzyme,which are mainly expressed by microglia.19

Riluzole is the only proven effective medicine foramyotrophic lateral sclerosis (ALS) because it has beendemonstrated to delay the time of death in ALSpatients.20 Riluzole is an antiglutamatergic drug,which interferes with responses mediated by excita-tory amino acids, even though it does not interact withany known binding site on NMDA, kainate, or�-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid(AMPA) glutamate receptors.20 In addition, it has beenshown that coadministration of riluzole with morphinedecreased the intensity of the withdrawal syndrome,reflecting a reduction in physical dependence.21

In view of these data, both minocycline and riluzolehave a common mechanism of action on the glutama-tergic system; therefore, in this study, we evaluatedthe effect of intracerebroventricular (ICV) administra-tion of minocycline and riluzole on morphine toler-ance in rats.

METHODSAnimals

Male Wistar rats (Razi Institute, Tehran, Iran) weigh-ing 250–300 g (eight animals in each group) were used inthis study. They were kept in a temperature-controlledroom (24°C � 0.5°C) and maintained on a 12-h light/dark cycle (light on 08:00 am) with free access to foodand water. All experiments were executed in accordancewith the Guide for the Care and Use of LaboratoryAnimals (National Institutes of Health Publication No.85-23, revised 1985) and were approved by the researchand ethics committee of Tabriz University of MedicalSciences.

Intracerebroventricular Cannula ImplantationRats were anesthetized with sodium pentobarbital

(50 mg/kg, IP) (Merck, Germany) and a stainless steelguide cannula (23 gauge) was implanted stereotaxi-cally into the lateral cerebral ventricle (coordinates:�0.8 mm posterior, �1.3 mm midline to lateral, and3.5 mm ventral) with respect to bregma.22

A stainless steel guide (30 gauge) was placed intothe guide cannula as a dummy cannula to maintainpatency. After surgery, a recovery period of 7 dayswas allowed before experiments. During the recoveryperiod, animals were habituated to the testing envi-ronment including transfer to the experimental roomand twice daily handling, weighing, restraining on theplatform for 1 min, and gently removing and replac-ing the dummy cannula. Animals were also habitu-ated to the hotplate apparatus and testing started afterthe recovery period of 7 days in all groups.

Verification of Cannula PlacementAt the end of all experiments, methylene blue

solution (5 �L/rat, ICV) was injected into the cannulaand the animals were killed by an overdose of etherfollowed by decapitation. The brain of each animalwas dissected out and cut in the coronal plane toverify the placement of the guide cannula and distri-bution of methylene blue in the ventricles. Only datafrom animals that showed uniform distribution ofmethylene blue in the ventricles were considered forstatistical analysis. In all, six animals were discardedbecause the placement of the guide cannula wasincorrect.

Drug TreatmentMorphine sulfate (Sigma-Aldrich; Sigma-Aldrich,

Germany) (10 mg/kg, daily) was dissolved in doubledistilled water and was injected IP using 1-mL insulinsyringes. Minocycline (Sigma-Aldrich) (60, 120, and 240�g/10 �L per rat) was dissolved in double distilledwater and infused ICV using a Hamilton microsy-ringe. Riluzole (Sigma-Aldrich) (20, 40, and 80 �g/10�L per rat) was dissolved (1% Tween 80 in sterile 0.9%normal saline) and infused ICV using a Hamiltonsyringe. Dizocilpine (Sigma-Aldrich) (1 �g/10 �L perrat) was dissolved in double distilled water andinfused ICV using a Hamilton microsyringe. Twocontrol groups were included, which received eithermorphine, IP � 1% Tween 80 in saline normal 0.9%,ICV or morphine, IP � distilled water 0.9%, ICV.Volume of infusion was 10 �L at a rate of 10 �L/minin each rat.

Assessment of NociceptionNociception was assessed using the hotplate appa-

ratus (55°C � 0.5°C).23 Hotplate latency was recordedwhen the rat licked its hindpaw. A cut-off time (40 s)was imposed to prevent tissue damage.24 Hotplateresponse latencies (s) are expressed as the percentageof maximal possible effect (%MPE) using the equationbelow:

%MPE �Post-drug latency (s) � Baseline latency (s)

Cut-off value (s) � Baseline latency (s)� 100

Baseline latency was determined once per day foreach rat, before daily injection of morphine (10 mg/kg).After 20 min, the drugs were administered and thepostdrug latency was measured 10 min after the injec-tion of drugs or vehicles (30 min after the injection ofmorphine). The %MPE was then calculated for that day.The experiments continued until there was no significantdifference in %MPE between the vehicle- or drug-treatedgroups and the saline group.

Evaluation of the Global Analgesic EffectTo evaluate the global analgesic effect and to allow

a comparison of the effects from different behavioraltests, the area under the curve (AUC) of the %MPEwas calculated. To calculate the AUC, the trapezoidal


rule was used. The AUC (1–13 days) was calculatedusing the trapezoidal rule from the observed values.

Evaluation of Tolerance InductionTo evaluate the induction of tolerance, groups of

rats received either saline or morphine (10 mg/kg, IP)� saline or morphine (10 mg/kg, IP) � minocycline(the most effective dose) or morphine (10 mg/kg, IP)� riluzole (the most effective dose) for 8 days, then onthe 9th day (1 day after morphine tolerance in thecontrol group) several doses of morphine (10, 25, 50,and 100 mg/kg, IP) were administered to generateanalgesic dose-response curves. Morphine antinoci-ceptive 50% effective dose (ED50) values for each of thedrug groups were derived using linear regression of%MPE of the morphine dose. Differences in the ED50estimations were determined using the confidenceinterval method at P � 0.05.25

Data AnalysisData are expressed as the mean of %MPE � sem of

eight rats per group. One-way analysis of variancefollowed by Tukey’s test were used to analyze statis-tical significance in multiple comparisons. P values�0.05 were considered to be significant in all analyses.*P � 0.05, **P � 0.01, and ***P � 0.001 indicate asignificant difference as compared with the salinegroup for that day. The AUC1–13 data were analyzedby one-way analysis of variance.

RESULTSInduction of Tolerance to the Antinociceptive Effectof Morphine

As shown in Figure 1, daily administration ofmorphine (10 mg/kg, IP) induced tolerance to theantinociceptive effect of this drug in both the controlgroups which received 1% Tween 80 in saline normal

0.9% or distilled water. The analgesic effect of mor-phine decreased on the 8th day compared with the 1stday and, because there were no significant differencesbetween the control groups and the saline-treatedanimals on Day 8, this was considered the day ofmorphine tolerance initiation.

Evaluation of the Effect of Minocycline on Morphine-Induced Tolerance to the Analgesic Effect

Minocycline delayed the onset of morphine-induced tolerance. Minocycline (60, 240, and 120�g/10 �L per rat) delayed morphine tolerance for 4, 4and 5 days, respectively (Fig. 2). Analysis of the AUCof hotplate latency (Table 1), which allowed evalua-tion of the global effect, showed that repeated treat-ment with minocycline before morphine enhanced theeffectiveness of morphine. On the other hand, mino-cycline (120 �g/10 �L per rat) had the greatest AUC of%MPE (289.3) compared with the control group(177.5) or minocycline (60 �g/10 �L per rat) (264.7) orminocycline (240 �g/10 �L per rat) (234.7) (Table 1).In addition, the results in Figure 3 show a significantshift to the right in the dose-response curve foranimals who received morphine (10 mg/kg) � saline(10 �L/rat) compared with those receiving saline (10�L/rat) or morphine (10 mg/kg) � minocycline (120�g/10 �L per rat). A significant shift to the right inED50 in the control group (88.64) compared with saline(29.5) or morphine (10 mg/kg) � minocycline (120�g/10 �L per rat) (61.1) treated animals was also seen.

Evaluation of the Effect of Riluzole on Morphine-InducedTolerance to the Analgesic Effect

Riluzole (20, 40, and 80 �g/10 �L per rat) alsodelayed morphine tolerance. Riluzole (20 and 40�g/10 �L per rat) delayed morphine tolerance for 4days; however, the results indicated that riluzole (80�g/10 �L per rat) decreased the development of

Figure 1. Analgesic effect of daily administration of mor-phine (10 mg/kg, IP) in combination with distilled water (10�L/rat) or 1% Tween 80 in normal saline (10 �L/rat).Developed tolerance to the analgesic effect of morphine wascomplete on the 8th day when there were no significantdifferences in percentage of maximal possible effect (%MPE)between the control groups and the saline group. Each barrepresents the mean of %MPE � sem for eight rats. M �morphine; DW � distilled water; Mino � minocycline;Rilu � riluzole.

Figure 2. Effect of daily ICV injections of minocycline (60,120, and 240 �g/10 �L per rat) on tolerance to the analgesiceffect of morphine. Each bar represents the mean of percent-age of maximal possible effect (%MPE) � sem for eight rats.One-way analysis of variance (ANOVA) followed byTukey’s test were used to analyze the statistical signifi-cances. P values �0.05 were considered to be significant inall analyses. *P � 0.05; **P � 0.01; ***P � 0.001 whencompared with the control group. Arrow represents the dayof morphine tolerance. M � morphine; DW � distilledwater; Mino � minocycline.

938 Minocycline and Riluzole Decreased Morphine Tolerance ANESTHESIA & ANALGESIA

morphine tolerance and could delay morphine toler-ance for 5 days (Fig. 4). Riluzole (80 �g/10 �L per rat)had the greatest AUC of %MPE (261) compared withthe control group (156) or riluzole (20 �g/10 �L perrat) (216) or riluzole (40 �g/10 �L per rat) (197) (Table1). Figure 3 shows a significant shift to the right in thedose-response curve for animals that received mor-phine (10 mg/kg) � saline (10 �L/rat) compared withthose receiving saline (10 �L/rat) or morphine (10mg/kg) � riluzole (80 �g/10 �L per rat). Further-more, a significant shift to the right in ED50 in thecontrol group (88.64) was observed when comparedwith saline (29.5) and morphine (10 mg/kg) � riluzole(80 �g/10 �L per rat) (66.8) treated animals.

Evaluation of the Analgesic Effects of Minocyclineand Riluzole

Administration of the most effective doses of mino-cycline (120 �g/10 �L per rat) or riluzole (80 �g/10�L per rat) on morphine-induced tolerance did nothave a significant analgesic effect and there weresignificant differences between the administration ofthese drugs and saline (Fig. 5).

Comparison of the Effect of Minocycline or Riluzolewith Dizocilpine on Attenuation of MorphineTolerance Development

To examine the possible mechanism involved inmorphine-induced tolerance, we tested the effect ofICV administration of dizocilpine (1 �g/10 �L per rat)(a noncompetitive NMDA receptor antagonist), be-cause this agent has well-established effects on opioidtolerance and was used as a positive control in thisstudy. As shown in Figure 6, dizocilpine attenuatedmorphine tolerance and delayed tolerance initiationfor 6 days at this dose. Dizocilpine (1 �g/10 �L perrat) did not have a significant analgesic effect, thus theeffects of this drug are not related to analgesia.

DISCUSSIONTolerance is a behavioral adaptation to the pro-

longed use of opioid drugs, such as morphine. Thecellular mechanism underlying the development ofmorphine tolerance remains controversial. In the cur-rent study, we investigated the effect of minocyclineand riluzole on morphine-induced tolerance to theanalgesic effect. The main findings of this study indi-cate that ICV administration of minocycline and ri-luzole can prevent the development of morphinetolerance.

Figure 3. Hotplate responses and percent of maximal pos-sible effect (%MPE) to various morphine doses (10, 25, 50,and100 mg/kg, IP) administered on Day 9 after 8 days ofcontinuous ICV drug infusion. Each point represents themean � sem of eight rats. Different morphine doses admin-istered on Day 9 demonstrated a significant shift to the rightin the dose-response curve and antinociceptive ED50 valuesin animals treated with morphine � saline compared withthose receiving saline or morphine � minocycline (120�g/10 �L per rat) or morphine � riluzole (80 �g/10 �L perrat).

Figure 4. Effect of daily ICV injections of riluzole (20, 40, and80 �g/10 �L per rat) on tolerance to the analgesic effect ofmorphine. Each bar represents the mean of percentage ofmaximal possible effect (%MPE) � sem for eight rats.One-way analysis of variance (ANOVA) followed byTukey’s test were used to analyze the statistical signifi-cances. P values �0.05 were considered to be significant inall analyses. *P � 0.05; **P � 0.01; ***P � 0.001 whencompared with the control group. Arrow represents the dayof morphine tolerance. M � morphine; Rilu � riluzole.

Table 1. The Global Analgesic Effect of Morphine in the Control and Treatment Groups During 13 Days of Experimentation

Minocycline AUC sem Riluzole AUC semControl mino 177.5 4.2 Control rilu 156 3.460 �g/10 �L per rat 264.7* 3.7 20 �g/10 �L per rat 216† 3.1120 �g/10 �L per rat 289.3* 2.6 40 �g/10 �L per rat 197‡ 2.4240 �g/10 �L per rat 234.7* 2.9 80 �g/10 �L per rat 261* 3.4

Dizo 1 �g/10 �L per rat 363.8* 4.1Area under the curve (AUC) of percentage of maximal possible effect (%MPE) was calculated for each group for 13 days. To calculate the AUC, the trapezoidal rule was used. One-way analysisof variance followed by Tukey’s test was used to analyze the differences between the control and treatment groups.Mino � Minocycline; Rilu � Riluzol; Dizo � Dizocilpine.P values less than 0.05 were considered to be significant in all analyses. *P � 0.001; †P � 0.01; ‡P � 0.05 when compared with the control group.


Several studies have indicated that repeated admin-istration of opiates can activate the NMDA receptorthrough the G-protein associated with the opioidreceptor and/or intracellular mechanisms.26,27 Thisopiate-related activation of NMDARs may initiatesubsequent intracellular changes, such as the produc-tion of NO and/or the activation of protein kinase C(PKC). Both NO and PKC have been shown to becritical in the development of morphine tolerance.28,29

Previous studies have shown that minocycline, asemisynthetic tetracycline derivative, exhibits neuro-protective effects against neuronal damage in animaldisease models.18,30–33 Our results showed that mino-cycline (120 �g/10 �L per rat) postponed morphinetolerance for 5 days and minocycline (60 and 240�g/10 �L per rat) shifted morphine tolerance from the8th to the 12th day (Fig. 2). On the other hand, the totalanalgesic effect of morphine (AUC of %MPE) signifi-cantly increased in all treatment groups (Table 1).Although minocycline (120 �g/10 �L per rat) delayedmorphine tolerance more than other doses, there wasno significant difference among the three doses intheir effects on morphine tolerance. Furthermore, theresults shown in Figure 5 demonstrate that the dosesof minocycline administered in this study did nothave an analgesic effect. Therefore, the action ofminocyline in preventing morphine tolerance is notrelated to its analgesic effect. Several reports attributethe neuroprotective effects of minocycline to variousintracellular signaling pathways, including antioxi-dant systems,34 inhibition of NOS19 blockade of in-flammatory responses,35 prevention of the activationof Ca2�-dependent intracellular pathways, and amarked decrease in glutamate release.20

In addition, another study showed that NMDA-induced neuronal death involved proliferation andactivation of microglial cells and that minocycline

completely prevented NMDA toxicity and the preced-ing activation and proliferation of microglial cells.These results support the notion that microglial activa-tion contributes to excitotoxic neuronal death, which canbe inhibited by antiinflammatory compounds, such asminocycline.18 The mechanism underlying the role ofglial cells in the effects of morphine on naive mice isunclear. It is possible that morphine acts directly onmicroglia, triggering alterations in their morphology,metabolism, and function.36 Furthermore, a recentstudy indicated that systemic administration of mino-cycline attenuated morphine antinociceptive toler-ance.37 Mika et al.37 concluded that the effect ofminocycline on morphine tolerance is related to mi-croglia. Their results provide evidence that systemicadministration of minocycline in mice influences mor-phine’s effectiveness and delays the development ofmorphine tolerance by attenuating microglial activa-tion and its markers.

According to the above-mentioned studies and ourfindings, it is concluded that the effect of minocyclinein this study is possibly related to its neuroprotectiveproperty, its effect on preventing glutamate release,and its inhibition of microglial cells and NOS.

Figure 4 showed that riluzole decreased toleranceto the analgesic effect of morphine. Riluzole is the onlyproven effective medicine for ALS and was demon-strated to delay the time of death in these patients.38,39

This is thought to result from the neuroprotectiveeffect of riluzole, which has a complex mechanism ofaction involving several effects: inhibition of voltage-dependent sodium channels,40,41 high-voltage-activatedcalcium and potassium channels,41 and inhibition ofPKC, suggesting involvement in antioxidative pro-cesses.42 Our results showed that riluzole (20, 40, and 80�g/10 �L per rat) delayed morphine tolerance. Asshown in Figure 4, low doses of riluzole (20 and 40�g/10 �L per rat) only delayed morphine tolerancefor 2 days and 1 day, respectively; however, riluzole(80 �g/10 �L per rat) delayed morphine tolerance for

Figure 5. Analgesic effects of daily ICV injections of dizo-cilpine (1 �g/10 �L per rat), minocycline (120 �g/10 �L perrat), riluzole (80 �g/10 �L per rat), and saline (10 �L/rat).Each bar represents the mean of percentage of maximalpossible effect (%MPE) � sem for eight rats. One-wayanalysis of variance (ANOVA) followed by Tukey’s testwere used to analyze the differences between the saline andtreatment groups. P values �0.05 were considered to besignificant in all analyses. Mino � minocycline; Rilu �riluzole; Dizo � dizocilpine.

Figure 6. Effects of daily ICV injections of the most effectivedoses of minocycline (120 �g/10 �L per rat) and riluzole (80�g/10 �L per rat) were compared with dizocilpine (1 �g/10�L per rat) used as a positive control. Each bar represents themean of percentage of maximal possible effect (%MPE) � semfor eight rats. M � morphine; DW � distilled water; Mino �minocycline; Rilu � riluzole; Dizo � dizocilpine.


5 days. On the other hand, the total analgesic effect ofmorphine (AUC of %MPE) significantly increased inanimals treated with morphine � riluzole (80 �g/10�L per rat). The results shown in Figure 5 indicate thatthe most effective dose of riluzole in morphine toler-ance (80 �g/10 �L per rat) did not have a significantanalgesic effect. Previous studies have indicated thatthe most important mechanism of action for riluzole isits effect on glutamatergic transmission: riluzole inhib-ited glutamate release from presynaptic terminalsthrough a mechanism linked to G-protein signaling.43

Riluzole also affects neurotransmission mediated byAMPA/kainate receptors and reduces NMDA-evokedresponses.44,45 Finally, riluzole enhances high-affinityglutamate uptake in rat spinal cord synaptosomes invitro and after treatment in vivo.46,47 A recent studydemonstrated that riluzole significantly increased glu-tamate uptake mediated by transporters, such asGLAST, GLT1, and EAAC1.48 As previously men-tioned, it has been shown that the neuroprotectantriluzole has a direct inhibitory action on PKC, whichhas a critical role in the development of morphinetolerance,49 and it has been confirmed that riluzole ata concentration �30 mM protects against excitotoxicneuronal injury induced by NMDA or kainate inmouse cortical cultures.42 Furthermore, there is evi-dence that riluzole inhibits the electrophysiologicalresponses mediated by rat kainate and NMDA recep-tors expressed in Xenopus oocytes.50 In this study, weexamined the analgesic effect of three other doses ofmorphine in combination with saline or minocycline(120 �g/10 �L per rat) or riluzole (80 �g/10 �L perrat) on the 9th day (the day after morphine tolerancein the control group). The significant shift to the rightin the dose-response curve and ED50 for animalsreceiving morphine (10 mg/kg) � saline (10 �L/rat)showed that these animals were tolerant to morphineanalgesia. The ED50 in those rats that received mor-phine � minocycline or riluzole indicated that thesedrugs could prevent tolerance to the analgesic effect ofmorphine and that they showed significant differencesin ED50 compared with the control group. Further-more, our results showed that dizocilpine (1 �g/10 �Lper rat), a noncompetitive NMDA receptor antagonist,which has a well-established effect on opioid toler-ance, could attenuate morphine tolerance and theeffects of minocycline and riluzole were similar to thisdrug, thus dizocilpine could help to elucidate themechanisms involved in morphine tolerance. Dizo-cilpine alone did not have a significant analgesiceffect; however, the global analgesic effect of this drugwhen combined with morphine was greater than mor-phine � minocycline or morphine � riluzole. Similarly,dizocilpine delayed morphine tolerance from the 8th dayto the 14th day. In conclusion, our results showed thatICV administration of minocycline and riluzole coulddelay morphine tolerance; however, further studies areneeded to clarify the exact mechanism involved.

REFERENCES

1. Barton C, Basbaum AI, Fields HL. Dissociation of supraspinaland spinal actions of morphine: a quantitative evaluation. BrainRes 1980;188:487–98

2. Trujillo KA, Akil H. Inhibition of morphine tolerance anddependence by the NMDA receptor antagonist MK-801. Science1991;251:85–7

3. Trujillo KA. Effects of non-competitive N-methyl-d-aspartatereceptor antagonists on opiate tolerance and physical depen-dence. Neuropsychopharmacology 1995;13:301–7

4. Trujillo KA. The neurobiology of opiate tolerance, dependenceand sensitization: mechanisms of NMDA receptor-dependentsynaptic plasticity. Neurotox Res 2002;4:373–91

5. Mao J. NMDA and opioid receptors: their interactions inantinociception, tolerance and neuroplasticity. Brain Res Rev1999;30:289–304

6. Habibi-Asl B, Hassanzadeh K. Effects of ketamine and midazo-lam on morphine induced dependence and tolerance in mice.DARU 2004;12:101–5

7. Habibi-Asl B, Hassanzadeh K, Moosazadeh S. Effects of ket-amine and magnesium on morphine induced tolerance anddependence in mice. DARU 2005;13:110–5

8. Habibi-Asl B, Hassanzadeh K, Khezri E, Mohammadi S. Evalu-ation the effects of dextromethorphan and midazolam on mor-phine induced tolerance and dependence in mice. Pak J Biol Sci2008;11:1690–5

9. Rothman SM, Olney JW. Glutamate and the pathophysiology ofhypoxic-ischemic brain damage. Ann Neurol 1986;19:105–11

10. Mao J, Mayer DJ, Hayes RL, Lu J, Price DD. Differential roles ofNMDA and non-NMDA receptor activation in induction andmaintenance of thermal hyperalgesia in rats with painful pe-ripheral mononeuropathy. Brain Res 1992;598:271–8

11. Mao J, Price DD, Mayer DJ. Mechanisms of hyperalgesia andopiate tolerance: a current view of their possible interactions.Pain 1995;62:259–74

12. Mao J, Price DD, Zhu J, Lu J, Mayer DJ. The inhibition of nitricoxide-activated poly(ADP-ribose) synthetase attenuates trans-synaptic alteration of spinal cord dorsal horn neurons andneuropathic pain in the rat. Pain 1997;72:355–66

13. Montague PR, Gancayco CD, Winn MJ, Marchase RB, Fried-lander MJ. Role of NO production in NMDA receptor mediatedneurotransmitter release in cerebral cortex. Science 1994;263:973–7

14. Pogun S, Dawson V, Kuhar MJ. Nitric oxide inhibits 3H-glutamate transport in synaptosomes. Synapse 1994;18:21–6

15. Trotti D, Rossi D, Gjelsdal O, Levy LM, Racagni G, Danbolt NC.Peroxynitrite inhibits glutamate transporter subtypes. J BiolChem 1996;271:5976–9

16. Yrjanheikki J, Keinanen R, Pellikka M, Kfelt TH, Koistinaho J.Tetracyclines inhibit microglial activation and are neuroprotec-tive in global brain ischemia. Proc Natl Acad Sci USA1998;95:15769–74

17. Yrjanheikki J, Tikka T, Keinanen R, Goldsteins G, Chan PH,Koistinaho JA. Tetracycline derivative, minocycline, reducesinflammation and protects against focal cerebral ischemia witha wide therapeutic window. Proc Natl Acad Sci USA1999;96:13496–500

18. Tikka TM, Koistinaho JE. Minocycline provides neuroprotectionagainst N-methyl-d-aspartate neurotoxicity by inhibiting micro-glia. J Immunol 2001;166:7527–33

19. Sadowski T, Steinmeyer J. Minocycline inhibits the productionof inducible nitric oxide synthase in articular chondrocytes.J Rheumatol 2001;28:336–40

20. Jose CG, Javier E, Marıa CG, Francisco J, Fernandez G, Jose SP.Neuroprotectant minocycline depresses glutamatergic neuro-transmission and Ca2� signalling in hippocampal neurons. EurJ Neurosci 2007;26:2481–95

21. Debono MW, LeGuern L, Canton T. Inhibition by riluzole ofelectrophysiological responses mediated by rat kainate andNMDA receptors expressed in Xenopus oocytes. Eur J Pharma-col 1993;235:283–9

22. Sepulveda J, Astorga JG, Contreras E. Riluzole decreases theabstinence syndrome and physical dependence in morphine-dependent mice. Eur J Pharmacol 1999;379:59–62

23. Paxinos G, Watson C. The rat brain in stereotaxic coordinates.4th ed. London: Academic Press, 1998


24. Eddy NB, Leimback D. Synthetic analgesics. II. Dithienylbute-nyl and dithienylbutylamines. J Pharmacol Exp Ther 1953;107:385–93

25. McCarthy RJ, Kroin JS, Tuman KJ, Penn RD, Ivankovich AD.Antinociceptive potentiation and attenuation of tolerance byintrathecal co-infusion of magnesium sulfate and morphine inrats. Anesth Analg 1998;86:830–6

26. Elliott K, Kest B, Man A, Inturrisi, CE. N-methyl-d-aspartate(NMDA) receptors, mu and kappa opioid tolerance and per-spectives on new analgesic drug development. Neuropharma-cology 1995;13:347–56

27. Eric JN, Aghajanian GK. Molecular and cellular basis of addic-tion. Science 1997;278:58–63

28. George FK. Neuroadaptive mechanisms of addiction: study on theextended amigdala. Neuropsychopharmacology 2003;13:442–52

29. Liu JG, Anand KJ. Protein kinases modulate the cellular adap-tations associated with opioid tolerance and dependence. BrainRes Brain Res Rev 2000;38:1–19

30. Wang X, Zhu S, Drozda M, Zhang W, Stavrovskaya IG, CattaneoE. Minocycline inhibits caspase-independent and -dependent mi-tochondrial cell death pathways in models of Huntington’s dis-ease. Proc Natl Acad Sci USA 2003;100:10483–7

31. Zhu S, Stasvrovskaya IG, Drozda M, Kim BYS, Ona V, Li M,Sarang S. Minocycline inhibits cytochrome C release and delaysprogression of amyotrophic lateral sclerosis in mice. Nature2002;417:74–8

32. Hunter CL, Quintero EM, Gilstrap L, Bhat NR. Granholm A.Minocycline protects basal forebrain cholinergic neurons frommu p75-saporin immunotoxic lesioning. Eur J Neurosci2004;19:3305–16

33. He Y, Appel S, Le W. Minocycline inhibits microglial activationand protects nigral cell after 6-hydroxydopamine injection intomouse striatum. Brain Res 2001;909:187–93

34. Kraus RL, Pasiweczny R, Lariosa WK, Turner MS, Jiang A,Trauger JW. Antioxidant properties of minocycline. Neuropro-tection in an oxidative stress assay and direct radical-scavenging activity. J Neurochem 2005;94:819–27

35. Stirling DP, Khodarahmi K, Steeves JD, Tetzlaff W. Minocyclineas neuroprotective agent. Neuroscientist 2005;11:308–22

36. Watkins LR, Hutchinson MR, Johnston IN, Maier SF. Glia: novelcounterregulators of opioidanalgesia. Trends Neurosci2005;28:661–9

37. Mika J, Wawrzczak-Bargiela A, Osikowicz M, Makuch W,Przewlocka B. Attenuation of morphine tolerance by minocy-cline and pentoxifylline in naive and neuropathic mice. BrainBehav Immun 2009;23:75–84

38. Bryson HM, Fulton B, Benfield P. Riluzole: a review of itspharmacodynamic and pharmacokinetic properties and thera-peutic potential in amyotrophic lateral sclerosis. Drugs1996;52:549–63

39. Mitsumoto H. Riluzole—what is its impact in our treatment andunderstanding of amyotrophic lateral sclerosis? Ann Pharma-cother 1997;31:779–81

40. Urbani A, Belluzzi O. Riluzole inhibits the persistent sodiumcurrent in mammalian CNS neurons. Eur J Neurosci2000;12:3567–74

41. Zona C, Siniscalchi A, Mercuri NB, Bernardi G. Riluzole inter-acts with voltage-activated sodium and potassium currents incultured rat cortical neurons. Neuroscience 1998;85:931–8

42. Noh KM, Hwang JY, Shin HC, Koh JY. A novel neuroprotectivemechanism of riluzole: direct inhibition of protein kinase C.Neurobiol Dis 2000;7:375–83

43. Wang SJ, Wang KY, Wang WC. Mechanisms underlying theriluzole inhibition of glutamate release from rat cerebral cortexnerve terminals (synaptosomes). Neuroscience 2004;125:191–201

44. Albo F, Pieri M, Zona C. Modulation of AMPA receptors inspinal motor neurons by the neuroprotective agent riluzole.J Neurosci Res 2004;78:200–7

45. De Sarro G, Siniscalchi A, Ferreri G, Gallelli L, De Sarro A.NMDA and AMPA/kainate receptors are involved in theanticonvulsant activity of riluzole in DBA/2 mice. Eur J Phar-macol 2000;408:25–34

46. Azbill RD, Mu X, Springer JE. Riluzole increases highaffinityglutamate uptake in rat spinal cord synaptosomes. Brain Res2000;871:175–80

47. Dunlop J, Beal McIlvain H, She Y, Howland DS. Impaired spinalcord glutamate transport capacity and reduced sensitivity toriluzole in a transgenic superoxide dismutase mutant rat modelof amyotrophic lateral sclerosis. J Neurosci 2003;23:1688–96

48. Fumagalli E, Funicello M, Rauen T, Gobbi M, Mennini T.Riluzole enhances the activity of glutamate transporters GLAST,GLT1 and EAAC1. Eur J Pharmacol 2008;578:171–6

49. Rang HP, Dale MM, Ritter JM. Pharmacology. 5th ed. London:Churchil Livingstone, 2005

50. Koh JY, Kim DK, Hwang JY, Kim YH, Seo JH. Antioxidative andproapoptotic effects of riluzole on cultured cortical neurons.J Neurochem 1999;72:716–23


The Effect of a Peripheral Block on Inflammation-InducedProstaglandin E2 and Cyclooxygenase Expression in Rats

Helene Beloeil, MD, PhD

Marc Gentili, MD, PhD

Dan Benhamou, MD

Jean-Xavier Mazoit, MD, PhD

BACKGROUND: Peripheral inflammatory pain is associated with an upregulation ofspinal cord COX-2 (cyclooxygenase-2), with a subsequent increase in centralprostaglandin E2 (PGE2) levels associated with the development of hyperalgesia.In this study, we evaluated the effect of bupivacaine administered via a nerve blockor via a systemic route on the spinal expression of PGE2 and COX in a model ofperipheral inflammation in rats.METHODS: All rats randomly received three injections: 1) a left subcutaneoushindpaw injection (0.2 mL with either carrageenan 2% w/v or saline), 2) a leftsciatic block (0.2 mL with either bupivacaine 0.5% or saline), and 3) a systemicinjection (subcutaneous interscapular with 0.2 mL with either bupivacaine 0.5% orsaline). Local edema, thermal, and mechanical hyperalgesia as well as cerebrospi-nal fluid PGE2 concentration and COX-1 and COX-2 expression in the spinal cordin dorsal root ganglions were measured.RESULTS: We confirmed that a bupivacaine block attenuates hyperalgesia and localinflammation in a model of inflammatory pain. This effect was associated withan inhibition of the increase in COX-2 expression induced by peripheral inflam-mation in dorsal root ganglions and cord. The subsequent production of PGE2 incerebrospinal fluid was also impaired. Systemic bupivacaine did not modify eitherthe hyperalgesia and local inflammation or COX expression.CONCLUSION: These results constitute a key element strongly suggesting that localanesthetics act at a different level when administered systematically or via a nerveblock.(Anesth Analg 2009;109:943–50)

Prostaglandin E2 (PGE2) is the predominant neuro-transmitter released after surgical trauma and has beenassociated with inflammation and pain.1,2 Human andanimal data have demonstrated an increase in spinalPGE2 after peripheral inflammation positively corre-lated with pain.3,4 Animal models of peripheral inflam-mation have demonstrated an upregulation of spinalcord COX-2 (cyclooxygenase-2) with a subsequent in-crease in central PGE2 levels associated with the devel-opment of allodynia and hyperalgesia.5,6 The preventionof hyperalgesia by analgesic drugs is associated with theprevention of the changes in PGE2 concentration incerebrospinal fluid (CSF) in animals.7 Local anesthetics(LAs) can inhibit components of the inflammatory re-sponse. We previously reported that LAs via a nerveblock could attenuate the inflammatory hindpaw edemaand hyperalgesia induced by hindpaw injection of car-rageenan (CARR) in rats.8 In the same study, the sys-temic administration of bupivacaine was ineffective in

preventing hindpaw edema and hyperalgesia, but itregulated the systemic inflammatory response elicitedby the peripheral inflammation in rats. Bupivacaine wasindeed effective in suppressing systemic tumor necrosisfactor-� (TNF) and interleukin 1-�. The mechanisms bywhich LAs affect inflammation and hyperalgesia are stillnot clear. Although the involvement of both spinal PGE2and COX in pain transmission has been demonstrated,the effect of LAs on the release of these pain mediatorsinto the CSF of animals with peripheral inflammatoryhyperalgesia has been poorly investigated.

The purpose of this study, therefore, was to evalu-ate the effect of bupivacaine administered via a nerveblock or via a systemic route on the spinal expressionof PGE2 and COX in a model of peripheral inflamma-tion in rats.

METHODSYoung adult male Sprague-Dawley rats weighing

200–250 g were used. Guidelines of the InternationalAssociation for the Study of Pain were followed.9 Ourinstitutional committee on research in animals ap-proved this study. The animals were kept on a 12-hlight/dark cycle with free access to food and water.The rats were handled repeatedly for at least 3 daysbefore the experiments to habituate them to the inves-tigators and the testing paradigm.

From the Univ Paris-Sud, Laboratoire d’Anesthesie, UPRES EA3540, F-94276 Le Kremlin Bicetre, France.

Accepted for publication April 27, 2009.Address correspondence and reprint requests to Helene Beloeil,

MD, PhD, Laboratoire d’Anesthesie, UPRES EA 3540, Faculte deMedecine, Universite de Paris-Sud, 94276 Le Kremlin Bicetre,France. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181aff25e


SolutionsCARR was prepared fresh before each experiment

(0.2 mL of 2% w/v solution of lambda CARR in saline(Sigma Chemical Co.). Bupivacaine 0.5% w/v (5 g/L)was used as the LA.

Sciatic Blockade TechniqueBefore nerve block injections, rats were anesthetized

briefly with isoflurane (2%–4% inspired concentration in100% oxygen) by face mask. The block was initiated byintroducing a 23-gauge needle posteromedially to thegreater trochanter pointed in an anteromedial direction.Once bone was touched, the needle was withdrawn 1mm, and the drug was injected. The final volume ofinjectate was 0.2-mL test solution. The left leg wasalways used for blocks. The efficacy of the block wastested by measuring paw withdrawal latency in re-sponse to a radiant thermal stimulus applied using aHargreaves-type testing device (cf. Behavioral Measure-ments section) 30 min after the injection. Failure toremove the hindpaw after 22 s was regarded as a densethermal nocifensive blockade. All animals receiving asciatic blockade with bupivacaine had a dense blockade30 min after the injection of bupivacaine.

In a separated group of eight animals receiving abupivacaine sciatic block, bupivacaine blood levelswere determined 6 h later using gas chromatography.The blood levels achieved were below the level ofdetection or very low (0.015 mg/L), excluding asystemic effect of the bupivacaine administered via anerve block.

Experimental GroupsAnimals were randomly assigned to one of six

experimental groups (n � 5–8/group) as described inTable 1. Each animal received three injections attime � 0: 1) a left subcutaneous hindpaw injection (0.2mL with either CARR 2% w/v or saline), 2) a leftsciatic block (0.2 mL with either bupivacaine 0.5% orsaline), and 3) a systemic injection (subcutaneousinterscapular with 0.2 mL with either bupivacaine0.5% or saline). Bupivacaine was injected at only onesite (sciatic or back) in an animal.

Behavioral MeasurementsAll behavioral tests were performed by a single

investigator. Nociceptive responses to a thermal stimu-lus were evaluated by measuring paw withdrawal la-tency in response to a radiant thermal stimulus appliedusing a Hargreaves-type testing device (Ugo Basile,Milan, Italy). It consists of a movable infrared source,which the operator glides below a glass pane, uponwhich a three-compartment enclosure for the rat ispositioned. When the rat withdraws its paw, the instru-ment automatically detects the withdrawal latency to thenearest 0.1 s. The paw withdrawal latency was evaluated6 h after initial injections. Failure to remove the hindpawafter 22 s was regarded as dense thermal nocifensive

blockade. This test was repeated three times on eachhindpaw for each rat.

The development of mechanical hypersensitivity afterhindpaw inflammation was assessed by the applicationof calibrated von Frey filaments. Animals were placedon a mesh floor in individual plastic boxes and allowedto acclimate to their environment. von Frey filamentswere then applied vertically to the plantar surface ofboth hindpaws. Filaments were applied three times over2 s. If no response was elicited, a larger diameter filamentwas applied in the same manner. The filaments wereapplied in increasing order until brisk withdrawal orpaw flinching was elicited, which was considered apositive response. This withdrawal threshold was deter-mined three times, and the mean withdrawal thresholdwas used for data analysis.

Paw CircumferenceTo evaluate the edema, we used a technique previ-

ously described.10 The paw circumference (PC) wasmeasured by a thread, to the nearest millimeter, at themetatarsal level.

PGE2 in CSFCSF was collected 6 h after drug injections. The

amounts of PGE2 were measured with a commercialenzyme-linked immunosorbent assay kit (R&D sys-tems) according to the manufacturer’s instructions.The assay detection limits were 10 pg/mL. At the endof each experiment, rats were killed with an overdoseof pentobarbital (100 mg/kg administered IV).

COX-1 and COX-2COX-1 and COX-2 expression was measured by

quantitative reverse-transcriptase polymerase chain re-action (qRT-PCR). The animals were anesthetized usingisoflurane and decapitated for exsanguination. The spi-nal cord (L3–L5) separated in right and left portions andthe corresponding dorsal root ganglions (DRG) wererapidly immersed in RNAlater� (Quiagen, CourtaboeufFrance) and kept frozen at �80°C. After tissue homoge-nization in ice-cold tubes, total RNA was extracted usingTrizol (Invitrogen, Cergy Pontoise, France). Reversetranscription was performed using 0.5-�g total RNAusing the Superscript II� reverse transcriptase (Invitro-gen, France). TaqMan real-time PCR assays for COX-1,COX-2 microsomial ribonucleic acid (mRNA), and 18S

Table 1. Summary of Treatment Groups

Groups

Lefthindpaw

(SC)

Leftsciaticarea

Systemic(back)

Control Saline Saline SalineSystemic bupi Saline Saline BupiBupi block Saline Bupi SalineCARR CARR Saline SalineCARR � bupi block CARR Bupi SalineCARR � systemic bupi CARR Saline BupiBupi � bupivacaine; CARR � carrageenan; SC � subcutaneous.

944 Nerve Block, COX-2, and PGE2 ANESTHESIA & ANALGESIA

ribosomial ribonucleic acid (rRNA) were performed onan ABI Prism 7300 sequence detector (Applied Biosys-tems). After 2 min at 50°C and 10 min at 95°C, 40 cyclesof denaturation/annealing-extending (95°C for 15 s,60°C for 1 min) were performed. Primers and probeswere purchased from Applied Biosystems. The oligonu-cleotide primer pairs were purchased from AppliedBiosystems, Courtaboeuf France: Rn 00566881_m1 andRn00568225_1 for COX-1 and COX-2, respectively.COX-1 and COX-2 mRNA are expressed relative to 18SrRNA.

Statistical AnalysisAs the behavioral and the PC data were not nor-

mally distributed, differences among groups wereassessed using nonparametric tests (Kruskal–Wallisand Mann–Whitney U-test with the Bonferroni correc-tion). The results are expressed as the median with25th and 75th percentiles. PGE2 production in CSF,COX-1, and COX-2 expression was compared amonggroups using the Kruskal–Wallis test followed by aMann–Whitney U-test with the Bonferroni correction.The results are expressed as median with 25th and75th percentiles. A P value below 0.05 was consideredthe minimum level of statistical significance.

RESULTSEvaluation of Hindpaw Edema by PC

Six hours after the injection of CARR, a significantlyincreased PC was observed in the CARR group com-pared with that in the control group (Fig. 1). In thegroups receiving CARR and an ipsilateral sciatic blockwith bupivacaine, the mean PC was significantly lessthan that in the CARR group. The group receivingCARR plus systemic bupivacaine had mean PCs thatwere not significantly different from those of theCARR group (Fig. 1). In the nonhindpaw injection

side, no significant differences were observed amongthe groups (data not shown).

Thermal Nociceptive Withdrawal Latencies and von FreyFilament Mechanical Withdrawal Thresholds

Six hours after injection of CARR, a significantdecrease in heat withdrawal latency and in the me-chanical withdrawal threshold were observed in theCARR group compared with that in the control group,indicating thermal hyperalgesia in the CARR group(Figs. 2 and 3). In the groups receiving hindpaw CARRand a sciatic block with bupivacaine, heat withdrawallatency and mechanical threshold were significantlygreater than in the CARR group, indicating partialprevention of CARR-induced hyperalgesia. The motorblockade observed after the injection of the nerveblock was not present 6 h later. Systemic bupivacainewas ineffective in prevention of CARR-induced me-chanical hyperalgesia (Figs. 2 and 3). In the nonhind-paw injection side, no significant differences wereobserved among the groups (data not shown).

Production of PGE2 in CSFThe basal PGE2 concentration in CSF was 112

(96–246) pg/mL (median and interquartile range)(Fig. 4). In the group receiving CARR, PGE2 produc-tion was increased and was significantly differentfrom the control group. In the groups receiving hind-paw saline and bupivacaine (systemic or block), PGE2production was not significantly different from theproduction observed in the control group. In thegroup receiving hindpaw CARR and a bupivacaineblock, PGE2 production was not significantly differentfrom the production observed in the control group,showing that a bupivacaine block inhibited the in-creased production of PGE2 induced by a hindpawCARR injection. In the group receiving hindpaw

Figure 1. Paw circumference (mm)assessing edema 6 h after injection inthe hindpaw injection side. Resultsare expressed as median with 25thand 75th percentiles. *P � 0.01 versuscontrol group. §P � 0.01 versus carrgroup. Bupi � bupivacaine; carr �carrageenan; syst � systemic.


CARR and systemic bupivacaine, PGE2 productionwas not significantly different from the productionobserved in the CARR group.

COX-1 and COX-2 Expression in Cord and DRGsIn control animals, COX-1 was expressed in both cord

and DRG at low levels, whereas COX-2 was almost notexpressed (Tables 2 and 3). The COX mRNA/18S rRNAlevel was unchanged in these control animals. Theexpression of COX-1 was not modified by any treatmentat any time. Contrary to COX-1, COX-2 mRNA expres-sion was increased in the animals treated with CARR.Six hours after CARR injection, COX-2 expression sig-nificantly increased in both left (side of CARR injection)DRGs and cord (Fig. 5). Importantly, COX-2 mRNAexpression markedly increased in the opposite side of

the spinal cord (Fig. 6) but not in the opposite DRG (Fig.6). In animals treated with a bupivacaine block, theincrease of COX-2 mRNA was impaired in the ipsilateralcord and DRG. This was significantly less comparedwith the CARR group. Moreover, a bupivacaine blockwas able to impair the increase in COX-2 expression incord on the opposite side. The increase of expression inCOX-2 after CARR was not modified by bupivacaine viaa systemic route.

DISCUSSIONIn this study, we confirmed that a bupivacaine

block attenuates thermal hyperalgesia, mechanical al-lodynia, and local inflammation in a model of inflam-matory pain. We and others had already shown such

Figure 2. Thermal nociceptive with-drawal latency (s) assessing thermalhyperalgesia in the hindpaw injectionside 6 h after injection. Results areexpressed as median with 25th and75th percentiles. *P � 0.01 versuscontrol group. §P � 0.01 versus carrgroup. Bupi � bupivacaine; carr �carrageenan; syst � systemic.

Figure 3. Withdrawal threshold (g) tovon Frey filaments assessing me-chanical hyperalgesia in the hindpawinjection side, 6 h after injection. Re-sults are expressed as median withinterval range. *P � 0.01 versus con-trol group. §P � 0.01 versus carrgroup. Bupi � bupivacaine; carr �carrageenan; syst � systemic.


a property,8,11 and we wanted to better explain themechanisms involved. This effect was associated withan inhibition of the increase in COX-2 expressioninduced by peripheral inflammation in DRG and cord.The subsequent production of PGE2 in CSF was alsoimpaired. Systemic bupivacaine did not modify eitherthe hyperalgesia and local inflammation or the COXexpression.

As already published,5,12,13 the inflammatory pro-cess induced by CARR did not increase the expressionof COX-1. COX-1 mRNA was observed at a lowconcentration, but the concentration did not increase

at any time in any group with any treatment. Incontrast, COX-2 expression was significantly in-creased both in DRG and in cord 6 h after CARRinjection.6,12,13 Interestingly, COX-2 expression wasalso increased in the opposite side of the spinal cord.Activation of TNF-�, interleukin-1�, and COX-2 incontralateral DRGs has been shown, and this is aremarkable observation because somatic afferent pe-ripheral fibers project to ipsilateral DRGs and are notthought to have contralateral connections at the levelof DRGs.12,13 We previously observed that hindpawCARR-induced activation of cytokines and p-p38

Figure 4. Spinal prostaglandin E2(PGE2) production at 6 h in cerebro-spinal fluid (CSF). Results are ex-pressed as median with intervalrange. *P � 0.01 versus control group.Bupi � bupivacaine; carr � carra-geenan; syst � systemic.

Table 2. Expression of Cyclooxygenase (COX)-1 Relative to 18S in the Spinal Cord and Dorsal Root Ganglions (DRGs) Measured byQuantitative Reverse-Transcriptase Polymerase Chain Reaction (qRT-PCR)

Cord left Cord right DRG left DRG rightControl 0.69 (0.42–0.85) 0.56 (0.37–0.86) 0.18 (0.1–0.31) 0.21 (0.15–0.28)Systemic bupi 0.55 (0.36–0.91) 0.79 (0.64–1.05) 0.25 (0.08–0.46) 0.36 (0.03–0.76)Bupi block 0.32 (0.16–0.4) 0.56 (0.43–0.85) 0.36 (0.13–0.56) 0.2 (0.16–0.54)CARR 0.51 (0.26–0.58) 0.59 (0.56–1.63) 0.2 (0.1–0.58) 0.28 (0.17–1.7)CARR � bupi block 0.5 (0.02–1.1) 0.3 (0.02–0.9) 0.25 (0.01–0.79) 0.4 (0.2–0.8)CARR � systemic bupi 0.55 (0.29–0.68) 0.34 (0.23–0.56) 0.2 (0.03–0.2) 0.2 (0.12–0.9)Results are presented as median (interquartile range).Bupi � bupivacaine; CARR � carrageenan.

Table 3. Expression of Cyclooxygenase (COX)-2 Relative to 18S in the Spinal Cord and Dorsal Root Ganglions (DRGs) Measured byQuantitative Reverse-Transcriptase Polymerase Chain Reaction (qRT-PCR)

Cord left Cord right DRG left DRG rightControl 0.29 (0.1–0.33) 0.1 (0.08–0.36) 0.15 (0.07–0.4) 0 (0–0.01)Systemic bupi 0.68 (0.11–1.27) 0.8 (0.56–1.77) 0.06 (0.05–0.08) 0.09 (0.08–0.1)Bupi block 0.69 (0.25–0.96) 0.30 (0.02–0.3) 0.55 (0.45–0.85) 0.01 (0.01–0.59)CARR 37.76 (27.5–45.24)* 7.80 (4.25–10.15)* 3.8 (3.22–5)* 0.56 (0.5–0.6)CARR � bupi block 6.69 (5.89–8.96)*† 2.03 (0.6–2.36)*† 0.36 (0–0.56)† 0.1 (0.05–0.5)CARR � systemic bupi 42.56 (40.23–45.63)* 8.96 (7.89–9.34)* 5.69 (5.63–6.56)* 0.5 (0.47–0.56)Results are presented as median (interquartile range).Bupi � bupivacaine; CARR � carrageenan.* Versus control, P � 0.01.† Versus CARR, P � 0.01.


mitogen-activated protein kinase in bilateral lumbarDRGs involves a regional or segmental, rather thansystemic, mechanism.14 Potential mechanisms of thisbilateralization are not clearly understood and needfurther study. In this study, there was minor but nosignificant hyperalgesia on the contralateral side of thelocal inflammation created by CARR. A bilateraliza-tion of hyperalgesia has, however, been observed 2 hafter CARR injection in the rat hindpaw.15 SubsequentPGE2 production in CSF was also increased afterinflammation as has been described in animals16 andhumans after surgery.3

As previously reported, LAs, via a nerve block,attenuated the inflammatory hindpaw edema andhyperalgesia induced by hindpaw injection of CARRin rats. This was associated with an inhibition of theinflammatory-induced increase of COX-2 expression inDRG and spinal cord and subsequent PGE2 produc-tion in CSF. Many other markers of central andperipheral nerve sensitization are blocked by a nerveblock, such as cytokines. We previously observed thata bupivacaine nerve block regulated the systemiccytokine response elicited by peripheral inflammationin rats.8 A prolonged nerve block itself (70% ethanol)can decrease not only the local inflammatory reaction

observed after CARR injection but also its systemicconsequences.17 On the other hand, in vitro studieshave reported a direct specific effect of LAs on theeicosanoid system. Lidocaine was shown in vitro toinhibit PGE2 release18 and PLA2 activity.19,20 Productsof COX (PG1 � and thromboxane A2) were inhibitedby topical lidocaine/prilocaine applied on burnedskin in ex vivo experiments.21 An effect of bupivacaineon PGE2 EP1 receptor signaling has also been ob-served in vitro.22 In an animal model of neuropathicpain, an interaction between intrathecal lidocaine andthe eicosanoid system in the spinal cord was reportedby Ma et al.23 Although these studies suggested thatLAs may inhibit prostaglandin production, Kroin etal.24 did not observe any decrease in CSF PGE2 insham-operated rats using spinal bupivacaine. Theyalso observed that spinal bupivacaine produced alarge postsurgical CSF PGE2 upregulation, isofluranea moderate increase, and propofol did not allow anyincrease in CSF PGE2. Samad et al.2 were the first toreport that a sciatic block administered before com-plete Freund’s adjuvant-induced inflammation couldreduce but not eliminate COX2-mRNA induction inthe spinal cord or PGE2 levels in CSF. To prolong theeffect of the sciatic block, however, they used bupiv-acaine microspheres, which have been reported to

Figure 5. Expression of cyclooxygenase (COX)-2 microsomialribonucleic acid (mRNA) (relative to 18S ribosomial ribonucleicacid [rRNA]) in the left dorsal root ganglion (DRG) and spinalcord measured by quantitative reverse-transcriptase polymer-ase chain reaction (qRT-PCR). *P � 0.01 versus control group.§P � 0.01 versus carr group.

Figure 6. Expression of cyclooxygenase (COX)-2 microsomialribonucleic acid (mRNA) (relative to 18S ribosomial ribonucleicacid [rRNA]) in the right dorsal root ganglion (DRG) andspinal cord measured by quantitative reverse-transcriptasepolymerase chain reaction (qRT-PCR). *P � 0.01 versus controlgroup. §P � 0.01 versus carr group.


produce inflammation.25 A recent study reported thatbupivacaine administered locally in patients undergo-ing dental surgery had no effect on local PGE2 con-centration and COX-2 expression when comparedwith a COX-2 inhibitor and less effect when comparedwith local lidocaine.26 However, the lack of a controlgroup in this particular study did not allow us toconclude that bupivacaine had an effect on the in-creased PGE2 and COX-2 levels usually observed aftersurgery without analgesia in experimental studies.

Although a bupivacaine nerve block decreasedspinal PGE2 and COX-2 after peripheral inflamma-tion, systemic bupivacaine modified neither hyperal-gesia and local inflammation nor COX expression inour study. We previously reported that systemic ad-ministration of bupivacaine was ineffective in pre-venting hindpaw edema and hyperalgesia, but itregulated the systemic inflammatory response elicitedby peripheral inflammation in rats.8 Many argumentsstrongly suggest that LAs act at a different level whenadministered systematically or via a nerve block.Studies in humans have demonstrated little effect ofIV lidocaine on normal pain thresholds but profoundeffects on hyperalgesia-related phenomena.27 Intrave-nous lidocaine can specifically inhibit visceral nocicep-tive reflexes and spinal neurons in the rat.28 In pa-tients, continuous IV administration of lidocaineduring and after abdominal surgery improves reha-bilitation and shortens hospital stay.29,30 Meanwhile, anerve block can inhibit pain, edema, and hyperalgesia,which are local and systemic consequences of a pe-ripheral inflammation. This effect is thought to berelated to the conduction blockade initiated by thenerve block. Inhibition of axonal transport by LAs wasonly reported in vitro.31 Recently, we showed that theproinflammatory cytokine TNF-� was transportedalong the axon after peripheral inflammation in rats,and this slow retrograde (from the periphery to theDRG) transport was inhibited by bupivacaine in adose-dependent manner (Deruddre et al. submitted).This phenomenon could explain the effects of a nerveblock on inflammation, and these effects could be ofinterest in the treatment of inflammatory disease. Forexample, patients with complex regional pain syn-drome frequently develop bilateral pain and neuro-vascular signs and symptoms after a unilateral injury,which could be treated by a prolonged nerve block.32

We found that the antihyperalgesic and antiinflam-matory effects of a bupivacaine block in a peripheralmodel of inflammation was associated with an inhibi-tion of the increase in COX-2 expression induced byperipheral inflammation in DRG and cord. The sub-sequent production of PGE2 in CSF was also impaired.Systemic bupivacaine did not modify either the hy-peralgesia and local inflammation or COX expression.These results constitute one more key elementstrongly suggesting that LAs act at a different levelwhen administered systematically or via a nerveblock.

ACKNOWLEDGMENTSThe authors thank Mrs. Regine Le Guen for her technical

assistance.

REFERENCES

1. Baba H, Kohno T, Moore KA, Woolf CJ. Direct activation of ratspinal dorsal horn neurons by prostaglandin E2. J Neurosci2001;21:1750–6

2. Samad TA, Moore KA, Sapirstein A, Billet S, Allchorne A, PooleS, Bonventre JV, Woolf CJ. Interleukin-1beta-mediated induc-tion of Cox-2 in the CNS contributes to inflammatory painhypersensitivity. Nature 2001;410:471–5

3. Buvanendran A, Kroin JS, Berger RA, Hallab NJ, Saha C,Negrescu C, Moric M, Caicedo MS, Tuman KJ. Upregulation ofprostaglandin E2 and interleukins in the central nervous systemand peripheral tissue during and after surgery in humans.Anesthesiology 2006;104:403–10

4. Ebersberger A, Grubb BD, Willingale HL, Gardiner NJ, Nebe J,Schaible HG. The intraspinal release of prostaglandin E2 in amodel of acute arthritis is accompanied by an up-regulation ofcyclo-oxygenase-2 in the spinal cord. Neuroscience 1999;93:775–81

5. Guay J, Bateman K, Gordon R, Mancini J, Riendeau D.Carrageenan-induced paw edema in rat elicits a predominantprostaglandin E2 (PGE2) response in the central nervous systemassociated with the induction of microsomal PGE2 synthase-1.J Biol Chem 2004;279:24866–72

6. Hay CH, Trevethick MA, Wheeldon A, Bowers JS, de BellerocheJS. The potential role of spinal cord cyclooxygenase-2 in thedevelopment of Freund’s complete adjuvant-induced changesin hyperalgesia and allodynia. Neuroscience 1997;78:843–50

7. Bianchi M, Martucci C, Ferrario P, Franchi S, Sacerdote P.Increased tumor necrosis factor-alpha and prostaglandin E2concentrations in the cerebrospinal fluid of rats with inflamma-tory hyperalgesia: the effects of analgesic drugs. Anesth Analg2007;104:949–54

8. Beloeil H, Ababneh Z, Chung R, Zurakowski D, Mulkern RV,Berde CB. Effects of bupivacaine and tetrodotoxin oncarrageenan-induced hind paw inflammation in rats (Part 1):hyperalgesia, edema, and systemic cytokines. Anesthesiology2006;105:128–38

9. Zimmermann M. Ethical guidelines for investigations of experi-mental pain in conscious animals. Pain 1983;16:109–10

10. Fletcher D, Kayser V, Guilbaud G. Influence of timing ofadministration on the analgesic effect of bupivacaine infiltrationin carrageenin-injected rats. Anesthesiology 1996;84:1129–37

11. Gentili ME, Mazoit JX, Samii KK, Fletcher D. The effect of asciatic nerve block on the development of inflammation incarrageenan injected rats. Anesth Analg 1999;89:979–84

12. Ichitani Y, Shi T, Haeggstrom JZ, Samuelsson B, Hokfelt T.Increased levels of cyclooxygenase-2 mRNA in the rat spinalcord after peripheral inflammation: an in situ hybridizationstudy. Neuroreport 1997;8:2949–52

13. Pham-Marcou TA, Beloeil H, Sun X, Gentili M, Yaici D, BenoitG, Benhamou D, Mazoit JX. Antinociceptive effect of resveratrolin carrageenan-evoked hyperalgesia in rats: prolonged effectrelated to COX-2 expression impairment. Pain 2008;140:274–83

14. Beloeil H, Ji RR, Berde CB. Effects of bupivacaine and tetrodo-toxin on carrageenan-induced hind paw inflammation in rats(Part 2): cytokines and p38 mitogen-activated protein kinases indorsal root ganglia and spinal cord. Anesthesiology 2006;105:139–45

15. Estebe JP, Gentili ME, Le Corre P, Leduc C, Moulinoux JP,Ecoffey C. Contralateral effect of amitriptyline and bupivacainefor sciatic nerve block in an animal model of inflammation. Br JAnaesth 2004;93:705–9

16. Ibuki T, Matsumura K, Yamazaki Y, Nozaki T, Tanaka Y, Koba-yashi S. Cyclooxygenase-2 is induced in the endothelial cellsthroughout the central nervous system during carrageenan-induced hind paw inflammation; its possible role in hyperalgesia.J Neurochem 2003;86:318–28

17. Pham-Marcou TA, Gentili M, Asehnoune K, Fletcher D, MazoitJX. Effect of neurolytic nerve block on systemic carrageenan-induced inflammatory response in mice. Br J Anaesth 2005;95:243–6


18. Goel RK, Tavares IA, Nellgard P, Jonsson A, Cassuto J, BennettA. Effect of lignocaine on eicosanoid synthesis by pieces ofhuman gastric mucosa. J Pharm Pharmacol 1994;46:319–20

19. Kunze H, Nahas N, Traynor JR, Wurl M. Effects of localanaesthetics on phospholipases. Biochim Biophys Acta1976;441:93–102

20. Vadas P, Stefanski E, Pruzanski W. Potential therapeutic effi-cacy of inhibitors of human phospholipase A2 in septic shock.Agents Actions 1986;19:194–202

21. Jonsson A, Cassuto J, Tarnow P, Sinclair R, Bennett A, TavaresIA. Effects of amide local anaesthetics on eicosanoid formationin burned skin. Acta Anaesthesiol Scand 1999;43:618–22

22. Honemann CW, Heyse TJ, Mollhoff T, Hahnenkamp K, BerningS, Hinder F, Linck B, Schmitz W, van Aken H. The inhibitoryeffect of bupivacaine on prostaglandin E(2) (EP(1)) receptorfunctioning: mechanism of action. Anesth Analg 2001;93:628–34

23. Ma W, Du W, Eisenach JC. Intrathecal lidocaine reverses tactileallodynia caused by nerve injuries and potentiates the antiallo-dynic effect of the COX inhibitor ketorolac. Anesthesiology2003;98:203–8

24. Kroin JS, Buvanendran A, Watts DE, Saha C, Tuman KJ.Upregulation of cerebrospinal fluid and peripheral prostaglan-din E2 in a rat postoperative pain model. Anesth Analg2006;103:334–43

25. Drager C, Benziger D, Gao F, Berde CB. Prolonged intercostalnerve blockade in sheep using controlled-release of bupivacaineand dexamethasone from polymer microspheres. Anesthesiol-ogy 1998;89:969–79

26. Gordon SM, Chuang BP, Wang XM, Hamza MA, Rowan JS,Brahim JS, Dionne RA. The differential effects of bupivacaineand lidocaine on prostaglandin E2 release, cyclooxygenase geneexpression and pain in a clinical pain model. Anesth Analg2008;106:321–7

27. Koppert W, Zeck S, Sittl R, Likar R, Knoll R, Schmelz M.Low-dose lidocaine suppresses experimentally induced hyper-algesia in humans. Anesthesiology 1998;89:1345–53

28. Ness TJ. Intravenous lidocaine inhibits visceral nociceptivereflexes and spinal neurons in the rat. Anesthesiology2000;92:1685–91

29. Marret E, Rolin M, Beaussier M, Bonnet F. Meta-analysis ofintravenous lidocaine and postoperative recovery after abdomi-nal surgery. Br J Surg 2008;95:1331–8

30. Herroeder S, Pecher S, Schonherr ME, Kaulitz G, HahnenkampK, Friess H, Bottiger BW, Bauer H, Dijkgraaf OG, Durieux ME,Hollmann MW. Systemic lidocaine shortens length of hospitalstay after colorectal surgery: a double-blinded, randomized,placebo-controlled trial. Ann Surg 2007;246:192–200

31. Kanai A, Hiruma H, Katakura T, Sase S, Kawakami T, Hoka S.Low-concentration lidocaine rapidly inhibits axonal transport incultured mouse dorsal root ganglion neurons. Anesthesiology2001;95:675–80

32. Dadure C, Motais F, Ricard C, Raux O, Troncin R, Capdevila X.Continuous peripheral nerve blocks at home for treatment ofrecurrent complex regional pain syndrome I in children. Anes-thesiology 2005;102:387–91


A Peripherally Acting Nav1.7 Sodium Channel BlockerReverses Hyperalgesia and Allodynia on Rat Models ofInflammatory and Neuropathic Pain

Erin McGowan, BS

Scott B. Hoyt, PhD

Xiaohua Li, BS

Kathryn A. Lyons, BS

Catherine Abbadie, PhD

BACKGROUND: Voltage-gated sodium channels (Nav1) are expressed in primarysensory neurons where they influence excitability via their role in the generationand propagation of action potentials. Recently, human genetic data have shownthat one sodium channel subtype, Nav1.7, plays a major role in pain. We performedthese studies to characterize the antinociceptive effects of N-[(R)-1-((R)-7-chloro-1-isopropyl-2-oxo-2,3,4,5-tetrahydro-1H-benzo[b]azepin-3-ylcarbamoyl)-2-(2-fluorophenyl)-ethyl]-4-fluoro-2-trifluoromethyl-benzamide (BZP), a non-centralnervous system (CNS) penetrant small molecule with high affinity and preferentialselectivity for Nav1.7 over Nav1.8 and Nav1.5.METHODS: BZP was evaluated in rat preclinical models of inflammatory andneuropathic pain and compared with standard analgesics. Two models were used:the complete Freund’s adjuvant model of inflammatory pain and the spinal nerveligation model of neuropathic pain. BZP was also evaluated in a motor coordina-tion assay to assess its propensity for CNS side effects.RESULTS: In preclinical models of chronic pain, BZP displayed efficacy comparablewith that of leading analgesics. In the complete Freund’s adjuvant model, BZPproduced reversal of hyperalgesia comparable with nonsteroidal antiinflammatorydrugs, and in the spinal nerve ligation model, BZP produced reversal of allodyniacomparable with gabapentin and mexiletine. Unlike the CNS penetrant compoundsgabapentin and mexiletine, BZP did not induce any impairment of motor coordination.CONCLUSIONS: These data suggest that a peripherally acting sodium channel blocker,preferentially acting through Nav1.7, could provide clinical relief of chronic painwithout the CNS side effects typical of many existing pain treatments.(Anesth Analg 2009;109:951–8)

Voltage-gated sodium channels (Nav1) are multi-subunit protein complexes composed of a pore-forming, voltage-sensing �-subunit and two smaller�-subunits.1,2 They are essential for the generation andpropagation of action potentials and have been shownto play a central role in primary afferent ectopicdischarges that originate from the injury site or thedorsal root ganglia (DRG).3,4 Nine different mamma-lian �-subunits (Nav1.1–1.9) have been cloned (fornomenclature see Ref. 5). Over the last decade, therehas been considerable debate regarding which�-subunit would provide the best target for the devel-opment of novel analgesics.

Compelling genetic evidence linking Nav1.7 to painin humans has been provided by the identification ofgain-of-function and loss-of-function mutations in

SCN9A, the gene that encodes Nav1.7.6,7 Gain-of-function mutations that result in increased Nav1.7activity are responsible for inherited erythromelalgia,a burning pain syndrome of the skin of the extremitiesin response to warmth or moderate exercise.8–10 Ninemutations of SCN9A have been identified in patientswith erythromelalgia (see references in Ref. 7). Thesemutations cause a hyperpolarizing shift in the voltagedependence of channel activation, which in turn allowsthe channel to be activated by smaller depolarizations,resulting in enhanced Nav1.7 activity. In addition, recov-ery from inactivation (repriming) has been shown to befaster for some mutations. Alterations in the activation ordeactivation of Nav1.7 might contribute to the hyperex-citability of DRG neurons that underlies some forms ofhyperalgesia. Gain-of-function mutations of Nav1.7 canalso cause paroxysmal extreme pain disorder, which ischaracterized by ocular, mandibular, and/or rectalpain.11,12 In contrast, mutations leading to loss ofNav1.7 function have been linked to a congenitalinsensitivity to pain.13 Individuals with these muta-tions have the ability to detect tactile thresholds anddifferences in temperature but are unable to perceiveany form of pain. Functional studies show thatchannelopathy-associated insensitivity to pain is

From the Merck Research Laboratories, Department of Pharma-cology and Medicinal Chemistry Rahway, New Jersey.

Accepted for publication April 13, 2009.All authors are Merck employees.Address correspondence and reprint requests to Catherine

Abbadie, PhD, Alcon Labs, 6201 South Freeway, Fort Worth, TX76134-2099. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181b01b02


caused by loss-of-function of Nav1.7,13,14 in contrastwith the genetic basis of inherited erythermalgia andparoxysmal extreme pain disorder associated withgain-of-function.9,10 Collectively, these studies pro-vide strong genetic evidence for the importance ofNav1.7 in pain.

The present studies were undertaken to charac-terize the antinociceptive effects of N-[(R)-1-((R)-7-chloro-1-isopropyl-2-oxo-2,3,4,5-tetrahydro-1H-benzo[b]azepin-3-ylcarbamoyl)-2-(2-fluorophenyl)-ethyl]-4-fluoro-2-trifluoromethyl-benzamide (BZP), asmall molecule that displayed high affinity and pref-erential selectivity for Nav1.7 over Nav1.8.15 BZP wasscreened against a broad panel of ion channels, recep-tors, and enzymes and was found to have no signifi-cant in vitro activity for known pain targets other thanNav1 channel blockade.16 BZP was therefore furtherevaluated in chronic models of inflammatory andneuropathic pain. Because sodium channel blockerscurrently approved for pain relief are often brain-penetrant, they frequently elicit central nervoussystem (CNS) side effects, such as sedation andimpairment. In light of this, BZP was also evaluatedin a motor coordination assay to assess the probabil-ity of CNS side effects and to determine a preclinicaltherapeutic index between side effects and antino-ciceptive effects.

METHODSAnimals

Male Sprague-Dawley rats (220–280 g) were pur-chased from Charles River Laboratories (Wilmington,MA). The procedures used in these studies wereapproved by the Institutional Animal Care and UseCommittee at Merck, Rahway, NJ and adhered to theguidelines of the Committee for Research and EthicalIssues.17 Rats were habituated to the testing environ-ment by being placed in the experiment room 3 daysbefore sensory testing. For von Frey assessment, ratswere habituated 2 h/day for 2 days before evaluation.Rats were used for only one drug and one dose.

For testing in the neuropathic pain model (spinalnerve ligation [SNL]), rats were anesthetized withisoflurane and placed on a heating pad. Using aseptictechniques, the L5 spinal nerve was exposed, ligated,and transected.18 Muscle and skin were closed with4-0 polydiaxone and wound clips, respectively. Allo-dynia was assessed 4 wk after SNL surgery, and onlyrats that developed allodynia as defined by a signifi-cant decrease in their mechanical threshold using vonFrey filaments were used. Tactile allodynia was as-sessed with calibrated von Frey filaments (Stoelting,Wood Dale, IL) using an up-down paradigm.19 Me-chanical sensitivity was determined by applying aseries of eight calibrated von Frey filaments (0.36, 0.6,1, 2, 4, 6, 8, and 15 g) to the plantar aspect of the lefthindpaw. Cutoff value corresponded to 15 g. Rats thatdisplayed preinjury baseline measurements �15 gwere not included in the study. A response wasindicated by brisk withdrawal of the hindpaw.

For testing in the inflammatory pain model, ratswere injected with complete Freund’s adjuvant (CFA)(200 �L, 1:1 in saline; Sigma, St. Louis, MO) intraplan-tar into their left paws. Animals were tested forhyperalgesia 3 days after CFA administration, usingwithdrawal threshold to paw pressure (Randal-Sellito,Stoelting). In the absence of inflammation, 95% of theanimals reached cutoff values of 25 g.

For motor coordination assessment, rats weretrained on the rota-rod (Stoelting) for 3 min at a speedof 10 rpm. For testing, the speed was set at 10 rpm for60 s and subsequently accelerated from 6 to 60 rpm.The time required for rats to fall after the beginning ofacceleration was recorded.

Compound AdministrationBZP (Fig. 1) was synthesized according to estab-

lished procedures.15 As described by Williams et al.,16

in stably transfected human embryonic kidney 293cells, BZP displayed selective block of Nav1.7 overNav1.5 and Nav1.8. In a voltage-dependent fluores-cence resonance energy transfer imaging assay, BZPblocked hNav1.7, Nav1.5, and Nav1.8 with IC50s of

Figure 1. A, Structure of BZP, N-[(R)-1-((R)-7-chloro-1-isopropyl-2-oxo-2,3,4,5-tetrahydro-1H-benzo[b]azepin-3-ylcarbamoyl)-2-(2-fluorophenyl)-ethyl]-4-fluoro-2-trifluoromethyl-benzamide. B, Plasma levels versus time of BZP when administered at 1mg/kg IV (n � 2) or 3 mg/kg PO (n � 3).

952 Effects of a Nav1.7 Blocker in Rat Chronic Pain Models ANESTHESIA & ANALGESIA

0.03 � 0.02, 0.18 � 0.05, and 0.3 � 016 (mean � sd)�M, respectively. Similarly, in whole cell electrophysi-ology experiments, BZP blocked Nav1.5 and Nav1.8more weakly than Nav1.7.16

For PO administration, rats were manually re-strained for oral gavage. BZP was diluted inDMSO:PEG300:water (15:60:25). Naproxen, indo-methacin (Sigma), and rofecoxib (synthesized inhouse) were diluted in 0.5% methylcellulose (Sigma)in water. Mexiletine and gabapentin (Sigma) werediluted in water. Compounds were administered at thedoses indicated in a formulation of 2 mL/kg of bodyweight. Investigators were blinded to rat treatment.

Pharmacokinetic AnalysisFor pharmacokinetic experiments, rats received

BZP at 1 mg/kg IV (n � 2) or 3 mg/kg PO (n � 3).For brain penetration analysis, rats received 30 or100 mg/kg PO BZP (n � 6/group). BZP plasma andbrain concentrations were determined by liquidchromatography/mass spectrometry using an ABISciex API 3000 mass spectrometer operated in positiveion atmospheric pressure chemical ionization modewith multiple-reaction monitoring. Brain homogenate(1:3, tissue:water) and plasma were prepared for anal-ysis by protein precipitation with acetonitrile. Extractswere chromatographed using a DuPont Zorbax SB-C8column (50 � 2 mm, 5 �m) and eluted at 0.2 mL/minunder isocratic conditions with acetonitrile:water (77:23)containing 5 mM ammonium formate/0.1% formic acid.Under these conditions, BZP eluted at 1.4 min.

Pharmacokinetic parameters were calculated with anoncompartmental model using Watson software(Watson Software System version 7.3, Thermo Fisher,Waltham, MA). The area under the plasma concentra-tion versus time curve from 0 to 24 h (AUC0–24) wasdetermined using linear trapezoidal interpolation inthe ascending slope and logarithmic trapezoidal inter-polation in the descending slope. The portion of theAUC from the last measurable concentration to infin-ity (AUC0-inf) was estimated by Ct/kel, where Ct rep-resents the last measurable concentration and kel is theelimination rate constant. The latter was determinedfrom the concentration versus time curve at the termi-nal phase by linear regression of the semilogarithmicplot. Oral bioavailability (F) was estimated as theAUC0-inf ratio after oral and IV administration normal-ized for differences in dose. Peak plasma concentration(Cmax [�M]) and its time of occurrence (Tmax [h]) wereobtained by inspection of the plasma concentration-timeprofile. The apparent half-life (t1/2) was estimated fromthe slope of the terminal phase of the log plasmaconcentration-time curve.

Data AnalysisRats were randomly assigned to each treatment

group, and the investigator evaluating animals wasblinded to the animal’s treatment. Results are pre-sented as mean � sem. Percent reversals are calculated

as (postdose � predose)/(preinjury � predose) foreach rat. One hundred percent corresponds to com-plete reversal of hyperalgesia or allodynia, equivalentto noninjured values, and 0% corresponds to valuesnot different from baseline postinjury (Figs. 2 and 3).Results were analyzed using a two-way analysis ofvariance (ANOVA) (for dose and time postdose) testfollowed by a Bonferroni post hoc test for multiplecomparisons (Prism, Graph Pad, San Diego, CA). ED50

are calculated as doses corresponding to a 50% effect(100% effect corresponding to recovery to baselinevalues in the absence of injury).

RESULTSPharmacokinetic Profile of BZP

BZP exhibited good bioavailability in rats (F � 90%)after oral administration of a 3 mg/kg dose, with aCmax of 0.33 �M obtained 2 h postdose (Tmax). BZPhalf-life was 2.8 h after a 1 mg/kg IV dose. Plasmaconcentrations of BZP were dose-proportional be-tween 1 and 100 mg/kg PO. BZP was poorly brain-penetrant, with a brain-to-plasma ratio of 0.077.Plasma samples harvested after administration of BZPin rat models of pain or motor coordination areillustrated in Figure 3D. As an example, a 10 mg/kgPO dose gave plasma concentrations of 0.4 and 0.8 �Mat 2 and 4 h postdose, respectively.

Rat CFA Model of Inflammatory PainInflammatory pain was induced by intraplantar

injection of CFA into the hindpaws of rats. Three daysafter CFA injection, a single PO dose (1, 3, or 10mg/kg) of BZP or vehicle was administered, andmechanical hyperalgesia was assessed at 2, 4, 8, and24 h postdose. Two-way ANOVA revealed a signifi-cant effect of dose (F � 24.80, P � 0.0001) and of time(F � 51.01, P � 0.0001) with a significant interaction(F � 16.31, P � 0.0001). Subsequent Bonferroni post hoctests comparing each dose with the vehicle groupdetermined that hyperalgesia was significantly re-versed by 1 mg/kg PO at 4 and 8 h postdose (Fig. 2A).At the 3 and 10 mg/kg doses, significant reversal ofhyperalgesia was observed at 2, 4, and 8 h postdose.Maximal reversal of hyperalgesia was 69% at the 10mg/kg dose. At 24 h postdose, hyperalgesia was notdifferent from baseline before administering BZP(Figs. 2A and B). The pharmacokinetic versus pharma-codynamic effect of BZP is illustrated in Figure 2C.Regardless of the dose, BZP reversal of hyperalgesiawas similar at 2, 4, or 8 h postdose in agreement withthe concentration of BZP in plasma (Fig. 2C). Thecomparison of BZP antihyperalgesic effects to stan-dard analgesics showed that BZP was as potent asrofecoxib in reversing CFA-induced hyperalgesia. TheBZP ED50 value was equivalent to rofecoxib and lowerthan that of indomethacin or naproxen (Fig. 2D).


Rat SNL Model of Neuropathic PainFour weeks after SNL, a single PO dose (3, 10, or 30

mg/kg) of BZP or vehicle was administered, andmechanical allodynia was assessed at 2 and 4 hpostdose. Two-way ANOVA revealed a significanteffect of dose (F � 20.75, P � 0.0001) and of time (F �37.57, P � 0.0001) with a significant interaction (F �15.50, P � 0.0001). Subsequent Bonferroni posttestsdetermined that a 3 mg/kg PO dose significantlyreversed mechanical allodynia (Fig. 3A). Maximalreversal of allodynia was 61% at the 30 mg/kg dose(Fig. 3A). Comparison of BZPs antiallodynic effectwith neuropathic pain drugs used in the clinic showedthat BZP was three times more potent than gabapentinor mexiletine (Fig. 3C).

Rat Rota-Rod Model of Motor CoordinationIn naive rats, BZP activity was evaluated in a motor

coordination model at 30 and 100 mg/kg PO. At thesedoses, BZP induced no significant change in runn-ing latency in the rota-rod (Fig. 3B). Gabapentin atdoses larger than 10 mg/kg PO and mexiletine at

doses larger than 30 mg/kg induced significant motorimpairment (Fig. 3C).

CNS Therapeutic WindowIn the SNL model of neuropathic pain, mexiletine

and gabapentin each exhibited an ED50 of 45 and 50mg/kg PO, respectively (Fig. 3C). In the rota-rodmodel, where the ED20 indicated significant motorcoordination impairment, mexiletine and gabapen-tin exhibited ED20s of 50 and 10 mg/kg PO, respec-tively. Therefore, the CNS therapeutic index wasdetermined to be 1 for mexiletine and �1 forgabapentin (Fig. 3C). BZP exhibited an ED50 in theSNL model of 7 mg/kg PO (Fig. 3C), with nosignificant effects on motor coordination at 100mg/kg PO in the rota-rod model. Additionally, BZPEC50 in rat chronic pain models was 0.4 �M (Fig.2C), with no rota-rod effects observed at concentra-tions up to 5 �M. Thus, CNS therapeutic index ofBZP was at least �12, greater than that of mexiletineor gabapentin.

Figure 2. Effects of N-[(R)-1-((R)-7-chloro-1-isopropyl-2-oxo-2,3,4,5-tetrahydro-1H-benzo[b]azepin-3-ylcarbamoyl)-2-(2-fluorophenyl)-ethyl]-4-fluoro-2-trifluoromethyl-benzamide (BZP) in the rat complete Freund’s adjuvant (CFA)-induced hy-peralgesia model. A, Time course and dose-response of the effects of BZP using a Randal-Sellito apparatus to assessmechanical hyperalgesia. BZP significantly reversed CFA-induced hyperalgesia at 1–10 mg/kg PO with a duration of actionmore than 8 h postdose. % reversal of hyperalgesia calculated as indicated in Methods are shown above graph bars. Pointsand bars represent the mean � sem. n � 6/group. Significance is expressed using a two-way analysis of variance followedby a Bonferroni posttests for multiple comparisons with “vehicle” values (*P � 0.05, ***P � 0.001). B, Percent reversal ofhyperalgesia versus time. BZP exerted a significant antihyperalgesic effect up to 8 h postdose. At 24 h postdose, hyperalgesiavalues were not different from predose values. C, Plasma levels of BZP versus percent reversal of hyperalgesia in the CFAmodel. All timepoints (2–24 h postdose) are represented in this graph. D, Comparison of BZP antihyperalgesic effects tostandard analgesics. Maximal effect, regardless of time postdose is represented. BZP ED50 value was equivalent to rofecoxiband more than indomethacin or naproxen. All data are expressed as mean � sem, except for plasma levels that are expressedas mean � sd.


DISCUSSIONIn this study, we showed that a peripherally acting

sodium channel blocker dose-dependently reversedhyperalgesia in the CFA model of inflammatory painand allodynia in the SNL model of neuropathic pain.In the CFA-induced hyperalgesia model, BZP pro-duced reversal of hyperalgesia comparable with non-steroidal antiinflammatory drugs, and in the SNLmodel of neuropathic pain, BZP produced reversal ofallodynia comparable with the clinical drugs gabap-entin and mexiletine. In contrast to gabapentin andmexiletine, BZP did not induce any sedative effects.

The small molecule sodium channel blocker BZPdisplays selectivity for Nav1.7 versus other Nav1.8 andNav1.5 subtypes. In a voltage/ion probe reader assayin stably transfected cells, BZP displayed 10-fold se-lectivity for block of Nav1.7 over Nav1.5 and Nav1.8(IC50 � 0.03 vs 0.3 �M). Similarly, in whole cellelectrophysiology experiments, BZP blocked Nav1.5and Nav1.8 more weakly than Nav1.7.16 BZP was alsoscreened for activity against a broad panel of other ionchannels, receptors, and enzymes and was found tohave no significant in vitro activity other than sodium

channel blockade.16 To our knowledge, BZP actssolely through sodium channels and no other currentsthat contribute to neuronal excitability. Because theEC50 in rodent models of pain was 0.4 �M, we cannotexclude that BZP acts solely through Nav1.7 and notany other sodium channel subtypes. Although wecalculated EC50s based on plasma concentrations,local concentration at the tissue level (i.e., nerve orDRGs) would be more relevant, albeit more difficultto determine.

Over the last decade, there has been intense debateregarding the relative role of sodium channel � sub-types in nociceptive transmission.20 The �-subunit isnecessary and sufficient to generate a functional so-dium channel, and each �-subunit confers uniquebiophysical properties to the voltage-gated sodiumchannel. The distribution of sodium channels is alsoimportant in determining channel function. Five so-dium channels, Nav1.1, Nav1.6, Nav1.7, Nav1.8, andNav1.9, are expressed at substantial levels in DRG ofadult rats, and most, if not all, DRG neurons expressmultiple sodium channel isoforms.21 The expressionof sodium channels in DRG neurons is dynamic. For

Figure 3. Effects of N-[(R)-1-((R)-7-chloro-1-isopropyl-2-oxo-2,3,4,5-tetrahydro-1H-benzo[b]azepin-3-ylcarbamoyl)-2-(2-fluorophenyl)-ethyl]-4-fluoro-2-trifluoromethyl-benzamide (BZP) in the rat spinal nerve ligation (SNL)-induced allodyniamodel of neuropathic pain and in the rota-rod (RR) model of motor coordination. A, Dose-response of the effects of BZP usingvon Frey filaments to assess mechanical allodynia. BZP significantly reversed SNL-induced allodynia at 3–30 mg/kg PO. %reversal calculated as indicated in Methods are shown above graph bars. Significance is expressed comparing postdose valueswith vehicle values using a two-way analysis of variance followed by a Bonferroni posttests for multiple comparisons (**P �0.01, ***P � 0.001). n � 8/group. B, BZP effects in the RR model of motor coordination. n � 6/group. BZP at 30 or 100 mg/kgPO exerted no significant effects on motor coordination 1 h postdose. C, Comparison of the antiallodynic activity versus sideeffect profile for BZP versus standard analgesics used for neuropathic pain. BZP ED50 value in SNL model is more thanmexiletine and gabapentin. In the RR model, mexiletine and gabapentin significantly (�20%) impair motor coordination.


example, Nav1.3 is expressed at low levels in adultDRG neurons but upregulated in several models ofneuropathic pain,22 whereas Nav1.1, Nav1.6, andNav1.7 are downregulated after tight SNL.23,24 Inaddition, inflammatory or neurotrophic factors (nervegrowth factor and/or glial cell neurotrophic factor) aswell as prostaglandin E2 can affect the expression ofspecific sodium channels (see references in Ref. 20).Regarding the relative role and contribution of Nav1subtypes to nociceptive mechanisms, data from micedeficient in one channel subtype versus data fromantisense oligonucleotides knock down are contradic-tory. For example, Nav1.8 antisense studies haveshown that Nav1.8 contributes to both neuropathic25,26

and inflammatory27 pain. However, Nav1.8-disruptedmice showed reduction in inflammatory hyperalgesiacompared with wild-type control mice but no attenu-ation of mechanical allodynia after partial sciatic nerveligation.28,29 Consistent with many of the Nav1.8 anti-sense data, A-803467, a small molecule-selectiveblocker of Nav1.8, is effective in various rat models ofinflammatory and neuropathic pain.30

In agreement with our data showing that BZPpotently inhibits inflammation-induced hyperalgesiain rats, and in addition to human genetic data sup-porting a role for Nav1.7 in acute nociception andinflammatory pain (see references in Ref. 7), preclini-cal studies demonstrate a prominent role for Nav1.7 ininflammatory pain. Both Nav1.7 mRNA and proteinare upregulated in DRG in rodent models of inflam-mation.31,32 Because a global Nav1.7 null mutant wasfound to die shortly after birth, Nassar et al.33 used aCre-loxP system to generate nociceptor-specificknockouts. Nav1.7 nociceptor-specific knockout miceare viable and apparently normal. These animals showincreased mechanical and thermal pain thresholds.Remarkably, all inflammatory pain responses evokedby a range of stimuli, such as formalin, carrageenan,CFA, or nerve growth factor, are reduced or abolishedin Nav1.7 null mutant mice.33 In contrast to the highlysignificant role for Nav1.7 in determining inflamma-tory pain thresholds, the development of neuropathicpain is not affected in Nav1.7 nociceptor-specificknockout mice or in double knockouts of both Nav1.7and Nav1.8 mice.34 These data in mice deficient forNav1.7 and/or Nav1.8 are not in agreement with ourpresent data showing that pharmacological blockadeof Nav1.7 with BZP potently reverses SNL-inducedallodynia. Nav1.7 sodium channels produce a rapidlyactivating and inactivating current that is sensitive totetrodotoxin. Nav1.7 appears to be important in theearly phases of depolarization. It is characterized byslow transition of the channel into an inactive statewhen it is depolarized, allowing these channels toremain available for activation with small or slowlydeveloping depolarizations.35 Nav1.7 amplifies smalldepolarizations, such as generator potentials, andtherefore plays a prominent role in spontaneous firingassociated with nerve injury. There are also a number

of lines of evidence that support a role for Nav1.8 inhyperexcitability and neuropathic pain. These includeantisense knockdown of the channel,25,26 as well as theuse of A-803467, a Nav1.8-selective small moleculesodium channel blocker, to reduce pain in models ofnerve injury.30 Subtype selectivity does not seem to bea prerequisite for alleviating neuropathic pain becausenonsubtype selective sodium channel blockers areeffective in preclinical models of neuropathic pain,36,37

and approved drugs, such as lidocaine or amitripty-line, are nonsubtype selective.

Several hypotheses regarding BZP mechanism ofaction can be proposed. Sodium channels expressed inprimary afferent neurons have been implicated in theaberrant firing that follows nerve injury from periph-eral inflammation,20 suggesting that BZP could inhibitthe hyperexcitability of damaged or inflamed primaryafferent fibers.38,39 Alternatively, because Nav1.7 chan-nels are expressed, not only in DRG neurons but alsoin sympathetic ganglion neurons,40 BZP could exert itsantihyperalgesic activity through sympathetic block-ade. Because it is poorly brain-penetrant, BZP likelydoes not act via a central mechanism, such as mexil-etine or gabapentin.

The exact mechanism by which BZP blocks Nav1.7channels remains to be investigated. Local anesthetic,antiarrhythmic, and antiepileptic sodium channelblockers bind to overlapping receptor sites located inthe inner cavity of the channel pore.41 Because pore-lining segments are highly conserved among sodiumchannel subtypes, most blockers interact with thesame region of the channel. At present it is unknownwhether BZP shares the same affinity site as localanesthetic, antiarrhythmic, and antiepileptic sodiumchannel blockers; however, these agents can competewith BZP for similar binding sites.16 The fact that BZPblocks Nav1.7 more potently than clinically used so-dium channel blockers16 suggests the existence ofspecific and well-defined interactions of BZP withselected domains of the channel.

Sodium channel blockers currently approved forpain treatment are highly brain penetrant and elicitdose-limiting side effects, such as somnolence andsedation. In contrast, BZP is poorly brain-penetrant(brain to plasma ratio � 0.08) and, in a model of motorcoordination, did not induce impairment at plasmalevels higher than those required for efficacy inchronic pain models. In principle, sodium channelblockade could affect motor coordination either cen-trally or by a peripheral effect at the neuromuscularjunction. It is not yet clear whether brain penetration isrequired for clinical efficacy, because pain relief isobtained when lidocaine is delivered via a transder-mal patch.42 Although the exact mechanism of actionof the lidocaine patch is unknown,43 a local drug effecthas been demonstrated in postherpetic neuralgia pa-tients.44 Nevertheless, as a peripherally acting com-pound, BZP would likely be devoid of CNS sideeffects in the clinic.


In summary, we have shown that a peripheralsodium channel blocker acting preferentially throughNav1.7 dose-dependently reversed hyperalgesia in theCFA model of inflammatory pain and allodynia in theSNL model of neuropathic pain. In the CFA-inducedhyperalgesia model, BZP produced reversal of hyper-algesia comparable with that observed with nonsteroi-dal antiinflammatory drugs. In the SNL model ofneuropathic pain, BZP produced reversal of allodyniacomparable with that observed with the clinical drugsgabapentin and mexiletine. Unlike gabapentin andmexiletine, BZP did not show any motor coordinationimpairment. These results suggest that a peripherallyacting Nav1.7 blocker could provide clinical relief ofchronic pain without the CNS side effects typical ofmany existing pain treatments.

ACKNOWLEDGMENTSThe authors thank Nina Jochnowitz for outstanding tech-

nical expertise.

REFERENCES

1. Marban E, Yamagishi T, Tomaselli GF. Structure and function ofvoltage-gated sodium channels. J Physiol 1998;508:647–57

2. Catterall WA. From ionic currents to molecular mechanisms:the structure and function of voltage-gated sodium channels.Neuron 2000;26:13–25

3. Wall PD, Gutnick M. Properties of afferent nerve impulsesoriginating from a neuroma. Nature 1974;248:740–3

4. Devor M, Janig W, Michaelis M. Modulation of activity in dorsalroot ganglion neurons by sympathetic activation in nerve-injured rats. J Neurophysiol 1994;71:38–47

5. Goldin AL, Barchi RL, Caldwell JH, Hofmann F, Howe JR,Hunter JC, Kallen RG, Mandel G, Meisler MH, Netter YB, NodaM, Tamkun MM, Waxman SG, Wood JN, Catterall WA. Nomen-clature of voltage-gated sodium channels. Neuron 2000;28:365–8

6. Dib-Hajj SD, Cummins TR, Black JA, Waxman SG. From genesto pain: Nav1.7 and human pain disorders. Trends Neurosci2007;30:555–63

7. Drenth JP, Waxman SG. Mutations in sodium-channel geneSCN9A cause a spectrum of human genetic pain disorders.J Clin Invest 2007;117:3603–9

8. Drenth JP, te Morsche RH, Guillet G, Taieb A, Kirby RL, JansenJB. SCN9A mutations define primary erythermalgia as a neuro-pathic disorder of voltage gated sodium channels. J InvestDermatol 2005;124:1333–8

9. Dib-Hajj SD, Rush AM, Cummins TR, Hisama FM, Novella S,Tyrrell L, Marshall L, Waxman SG. Gain-of-function mutationin Nav1.7 in familial erythromelalgia induces bursting of sen-sory neurons. Brain 2005;128:1847–54

10. Waxman SG, Dib-Hajj SD. Erythromelalgia: a hereditary painsyndrome enters the molecular era. Ann Neurol 2005;57:785–8

11. Fertleman CR, Ferrie CD. What’s in a name—familial rectal painsyndrome becomes paroxysmal extreme pain disorder. J NeurolNeurosurg Psychiatry 2006;77:1294–5

12. Fertleman CR, Baker MD, Parker KA, Moffatt S, Elmslie FV,Abrahamsen B, Ostman J, Klugbauer N, Wood JN, GardinerRM, Rees M. SCN9A mutations in paroxysmal extreme paindisorder: allelic variants underlie distinct channel defects andphenotypes. Neuron 2006;52:767–74

13. Cox JJ, Reimann F, Nicholas AK, Thornton G, Roberts E,Springell K, Karbani G, Jafri H, Mannan J, Raashid Y, Al-GazaliL, Hamamy H, Valente EM, Gorman S, Williams R, McHale DP,Wood JN, Gribble FM, Woods CG. An SCN9A channelopathycauses congenital inability to experience pain. Nature 2006;444:894–8

14. Ahmad S, Dahllund L, Eriksson AB, Hellgren D, Karlsson U,Lund PE, Meijer IA, Meury L, Mills T, Moody A, Morinville A,Morten J, O’Donnell D, Raynoschek C, Salter H, Rouleau GA,Krupp JJ. A stop codon mutation in SCN9A causes lack of painsensation. Hum Mol Genet 2007;16:2114–21

15. Hoyt SB, London C, Ok H, Gonzalez E, Duffy JL, Abbadie C,Dean B, Felix JP, Garcia ML, Jochnowitz N, Karanam BV, Li X,Lyons KA, McGowan E, Macintyre DE, Martin WJ, Priest BT,Smith MM, Tschirret-Guth R, Warren VA, Williams BS, Kaczo-rowski GJ, Parsons WH. Benzazepinone Nav1.7 blockers: po-tential treatments for neuropathic pain. Bioorg Med Chem Lett2007;17:6172–7

16. Williams BS, Felix JP, Priest BT, Brochu RM, Dai K, Hoyt SB,London C, Tang YS, Duffy JL, Parsons WH, Kaczorowski GJ,Garcia ML. Characterization of a new class of potent inhibitorsof the voltage-gated sodium channel Nav1.7. Biochemistry2007;46:14693–703

17. Zimmermann M. Ethical guidelines for investigations of experi-mental pain in conscious animals. Pain 1983;16:109–10

18. Kim SH, Chung JM. An experimental model for peripheralneuropathy produced by segmental spinal nerve ligation in therat. Pain 1992;50:355–63

19. Chaplan SR, Bach FW, Pogrel JW, Chung JM, Yaksh TL.Quantitative assessment of tactile allodynia in the rat paw.J Neurosci Methods 1994;53:55–63

20. Gold MS. Na(�) channel blockers for the treatment of pain:context is everything, almost. Exp Neurol 2008;210:1–6

21. Black JA, Dib-Hajj S, McNabola K, Jeste S, Rizzo MA, Kocsis JD,Waxman SG. Spinal sensory neurons express multiple sodiumchannel alpha-subunit mRNAs. Brain Res Mol Brain Res1996;43:117–31

22. Waxman SG, Kocsis JD, Black JA. Type III sodium channelmRNA is expressed in embryonic but not adult spinal sensoryneurons, and is reexpressed following axotomy. J Neurophysiol1994;72:466–70

23. Kim CH, Oh Y, Chung JM, Chung K. The changes in expressionof three subtypes of TTX sensitive sodium channels in sensoryneurons after spinal nerve ligation. Brain Res Mol Brain Res2001;95:153–61

24. Kim CH, Oh Y, Chung JM, Chung K. Changes in three subtypesof tetrodotoxin sensitive sodium channel expression in theaxotomized dorsal root ganglion in the rat. Neurosci Lett2002;323:125–8

25. Lai J, Gold MS, Kim CS, Bian D, Ossipov MH, Hunter JC,Porreca F. Inhibition of neuropathic pain by decreased expres-sion of the tetrodotoxin-resistant sodium channel, NaV1.8. Pain2002;95:143–52

26. Gold MS, Weinreich D, Kim CS, Wang R, Treanor J, Porreca F,Lai J. Redistribution of Na(V)1.8 in uninjured axons enablesneuropathic pain. J Neurosci 2003;23:158–66

27. Joshi SK, Mikusa JP, Hernandez G, Baker S, Shieh CC, NeelandsT, Zhang XF, Niforatos W, Kage K, Han P, Krafte D, Faltynek C,Sullivan JP, Jarvis MF, Honore P. Involvement of the TTX-resistant sodium channel Nav 1.8 in inflammatory and neuro-pathic, but not post-operative, pain states. Pain 2006;123:75–82

28. Akopian AN, Souslova V, Engl S, Okuse K, Ogata N, Ure J,Smith A, Kerr BJ, McMahon SB, Boyce S, Hill R, Stanfa LC,Dickenson AH, Wood JN. The tetrodotoxin-resistant sodiumchannel SNS has a specialized function in pain pathways. NatNeurosci 1999;2:541–8

29. Kerr BJ, Souslova V, McMahon SB, Wood JN. A role for theTTX-resistant sodium channel Nav 1.8 in NGF-induced hyper-algesia, but not neuropathic pain. Neuroreport 2001;12:3077–80

30. Jarvis MF, Honore P, Shieh CC, Chapman M, Joshi S, Zhang XF,Kort M, Carroll W, Marron B, Atkinson R, Thomas J, Liu D,Krambis M, Liu Y, McGaraughty S, Chu K, Roeloffs R, Zhong C,Mikusa JP, Hernandez G, Gauvin D, Wade C, Zhu C, Pai M, ScanioM, Shi L, Drizin I, Gregg R, Matulenko M, Hakeem A, Gross M,Johnson M, Marsh K, Wagoner PK, Sullivan JP, Faltynek CR,Krafte DS. A-803467, a potent and selective Nav1.8 sodium channelblocker, attenuates neuropathic and inflammatory pain in the rat.Proc Natl Acad Sci USA 2007;104:8520–5

31. Black JA, Liu S, Tanaka M, Cummins TR, Waxman SG. Changesin the expression of tetrodotoxin-sensitive sodium channelswithin dorsal root ganglia neurons in inflammatory pain. Pain2004;108:237–47

32. Gould HJ III, Engl JD, Soignier RD, Nolan P, Minor LD, Liu ZP,Levinson SR, Paul D. Ibuprofen blocks changes in Na v 1.7 and1.8 sodium channels associated with complete Freund’sadjuvant-induced inflammation in rat. J Pain 2004;5:270–80


33. Nassar MA, Stirling LC, Forlani G, Baker MD, Matthews EA,Dickenson AH, Wood JN. Nociceptor-specific gene deletionreveals a major role for Nav1.7 (PN1) in acute and inflammatorypain. Proc Natl Acad Sci USA 2004;101:12706–11

34. Nassar MA, Levato A, Stirling LC, Wood JN. Neuropathic paindevelops normally in mice lacking both Nav1.7 and Nav1.8. MolPain 2005;1:24

35. Cummins TR, Howe JR, Waxman SG. Slow closed-state inacti-vation: a novel mechanism underlying ramp currents in cellsexpressing the hNE/PN1 sodium channel. J Neurosci1998;18:9607–19

36. Brochu RM, Dick IE, Tarpley JW, McGowan E, Gunner D,Herrington J, Shao PP, Ok D, Li C, Parsons WH, Stump GL,Regan CP, Lynch JJ Jr, Lyons KA, McManus OB, Clark S, Ali Z,Kaczorowski GJ, Martin WJ, Priest BT. Block of peripheral nervesodium channels selectively inhibits features of neuropathicpain in rats. Mol Pharmacol 2006;69:823–32

37. Stummann TC, Salvati P, Fariello RG, Faravelli L. The anti-nociceptive agent ralfinamide inhibits tetrodotoxin-resistantand tetrodotoxin-sensitive Na� currents in dorsal root ganglionneurons. Eur J Pharmacol 2005;510:197–208

38. Devor M, Wall PD, Catalan N. Systemic lidocaine silencesectopic neuroma and DRG discharge without blocking nerveconduction. Pain 1992;48:261–8

39. Xiao WH, Bennett GJ. C-fiber spontaneous discharge evoked bychronic inflammation is suppressed by a long-term infusion oflidocaine yielding nanogram per milliliter plasma levels. Pain2008;137:218–28

40. Morinville A, Fundin B, Meury L, Jureus A, Sandberg K, KruppJ, Ahmad S, O’Donnell D. Distribution of the voltage-gatedsodium channel Na(v)1.7 in the rat: expression in the autonomicand endocrine systems. J Comp Neurol 2007;504:680–9

41. Catterall WA, Goldin AL, Waxman SG. International Union ofPharmacology. XLVII. Nomenclature and structure-functionrelationships of voltage-gated sodium channels. Pharmacol Rev2005;57:397–409

42. Davies PS, Galer BS. Review of lidocaine patch 5% studies in thetreatment of postherpetic neuralgia. Drugs 2004;64:937–47

43. Janig W. What is the mechanism underlying treatment of painby systemic application of lidocaine? Pain 2008;137:5–6

44. Rowbotham MC, Davies PS, Fields HL. Topical lidocaine gelrelieves postherpetic neuralgia. Ann Neurol 1995;37:246–53


Cytokine Gene Expression After Total Hip Arthroplasty:Surgical Site versus Circulating Neutrophil Response

Asokumar Buvanendran, MD*

Kendall Mitchell, PhD†

Jeffrey S. Kroin, PhD*

Michael J. Iadarola, PhD†

BACKGROUND: After surgery, cytokines and chemokines are released at the surgicalwound site, which can contribute to postoperative pain, local inflammation, andtissue repair. Multiple cell types are present that can release cytokines/chemokinesat the wound site and, thus, the exact cellular source of these molecules is unclear. Wesought to better understand the contribution of neutrophils to cytokine/chemokinegene expression at the surgical wound site during the initial postsurgery phase of totalhip arthroplasty (THA).METHODS: Hip drain fluid was collected at 24 h postsurgery from six patientsundergoing standardized THA. In addition, venous blood was collected presur-gery and 24 h postsurgery. Neutrophils were isolated, total RNA extracted, and abiotinylated cRNA probe generated. The probes were hybridized with a cDNAmicroarray containing approximately 100 oligonucleotide sequences representingvarious human cytokines/chemokines or receptor genes. Changes in gene expres-sion seen in the microarray were verified by reverse transcription polymerase chainreaction.RESULTS: In the microarray analysis of hip drain neutrophils, interleukin-1 receptorantagonist (IL1RN), interleukin-18 receptor 1 (IL18R1), macrophage migrationinhibitory factor (MIF), and macrophage inflammatory protein 3� (CCL20) wereupregulated, whereas interleukin-8 receptor � (IL8RB/CXCR2) was consistentlydownregulated, compared with presurgery blood neutrophils. All of these changeswere confirmed by reverse transcription polymerase chain reaction.CONCLUSION: There is a distinct cytokine gene expression profile in neutrophils atthe THA surgical wound site at 24 h postsurgery when compared with that foundin presurgery circulating neutrophils. Understanding these changes may allow usto knowledgeably manipulate neutrophil activity to reduce postoperative pain andinflammation without impairing wound healing.(Anesth Analg 2009;109:959–64)

Despite advances in both surgical and anesthetictreatments, several studies demonstrate that approxi-mately 80% of postoperative patients experience mod-erate or severe pain postsurgery.1 Surgery induces astate of inflammatory response and understanding thepathophysiology of this response can potentially yieldnew targets for therapy. After hip replacement sur-gery, factors contributing to postoperative pain in-clude prostaglandin E2 and cytokines, both of whichare increased in wound site exudates.2 The cellularorigin of such immuno- or neuroactive molecules in

wound exudates has not yet been determined becausethey may arise from a variety of cell types and fromplasma extravasates.

In the classic model, delineating the phases ofhealing in cutaneous wounds, there is an initial stagein which blood platelets release clotting factors as wellas growth factors and cytokines, such as platelet-derived growth factor and TGF-�.3 This is followed byan inflammatory stage in which polymorphonuclearneutrophils cells and soon afterward macrophagesmigrate into the wound site.4–6 Typically, at 24 h aftera cutaneous injury, the neutrophil population is at itsmaximum at the wound site and the activity of theseneutrophils may play a critical role in recovery.5 Atthe same time, several studies have suggested thatvarious leukocyte populations may secrete a variety ofproalgesic compounds (e.g., interleukin [IL]-6) and anal-gesic compounds (e.g., IL-10) that can either sensitize orreduce the excitability of nociceptive primary afferentnerve endings, respectively, and modulate nociceptiveinput into the central nervous system.7,8 Matching thecell type(s) to the released molecules may provide in-sight into our understanding of inflammatory and noci-ceptive processes and wound healing in the periphery.

From the *Department of Anesthesiology, Rush UniversityMedical Center, Chicago, Illinois; and †Neurobiology and PainTherapeutics Section, National Institute of Dental and CraniofacialResearch, NIH, Bethesda, Maryland.

Accepted for publication March 9, 2009.Supported by the Intramural Research Program, NIDCR, NIH,

DHHS, and University Anesthesiologists S.C., Chicago, IL.Address correspondence to Dr. Asokumar Buvanendran, De-

partment of Anesthesiology, Rush University Medical Center,1653 W. Congress Parkway, Chicago, IL 60612. Address e-mail [email protected].

Reprints will not be available from the author.Copyright © 2009 International Anesthesia Research Society

DOI: 10.1213/ane.0b013e3181ac1746


At present, the local cellular response to deepsurgical trauma, such as hip replacement surgery, hasnot been well characterized. Exudates from hip drains(HDs) obtained after surgery contain leukocytes thathave undergone emigration from the bloodstream tothe wound site. In this study, we showed that at 24 halmost all of these leukocytes in the HD are neutro-phils. Thus, the HD fluid at 24 h allows for clarifyingthe contribution of one population of leukocytes totissue damage and wound healing without contami-nation from other cell types. This study analyzedmultiple cytokine messenger RNAs from 24 h HD andcirculating blood neutrophils to identify which cyto-kines and cytokine receptors are altered after majorsurgery.

METHODSPatient Selection

After IRB approval (April 18, 2005) from RushUniversity Medical Center, patients scheduled fortotal hip arthroplasty (THA) signed informed consentforms and were enrolled in the study. Patients were�80-yr-old and were without recent trauma or sys-temic infection within 3 mo of surgery date. Patientswho had used corticosteroid medications within 3 moof the surgery date were also excluded.

Study ProtocolAll nonsteroidal antiinflammatory therapy was dis-

continued 14 days before surgery (routine clinicalpractice to avoid perioperative bleeding). At the pre-operative visit, demographic data were collected andall preoperative medications, including the dose,route, and duration, were recorded.

A standardized surgical technique of noncementedTHA was performed through an anterolateral ap-proach in all patients. All patients underwent stan-dardized surgical management with combinedspinal/epidural anesthesia.2

Sample CollectionVenous blood (10 mL) was collected in tubes with

lithium heparin before surgical incision and at 24 hafter the start of surgery. When the hip replacementwas completed, a standard drain was placed in thedeepest portion of the wound, in proximity to thenewly replaced joint. Drain exudates were collectedover a 60-min period, 23–24 h from start of surgery, ina 400 mL capacity Hemovac reservoir. The approxi-mate volume of fluid obtained over this 60-min periodwas 10 mL, and no patient had excessive bleeding.Preliminary analysis with cell slide smears demon-strated that, at this time point, 95%–98% of HDleukocytes are neutrophils. Cells from either blood orHD fluid were fractionated by placing the sample overa separation gel (1-Step Polymorphs, Accurate Chemi-cals, Westbury, NY) and centrifuging at 500g for 30min. A lower band of polymorphonuclear neutrophilcells appears in the gel, and this fraction was aspirated

off and washed twice in Hanks balanced salt solution.A cell count and analysis of the percentage of eachtype of white blood cell was performed, and the cellpellet frozen at �80°C. The frozen pellet was then sentto the National Institutes of Health for analysis.

Microarray Analysis of Gene ExpressionTotal RNA was isolated from the frozen neutrophil

pellets using TRIzol reagent (Invitrogen, San Diego,CA) and was further purified by the RNeasy Mini kit(Qiagen, Valencia, CA) with an additional step ofDNase treatment. Neutrophil pellets from all sampleswere processed in an identical manner. RNA wasquantified fluorometrically by the RiboGreen re-agent (Molecular Probes, Eugene, OR). BiotinylatedcRNA was generated using total RNA as a templatewith a microarray cRNA synthesis kit (SuperArray,Frederick, MD). The labeled cRNA probe was hy-bridized to an inflammatory cytokine-targeted mi-croarray containing genes encoding cytokines and ILsassociated with the inflammatory responses and theirreceptors, representing various human cytokine andcytokine receptor genes and control genes (OligoGEArray, OHS-011, 113 oligonucleotide sequences;SuperArray). Chemiluminescence images were cap-tured by a charge-coupled device camera (AlphaIm-ager, Alpha Innotech, San Leandro, CA) and analyzedusing ImageQuant 5 software (Molecular Dynamics,Piscataway, NJ). Eighteen membranes were used toobtain gene expression for presurgical circulating neu-trophils (B0), postsurgical circulating neutrophils(B24), and HD neutrophils for the six patients. Permembrane, genes were normalized to �-actin expres-sion (also located on the membrane) and the normal-ized values were put in three groups: B0, B24, and HD.Transcripts demonstrating a twofold change9 and a P �0.05 (using Wilcoxon’s signed rank test) between the B0and HD groups were chosen for further evaluation.

Reverse Transcription Polymerase Chain ReactionTo confirm the results of array screening, tran-

scripts identified as altered in the gene microarraywere further analyzed by reverse transcription poly-merase chain reaction (RT-PCR) using the extractedRNA obtained from each patient (see above). Per gene,B0, B24, and HD samples from all patients wereexamined simultaneously. RT-PCR was performedusing the Access RT-PCR system (Promega, Madison,WI). The PCR primer pairs and product sizes of genesthat were successfully amplified are listed in Table 1.The RT-PCR analysis was performed according to themanufacturer’s instruction in 25 �L reaction mixturecontaining exactly 8 ng of RNA. RT-PCR steps were 1cycle of 45 min at 45°C for reverse transcription, 1cycle of 2 min at 94°C for inactivation of transcriptase,28–35 cycles of 30 s at 94°C for denaturation, 1 min at55°C for annealing, 2 min at 68°C for extension, andfinal extension at 68°C for 7 min. For each gene, allpatient samples were amplified the same time for the

960 Postsurgical Local Neutrophil Response ANESTHESIA & ANALGESIA

same number of cycles: 28 cycles for IL1RN, 30 cyclesfor IL18R1, MIF, IL8RB, and CCL20, and 23 cycles for�-actin. The RT-PCR products were separated byelectrophoresis on 2% agarose/ethidium bromide gelsand images were acquired by an AlphaImager charge-coupled device camera. The relative intensities of theRT-PCR products, as visualized on the gel, wereanalyzed quantitatively using ImageQuant 5 software.The results were normalized to �-actin. Comparisonsof gene expression from B0, B24, and HD sampleswere made by repeated measures mixed model withTukey-Kramer post hoc test (P � 0.05 for significance).

RESULTSSamples from six patients undergoing THA were

analyzed. Patient ages ranged from 46 to 80 yr andwere equally distributed between genders. For bothblood and HD samples, 96% � 3% of the leukocytes inthe cell pellet were neutrophils. Lymphocytes, eosin-ophils, and monocytes were always �10%. In themicroarray analysis, genes significantly upregulatedin the HD neutrophils when compared with the pre-surgery blood sample neutrophils were IL-1 receptorantagonist (IL1RN), IL-18 receptor 1 (IL18R1), macro-phage migration inhibitory factor (MIF), and macro-phage inflammatory protein 3� (CCL20), whereas IL-8receptor � (IL8RB/CXCR2), CCR3, CX3CR1, CCR5,and LTB were downregulated (Fig. 1, Table 2). All ofthe genes expressed in the microarray are tabulated inthe online supplement table (see Supplemental DigitalContent 1, available at: http://links.lww.com/A1335),which shows that most cytokines or chemokines didnot show a twofold change or a statistically significantchange in HD neutrophils when compared with thepresurgery blood sample neutrophils.

Changes seen in the gene microarray were con-firmed by RT-PCR (Fig. 2) for ILIRN, IL18R1, MIF, andCCL20 for which expression in the HD neutrophilpopulation was upregulated compared with those incirculating presurgery blood. In addition, IL18R1 ex-pression was also increased in 24 h blood comparedwith presurgery blood. RT-PCR also confirmed thatIL8RB/CRCX2 expression in HD was downregulated

compared with presurgery blood. IL8RB/CXCR2 wasalso decreased in 24 h blood but not to the same extentas in the HD population. As a control, Figure 2 alsodemonstrates that �-actin expression did not differbetween HD and blood neutrophils.

We also attempted to examine the expression ofCCR3, CCR5, CXCR1, and LTB via RT-PCR. GenesCCR5 and CX3CR1 had very weak signals in themicroarray and could not be amplified during RT-PCR. Although LTB had an adequate signal on themicroarray, it could not be amplified appropriatelywith two different primer pairs in the RT-PCR. CCR3also gave a low signal on the arrays and did not showdownregulation in the RT-PCR gel. Based on the lowbaseline signals for these four genes and/or the diffi-culty in amplifying them (e.g., LTB), we consider themmarginally or nonexpressed in this cell population.

DISCUSSIONA complex array of cytokines and chemokines are

found in the extracellular milieu after surgery-induced tissue damage.2,10 In such a complex cellular

Figure 1. Microarray analysis for genes associated with cyto-kines, chemokines, and their receptors. The oligo GEArraymembrane containing approximately 100 genes was hybrid-ized with biotin-labeled cRNA generated with RNAs fromneutrophils from presurgical blood (left) and from hip drainneutrophils of the same patient (right). Transcripts which wereconsistently altered in patients are indicated by an arrow.

Table 2. Genes Upregulated or Downregulated in HipDrain Neutrophils After Total Hip Arthroplasty UsingMicroarray Analysis

Symbol Gene nameFold

changeIL8RB Interleukin-8 receptor �/CXCR2 0.23MIF Macrophage migration inhibitory

factor2.7

IL18R1 Interleukin-18 receptor 1 3.1IL1RN Interleukin-1 receptor antagonist 3.2CCL20 LARC/MIP-3� 5.3CCR3 CC-CKR-3/CKR3 0.19CX3CR1 CCRL1/CMKBRL1 0.35CCR5 CC-CKR-5 0.43LTB Cytokine P33 0.26

Genes that show more than a twofold upregulation or downregulation in 24 h hip drainneutrophils versus presurgery blood neutrophils with P � 0.05.

Table 1. Reverse Transcription Polymerase Chain Reaction(RT-PCR) Primer Pairs and Length of PCR Products

Gene Primer pairs Product (bp)�-Actin CTCCTGAGCGCAAGTACTCC 299

GTCACCTTCACCGTTCCAGTIL1RN CTCCTGGGGGTTCTTTCTTC 251

TAGGGAACTTTGCACCCAACIL8RB ATTCTGGGCATCCTTCACAG 250

TGAGGCTTGGAATGTGACTGIL18R1 GAAGAACGCCGAGTTTGAAG 250

ATTTTCTTCCCCGAACATCCMIF AGAACCGCTCCTACAGCAAG 234

ATTTCTCCCCACCAGAAGGTCCL20 CTGGCCAATGAAGGCTGT 266

GACAAGTCCAGTGAGGCACA


milieu, identifying the sources of individual cytokines/chemokines is difficult because multiple cell types atthe wound site express these molecules. By investigat-ing HD exudates from patients who had surgical hipreplacement, we were able to obtain an almost purepopulation of neutrophils enabling us to better as-sess the contribution of this cell type to cytokine/chemokine production in the extracellular space. Thisapproach demonstrated that neutrophils collected at24 h after THA express altered transcript levels in adistinct set of cytokines compared with presurgicalcirculating neutrophils.

One of the cytokines that is induced in HD neutro-phils, but not in 24-h circulating neutrophils, after THAencodes the proinflammatory cytokine MIF. Function-ally, MIF can induce the expression of proinflammatorycytokines and cyclooxygenase 2.11 MIF has also beensuggested to amplify neurogenic inflammation in-duced by the pronociceptive neuropeptide substanceP.12 The secretion of MIF protein in patients sufferingfrom endometriosis has been shown to correlate withpain,13,14 suggesting the possibility that this moleculeis involved with sensitization of nociceptive nerveterminals. MIF can also activate macrophages andinhibit apoptosis of these cells thereby sustainingmacrophage activity during inflammation.15,16 Macro-phages, which are generally recruited to the woundsite after neutrophils, may in-turn release factors thatcan sensitize primary afferent fibers and contribute toinflammation. It may be interesting then to determinewhether MIF produced by HD neutrophils is involvedin the recruitment of macrophages and the reportedincrease in cytokines and prostaglandin.2

At the site of inflammation, it is common to observethe induction of both proinflammatory and antiin-flammatory cytokines.10 The observed induction of the

antiinflammatory cytokine IL1RN in the HD neutro-phils is consistent with this duality. IL1RN functionsto antagonize the binding of the proinflammatorycytokine IL-1 to its receptor.17 IL-1� protein waspreviously reported to be elevated in the HD afterTHA, has well-documented roles in inflammation,and like MIF, has been demonstrated to sensitizenerve terminals to pain.2,18 The increase in IL1RN afterTHA may thus be a natural process for attenuating theeffects of IL-1�, suggesting that neutrophils at thispoint may also participate in postoperative repair.Concordant with this hypothesis, chronic treatmentwith IL1RN or anakinra, a recombinant analog ofIL1RN, has been demonstrated to reduce basal noci-ceptive sensitivity in mice.19,20 Moreover, anakinra hasbeen used clinically to reduce joint inflammation inrheumatoid arthritis patients.21 In this context, itwould be interesting to determine whether furthersupplementation with exogenous IL1RN after THAcould reduce pain and inflammation without havingan adverse affect on wound healing.

We also detected significant alterations in messagelevels for two cytokine/chemokine receptors. Thegene encoding IL18R1, which is the receptor for theproinflammatory cytokine IL-18, is significantly in-creased in HD neutrophils. Increased IL18R1 mRNAhas also been reported in synovial fluid neutrophils ofpatients suffering from rheumatoid arthritis.22 It hasbeen reported that IL-18 recruits neutrophils to theinflamed site via IL18R1,22 which is consistent withthe massive, sustained infiltration of neutrophils afterTHA. IL-18 also activates neutrophils through thisreceptor, causing them to release various cytokinesand chemokines.22 Regarding nociception, intraplan-tar injection of IL-18 causes mechanical hyperalge-sia,23 although the exact role of the neutrophils in

Figure 2. Left, Gel electrophoresis of reverse transcription polymerase chain reaction (RT-PCR) expression of neutrophilmRNA showing genes that were significantly upregulated or downregulated in the gene microarray. Results from tworepresentative patients are displayed for presurgery blood (B0), 24 h blood (B24), and 24 h postsurgery hip drain (HD).�-Actin was the internal control. Right, RT-PCR analysis of mRNA levels, relative to �-actin, showing four genes upregulated(MIF, IL18R1, IL1RN, CCL20) and one gene downregulated (IL8RB/CXCR2) in 24 h postsurgery HD neutrophils versuspresurgery blood neutrophils. Data presented as mean � sem; *P � 0.05, ***P � 0.001. In the graph, �-actin expression of B0,B24, and HD neutrophils were normalized to the B0 average.


this process needs further examination. Finally, thefact that IL18R1 is also induced in 24-h circulatingneutrophils suggests that this receptor may havebeen involved in the emigration from the blood tothe wound site.

We also observed that IL8RB/CXCR2, a high affinityreceptor for IL-8/CXCL8, is strongly downregulated inHD neutrophils. IL-8, which promotes chemoattractionand activation of neutrophils,24,25 has been reported tobe increased in HD exudates2 after THA. Thus, it ispossible that IL8RB-expressing neutrophils are re-cruited to the wound site via IL-8. IL-8 can alsoregulate the expression of IL8RB, because in vitrostudies have shown that this molecule causes a rapiddownregulation of its receptors.26,27 It is possible thenthat the downregulation of IL8RB in HD neutrophilsmay be caused by the increased levels of IL-8 in theHD exudate. Given that the HD neutrophils havereached their final destination site, a mechanism fordecreasing receptors such as IL8RB seems likely inthese cells. Understanding why receptors with similarfunctions (e.g., IL18R1) are not downregulated sug-gests a multiplicity of regulatory processes and pro-vides different targets for manipulation.

The transcript encoding macrophage inflammatoryprotein 3� (MIP 3�/CCL20) was increased in HDneutrophils at 24 h after THA. The encoding moleculeis a strong chemoattractant for lymphocytes, whileweakly attracting neutrophils. Thus, a release ofCCL20 from the neutrophils may be a signal forrecruitment of cells other than neutrophils. Regardingpain, CCL20 has not been thoroughly investigated,although it is increased in conditions in which pain iselevated. For example, neutrophils in synovial fluid ofsome patients with rheumatoid arthritis show in-creased CCL20 mRNA, but CCL20 expression in therheumatoid study was not detectable in circulatingblood neutrophils.28 CCL20 has also been reported tobe altered in oral wound healing models.29

Although this study focused on the most consis-tently altered genes within a 113-gene microarray, itcannot be excluded that additional genes are altered inHD neutrophils. Moreover, the 24-h time point maynot be the optimal time for detecting alterations inother genes, although 24 h is the time point whenneutrophils predominate at wound sites.4–6 Althoughit would be of interest to analyze cytokine and che-mokine mRNA in neutrophils at later time points (e.g.,Days 2–4), the risk of infection makes it unsafe tomaintain a drain beyond the 24-h recovery period. It isalso important to note that a lack of alteration inneutrophil mRNA does not mean that the correspond-ing protein is not secreted by another cell type. Thus,cytokines that were reported in HD fluid in ourprevious study,2 IL-1�, IL-6, and IL-8, may haveoriginated, for example, from tissue macrophagessurrounding the HD catheter. A limitation of thisstudy is that we did not show that MIF and CCL20 arealso produced and released into the HD exudates after

THA as would be suggested by the upregulation ofthe encoding mRNAs. The expression of ILIRN,IL18R1, and IL8RB proteins in isolated HD neutro-phils remains to be evaluated using methods such asWestern blots or flow cytometry30 as well as thefunctional consequence in ex vivo experiments.

In contrast to the presurgery neutrophils, the neu-trophils taken from the HD and circulating blood at24 h were obtained while the patients were receivingepidural anesthesia. Thus, it is possible that anesthesiamay have influenced the cytokine/chemokine profilein our study. However, a previous study failed todetect a difference in plasma IL-6 and tumor necrosisfactor-� levels after THA with general versus regionalspinal/epidural anesthesia, suggesting that the celltypes involved in this study may not have beenaffected by the anesthetic.31

The data obtained here demonstrate that opponentprocesses (anti- and proinflammatory) occur in HDneutrophils after THA. Deciphering their roles inevents such as pain processing, inflammation, andtissue repair could aid in our approach to treatingpatients pre- and postoperatively.

REFERENCES

1. Apfelbaum JL, Chen C, Mehta SS, Gan TJ. Postoperative painexperience: results from a national survey suggest postoperativepain continues to be undermanaged. Anesth Analg 2003;97:534–40

2. Buvanendran A, Kroin JS, Berger RA, Hallab NJ, Saha C,Negrescu C, Moric M, Caicedo MS, Tuman KJ. Upregulation ofprostaglandin E2 and interleukins in the central nervous systemand peripheral tissue during and after surgery in humans.Anesthesiology 2006;104:403–10

3. Diegelmann RF, Evans MC. Wound healing: an overview ofacute, fibrotic and delayed healing. Front Biosci 2004;9:283–9

4. Englelhardt E, Toksoy A, Goebeler M, Debus S, Brocker EB,Gillitzer R. Chemokines IL-8, GROalpha, MCP-1, IP-10, and Migare sequentially and differentially expressed during phase-specific infiltration of leukocyte subsets in human woundhealing. Am J Pathol 1998;153:1849–60

5. Gillitzer R, Goebeler M. Chemokines in cutaneous woundhealing. J Leukoc Biol 2001;69:513–21

6. Park JE, Barbul A. Understanding the role of immune regulationin wound healing. Am J Surg 2004;187:11S–16S

7. Cunha FQ, Ferreira SH. Peripheral hyperalgesic cytokines. AdvExp Med Biol 2003;521:22–39

8. Rittner HL, Machelska H, Stein C. Leukocytes in the regulationof pain and analgesia. J Leukoc Biol 2005;78:1215–22

9. Schena M, Shalon D, Heller R, Chai A, Brown PO, Davis RW.Parallel human genome analysis: microarray-based expressionmonitoring of 1000 genes. Proc Natl Acad Sci USA 1996;93:10614–9

10. Yang HY, Mitchell K, Keller JM, Iadarola MJ. Peripheral inflam-mation increases Scya2 expression in sensory ganglia andcytokine and endothelial related gene expression in inflamedtissue. J Neurochem 2007;103:1628–43

11. Calandra T, Roger T. Macrophage migration inhibitory factor: aregulator of innate immunity. Nat Rev Immunol 2003;3:791–800

12. Meyer-Siegler KL, Vera PL. Intraluminal antibodies to macro-phage migration inhibitory factor decrease substance P inducedinflammatory changes in the rat bladder and prostate. J Urol2004;172:1504–9

13. Akoum A, Metz CN, Al-Akoum M, Kats R. Macrophage migra-tion inhibitory factor expression in the intrauterine endome-trium of women with endometriosis varies with disease stage,infertility status, and pelvic pain. Fertil Steril 2006;85:1379–85


14. Morin M, Bellehumeur C, Therriault MJ, Metz C, Maheux R,Akoum A. Elevated levels of macrophage migration inhibitoryfactor in the peripheral blood of women with endometriosis.Fertil Steril 2005;83:865–72

15. Hudson JD, Shoaibi MA, Maestro R, Carnero A, Hannon GJ,Beach DH. A proinflammatory cytokine inhibits p53 tumorsuppressor activity. J Exp Med 1999;190:1375–82

16. Mitchell RA, Liao H, Chesney J, Fingerle-Rowson G, Baugh J,David J, Bucala R. Macrophage migration inhibitory factor(MIF) sustains macrophage proinflammatory function by inhib-iting p53: regulatory role in the innate immune response. ProcNatl Acad Sci USA 2002;99:345–50

17. Arend WP, Guthridge CJ. Biological role of interleukin 1 receptorantagonist isoforms. Ann Rheum Dis 2000;59(suppl 1):i60–4

18. Ferreira SH, Lorenzetti BB, Bristow AF, Poole S. Interleukin-1beta as a potent hyperalgesic agent antagonized by a tripeptideanalogue. Nature 1988;334:698–700

19. Wolf G, Yirmiya R, Goshen I, Iverfeldt K, Holmlund L, TakedaK, Shavit Y. Impairment of interleukin-1 (IL-1) signaling reducesbasal pain sensitivity in mice: genetic, pharmacological anddevelopmental aspects. Pain 2003;104:471–80

20. Baamonde A, Curto-Reyes V, Juarez L, Meana A, Hidalgo A,Menendez L. Antihyperalgesic effects induced by the IL-1 receptorantagonist anakinra and increased IL-1beta levels in inflamed andosteosarcoma-bearing mice. Life Sci 2007;81:673–82

21. Furst DE. Anakinra: review of recombinant human interleukin-Ireceptor antagonist in the treatment of rheumatoid arthritis.Clin Ther 2004;26:1960–75

22. Leung BP, Culshaw S, Gracie JA, Hunter D, Canetti CA,Campbell C, Cunha F, Liew FY, McInnes IB. A role for IL-18 inneutrophil activation. J Immunol 2001;167:2879–86

23. Verri WA Jr, Schivo IR, Cunha TM, Liew FY, Ferreira SH, CunhaFQ. Interleukin-18 induces mechanical hypernociception in ratsvia endothelin acting on ETB receptors in a morphine-sensitivemanner. J Pharmacol Exp Ther 2004;310:710–7

24. Holmes WE, Lee J, Kuang WJ, Rice GC, Wood WI. Structure andfunctional expression of a human interleukin-8 receptor. Science1991;253:1278–80

25. Murphy PM, Tiffany HL. Cloning of complementary DNAencoding a functional human interleukin-8 receptor. Science1991;253:1280–3

26. Samanta AK, Oppenheim JJ, Matsushima K. Interleukin 8(monocyte-derived neutrophil chemotactic factor) dynamicallyregulates its own receptor expression on human neutrophils.J Biol Chem 1990;265:183–9

27. Chuntharapai A, Kim KJ. Regulation of the expression of IL-8receptor A/B by IL-8: possible functions of each receptor.J Immunol 1995;155:2587–94

28. Schlenk J, Lorenz HM, Haas JP, Herrmann M, Hohenberger G,Kalden JR, Rollinghoff M, Beuscher HU. Extravasation intosynovial tissue induces CCL20 mRNA expression in polymor-phonuclear neutrophils of patients with rheumatoid arthritis.J Rheumatol 2005;32:2291–8

29. McGrory K, Flaitz CM, Klein JR. Chemokine changes duringoral wound healing. Biochem Biophys Res Commun 2004;324:317–20

30. van Eeden SF, Klut ME, Walker BA, Hogg JC. The use of flowcytometry to measure neutrophil function. J Immunol Methods1999;232:23–43

31. Høgevold HE, Lyberg T, Kahler H, Haug E, Reikerås O.Changes in plasma IL-1beta, TNF-alpha and IL-6 after total hipreplacement surgery in general or regional anaesthesia. Cyto-kine 2000;12:1156–9


The Neuraxial Effects of Intraspinal Amitriptyline atLow Concentrations

Fernanda B. Fukushima, MD,PhD*

Guilherme A. M. Barros, MD, PhD*

Mariangela E. A. Marques, MD,PhD†

Edison I. O. Vidal, MD, MPH‡§

Eliana M. Ganem, MD, PhD*

BACKGROUND: As a result of amitriptyline’s vast array of actions, it could potentiallybe used as an intraspinal adjuvant in neuraxial anesthesia and/or in the treatmentof refractory neuropathic pain. None of the previous studies examining the safetyprofile of intraspinal single doses of amitriptyline found signs of toxicity atconcentrations below 15.4 mM/L (0.5%) and the current hypothesis regarding thepathophysiology of amitriptyline toxicity suggests it might be safe at low concen-trations while still having relevant clinical effects. Hence, we conducted this studyto assess the clinical and histological toxicity of intraspinal amitriptyline at thelowest dosages previously known to be effective.METHODS: Twenty-one dogs were randomized to receive a 1-mL single intraspinaldose of one of the three solutions: saline (0.9%), amitriptyline (0.15%), or amitrip-tyline (0.3%). The dogs were evaluated clinically 1 h after awakening fromanesthesia and 21 days later. At 21 days, all animals were killed, and histologicalsections of the spinal cord and surrounding meninges were retrieved for analysis.RESULTS: All dogs recovered motor function, anal sphincter tone and sensibility.With the exception of one dog in the 0.15% amitriptyline group, all animals in bothamitriptyline groups had marked adhesive arachnoiditis, which was absent in thecontrol group. No evidence of direct neural damage was found on histologicalsections stained by glial fibrillary acidic protein technique in any of the studyanimals.CONCLUSION: The intraspinal administration of amitriptyline to dogs even in lowconcentrations is strongly associated with the development of intense meningealadhesive arachnoiditis and is not safe even at low concentrations for which therewas no previous evidence of toxicity.(Anesth Analg 2009;109:965–71)

In the past decades, there has been considerableprogress in the knowledge of the physiopathology ofneuropathic pain.1–3 However, the treatment of neu-ropathic pain syndromes remains an important thera-peutic challenge, and the quest for an ideal drug withhigh levels of efficacy and low toxicity is far frombeing fulfilled.4–6

Tricyclic antidepressant drugs are among the mosteffective drugs used in the treatment of neuropathicpain and correspond to the third most prescribeddrugs for the treatment of nononcological pain syn-dromes.7 Besides their action in the recaptation ofnorepinephrine and serotonin, tricyclic antidepres-sants also have antiinflammatory activity, block

Na�, K�, and Ca2� ion channels, �-2 adrenergic,nicotinic, muscarinic, N-methyl-d-aspartate, gamma-aminobutyric-B, and histaminergic receptors.8–17 Ami-triptyline is the prototype drug of this class of drugsand has been used for more than 40 yr in the manage-ment of neuropathic pain.18 Nevertheless, its use isfrequently limited by several factors, such as anticho-linergic side effects.

As a result of amitriptyline’s vast array of actions, itcould potentially be used as an intraspinal adjuvant inneuraxial anesthesia and/or in the treatment of refrac-tory neuropathic pain. Theoretically, in selected cases,the intraspinal administration of amitriptyline couldenable higher efficacy with fewer doses and systemicside effects. Previous studies analyzed many aspectsof the safety/toxicity of amitriptyline.10,14,16,19 –35

When administered IV, it had less cardiovascular andcentral nervous system toxicity than bupivacaine.33 Afew studies analyzed the neurotoxicity profile of in-traspinal amitriptyline in single doses20,24,34,36 andunder continuous infusions.35 Even though continu-ous intrathecal infusions seemed to be toxic in lowconcentrations,35 none of the studies of a single in-traspinal dose found signs of neurotoxicity for concen-trations below 15.4 mM/L (0.5%).20,24,34,36 However,all the studies restricted their analyses to short-term

From the Departments of *Anesthesiology and †Pathology, SaoPaulo State University—UNESP, Botucatu/SP; ‡Department of Pre-ventive and Social Medicine, Campinas State University—UNICAMP,Campinas/SP; and §Albert Einstein Hospital, Sao Paulo/SP, Brazil.

Accepted for publication March 24, 2009.Supported by Brazilian Federal Agency for the Support and

Evaluation of Graduate Education (CAPES).Address correspondence and reprint requests to Fernanda Bono

Fukushima, MD, PhD, Rua Itororo, 427 Vila Galo Americana-SPCEP 13466-240, Brazil. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181ad581e

Vol. 109, No. 3, september 2009 965

(7 days or less) clinical and/or histological evalua-tions, e.g., in most cases, animals without clinical signsof neurologic deficits were not submitted to histolog-ical examination.24,34 Therefore, the possibility of eithertrue clinical safety or later occurring toxicity at lowconcentrations was not properly assessed.37,38 Further-more, evidence suggests that, according to the currentlyproposed mechanism of amitriptyline toxicity, theremight be no neurotoxicity for low concentrations of thisdrug29 below 10 mM/L (0.3%). Hence, an experimentalstudy was conducted to assess whether small singledoses of intraspinal amitriptyline are associated withclinical and histological signs of neurotoxicity after 21days of its administration.

METHODSAnimals

After receiving approval from the local ethics com-mittee on animal experimentation, 21 adult mongreldogs of both sexes were obtained from the Experimen-tal Animal Center at the State University of Sao Pauloat Botucatu Campus. The weights of the animalsvaried from 7 to 16 kg, and the length of their vertebralcolumn ranged from 53 to 70 cm. All dogs were keptunder clinical observation in individual cells for atleast 40 days before they were defined as healthy andcould be randomized for the experiment. All animalswere assessed before spinal puncture and had normalneurologic function. All tests were performed in ac-cordance with the guidelines of the InternationalAssociation for the Study of Pain.39

The sample size was calculated according to Fleisset al.40 estimating a proportion of histological neuro-toxicity of 1% and 80% in the control and amitriptylinegroups, respectively, so as to obtain a power value of90% while setting the one-sided � level for statisticalsignificance at 0.05.

Experimental GroupsThe dogs were randomized to one of three experi-

mental groups according to the type of solution to beadministered into the subarachnoid space. Seven dogswere allocated to each group. Group 1 was definedas the control group, in which 0.9% normal salinesolution was injected intraspinally. Groups 2 and 3received 0.15% and 0.3% amitriptyline solutions, re-spectively. All three solutions had the same 1-mLvolume. The researchers responsible for spinal admin-istration of the solution were blinded to its content.

Spinal Puncture ProtocolThe animals were fasted for 12 h before the proce-

dure, with water ad libitum. All dogs were submittedto the same anesthetic technique, such as IV etomidate(2 mg/kg) and fentanyl (0.005 mg/kg). A 10-cm areaaround the site of the spinal puncture at L6-7 inter-vertebral space level was washed with water andsoap, followed by hair removal and skin cleansingwith 0.9% normal saline. Finally, the naked skin was

submitted to antisepsis with a 2% chlorhexidine glu-conate solution, and sterile fields were appropriatelypositioned.

Subarachnoid puncture was performed through themedian line approximately 45° to the skin with a22-gauge Quincke needle. Any difficulties during theprocedure and the color of the cerebrospinal fluid(CSF) were recorded. In any circumstance, when atraumatic spinal tap was identified, as defined by thepresence of hemorrhagic CSF or the need for morethan one puncture, the animal was immediately ex-cluded from the study and no solution was adminis-tered into the subarachnoid space. Only two dogswere excluded due to these criteria.

Once the needle was properly located and clear CSFcould be identified, the 1-mL randomized solutionwas injected for approximately 10 s through 1-mLdisposable syringes.

Solution SpecificationsThe amitriptyline solutions administered to Groups

2 and 3 composed of 0.15% and 0.3% hydrochlorideamitriptyline, respectively (Vashuda Pharma ChemLimited, Andhra Pradesh, India), at pH 5.5 and free ofchemical preservatives. The solutions were suppliedin individual ampules by a compounding pharmacycertified in the formulation of parenteral medications.Solutions were stored at 4°C, protected from directexposure to light, and administered about 36 h aftersynthesis. The 0.9% saline solution (Baxter HealthcareCorp., Sao Paulo, Brazil) administered to the controlgroup had a pH of 5.0.

Evaluation and OutcomesThe study animals were evaluated at two different

times: 1 h after intraspinal administration of thesolution after recovery from anesthesia and 21 dayslater. Each animal was assessed regarding the follow-ing secondary outcomes: motor deficit, anal sphinctertonus, and painful sensibility. The primary outcome ofthe study was histological analysis of the spinal cordand meninges of the dogs 21 days after subarachnoidadministration of study solutions.

Motor deficit was determined by the ability to walk,jump, and sustain the tail in an upward position. Analsphincter relaxation was ascertained through visualinspection. Nociception was assessed by reaction topainful pressure and thermal stimuli. To control forpossible interference due to visual perception of thestimuli by the animals, one researcher was responsiblefor masking the animals with a nontransparent clothcomfortably positioned around their neck. Pressurenociceptive stimuli were elicited by the bilateral pinchof a skin fold over sacral, lumbar and thoracic der-matomes, and interdigital membranes of hindlimbs.Thermal painful stimuli were provided by a thermoalgometer set at 50°C for 10 s touching the interdigitalmembranes of the hindlimbs. The presence of pain

966 Neuraxial Administration of Amitriptyline ANESTHESIA & ANALGESIA

was defined by the following: limb withdrawal, vocal-ization, and facial expression. All three secondaryoutcomes (motor deficit, anal sphincter relaxation, andnociception) were classified dichotomously into ab-sent or present. If the slightest deficit in any of thesedimensions were observed at clinical assessment, theanimal would be classified as positive for deficitaccording to the dichotomous classification used.

After IV anesthesia with sodium pentobarbital,animals were killed by electroshock. Thereafter, thelumbar and sacral segments of the spinal cord with thesurrounding meninges were quickly removed in �3min to minimize the risk of injuries to those tissuesfrom ischemia and apoptosis. The anatomical pieceswere fixed in formalin 10% solution for 7 days beforehistological sections were prepared encompassingfrom about 10 cm above the level of the spinalpuncture to the end of the cauda equina. The histo-logical sections were stained by hematoxylin andeosin, Masson trichrome, and glial fibrillary acidicprotein (GFAP) techniques and examined by opticalmicroscopy. Three researchers (FBF, EMG, and MEAM)blinded to the intervention and experienced in histo-logical neurotoxicity assessment classified by consen-sus each of the sections according to the presence orabsence of histological injury. If any kind of lesion wasidentified, it was further specified, and to verify apossible dose-related gradient effect, injuries werestratified according to severity and extent as ascer-tained by consensus.

All clinical and histological evaluations were per-formed by researchers blinded to the solutions admin-istered to each animal.

Statistical AnalysisTo evaluate the effectiveness of the randomization

procedure and the comparability of the three studygroups, one-way analysis of variance was performedfor animals’ weights and length of their vertebralcolumns. One-sided Fisher’s exact test was selected tocompare the frequencies of the findings on the pri-mary and the secondary outcomes between the ami-triptyline and the control groups. The Kruskal–Wallistest was performed for the comparison among treat-ment groups regarding the stratification of histologi-cal injuries. As previously reported, the � level forstatistical significance was set at 0.05. The R software(Version 2.7.1) was used for the performance of statis-tical analysis.41

RESULTSOne-way analysis of variance revealed all three

groups were similar with respect to weight (P � 0.37)and length of the vertebral column (P � 0.65). Therewere no deaths among the study animals. During the21 days of observation, none of them exhibited abnor-mal behavior.

Control group animals had no impaired motorfunction, anal sphincter relaxation or decreased noci-ception at 1 h or at 21 days after the subarachnoidadministration of 0.9% normal saline. Twenty-onedays after the administration of the amitriptylinesolutions, none of the animals in Groups 2 and 3displayed signs of motor impairment, anal sphincterrelaxation or abnormal reactions to painful stimula-tion. Table 1 lists motor function, anal sphincter tone,and sensibility to painful stimuli 1 h after intraspinaladministration of the randomized solution. The as-sessments of histological sections are summarized inTable 2. None of the animals in the three groups haddirect injuries to neural tissue, as ascertained by GFAPstaining; however, in the two amitriptyline groupsmarked adhesive, arachnoiditis was observed, asshown in Figure 1.

To identify a possible dose-related injury gradient,histological sections of the amitriptyline groups werefurther stratified for four dimensions: presence ofmeningeal thickening, fibrosis, meningeal adherence,and inflammatory lymphoplasmocytic infiltrate. Eachof these dimensions was classified into a 4-point scale,yielding a score from 0 to 12 quantitatively describingthe extent and severity of the arachnoiditis. Figure 2depicts the total meningeal toxicity score of the twoamitriptyline groups. The comparison between the twoamitriptyline groups by means of the Kruskal–Wallistest demonstrated a statistically significant associationbetween severity and extensive histological injury andhigher doses of amitriptyline (P � 0.012).

DISCUSSIONIn the pursuit of the perfect local anesthetic, one

marked by low toxicity and high-potency profile,amitriptyline has become the focus of several investi-gations due to its potent Na� channel-blocking ef-fect.14,42 The wide array of direct local actions on thenervous system by amitriptyline, such as N-methyl-d-aspartate, gamma-aminobutyric acid-b, and histamin-ergic receptor blockade,13,43,44 calls attention to itspotential use as a direct drug or adjuvant drug forneuraxial therapy in resistant cases of neuropathic

Table 1. Results of the Assessment of Motor Blockade, AnalSphincter Relaxation, Thermal, and Pressure Nociception 1 hAfter Intraspinal Administration of the Randomized SolutionAccording to Experimental Groupa

Motorblockade

Analsphincterrelaxation

Thermalnociception

Pressurenociception

Controlgroup

0 0 7 7

AMT 0.15% 7* 7* 1† 1†AMT 0.3% 7* 7* 2‡ 1†

AMT � amitriptyline.a Control Group is the reference group for comparison.* P � 0.0006.† P � 0.0047.‡ P � 0.021.

Vol. 109, No. 3, september 2009 © 2009 International Anesthesia Research Society 967

pain syndromes and perhaps even as an opioid-sparing drug in spinal anesthesia. Other studieshave investigated some aspects of the safety andtoxicity of parenteral and single intrathecal doses ofamitriptyline.19 –26,30,32–36,45– 47 It is interesting to note

that none of the studies of single intraspinal doses ofamitriptyline demonstrated evidence of neurotoxicityat concentrations below 15.4 mM/L (0.5%). This isconsistent with the hypothesis by Kitagawa et al.29

that the main mechanism of cellular toxicity induced

Figure 2. Each bar represents the toxicityscore ascertained for each animal byconsensus. Comparison among groupsby Kruskal–Wallis test revealedstatistically significant difference(P � 0.012).

Figure 1. A, Low magnification (�1) glial fibrillary acidic protein (GFAP) stained section. Arrow: exuberant meningealthickening. B, Hematoxylin- and eosin-stained section. Arrow: meningeal adhesion. C, Hematoxylin- and eosin-stainedsection. Long arrow: vascular cuffing; short arrow: lymphoplasmocitic infiltrate. D, Masson trichome-stained section. Arrow:fibrous thickening of meninges with collagen deposition and meningeal adhesion. E, Masson trichome-stained section.Arrow: collagen deposition around the vessel. F, GFAP-stained section demonstrating meningeal thickening with underlyingnormal nervous tissue. All sections are from animals of the 0.3% amitriptyline group.

Table 2. Abnormal Findings Observed by Means of Examination of the Histological Sectionsa

Direct injury toneural tissue

Blood vessels,vascularwall thickening

Meninges, fibrous thickening with inflammatoryinfiltration and formation of trabeculae

Control group 0 0 0AMT 0.15% 0 6* 6*AMT 0.3% 0 7† 7†Control Group received 0.9% normal saline.AMT � amitriptyline.a Group 1 is the reference group for comparison.* P � 0.002.† P � 0.001.


by amitriptyline derives from its amphiphilic proper-ties, which cause cell membrane solubilization andrupture at concentrations above its molecular self-aggregation level. According to that hypothesis,amitriptyline concentrations below a given self-aggregation level (0.3% for the intraspinal model)could be safe.

To our knowledge, this was the first investigationto specifically examine both clinically and histologi-cally the neurotoxicity profile of single intraspinaldoses of amitriptyline in such small concentrationswith reference to outcomes for longer than 1 wk. Thisstudy design allowed us to observe the presence ofadhesive arachnoiditis without neural tissue injury, afinding secondary to intraspinal administration of thisdrug. This observation would have possibly goneundetected if the histological analysis had been per-formed earlier because the development of adhesivearachnoiditis usually occurs at a slower pace, weeks tomonths after spinal puncture.38,48 There were no signsof clinical neurologic deficits until final clinical evalu-ation, 21 days after spinal puncture. Other authors,analyzing the neurotoxicity of subarachnoid adminis-tration of different doses of the usual local anestheticshave also noted lack of association between histolog-ical and clinical findings related to adhesive arach-noiditis.49–51 This observation might be explained bythe unfeasibility of performing concomitant long-termclinical follow-up of one animal and serial histologicalsections of spinal cord segments in the same animal atsuccessive times. Nevertheless, because of the pro-gressive nature of the meningeal changes described, itis likely that some animals would develop clinicallyrelevant neurologic symptoms or deficits, such as painor even cauda equina syndrome.

It is not clear whether the present findings can beexplained by the membrane solubilization hypothesispreviously cited,29 not only because amitriptyline wasadministered at and below the reported membranesolubilization-inducing concentration but also becausehistological damage was restricted to the meninges(neural injury was excluded by GFAP staining). Thecurrent observation of adhesive arachnoiditis suggestseither the presence of other inflammation-relatedtoxicity mechanisms as proposed by others27,30,52 ora lower self-aggregation/membrane solubilizationthreshold. Our results suggest that this is a dose-dependent mechanism because the Kruskal–Wallistest disclosed statistical significance between thehigher amitriptyline concentration experimentalgroup and more severe arachnoiditis.

One important question that must be addressed iswhether arachnoiditis is a specific pathological find-ing of intrathecal amitriptyline because commonlyused local anesthetics also have been reported toinduce spinal cord toxicity.49,50 The mechanismsunderlying those injuries are not well understood; how-ever, the reported typical pattern of histological dam-age induced by local anesthetics is neuronal (axonal

swelling and degeneration, macrophage infiltration,demyelination, subpial vacuolization, and central ne-crosis) and not arachnoiditis or other meningealchanges. Other researchers34,35 studying intraspinalamitriptyline in different concentrations and usingdifferent techniques found meningeal lesions and neu-ronal damage. Therefore, the present findings suggestthat arachnoiditis is specific to amitriptyline. Perhaps,further studies examining the differences between thepharmacologic properties of local anesthetics andamitriptyline and the differential pattern of histo-logical damage associated with those drugs mightlead to better understanding of their own toxicitymechanisms.

This study was a blinded, randomized, controlledtrial, in which potential confounding due to lesionsinduced by the spinal puncture procedure in theamitriptyline groups was controlled by comparisonwith the control group, in which normal saline wasintraspinally administered in the same total volumeand with a similar pH as the amitriptyline solution.The experimental model selected of single-dose in-traspinal administration is similar to the usual spinalanesthesia procedures used in humans and displaysless risk of complications than other models in whichimplantable intrathecal catheters are used. The drugsolutions were free of chemical preservatives so as toexclude the possibility that the histological findingswere reactions to a substance other than amitriptyline.The doses used were the lowest doses reported tohave clinical effects. It seems unlikely that the presentfindings could be explained by unmeasured hemody-namic changes in the amitryptiline groups becauseother researchers20 using larger intrathecal doses ofamitriptyline did not observe hemodynamic changes(spinal blood flow or mean arterial blood pressure).Similarly, fast removal and fixation of the anatomicalpiece, as well as the comparison with controls submit-ted to the same procedure, make our findings veryunlikely due to cord extraction-related ischemic inju-ries or other procedure-related mechanisms.

This study has limitations. The specific osmolalityof the amitriptyline solutions was not measured.However, other researchers29 have described solutionsof amitriptyline in normal saline at similar concentra-tions (0.1%, 0.3%, and 0.5%) displaying osmolalitiesranging from 280 to 350 mOsm/kg, whereas theosmolality of CSF ranges from 280 to 300 mOsm/kg,which would not be expected to cause histologicaldamage given the diluting volume of the CSF and thevelocity of injection (10 s). A dichotomous classifica-tion was used instead of a scalar measure for thecomparison of motor function, anal sphincter tone, andsensibility to painful stimulation; however, becausethe classification scheme used was quite stringent (theslightest deficit would be classified as positive), it islikely that the comparisons were even more rigorousthan scalar comparisons. The assessment of anal


sphincter tone was made exclusively by visual inspec-tion without use of a sphincter manometer. Eventhough the observation of sphincter relaxation is usu-ally straightforward, the assessment method usedwould not be able to detect minor deficits regardinganal sphincter pressure.

On the basis of the present results, intraspinaladministration of amitriptyline solutions is markedlyassociated with the development of intense adhesivearachnoiditis even at low doses, for which there wereno previous reports of toxicity. Even if no evidence ofhistological damage to the arachnoid membrane ofdogs had been found, the therapeutic index of thisdrug would remain undetermined and its intrathecaluse would not be recommended. Further studies arenecessary to elucidate the mechanism of the menin-geal toxicity observed.

REFERENCES

1. Flor H, Kalso E, Dostrovsky JO. International Association for theStudy of Pain: Proceedings of the 11th World Congress on Pain.Seattle: IASP Press, 2006

2. Flor H. IASP Scientific Program Committee: Pain 2005: anupdated review: refresher course syllabus. Seattle: IASP Press,2005

3. Devor M. Sodium channels and mechanisms of neuropathicpain. J Pain 2006;7:S3–12

4. Scadding JW. Treatment of neuropathic pain: historical aspects.Pain Med 2004;5(suppl 1):S3–8

5. Woolf CJ, Decosterd I. Implications of recent advances in theunderstanding of pain pathophysiology for the assessment ofpain in patients. Pain 1999;suppl 6:S141–7

6. Rowbotham MC. Treatment of neuropathic pain: perspective oncurrent options. In: Justins DM, ed. Pain 2005: an updatedreview: refresher course syllabus. Seattle: IASP Press,2005:107–19

7. Max MB, Gilron IH. Antidepressants, muscle relaxants, andN-methyl-d-aspartate receptor antagonists. In: Loeser JD, ed.Bonica’s management of pain. 3rd ed. Philadelphia: LippincottWilliams & Wilkins, 2001:1710–26

8. Choi A, Mitchelson F. Variation in the affinity of amitriptylinefor muscarine receptor subtypes. Pharmacology 1994;48:293–300

9. Galeotti N, Ghelardini C, Bartolini A. Involvement of potassiumchannels in amitriptyline and clomipramine analgesia. Neuro-pharmacology 2001;40:75–84

10. Ghelardini C, Galeotti N, Bartolini A. Antinociception inducedby amitriptyline and imipramine is mediated by alpha2A-adrenoceptors. Jpn J Pharmacol 2000;82:130–7

11. Gumilar F, Arias HR, Spitzmaul G, Bouzat C. Molecularmechanisms of inhibition of nicotinic acetylcholine receptorsby tricyclic antidepressants. Neuropharmacology 2003;45:964 –76

12. Lavoie PA, Beauchamp G, Elie R. Tricyclic antidepressantsinhibit voltage-dependent calcium channels and Na(�)-Ca2�

exchange in rat brain cortex synaptosomes. Can J PhysiolPharmacol 1990;68:1414–8

13. McCarson KE, Duric V, Reisman SA, Winter M, Enna SJ.GABA(B) receptor function and subunit expression in the ratspinal cord as indicators of stress and the antinociceptiveresponse to antidepressants. Brain Res 2006;1068:109–17

14. Pancrazio JJ, Kamatchi GL, Roscoe AK, Lynch C, 3rd. Inhibitionof neuronal Na� channels by antidepressant drugs. J PharmacolExp Ther 1998;284:208–14

15. Reynolds JL, Ignatowski TA, Gallant S, Spengler RN. Amitrip-tyline administration transforms tumor necrosis factor-alpharegulation of norepinephrine release in the brain. Brain Res2004;1023:112–20

16. Sawynok J, Reid AR, Esser MJ. Peripheral antinociceptive actionof amitriptyline in the rat formalin test: involvement of adeno-sine. Pain 1999;80:45–55

17. Watanabe Y, Saito H, Abe K. Tricyclic antidepressants blockNMDA receptor-mediated synaptic responses and induction oflong-term potentiation in rat hippocampal slices. Neurophar-macology 1993;32:479–86

18. McQuay HJ, Tramer M, Nye BA, Carroll D, Wiffen PJ, MooreRA. A systematic review of antidepressants in neuropathic pain.Pain 1996;68:217–27

19. Barnet CS, Louis DN, Kohane DS. Tissue injury from tricyclicantidepressants used as local anesthetics. Anesth Analg2005;101:1838–43

20. Cerda SE, Tong C, Deal DD, Eisenach JC. A physiologicassessment of intrathecal amitriptyline in sheep. Anesthesiology1997;86:1094–103

21. Eisenach JC, Gebhart GF. Intrathecal amitriptyline. Antinocicep-tive interactions with intravenous morphine and intrathecalclonidine, neostigmine, and carbamylcholine in rats. Anesthesi-ology 1995;83:1036–45

22. Estebe JP, Myers RR. Amitriptyline neurotoxicity: dose-relatedpathology after topical application to rat sciatic nerve. Anesthe-siology 2004;100:1519–25

23. Fridrich P, Eappen S, Jaeger W, Schernhammer E, Zizza AM,Wang GK, Gerner P. Phase Ia and Ib study of amitriptyline forulnar nerve block in humans: side effects and efficacy. Anesthe-siology 2004;100:1511–8

24. Gerner P, Haderer AE, Mujtaba M, Sudoh Y, Narang S, Abdi S,Srinivasa V, Pertl C, Wang GK. Assessment of differentialblockade by amitriptyline and its N-methyl derivative in differ-ent species by different routes. Anesthesiology 2003;98:1484–90

25. Gerner P, Mujtaba M, Khan M, Sudoh Y, Vlassakov K, AnthonyDC, Wang GK. N-phenylethyl amitriptyline in rat sciatic nerveblockade. Anesthesiology 2002;96:1435–42

26. Gerner P, Mujtaba M, Sinnott CJ, Wang GK. Amitriptylineversus bupivacaine in rat sciatic nerve blockade. Anesthesiology2001;94:661–7

27. Haller I, Lirk P, Keller C, Wang GK, Gerner P, Klimaschewski L.Differential neurotoxicity of tricyclic antidepressants and novelderivatives in vitro in a dorsal root ganglion cell culture model.Eur J Anaesthesiol 2007;24:702–8

28. Heughan CE, Allen GV, Chase TD, Sawynok J. Peripheralamitriptyline suppresses formalin-induced Fos expression inthe rat spinal cord. Anesth Analg 2002;94:427–31

29. Kitagawa N, Oda M, Nobutaka I, Satoh H, Totoki T, MorimotoM. A proposed mechanism for amitriptyline neurotoxicitybased on its detergent nature. Toxicol Appl Pharmacol2006;217:100–6

30. Lirk P, Haller I, Hausott B, Ingorokva S, Deibl M, Gerner P,Klimaschewski L. The Neurotoxic Effects of Amitriptyline AreMediated by Apoptosis and are Effectively Blocked by Inhibi-tion of Caspase Activity. Anesth Analg 2006;102:1728–33

31. McCaslin PP, Yu XZ, Ho IK, Smith TG. Amitriptyline preventsN-methyl-d-aspartate (NMDA)-induced toxicity, does not pre-vent NMDA-induced elevations of extracellular glutamate, butaugments kainate-induced elevations of glutamate. J Neuro-chem 1992;59:401–5

32. Sawynok J, Reid AR, Liu XJ, Parkinson FE. Amitriptylineenhances extracellular tissue levels of adenosine in the rathindpaw and inhibits adenosine uptake. Eur J Pharmacol2005;518:116–22

33. Srinivasa V, Gerner P, Haderer A, Abdi S, Jarolim P, Wang GK.The relative toxicity of amitriptyline, bupivacaine, andlevobupivacaine administered as rapid infusions in rats. AnesthAnalg 2003;97:91–5, table of contents

34. Sudoh Y, Desai SP, Haderer AE, Sudoh S, Gerner P, AnthonyDC, De Girolami U, Wang GK. Neurologic and histopathologicevaluation after high-volume intrathecal amitriptyline. RegAnesth Pain Med 2004;29:434–40

35. Yaksh TL, Tozier N, Horais KA, Malkmus S, Rathbun M,Lafranco L, Eisenach J. Toxicology profile of N-methyl-d-aspartate antagonists delivered by intrathecal infusion in thecanine model. Anesthesiology 2008;108:938–49

36. Chen YW, Huang KL, Liu SY, Tzeng JI, Chu KS, Lin MT, WangJJ. Intrathecal tri-cyclic antidepressants produce spinal anesthe-sia. Pain 2004;112:106–12

37. Burton CV. Lumbosacral arachnoiditis. Spine 1978;3:24–3038. Woods W, Franklin R. Progressive adhesive arachnoiditis fol-

lowing spinal anesthesia. Calif Med 1951;75:196–839. Zimmermann M. Ethical guidelines for investigations of

experimental pain in conscious animals. Pain 1983;16:109 –10


40. Fleiss JL, Levin BA, Paik MC. Statistical methods for rates andproportions. 3rd ed. Hoboken, NJ: Wiley, 2003

41. R Development Core Team (2008). R: A language and envi-ronment for statistical computing. R Foundation for Statisti-cal Computing, Vienna, Austria. ISBN3-900051-07-0, URL:http://www.R-Project.org.

42. Sudoh Y, Cahoon EE, Gerner P, Wang GK. Tricyclic antidepres-sants as long-acting local anesthetics. Pain 2003;103:49–55

43. Bryson HM, Wilde MI. Amitriptyline. A review of its pharma-cological properties and therapeutic use in chronic pain states.Drugs Aging 1996;8:459–76

44. Sawynok J, Reid A. Peripheral interactions between dextro-methorphan, ketamine and amitriptyline on formalin-evokedbehaviors and paw edema in rats. Pain 2003;102:179–86

45. Gerner P, Luo SH, Zhuang ZY, Djalali AG, Zizza AM, MyersRR, Wang GK. Differential block of N-propyl derivatives ofamitriptyline and doxepin for sciatic nerve block in rats. RegAnesth Pain Med 2005;30:344–50

46. Gerner P. Tricyclic antidepressants and their local anestheticproperties: from bench to bedside and back again. Reg AnesthPain Med 2004;29:286–9

47. Eisenach JC, Gebhart GF. Intrathecal amitriptyline acts as anN-methyl-d-aspartate receptor antagonist in the presence ofinflammatory hyperalgesia in rats. Anesthesiology 1995;83:1046–54

48. Hurst EW. Adhesive arachnoiditis and vascular blockagecaused by detergents and other chemical irritants: an experi-mental study. J Pathol Bacteriol 1955;70:167–78

49. Rosen MA, Baysinger CL, Shnider SM, Dailey PA, Norton M,Curtis JD, Collins M, Davis RL. Evaluation of neurotoxicity aftersubarachnoid injection of large volumes of local anestheticsolutions. Anesth Analg 1983;62:802–8

50. Ready L, Plumer M, Haschke R, Austin E, Sumi S. Neurotoxicityof intrathecal local anesthetics in rabbits. Anesthesiology1985;63:364–70

51. Ganem EM, Vianna PT, Castiglia YMM, Marques M, Vane LA.Neurotoxicity of subarachnoid hyperbaric bupivacaine in dogs.Reg Anesth Pain Med 1996;21:234–8

52. Chung EY, Shin SY, Lee YH. Amitriptyline induces earlygrowth response-1 gene expression via ERK and JNK mitogen-activated protein kinase pathways in rat C6 glial cells. NeurosciLett 2007;422:43–8


Regional AnesthesiaSection Editor: Terese T. Horlocker

Sciatic Nerve Catheter Placement: Success with Usingthe Raj Approach

Christopher Robards, MD

R. Doris Wang, MD

Steven Clendenen, MD

Beth Ladlie, MD

Roy Greengrass, MD

BACKGROUND: Continuous regional analgesia has increased in popularity and isbecoming standard of care for many painful surgical procedures. Various ap-proaches of sciatic catheter insertion have been proposed, each with attributes anddisadvantages. We investigated whether the Raj approach that uses a simplemidpoint landmark between the ischial tuberosity and greater trochanter willfacilitate sciatic catheter placement.METHODS: After informed consent, 20 patients were recruited to receive sciaticcatheter placement using the Raj approach. An insulated Tuohy needle wasinserted perpendicular to skin at the midpoint of a line between the ischialtuberosity and greater trochanter. After sciatic nerve stimulation, a catheter wasinserted 2–4 cm past the end of the needle and secured. The catheters were thenincrementally injected with 30 mL of 1.5% mepivacaine. Twenty minutes after localanesthetic injection, sensory block was assessed using cold and pinprick tests,whereas motor block was assessed using a modified Bromage score. Complicationsand side effects were recorded.RESULTS: In all instances, blocks were easy to perform and were successful. Nomajor side effects or complications were noted.CONCLUSION: Use of a simple landmark between easily identifiable bony structuresenhances the simplicity and placement of a sciatic nerve catheter and is recom-mended for use in clinical practice.(Anesth Analg 2009;109:972–5)

Postoperative pain associated with total joint re-placements, particularly total knee arthroplasty, is oftensevere and refractory to IV opioids. Advances in needleand catheter systems have enabled continuous regionalanalgesia to become increasingly popular with the pri-mary advantage of providing analgesia well into thepostoperative period. Single injection sciatic nerve blockand catheter techniques have been performed utilizingdifferent approaches at many levels after the nerve exitsthe sciatic notch in the pelvis.1–5 One of the mostcommonly used techniques of sciatic nerve blockade isthe Labat approach during which the patient is placed inthe Sim’s position. Because the “Euclidian Geometry”required to identify a surface landmark for needle inser-tion using this technique can be difficult, particularly inan obese patient population, alternative approaches havebeen suggested.6,7 Although these alternative approachesmay appear promising, the soft tissue landmarks identifiedusing these techniques can still be misleading.

In 1975, Raj described a technique of blocking thesciatic nerve at the point where it lies between the greatertrochanter of the femur and ischial tuberosity.8 The

accuracy and simplicity of this technique relies on thefact that these bones are easily palpable and consistentlandmarks requiring solely their identification and themidpoint between them before needle insertion. In ad-dition to the simplicity of needle insertion site identifi-cation, this technique is desirable because moving thepatient into a Sim’s position is not required and thesciatic nerve is more superficial at this level comparedwith transgluteal approaches. Although there is someevidence demonstrating success with sciatic nerve cath-eters using another subgluteal approach,2,9 there are nostudies in which a Raj approach was used for catheterplacement. This study was designed to determinewhether the simplicity of the single injection techniquecould be reproduced using a catheter placement tech-nique. This pilot study was performed to determine thereliability, feasibility, and success rate of sciatic cathetersplaced via the Raj approach.

METHODSAfter institutional review board approval, 20 pa-

tients, who met inclusion criteria (patients undergoingprimary unilateral knee arthroplasty or ankle surgery,�18 yr-of-age, ASA physical status of I, II, or III,competent and able to provide informed consent),were recruited for the study. Exclusion criteria in-cluded patients �18 yr of age, pregnant or lactatingpatients, patients who are unwilling or unable toprovide written informed consent, patients who refuse

From the Department of Anesthesiology, the Mayo ClinicFlorida, Jacksonville, Florida.

Accepted for publication April 9, 2009.Address correspondence and reprint requests to Christopher B.

Robards, MD, Mayo Clinic Florida, 4500 San Pablo Rd., Jacksonville,FL 32224. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181ae0ee7


regional anesthesia, patients who have a contraindica-tion to regional anesthesia (i.e., coagulopathy, bleed-ing diathesis), and patients who have a known allergyto amide local anesthetics. After informed consent,standard monitors (noninvasive blood pressure cuff,ECG, pulse oximetry) were placed on each patient.Supplemental oxygen was administered via nasalcanula at 2–3 L/min. Intravenous midazolam wasadministered in increments of 1 mg for anxiolysis andfentanyl was administered in increments of 50 �g forpain associated with the procedure. The patient waspositioned supine with the operative extremity flexedat the hip and flexed 90° at the knee (Fig. 1).

The greater trochanter and ischial tuberosity wereidentified and marked (Fig. 2). The needle insertionsite was at the midpoint of a line joining the greatertrochanter and ischial tuberosity at the level of thegluteal crease. After sterile prep and drape, and sub-cutaneous local anesthetic injection, an 18-G, 4-in. (100mm) insulated Tuohy needle (B. Braun, Bethlehem,PA) attached to a nerve stimulator (Stimuplex Dig RC,B. Braun) with an initial setting of 1.5 mA, 2 Hz wasinserted perpendicular to the skin with the beveldirected cephalad (toward the gurney). On successfulsciatic nerve stimulation (plantar flexion/dorsiflexion)

at a current of �0.5 mA, a 20-G multiport, closed tippolyamide nylon catheter (B. Braun) was advancedthrough the needle to lie approximately 2–4 cm pastthe tip. If difficulty was encountered with catheteradvancement (inability to easily advance catheter onfirst attempt), 10 mL of sterile saline were injectedthrough the needle injection side port, and an attemptto advance the catheter was repeated. An anesthesi-ologist present during the block procedure docu-mented the number of needle passes and the timetaken to perform the block procedure. After negativeaspiration and negative test dose injection (3 mL 1.5%lidocaine with 1:200,000 epinephrine), 30 mL of pre-servative free mepivacaine 1.5% was injected throughthe sciatic catheter in 5 mL increments. The catheterswere fixed to the skin with Steri-Strips (3M, St. Paul,MN) and a Tegaderm (3M). Sensory and motor block-ade were assessed 20 min after the completion ofinjection by another anesthesiologist who was blindedto the regional block technique performed. Sensoryblockade was assessed in the plantar and dorsalsurfaces of the foot using a blunt tip needle. Motorblock of the tibial and common peroneal branches ofthe sciatic nerve were assessed using a modifiedBromage score (Appendix). Successful block was de-fined as the presence of sensory block and motor block(Bromage scale �2) in either the common peroneal ortibial nerve distribution, 20 min after local anestheticinjection through the catheter.

Data CollectionThe following information was collected from 20

patients in this observational study: age, sex, height,weight, time from needle insertion to completion ofcatheter insertion, total number of skin punctures madeduring block, total number of redirections made duringblock, lowest current achieved during block, difficultyduring catheter insertion, need for saline dilation, dis-tance from skin to sciatic nerve, depth of catheter,presence of blood in catheter, fentanyl dose, midazolamdose, Bromage score in the tibial nerve distribution,Bromage score in the peroneal nerve distribution, and

Figure 1. Proper leg positioning for sciatic nerve block usingRaj approach.

Figure 2. Surface landmarks and needle insertion site forsciatic nerve block using Raj approach.


sensory block assessment at the bottom of the foot, heel,anterior and lateral aspect of the foot.

Statistical AnalysisNumerical data was summarized with the sample

median and range. Categorical data was summarizedwith number and percent of patients. An exact bino-mial 95% confidence interval was used to estimate theproportion of successful blocks.

RESULTSTwenty patients were recruited for the study. All 20

patients completed the study. All patients toleratedpositioning and catheter insertion well using moder-ate sedation. Patient characteristics are presented inTable 1. All 20 patients (100%) had a successful block.Most patients (75%) required one needle puncture site,only one required more than two puncture sites.Average time for catheter placement was 2.8 min with1.2 needle redirections. Difficult catheter advancementwas encountered in two patients (10%) but was easilymanaged with saline injection through the needlebefore catheter readvancement. Two other patientshad saline injection through the needle before catheteradvancement because of the anesthesiologist’s prefer-ence. Average distance of the sciatic nerve from skinwas 5.9 cm. Tibial nerve stimulation was observed in16 patients and peroneal nerve stimulation in fourpatients (Table 2). Success rate of the Raj sciaticcatheter is summarized in Table 3. All patients hadsensory anesthesia in the distribution of both the tibialand peroneal nerves. At the 20 min time point, 16patients had significant weakness in both terminalnerve distributions, whereas four patients had signifi-cant weakness in the peroneal distribution only. Noneof the patients demonstrated any signs of local anes-thetic toxicity during the procedure.

DISCUSSIONContinuous sciatic nerve blockade using a subglu-

teal approach has been described in the past withexcellent results.9–12 However, we know of no reportsof sciatic nerve catheter placement using a Raj ap-proach. The benefits of using this approach over otherapproaches are that patient repositioning to a Sim’sposition is not required and that dependence ondifficult to identify landmarks is eliminated. Easy toidentify landmarks are particularly important in anobese patient population where block failure is morelikely to occur.13 All patients in our study population(100%) had a successful block as defined by sensory

loss to pinprick on the dorsum or plantar surface ofthe foot at 20 min (in actuality both plantar anddorsum sensory blockade was present in all patients).All blocks were quickly performed (average, 2.8 min)with minimal needle redirections (average, 1 redirect).Most catheters (90%) were easily advanced on the firstattempt. The remaining two catheters (10%) wereeasily advanced after the injection of 10 mL of saline.Although data were not compiled regarding analgesiain the postoperative period, because the local anes-thetic was administered through the peripheral nervecatheter, a functional catheter is assumed. Pain asso-ciated with total knee arthroplasty is variable, particu-larly in the posterior knee. In fact some patients,although it is the minority, do not require the use ofcontinuous sciatic nerve blockade.14 This has led somepractitioners to perform single injection sciatic nerveblockade or forego sciatic nerve blockade altogether infavor of IV patient-controlled analgesia. However,because the majority of patients do in fact have at leastsome degree of posterior knee pain following totalknee arthroplasty,14 an easy to perform, reliable ap-proach to sciatic nerve catheter placement is particu-larly attractive for patients in whom narcotic analgesiais best avoided (allergy, history of opioid associatednausea/vomiting, obstructive sleep apnea, cognitive

Table 2. Surgery/Block Characteristics

VariableSummary(N � 20)

Side of surgery (right) 9 (45%)Time taken to place needle and catheter (min) 2.8 (1.6)Number of skin punctures made during block

1 15 (75%)2 4 (20%)3 1 (5%)

Number of redirections made during block 1 (0–4)Lowest current achieved during block (mA) 0.46 (0.09)Nerve distribution with motor responsea

Tibial nerve 15 (79%)Peroneal nerve 4 (21%)

Difficulty during catheter insertion 2 (10%)Saline dilation 4 (20%)Distance from skin to sciatic nerve (cm) 5.9 (2.0)Depth of catheter (cm) 6.5 (2.1)Fentanyl dose (�g) 128 (62)Midazolam dose (mg) 2.9 (1.1)Numerical data are summarized with the sample mean (SD) and the number of redirectionsgiven as a median with range.a Not available for one patient.

Table 3. Patient Outcomes

VariableSummary(N � 20)

Sensory blockPlantar aspect of the foot 20 (100%)Dorsum of the foot 20 (100%)

Motor blockPlantar flexion weakness (Bromage T �2) 16 (80%)Dorsi flexion weakness (Bromage P �2) 20 (100%)

Successful block 20 (100%)

Table 1. Patient Characteristics

Variable Summary (N � 20)Age 69 (9)Sex (male) 10 (50%)BMI 31 (4)Numerical data are summarized with the sample mean (SD).BMI � body mass index.

974 Raj Approach for Sciatic Nerve Catheters ANESTHESIA & ANALGESIA

dysfunction)15,16 or is likely to be inadequate (chronicopioid dependence).17 With the increasing prevalenceof obesity, an approach to sciatic nerve blockade thatis both easily performed and reliable is ideal. Byflexing the leg at the hip in the supine position, the Rajapproach to sciatic nerve blockade accentuates the twobony landmarks necessary for identification and sim-plifies nerve blockade. Furthermore, it requires littlecooperation on the part of the patient by allowingthem to remain in a supine position. It should be notedthat a subgluteal approach for sciatic nerve blockademay not provide adequate posterior thigh anesthesiaor analgesia because of a proximal branching of theposterior cutaneous nerve of the thigh.6

There are clearly some limitations to this pilotstudy. First of all, although all patients in our studypopulation were considered overweight, few of themwere obese, and there were no patients consideredmorbidly obese by body mass index criteria. Becausethe aim of our study was to demonstrate the feasibilityof sciatic nerve catheter placement and subsequentblockade with through the catheter injection of localanesthetic using the Raj approach, patients with anormal or slightly elevated body mass index were notexcluded. A follow-up study to test the utility of thisapproach over the classic Labat approach in an obesepatient population should recruit morbidly obese pa-tients and compare the two approaches directly. Sec-ondly, because sensory and motor testing data in thepostoperative period were not included, we are unableto ascertain the functionality of these catheters in termsof postoperative analgesia. However, the catheters wereused for the initial dosing, and 100% of patients had asensory deficit and 80% of patients had a motor deficit inboth tibial and common peroneal distributions beforethe surgical procedure, making some degree of function-ality implicit. Furthermore, the employed method ofdosing sciatic catheters in the postoperative period at ourinstitution (due in part to surgeon concern for foot dropand desire for participation in rehabilitation) is one of theintermittent boluses (4–6 mL every 4–6 h). This isidentical except in terms of volume to the initial (and100% successful) block.

Because all patients studied underwent total kneearthroplasty and received either spinal anesthesia orgeneral anesthesia we cannot determine whether ornot the blocks ever attained true surgical anesthesia.Again, comprehensive sensory and motor testing in-dicated that all blocks were successful.

In summary, our data suggest that a functionalperipheral nerve catheter can be easily placed usingthe Raj approach to sciatic nerve blockade with a highdegree of success. Although further randomized con-trolled studies are necessary to draw extensive con-clusions from this data, the implication is that thisapproach is an easy alternative to other previouslydescribed approaches to sciatic nerve catheter place-ment and blockade.

REFERENCES

1. Di Benedetto P, Casati A, Bertini L, Fanelli G. Posterior subglu-teal approach to block the sciatic nerve: description of thetechnique and initial clinical experiences. Eur J Anaesthesiol2002;19:682–6

2. Di Benedetto P, Bertini L, Casati A, Borghi B, Albertin A, FanelliG. A new posterior approach to the sciatic nerve block: aprospective, randomized comparison with the classic posteriorapproach. Anesth Analg 2001;93:1040–4

3. Chelly JE, Delaunay L. A new anterior approach to the sciaticnerve block. Anesthesiology 1999;91:1655–60

4. Morris GF, Lang SA, Dust WN, Van der Wal M. The parasacralsciatic nerve block. Reg Anesth 1997;22:223–8

5. Fanelli G, Sansone V, Nobili F, Pedotti E, Aldegheri G. [Locore-gional anesthesia for surgical arthroscopy of the knee]. MinervaAnestesiol 1992;58:121–5

6. Franco CD, Choksi N, Rahman A, Voronov G, AlmachnoukMH. A subgluteal approach to the sciatic nerve in adults at 10cm from the midline. Reg Anesth Pain Med 2006;31:215–20

7. Franco CD. Posterior approach to the sciatic nerve in adults: iseuclidean geometry still necessary? Anesthesiology 2003;98:723–8

8. Raj PP, Parks RI, Watson TD, Jenkins MT. A new single-positionsupine approach to sciatic-femoral nerve block. Anesth Analg1975;54:489–93

9. Taboada M, Rodriguez J, Valino C, Vazquez M, Laya A, GareaM, Carceller J, Alvarez J, Atanassoff V, Atanassoff PG. Aprospective, randomized comparison between the popliteal andsubgluteal approaches for continuous sciatic nerve block withstimulating catheters. Anesth Analg 2006;103:244–7

10. Di Benedetto P, Casati A, Bertini L. Continuous subgluteussciatic nerve block after orthopedic foot and ankle surgery:comparison of two infusion techniques. Reg Anesth Pain Med2002;27:168–72

11. Di Benedetto P, Casati A, Bertini L, Fanelli G, Chelly JE.Postoperative analgesia with continuous sciatic nerve blockafter foot surgery: a prospective, randomized comparison be-tween the popliteal and subgluteal approaches. Anesth Analg2002;94:996–1000

12. Cappelleri G, Aldegheri G, Ruggieri F, Mamo D, Fanelli G,Casati A. Minimum effective anesthetic concentration (MEAC)for sciatic nerve block: subgluteus and popliteal approaches.Can J Anaesth 2007;54:283–9

13. Cotter JT, Nielsen KC, Guller U, Steele SM, Klein SM, GreengrassRA, Pietrobon R. Increased body mass index and ASA physicalstatus IV are risk factors for block failure in ambulatorysurgery—an analysis of 9,342 blocks. Can J Anaesth 2004;51:810–6

14. Ben-David B, Schmalenberger K, Chelly JE. Analgesia after totalknee arthroplasty: is continuous sciatic blockade needed in addi-tion to continuous femoral blockade? Anesth Analg 2004;98:747–9

15. Aubrun F, Marmion F. The elderly patient and postoperativepain treatment. Best Pract Res Clin Anaesthesiol 2007;21:109–27

16. Cullen DJ. Obstructive sleep apnea and postoperative analgesia—apotentially dangerous combination. J Clin Anesth 2001;13:83–5

17. Carroll IR, Angst MS, Clark JD. Management of perioperativepain in patients chronically consuming opioids. Reg AnesthPain Med 2004;29:576–91

APPENDIX

Description of the Bromage score adapted to the tibialnerve: grade criteria

I Full capacity for plantar flexion of the footII Just able to plantar flex the footIII Unable to plantar flex the foot but with free

movement of the toesIV Unable to move the foot

Description of the Bromage score adapted to the peronealnerve: grade criteria

I Full capacity for dorsiflexion of the footII Just able to dorsiflex the footIII Unable to dorsiflex the foot but with free

movement of the toesIV Unable to move the foot


Regional Anesthesia for Vascular Access Surgery

Elizabeth B. Malinzak, BS

Tong J. Gan, MHS, MB, FRCA

BACKGROUND: Approximately 25% of initial arteriovenous fistula (AVF) placementswill fail as a result of thrombosis or failure to develop adequate vessel size andblood flow. Fistula maturation is impacted by patient characteristics and surgicaltechnique, but both increased vein diameter and high fistula blood flow rates arethe most important predictors of successful AVFs. Anesthetic techniques used invascular access surgery (monitored anesthesia care, regional blocks, and generalanesthesia) may affect these characteristics and fistula failure.METHODS: We performed a literature search using key words in the PubMed/MEDLINE database. Seven articles that related to the effects of anesthesia on AVFconstruction, including sympathetic block, vein dilation, blood flow, adverseoutcomes, or patency rates, comprised the sources for this review.RESULTS: Significant vasodilation after regional block administration is seen in boththe cephalic and basilic veins. These vasodilatory properties may assist with AVFsite selection. In the intraoperative and postoperative periods, use of a regionalblock, compared with other anesthetic techniques, resulted in significantly in-creased fistula blood flow. The greater sympathetic block contributed to vesseldilation and reduced vasospasm. Use of regional techniques in AVF constructionyielded shorter maturation times, lower failure rates, and higher patency rates.CONCLUSION: Use of regional blocks may improve the success of vascular accessprocedures by producing significant vasodilatation, greater fistula blood flow,sympathectomy-like effects, and decreased maturation time. However, a large-scale, prospective, clinical trial comparing the different anesthetic techniques is stillneeded to verify these findings.(Anesth Analg 2009;109:976–80)

End-stage renal disease (ESRD) currently affectsmore than 350,000 Americans, and each year, thispopulation increases by approximately 7%.1,2 Creationof permanent vascular access though surgical con-struction of an arteriovenous fistula (AVF) is preferredfor ESRD patients receiving chronic hemodialysis.However, about one quarter of these initial attemptswill fail as a result of stenosis or failure of the vesselsto develop adequate blood flow.3 Interventions tomaintain the access site cost dialysis patients morethan $600 million per year.4 Consequently, manystudies have attempted to determine the effect ofpatient characteristics, anesthetic management, or sur-gical techniques on graft or fistula failure rate. In thisinvestigation, we performed a review of the literatureto determine how the use of regional anesthesia caninfluence outcomes in AVF construction.

METHODSThe literature search for this review was conducted

in December 2007 using the PubMed/MEDLINE da-tabase. Two key words, one from List A and one fromList B, were joined with the term “and” in all possiblecombinations for the literature search. Key wordsfrom List A included “arteriovenous fistula,” “AVF,”“vascular access,” “arteriovenous graft,” “AVG,” “di-alysis,” “dialysis access,” “end-stage renal disease,”“ESRD,” “chronic kidney disease,” and “CKD.” List Bincluded “regional anesthesia,” “brachial plexusblock,” “BPB,” “supraclavicular,” “infraclavicular,”“axillary,” and “interscalene.” The results were lim-ited to full text articles published in the Englishlanguage. After the initial search, five articles wereexcluded because they did not pertain to the use ofregional anesthesia for creation of vascular access fordialysis in adults. Of the remaining articles, sevenrelated to the effects of regional anesthesia on AVFconstruction, including sympathetic block, vein dila-tion, blood flow, adverse outcomes, or patency rates(Tables 1 and 2). These articles comprised the basicsources for the purposes of this review. The other 16articles described or compared various regional blockapproaches for vascular access placement in terms ofonset, duration of action, and/or pharmacokinetics oflocal anesthetics. These articles exceeded the intendedscope of this review but were helpful sources forbackground information.

From the Department of Anesthesiology, Duke University Medi-cal Center, Duke University School of Medicine, Durham, NorthCarolina.

Accepted for publication April 3, 2009.Supported by Medical Student Anesthesia Research Fellowship,

Foundation for Anesthesia Education and Research.Address correspondence and reprint requests to Dr. Tong J. Gan,

Department of Anesthesiology, Duke University Medical Center,Box 3094, Durham, NC 27710. Address e-mail to [email protected].



Types of Vascular AccessA functional and mature access site is able to be

cannulated by two dialysis needles and achieve flow

rates more than 350 mL/min, usually beginning 3–4mo after placement. Early failure of a fistula occursbetween 1 wk and 1 mo after a surgical procedure to

Table 1. Studies Comparing Regional Anesthesia with Other Anesthetic Techniques in Vascular Access Surgery

Author Subjects and methods Main outcome(s) ResultsMouquet et al.12 36 AVF or AVG subjects receiving

BPB (n � 9), MAC (n � 9), ISO(n � 9), or HAL (n � 9)

Brachial artery blood flowand AVF blood flow(mL/min)

During anesthesia and in theimmediate postoperativeperiod, blood flow inthe BPB group wassignificantly greater thanthe HAL group. In the latepostoperative period,BPB and both generalanesthesia groups hadsignificantly higher bloodflow than MAC.

Shemesh et al.27 36 AVF or AVG subjects receivingBPB (n � 31) or GA (n � 5)

PI (measure ofsympathectomy), basilicvein diameter (mm)

As compared with GA, BPBcauses significant venousdilation and a significantlylower PI during and afterthe surgery.

Yildirim et al.32 50 AVF subjects receiving SGB �LA (n � 25) or LA (n � 25)

AVF blood flow (mL/min), peak radial arteryvelocity (cm/s),maturation time (d)

Use of a SGB resulted insignificantly higherpostoperative AVF bloodflow, significantly higheraverage peak velocity, andsignificantly lower meanmaturation time than LAalone.

Solomonson et al.26 469 AVF subjects receiving LA,GA, or BPB

Morbidity and mortality There was no significantassociation betweenanesthetic technique andany adverse outcome.

AVF � arteriovenous fistula; AVG � arteriovenous graft; BPB � brachial plexus block; MAC � monitored anesthesia care; ISO � isoflurane; HAL � halothane; PI � pulsatility index; GA �general anesthesia; SGB � stellate ganglion block; LA � local anesthesia.

Table 2. Studies Reporting the Effects of Regional Anesthesia on Outcomes in Vascular Access Surgery

Author Subjects and methods Results CommentsShemesh et al.8 157 AVF or AVG subjects

receiving a supraclavicularBPB

AVF: 57.3% of vascularaccesses placed

Description of successful algorithmdesigned to achieve DOQI goalsusing BPBs. AVFs have a lowearly failure rate and a highsecondary patency rate.

AVF immediate failure: 0%AVF early failure: 6.8%AVF 1 yr-assisted primary

patency rate: 81.8%AVF 18 mo secondary

patency rate: 98.6%Laskowski et al.31 26 AVF or AVG subjects

receiving an infraclavicularBPB

Average basilica and cephalicvein diameters significantlyincreased after BPB

Use of regional anesthesia can leadto improved site selection andincreased opportunity for AVFcreation because of significantvasodilation, without adverseeffects on patency.

30% of subjects hadmodification of originaloperative plan from AVGto AVF or from proximal todistal AVF site

No significant different inpatency rate between thegroup that maintained theoriginal operative plan andthe group with changes

Hingorani et al.19 34 AVF or AVG subjectsreceiving axillary, interscalene,and/or infraclavicular BPB

Venodilatation: post-BPBversus tourniquet:

Venodilatation with BPB isaugmented compared withtourniquet.Distal cephalic 42%

Midcephalic 19%Midbasilic 26%

AVF � arteriovenous fistula; AVG � arteriovenous graft; BPB � brachial plexus block; DOQI � Kidney Disease Outcomes Quality Initiative.


establish access. Primary patency is the interval fromaccess placement until any intervention to the inflowartery, venous outflow, or central veins designed tomaintain or reestablish functionality and maturation.Interventions can include angioplasty, vein ligation,thrombectomy or thrombolysis, or surgical revision.3,5–7

Two methods are currently used to connect anartery and vein to establish vascular access: an autog-enous AVF or a nonautogenous arteriovenous graftusing a prosthetic or biograft conduit. Arteriovenousgrafts were used more commonly because of their easeof placement, low early thrombosis rate, and shortinterval to cannulation. However, AVFs require fewerinterventional procedures, have better long-term pa-tency, and a lower rate of complications leading tofailure.2,8 Therefore, the Kidney Disease OutcomesQuality Initiative guidelines recommend the construc-tion of autogenous radiocephalic AVFs in the non-dominant upper extremity as the first option forpatients with ESRD.9,10*

Failure of AVFsAlthough they are the first choice for vascular

access, radiocephalic AVFs have a primary failurerange of 24%–35% because of thrombosis or inad-equate blood flow.11 After completion of the anasto-mosis, turbulent blood flow activates platelets andendothelial cells, which can result in thrombosis andreduction of fistula blood flow, usually in the 3–4 cmof the vein from the anastomosis.3,5 Primary AVFfailure rates may be affected by certain patient char-acteristics and surgical factors (Table 3).

During and after surgery, maintaining a high bloodflow helps to prevent thrombosis and failure in thepostoperative period.12 AVFs with flow rates morethan 160 mL/min after completion of the anastomosisand AVFs with flow rates more than 350 mL/min2 wk postprocedure have higher patency and matura-tion rates.5,6,13 Vessel size more than 0.4 cm alsoimproves maturation rates by allowing for decreasedresistance and increased blood flow.14 However, afterAVF construction, the vessel dilation created by nitricoxide and other vasodilators is limited by the wallshear stress produced by inflammation and intimalhyperplasia.15,16 Even a year after construction, theshear stress does not return to baseline.17

Anesthesia in Vascular Access SurgeryThree anesthetic techniques are commonly used for

vascular access surgery: monitored anesthesia care(MAC), regional anesthesia, and general anesthesia.MAC, which combines sedation with local anesthesia,is a simple, well-tolerated technique but can be diffi-cult to maintain for a long duration. It may requirerepeated injections, which entails additional pain and

sedation as well as an increased risk of intravascularinjection, potentially leading to central nervous sys-tem or cardiac toxicity.18–20 Furthermore, this methoddoes not offer motor block, and deleterious vasospasmis more common and severe with this technique.5,19

For prolonged or complex vascular access proce-dures, general anesthesia is commonly used. As com-pared with local anesthesia, this method does not failto provide adequate anesthesia and also increasesAVF blood flow.21 However, many patients requiringvascular access have severe comorbidities, includingcardiovascular disease, chronic lung disease, meta-bolic disease, neuropathy, and/or immunosuppres-sion, which can lead to changes in the patient’shemodynamics, stress response, and potential druginteractions during general anesthesia.5,19,20,22

Regional anesthesia may attenuate the side effectsof general anesthesia. For example, in patients under-going AVF placement, the use of a BPB bypasses thestress of induction and avoids the hemodynamic dis-turbances and systemic drug effects seen in generalanesthesia patients with severe comorbidities.21,23,24

BPB are more often used for AVF creation in diabetic,cardiac, and elderly patients than general anesthesiaor MAC.25 Regional anesthesia provides better post-operative analgesia and faster recovery from anes-thesia.19,26 –28 There are, however, risks with thistechnique, including unintentional damage to thesurrounding anatomy, neuropathy from nerve injury,hematoma, infection, and injection of local anestheticin vessels leading to central nervous system andcardiac toxicity.29 There also can be a longer latency

*NKF-F/DOQI Clinical Practice Guidelines for Vascular Access:Update 2000. National Kidney Foundation. Available at: www.kidney.org/professionals/kdoqi/guidelines_updates/doqi_uptoc.html#va. Accessed November 7, 2007.

Table 3. Factors That Increase Risk of AVF Failure

Factor SpecificsPatient

characteristicsAge �65 yr33

Female34,35

Tobacco use6,34

History of AVF (especiallyipsilateral)6,26,36

Dialysis36

Comorbidities Diabetes mellitus6,34,35

Peripheral vascular disease33

Coronary artery disease33

Hypertension6

Preoperative Cephalic vein diameter �2 mm6

Radial artery diameter �1.6 mm6

Surgical/intraoperative

Distal location35

Anastomosis: side-to-side � end-to-side,37 accomplishedby suture (versus clips/staples)16,34

Use of venous loops (versus clamps)36

No intraoperative heparin36

Limited surgical experience34,35

Postanastomosis blood flow�160 mL/min13

Postoperative AVF blood flow �350 mL/min5

Cephalic vein diameter �4 mm14

Lack of access surveillance34

Limited use of antiplatelet agentsand/or calcium channel blockers34

AVF � arteriovenous fistula.

978 Anesthesia for Vascular Access Surgery ANESTHESIA & ANALGESIA

between administration and anesthesia, and a smallfailure rate between 1% and 3% depending on theexperience of the anesthesiologist.5,21 The hyperdy-namic circulation in ESRD patients promotes absorp-tion of local anesthetics into the bloodstream, resultingin high plasma concentrations.30 However, despitehigh mepivacaine plasma concentrations after BPB in10 ESRD patients, there were no reports of serioussystemic toxicity.21

Influence of Regional Anesthetic Techniques onAVF Outcomes

Few studies have examined how the use of regionalanesthesia affects the construction of AVFs regardingvasodilation, blood flow, sympathetic block, and pa-tency (Table 1).

Vasodilation after regional block administration isseen in both the cephalic and basilic veins. In onestudy, compared with application of a tourniquet, useof a block increased venodilation by 42% in the distalcephalic vein, 19% in the midcephalic vein, and 26% inthe midbasilic vein.19 Significant basilic venous dila-tion was confirmed in a prospective study of 36patients, with more than 1.5 mm average dilationmeasured after regional block.27 These vasodilatoryproperties may assist with site selection. After admin-istration of a regional block and the resulting vasodi-lation, surgical plans were altered (i.e., graft to fistulaor proximal to more distal site) in 30% of patients withno change in patency rates.31

The vasodilatory properties of regional block mayhelp to maintain a high blood flow rate in the fistulaboth in the intraoperative and postoperative periods.Mouquet et al.12 measured and calculated fistulablood flow in four anesthetic groups: MAC, BPB,isoflurane, and halothane. After administration ofanesthesia, there was a significant increase in brachialartery blood flow in the BPB group because of vaso-dilatation, decreased forearm vascular resistance, andgreater blood velocity. The general anesthetic groupsalso had enhanced blood flow but only as a result ofimproved blood velocity. In the immediate postopera-tive period, the BPB subjects had significantly higherAVF blood flow than halothane and MAC subjects. Atpostoperative Days 3 and 10, all groups but the MACcohort had a high blood flow with decreased forearmvascular resistance. Overall, the blood flow increasedmost significantly and with minimal hemodynamicchanges in the BPB group as a result of its vasodilatoryeffect.12

Sympathetic block may have a direct effect on thevein to produce dilation. Alternatively, the sympa-thetic block may cause arterial dilation, which aug-ments venous return and consequently producesvenodilation.31 In one AVF study, the diminishedsympathetic tone generated by preemptive stellateganglion blockade improved arterial dilation and pre-vented radial artery spasm by lessening the reactivityof the arterial muscle that normally results from

surgical manipulation.32 Sympathectomy-like effectsof a BPB in AVF surgery were illustrated by Shemeshet al. by calculating the pulsatility index (PI) ratio, aratio of arterial resistances and blood flows that re-flects the magnitude of the sympathetic change. In theregional block subjects, PI decreased and remainedlow for 5 h after block administration, reflecting asympathectomy-like effect. In the general anesthesiapatients, the PI diminished after induction but in-creased immediately after the patients regained con-sciousness.27 A greater sympathectomy-like effect, incombination with enlarged vessel diameter and in-creased blood flow, may also enhance to the patencyof the fistula. The use of the preemptive stellateganglion blockade also resulted in increased averagefistula flow, greater average peak radial artery veloc-ity, and slower mean AVF maturation time.32 Addi-tionally, the combination of a tourniquet and a BPByielded AVFs that had low failure rates (0% immedi-ate failure and 6.8% failure within 1 mo) and highpatency rates (81.8% at 1 yr and 98.6% at 2 yr).8

CONCLUSIONSIt is evident that the successful creation and matu-

ration of AVFs is affected by a number of factors.Although preoperative planning and variations in thesurgical procedure might affect the success of theprocedure, additional factors in the perioperative pe-riod, including choice of anesthetic technique, mayaffect the physiologic response in the patient and thefistula. Use of regional blocks may likely improve thesuccess of vascular access procedures. They have beenshown to allow for significant vasodilatation, higherfistula blood flow, and sympathectomy-like effects.They have the potential to affect site and vesselselection for the AVF, as well as fistula maturation.However, without a large-scale, prospective, clinicaltrial, it still remains unclear whether the prevailinganesthetic techniques are associated with differentsurgical outcomes.

REFERENCES

1. Schulman G, Peale C, Himmelfarb J. Hemodialysis. In: BrennerBM, Rector FC, eds. Brenner & Rector’s the kidney. 8th ed.Philadelphia, PA: Saunders, 2008:1957–99

2. Tolkoff-Rubin N. Treatment of irreversible renal failure. In:Cecil RL, Goldman L, Ausiello DA, eds. Cecil textbook ofmedicine. 23nd ed. Philadelphia, PA: Saunders, 2008:936–40

3. Kian K, Vassalotti JA. The new arteriovenous fistula: the needfor earlier evaluation and intervention. Semin Dial 2005;18:3–7

4. Patel ST, Hughes J, Mills JL Sr. Failure of arteriovenous fistulamaturation: an unintended consequence of exceeding dialysisoutcome quality Initiative guidelines for hemodialysis access.J Vasc Surg 2003;38:439–45; discussion 45

5. Konner K, Nonnast-Daniel B, Ritz E. The arteriovenous fistula.J Am Soc Nephrol 2003;14:1669–80

6. Sidawy AN, Gray R, Besarab A, Henry M, Ascher E, Silva M Jr,Miller A, Scher L, Trerotola S, Gregory RT, Rutherford RB, KentKC. Recommended standards for reports dealing with arterio-venous hemodialysis accesses. J Vasc Surg 2002;35:603–10

7. Wolford HY, Hsu J, Rhodes JM, Shortell CK, Davies MG,Bakhru A, Illig KA. Outcome after autogenous brachial-basilicupper arm transpositions in the post-National Kidney FoundationDialysis Outcomes Quality Initiative era. J Vasc Surg 2005;42:951–6


8. Shemesh D, Zigelman C, Olsha O, Alberton J, Shapira J,Abramowitz H. Primary forearm arteriovenous fistula for he-modialysis access—an integrated approach to improve out-comes. Cardiovasc Surg 2003;11:35–41

9. Jindal K, Chan CT, Deziel C, Hirsch D, Soroka SD, Tonelli M,Culleton BF; Canadian Society of Nephrology Committee forClinical Practice Guidelines. Hemodialysis clinical practiceguidelines for the Canadian Society of Nephrology. J Am SocNephrol 2006;17:S1–27

10. Hemodialysis Adequacy 2006 Work Group. Clinical practiceguidelines for hemodialysis adequacy, update 2006. Am JKidney Dis 2006;48(suppl 1):S2–90

11. Rodriguez JA, Armadans L, Ferrer E, Olmos A, Codina S,Bartolome J, Borrellas J, Piera L. The function of permanentvascular access. Nephrol Dial Transplant 2000;15:402–8

12. Mouquet C, Bitker MO, Bailliart O, Rottembourg J, Clergue F,Montejo LS, Martineaud JP, Viars P. Anesthesia for creation of aforearm fistula in patients with endstage renal failure. Anesthe-siology 1989;70:909–14

13. Won T, Jang JW, Lee S, Han JJ, Park YS, Ahn JH. Effects ofintraoperative blood flow on the early patency of radiocephalicfistulas. Ann Vasc Surg 2000;14:468–72

14. Robbin ML, Chamberlain NE, Lockhart ME, Gallichio MH,Young CJ, Deierhoi MH, Allon M. Hemodialysis arteriovenousfistula maturity: US evaluation. Radiology 2002;225:59–64

15. Dixon BS. Why don’t fistulas mature? Kidney Int 2006;70:1413–22

16. Lin PH, Bush RL, Nguyen L, Guerrero MA, Chen C, LumsdenAB. Anastomotic strategies to improve hemodialysis accesspatency—a review. Vasc Endovascular Surg 2005;39:135–42

17. Dammers R, Tordoir JH, Kooman JP, Welten RJ, Hameleers JM,Kitslaar PJ, Hoeks AP. The effect of flow changes on the arterialsystem proximal to an arteriovenous fistula for hemodialysis.Ultrasound Med Biol 2005;31:1327–33

18. Strichartz GR, Berde CB. Local anesthetics. In: Miller RD,Fleisher LA, eds. Miller’s anesthesia. 6th ed. Philadelphia, PA:Elsevier Churchill Livingstone, 2005:573–99

19. Hingorani AP, Ascher E, Gupta P, Alam S, Marks N, SchutzerRW, Multyala M, Shiferson A, Yorkovich W, Jacob T, Salles-Cunha S. Regional anesthesia: preferred technique for venodi-latation in the creation of upper extremity arteriovenousfistulae. Vascular 2006;14:23– 6

20. Viscomi CM, Reese J, Rathmell JP. Medial and lateral antebrachialcutaneous nerve blocks: an easily learned regional anesthetic forforearm arteriovenous fistula surgery. Reg Anesth 1996;21:2–5

21. Rodriguez J, Quintela O, Lopez-Rivadulla M, Barcena M, Diz C,Alvarez J. High doses of mepivacaine for brachial plexus blockin patients with end-stage chronic renal failure. A pilot study.Eur J Anaesth 2001;18:171–6

22. Eldredge SJ, Sperry RJ, Johnson JO. Regional anesthesia forarteriovenous fistula creation in the forearm: a new approach.Anesthesiology 1992;77:1230–1

23. Weissman C. The metabolic response to stress: an overview andupdate. Anesthesiology 1990;73:308–27

24. Seltzer JL. Is regional anesthesia preferable to general anesthesiafor outpatient surgical procedures on an upper extremity? MayoClin Proc 1991;66:544–7

25. Alsalti RA, el-Dawlatly AA, al-Salman M, Jommaa S, Amro K,Dweiri MA, Jasser MT. Arteriovenous fistula in chronic renalfailure patients: comparison between three different anesthetictechniques. Middle East J Anesthesiol 1999;15:305–14

26. Solomonson MD, Johnson ME, Ilstrup D. Risk factors in patientshaving surgery to create an arteriovenous fistula. Anesth Analg1994;79:694–700

27. Shemesh D, Olsha O, Orkin D, Raveh D, Goldin I, ReichensteinY, Zigelman C. Sympathectomy-like effects of brachial plexusblock in arteriovenous access surgery. Ultrasound Med Biol2006;32:817–22

28. Leonard IE, Chinappa V. Vascular access procedures forhaemodialysis—potential hazard of regional anaesthesia. An-aesthesia 2001;56:917– 8

29. Wedel DJ, Horlocker TT Nerve blocks. In: Miller RD, FleisherLA, eds. Miller’s anesthesia. 6th ed. Philadelphia, PA: ElsevierChurchill Livingstone, 2005:1686–95

30. McEllistrem RF, Schell J, O’Malley K, O’Toole D, CunninghamAJ. Interscalene brachial plexus blockade with lidocaine inchronic renal failure—a pharmacokinetic study. Can J Anaesth1989;36:59–63

31. Laskowski IA, Muhs B, Rockman CR, Adelman MA, Ranson M,Cayne NS, Leivent JA, Maldonado TS. Regional nerve blockallows for optimization of planning in the creation of arterio-venous access for hemodialysis by improving superficial ve-nous dilatation. Ann Vasc Surg 2007;21:730–3

32. Yildirim V, Doganci S, Yanarates O, Saglam M, Kuralay E, CosarA, Erdal Guzeldemi M. Does preemptive stellate ganglionblockage increase the patency of radiocephalic arteriovenousfistula? Scand Cardiovasc J 2006;40:380–4

33. Lok CE, Allon M, Moist L, Oliver MJ, Shah H, Zimmerman D.Risk equation determining unsuccessful cannulation events andfailure to maturation in arteriovenous fistulas (REDUCE FTM I).J Am Soc Nephrol 2006;17:3204–12

34. Gibbons CP. Primary vascular access. Eur J Vasc Endovasc Surg2006;31:523–9

35. Ernandez T, Saudan P, Berney T, Merminod T, BednarkiewiczM, Martin PY. Risk factors for early failure of native arterio-venous fistulas. Nephron Clin Pract 2005;101:c39–44

36. Feldman HI, Joffe M, Rosas SE, Burns JE, Knauss J, Brayman K.Predictors of successful arteriovenous fistula maturation. Am JKidney Dis 2003;42:1000–12

37. Miller PE, Tolwani A, Luscy CP, Deierhoi MH, Bailey R, ReddenDT, Allon M. Predictors of adequacy of arteriovenous fistulas inhemodialysis patients. Kidney Int 1999;56:275–80

980 Anesthesia for Vascular Access Surgery ANESTHESIA & ANALGESIA

An Anatomical Study of the Transversus Abdominis PlaneBlock: Location of the Lumbar Triangle of Petitand Adjacent Nerves

Zorica B. Jankovic, MD, PhD*

Frances M. du Feu†

Patricia McConnell, BSc, PhD†

BACKGROUND: The transversus abdominis plane (TAP) block is a new technique forproviding analgesia to the anterior abdominal wall. Most previous studies haveused the lumbar triangle of Petit as a landmark for the block. In this cadavericstudy, we determined the exact position and size of the lumbar triangle of Petit andidentified the nerves affected by the TAP block.METHODS: The position of the lumbar triangle of Petit was assessed unilaterally in 26cadaveric specimens relative to reliably palpable surface landmarks. In addition, aseries of dissections were performed to explore the course of the nerves blocked bythe TAP.RESULTS: The mean distance from the midaxillary line along the iliac crest to thecenter of the base of the lumbar triangle of Petit at the level of the subcutaneoustissue and over the skin surface was 6.9 cm (range, 4.5–9.2 cm) and 9.3 cm (range,4–15.1 cm), respectively. The center of the lumbar triangle of Petit was 1.4 cm abovethe iliac crest. The depth of the TAP at the lumbar triangle of Petit position was0.5–4 cm and at the midaxillary line it was 0.5–2 cm. The average size of thelumbar triangle of Petit was 2.3 cm � 3.3 cm � 2.2 cm, with an average area of3.63 � 1.93 cm2. The three cadaveric specimens we explored showed the nervesblocked by TAP passed lateral to the triangle. An incidental finding was that in66% of specimens the lumbar triangle of Petit contained small branches of thesubcostal artery.CONCLUSIONS: The lumbar triangles of Petit found in the specimens in this studywere more posterior than the literature suggests. The position of the lumbartriangle of Petit varies largely and the size is relatively small. The relevant nervesto be blocked had not entered the TAP in the specimens in this study at the pointof the lumbar triangle of Petit. At the midaxillary line, however, all the nerves werein the TAP.(Anesth Analg 2009;109:981–5)

The transversus abdominis plane (TAP) is an ana-tomical space between the internal oblique and thetransversus abdominis muscle and spans the abdo-men wherever these two muscles exist. The TAP blockis a new, rapidly expanding regional anesthesia tech-nique that involves a single large bolus injection oflocal anesthetic into this anatomical compartment tosaturate somatic afferents before they leave the TAP tosupply the anterior abdominal wall from T8 to L1dermatomes.1 Initially, the TAP block was describedas easy to perform and without major complications.1

However, with increasing use, different techniques

emerged, serious complications occurred, and highfailure rates were reported.2–5

The lumbar triangle of Petit is an anatomical area thatin theory provides a reliable reference point for insertingthe needle into the TAP compartment.6–8 The triangle isformed posteriorly by the lateral border of the latissimusdorsi muscle and anteriorly by the posterior free borderof the external oblique muscle, with the iliac crest as thebase. The floor of the triangle from superficial to deep isformed by subcutaneous tissue, internal oblique muscle,and transversus abdominis muscle, respectively.9 How-ever, the precise location of the lumbar triangle of Petitremains controversial.

This study defined the exact position and size of thetriangle relative to palpable surface landmarks. Inaddition, a series of dissections were explored to showthe course of the nerves that would be affected by theTAP block.

METHODSTwenty-six cadaveric specimens (14 women and 12

men), age 72–102 years and mean height 161.8 � 9.9

From the *Department of Anaesthesia, St James’s UniversityHospital, Leeds, UK; and †Institute of Membrane and SystemsBiology, University of Leeds, Leeds, UK.

Accepted for publication April 3, 2009.Address correspondence and reprint requests to Dr. Zorica B.

Jankovic, Department of Anaesthesia, Lincoln Wing, St James’sUniversity Hospital, Beckett St., Leeds LS9 7TF, UK. Address e-mailto [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181ae0989


cm, were dissected. The cadavers were preservedusing 75 L of embalming fluid (consisting of 756 mLindustrial methyl, 125 mL phenol, 40 mL formalde-hyde, 22 mL glycerol, and 57 mL water per liter offluid) introduced into the common carotid artery bygravity feed and were then refrigerated for at least 4wk. All cadavers were in the prone position for thequantitative study and in the supine position for thequalitative study.

Quantitative StudyTo measure the precise position of the lumbar

triangle of Petit, pins were inserted at the anteriorsuperior iliac spine, the posterior superior iliac spine,the midaxillary point at the iliac crest, and at theangles of the lumbar triangle of Petit as shown inFigure 1. A flexible tape measure was used to measurethe distances between the points to the nearest milli-meter. The measurements taken from the lumbartriangle of Petit position are as follows.

1. Distance from the midaxillary point at iliac crestto the lateral base of the lumbar triangle of Petit.

2. Base of the lumbar triangle of Petit.3. Lateral side of the lumbar triangle of Petit (the

posterior attachment of external oblique muscleto the iliac crest).

4. Medial side of the lumbar triangle of Petit (theanterior attachment of latissimus dorsi to theiliac crest).

5. Medial base of the lumbar triangle of Petit toposterior superior iliac spine.

6. Anterior superior iliac spine to posterior supe-rior iliac spine along the iliac crest.

In 24 of the specimens, the superficial position ofthe triangle was also measured from the outside of theskin and subcutaneous tissue and from the midaxil-lary line to the middle of the lumbar triangle of Petitbase along the iliac crest.

We calculated the distance between the midaxillaryline and the middle of the lumbar triangle of Petitbase along the iliac crest by adding half the length ofthe lumbar triangle of Petit base to the distancebetween the midaxillary line at the level of the iliaccrest and the lateral base of the lumbar triangle ofPetit. We calculated the height of the lumbar tri-angle of Petit triangle corresponding to its base forall cadavers (Fig. 2).

Qualitative StudySpecimens 1, 2, and 3, women aged 97, 92, and 83

years, respectively, were dissected to examine theposition of the lumbar triangle of Petit in relation tothe iliohypogastric and ilioinguinal nerves.

Statistical TestsA paired t-test was used to determine whether

there was any significant difference in the position of

Figure 1. Specimen 1: Identification of the lumbar triangle of Petit (relative to bony landmarks). (S � superior; I � inferior; L �lateral; M � media). 1: midaxillary point at the iliac crest to the lateral base of the lumbar triangle of Petit; 2: base of the lumbartriangle of Petit; 3: lateral side of the lumbar triangle of Petit (the posterior attachment of the external oblique to the iliac crest); 4:medial side of the lumbar triangle of Petit (the anterior attachment of the latissimus dorsi muscle to the iliac crest); 5: medial baseof the lumbar triangle of Petit; 6: anterior superior iliac spine to posterior superior iliac spine along the iliac crest.

982 Anatomy of Lumbar Triangle of Petit ANESTHESIA & ANALGESIA

the lumbar triangle of Petit between male and femalecadavers.

RESULTSQuantitative Results

There were no significant differences in any mea-sured variables between male and female cadavers(Table 1). A wide variation in the distance from themidaxillary line at the iliac crest to the center of thebase of the lumbar triangle of Petit was found bothdeep to the subcutaneous tissue (mean, 6.9 cm; range,4.5–9.2 cm) and over the skin surface (mean, 9.3 cm;range, 4–15.1 cm).

The center of the lumbar triangle of Petit was amean of 1.1 cm (range, 0.2–3.6 cm) above the iliac crestat the subcutaneous level and 1.4 cm (0.3–4.5 cm) atthe skin surface level. The depth of the TAP at thelumbar triangle of Petit position was 0.5–4 cm and atthe midaxillary line it was 0.5–2 cm.

The surface position and dimensions of the mostanterior lumbar triangle of Petit found in this study(Specimen 3) were drawn onto a live subject (Fig. 3).The iliac crest was drawn onto the surface, anteriorsuperior iliac crest to posterior superior iliac crest, andthe midaxillary point on the iliac crest was markedand used to show the lumbar triangle of Petit 4 cmposterior to the midaxillary line.

The lumbar triangle of Petit measurements pre-sented in Table 1 were used to produce a diagram oflumbar triangle of Petit shapes and sizes found in thecadavers (Fig. 4). The mean size of the lumbar triangleof Petit was 2.3 cm at the base, 3.3 cm at the lateral

Figure 2. Diagram of lumbar tri-angle of Petit depicting landmarks.

Figure 3. Position of the most anterior lumbar triangle ofPetit (Specimen 3) (2.5 cm posterior to the midaxillary line)shown in a lateral view marked on the surface of the skin.

Table 1. Lumbar Triangle of Petit: Measurementsin 26 Cadavers

Range(cm)

Mean(cm)

Standarddeviation

(cm)Midaxillary to lateral base

of lumbar triangle ofPetit (n � 26)

2.5–9.0 5.8 1.56

Base of lumbar triangle ofPetit (n � 26)

1.2–4.5 2.3 1.03

Lateral side of lumbartriangle of Petit (n � 26)

1.7–7.5 3.3 1.36

Medial side of lumbartriangle of Petit (n � 26)

0.8–7.5 2.2 1.38

Medial base of lumbartriangle of Petit toposterior superior iliacspine (n � 26)

6.8–13.5 9.7 1.96

Anterior superior iliacspine to posteriorsuperior iliac spinealong iliac crest (n � 26)

20.0–30.0 25.2 2.8

Superficial position oflumbar triangle of Petit

Midaxillary line tomiddle of the triangleat the base of thetriangle (n � 24)

4.0–15.1 9.3 2.46


side, and 2.2 cm at the medial side. The average area ofthe triangle was 3.63 � 1.93 cm2.

Qualitative ResultsThe iliohypogastric, subcostal, and intercostals

nerves had a constant course in the TAP in relation tothe midaxillary line in the three cadavers studied (Fig.5). At this point, the nerves have not yet branchedextensively. In Part A of Figure 6, the first lumbarnerve (in purple) branches into the iliohypogastric(blue) and ilioinguinal (pink) nerves, whereas in PartB of Figure 6, the first lumbar nerve is already dividedas it exits the psoas major compartment. In all threedissections, the nerve branches do not enter the TAPuntil lateral to the lumbar triangle of Petit. An inci-dental finding was that in 16 of 24 specimens thelumbar triangle of Petit contained small blood vesselbranches of the subcostal artery.

DISCUSSIONThe TAP block technique was developed recently as a

result of the clinical need for a simple and efficientanalgesic technique for abdominal procedures, includinginguinal hernia repair, hysterectomy, cesarean delivery,colectomy, and suprapubic prostatectomy.6,8–10

Lumbar triangle of Petit has been used as a land-mark for TAP block in many studies because the TAPis directly accessible through the lumbar triangle ofPetit. This study found the center of the lumbartriangle of Petit to be an average of 6.9 cm (4.5–9.2 cm)posterior to the midaxillary point at the iliac crest and9.3 cm (4–15.1 cm) posterior to the midaxillary linewhen skin surface position is measured, which isconsiderably more posterior than is suggested by theliterature.1,6 The center of the lumbar triangle of Petitis 1.4 cm above the iliac crest at skin level. Because oftissue shrinkage in the cadavers, this distance could beeven longer in the patient population.

The location of the lumbar triangle of Petit inpatients has been identified differently in several

Figure 4. Comparison of sizes and shapes of the lumbartriangle of Petit and the distance of each posterior to themidaxillary line.

Figure 5. Lateral view of the nerves in the left transversusabdominis plane (TAP). The internal oblique muscle hasbeen reflected to show the transversus abdominis muscleand nerves in the TAP. The intercostal nerves (T9, T10, andT11) are shown in yellow, the subcostal nerve (T12) is shownin green, and the iliohypogastric nerve is shown in blue.

Figure 6. (A). Position of the lumbartriangle of Petit relative to the first lum-bar nerve (purple), the iliohypogastricnerve (blue), and the ilioinguinal nerve(pink) as they enter the transversus ab-dominis plane (TAP) lateral to the lum-bar triangle of Petit; the angles of thetriangle are indicated by the blue pins.(S: superior; I: inferior; L: lateral; M:medial.) (B) Specimen 2 (supine). Thefirst lumbar nerve has branched beforeexiting the psoas major compartment;the ilioinguinal and iliohypogastric nervesare shown entering the TAP at the lateraledge of the lumbar triangle of Petit.

984 Anatomy of Lumbar Triangle of Petit ANESTHESIA & ANALGESIA

clinical studies using the lumbar triangle of Petit as alandmark for TAP block. Rafi2 states that the point ofneedle insertion should be at the dip of the lateralborder of the latissimus dorsi muscle along the iliaccrest. Rafi found this position to be close to themidaxillary line at the level of the L3–4 intervertebralspace. McDonnell et al.1 located the lumbar triangle ofPetit by palpating the iliac crest from anterior toposterior until the latissimus dorsi muscle was felt andthe lumbar triangle of Petit was taken to be justanterior. However, Petit lumbar hernias are describedto be medial to a vertical line between the end of the12th rib and the iliac crest.11 It is possible that the greatvariability in the distance from the midaxillary line tothe center of the lumbar triangle of Petit found in thisstudy (4–15.1 cm along iliac crest and 1.4 cm aboveiliac crest) can explain the difficulty in determining thelumbar triangle of Petit position. The depth of TAP atthe position of the lumbar triangle of Petit was be-tween 0.5 and 4.0 cm, dependent on adipose tissue.When performing the block, the variation in depthneeded to reach the TAP should be considered.

The iliohypogastric, subcostal, and intercostalsnerves had a constant course in the TAP in relation tothe midaxillary line in the three cadavers studied. Atthis point, the nerves have not yet branched exten-sively, as has been confirmed in a recent study byRozen et al.12 The iliohypogastric nerves were not inthe TAP at the lumbar triangle of Petit. However,lumbar triangle of Petit is an access point for injectinglocal anesthetic into the compartment and thereforethe iliohypogastric nerve should be effectively blockedby TAP block. The optimal volume of local anestheticcannot be inferred from this study.

In more than half of the specimens, the lumbartriangle of Petit contained small vessels entering theTAP. The other blood vessels (the subcostal artery andthe ascending branch of the deep circumflex iliacartery) in the area were found to be along the iliaccrest in the TAP.

As shown in Figure 4, the lumbar triangles of Petitin this study vary in angle, shape, and size amongindividuals, making identification of the lumbar tri-angle of Petit difficult. The average size of the lumbartriangle of Petit is relatively small, and the presence ofadipose tissue makes lumbar triangle of Petit identifi-cation even more difficult. Thus, the lumbar triangle

of Petit is a misleading landmark for anterior abdomi-nal wall anesthesia. These results presented here arefrom adult cadavers and the conclusions drawn fromthis study should not be applied to children.

In conclusion, the lumbar triangle of Petit is moreposterior than the literature suggests. The lumbartriangle of Petit varies greatly in its position and itssize is relatively small; the presence of adipose tissuesignificantly changes the position. As a result, it isdifficult to find the lumbar triangle of Petit solely onpalpation. The posterior position of the lumbar tri-angle of Petit would make the TAP block less conve-nient to perform on supine patients.

REFERENCES

1. McDonnell JG, O’Donnell BD, Farrell T, Gough N, Tuite D,Power C, Laffey JG. Transversus abdominis plane block: acadaveric and radiological evaluation. Reg Anesth Pain Med2007;32:399–404

2. Rafi AN. Abdominal field block: a new approach via the lumbartriangle [Correspondence]. Anaesthesia 2001;56:1024–6

3. McDonnell JG, O’Donnell BD, Curley G, Heffernan A, Power C,Laffey JG. The analgesic efficacy of TAP block after abdominalsurgery: a prospective randomised controlled trial. Anesth Analg2007;104:193–7

4. Farooq M, Carey M. A case of liver trauma with a blunt regionalanesthesia needle while performing transversus abdominisplane block. Reg Anesth Pain Med 2008;33:274–5

5. Jankovic Z, Ahmad N, Ravishankar N, Archer F. Transversusabdominis plane block: how safe is it? Anesth Analg 2008;107:1758–9

6. Kuppuvelumani P, Jaradi H, Delilkan A. Abdominal nerveblockade for postoperative analgesia after caesarean section.Asia Oceania J Obstet Gynaecol 1993;19:165–9

7. McDonnell JG, Curley G, Carney J, Benton A, Costello J,Maharaj CH, Laffey JG. The analgesic efficacy of transversusabdominis plane block after cesarean delivery: a randomisedcontrolled trial. Anesth Analg 2008;106:186–91

8. Carney JJ, McDonnell JG, Bhinder R, Maharaj CH, Laffey JG.Efficacy of transversus abdominis plane block using ropivacainein multimodal postoperative pain relief in total abdominalhysterectomy surgery. Reg Anesth Pain Med 2007;32:137

9. O’Donnell BD: The transversus abdominis plane (TAP) block inopen retropubic prostatectomy [Letter to the Editor]. RegAnesth Pain Med 2006;31:91

10. Carney JJ, McDonnell JG, Bhinder R, Maharaj CH, Laffey JG.Ultrasound guided continuous transversus abdominis planeblock for postoperative pain relief in abdominal surgery. RegAnesth Pain Med 2007;32:24

11. Bhasin SK, Khan AB, Sharma S. Bilateral Petit’s triangle hernia.J Med Educ 2006;8:163–4

12. Rozen WM, Tran TMN, Ashton MW, Barrington MJ, Ivanusic JJ,Taylor GI. Refining the course of the thoracolumbar nerves: anew understanding of the innervation of the anterior abdominalwall. Clin Anat 2008;21:325–33


Brief Report

Unilateral Anesthesia Does Not Affect the Incidence ofUrinary Retention After Low-Dose Spinal Anesthesia forKnee Surgery

Wolfgang G. Voelckel, MD*†

Lukas Kirchmair, MD*

Peter Rehder, MD‡

Ivo Garoscio, MD§

Dietmar Krappinger, MD�

Thomas J. Luger, MD*

We evaluated whether unilateral low-dose spinal anesthesia may reduce thelikelihood of postoperative urinary retention. Forty patients scheduled for kneearthroscopy randomly received bilateral (n � 20) or unilateral (n � 20) spinalanesthesia with 6-mg hyperbaric bupivacaine 0.5%. The incidence of urinaryretention (�500 mL) assessed with an ultrasound device (Bladderscan) andsubsequent temporary catherization was 7/20 patients in the bilateral versus 6/20in the unilateral group (not significant). We concluded that unilateral low-dosespinal anesthesia does not further decrease the likelihood of urinary retention. Ourresults demonstrate the value and necessity of monitoring bladder volumepostoperatively.(Anesth Analg 2009;109:986–7)

Postoperative urinary retention and bladder over-distention may cause permanent detrusor damage,1

thus leading to persistent bladder dysfunction. Recog-nized risk factors for postoperative bladder distensionare age �60 yr, duration of surgery (�120 min), andspinal anesthesia.2 Excessive perioperative IV fluidsand adrenergic medication needed for hemodynamicstabilization may further increase the incidence andseverity of urinary retention.3 Low dose plain orhyperbaric 0.5% bupivacaine has been associated withminimal hemodynamic changes and decreases theduration of spinal anesthesia.4 Theoretically, unilat-eral spinal blockade will only partially affect bladderinnervation thus allowing spontaneous voiding. Inprevious studies, the likelihood of urinary retentionranged between 0% and 2% after low-dose unilateralspinal anesthesia but bladder volume was not as-sessed.4,5 This study compared the incidence of uri-nary retention (�500 mL), monitored with a portableultrasound device, in patients after a bilateral spinalanesthesia versus patients maintained in a lateral

decubitus position for 20 min after injection of 6-mghyperbaric 0.5% bupivacaine.

METHODSWith approval of the Ethics Committee, 40 ASA

Class I patients scheduled for elective knee arthros-copy in spinal anesthesia were enrolled with thestudy. Informed consent was obtained and patientswere monitored with electrocardiogram, noninvasivearterial blood pressure, and pulse oximetry. If baselinebladder volume assessed with an ultrasound scanner(Bladderscan, Diagnostic Ultrasound, Bladderscan�BVI 3000, Verathon Inc., Bothell, WA) exceeded 100mL, patients were prompted to void. IV infusion of7 mL � kg�1 � h�1 Ringer’s lactate solution was startedand maintained until the end of surgery, followed byan additional 4 mL � kg�1 � h�1 postoperatively. Thepatients were placed in lateral decubitus position withthe operative limb to be operated in the dependentposition. Dural puncture was performed at the L3–4interspace with a 25-gauge pencil point needle (Por-tex, Germany). Immediately after successful puncture,patients were assigned according to computerizedrandom list to the bilateral or unilateral group. Forbilateral anesthesia, 6-mg hyperbaric 0.5% bupiva-caine was injected with the needle bevel craniallydirected, and the patients were immediately turned inthe supine position. In the unilateral spinal anesthesiagroup, the needle orifice was directed toward thedependent side and 6-mg hyperbaric 0.5% bupiva-caine was slowly injected within 30 s; lateral decubitusposition was subsequently maintained for 20 min. Themotor blockade was evaluated using a modified Bro-mage scale (0 � no motor block; 3 � unable to movelimb). Urinary volume was assessed by bladder scan

From the *Department of Anesthesiology and Critical CareMedicine, Medical University, Innsbruck; †Department of Anesthe-siology and Critical Care Medicine, AUVA Trauma Center, Salzburg;‡Department of Neuro-Urology, Medical University, Innsbruck,Austria; §Department of Anesthesiology and Critical Care Medi-cine, Klinikum Amberg, Germany; and �Department for TraumaSurgery and Sports Medicine, Medical University, Innsbruck,Austria.

Accepted for publication April 17, 2009.Reprints will not be available from the author.Address correspondence to Wolfgang Voelckel, MSc, DEAA,

Department of Anesthesiology and Critical Care Medicine, AUVATrauma Center Salzburg, Dr. Franz-Rehrl-Platz 5, 5020 Salzburg,Austria. Address e-mail to [email protected].

Copyright © 2009 International Anesthesia Research SocietyDOI: 10.1213/ane.0b013e3181af406e


at the end of surgery and every 60 min thereafter untilthe patient was able to void spontaneously or until theurinary bladder volume exceeded 500 mL. In the lattersituation, the patient was prompted to void. If thepatient failed to do so, urinary catherization wasperformed to empty the bladder. SPSS 15.0 (SPSS,Chicago, IL) was used for statistical analysis. Forindependent samples, a t-test or a nonparametricMann–Whitney test was performed. The Kolmogorov-Smirnov test was used for determination of the distri-bution form. For the analysis of categorical data, aFisher’s exact test was performed. The probabilitylevel was set at P � 0.05.

RESULTSNo differences in the demographic variables, dura-

tion of surgery, and fluid volume infused were ob-served between the groups (Table 1). The maximumsensory level on the operated side was T9 in thebilateral group versus T10 in the unilateral group. Inthe unilateral group, four patients had a sensory level(impaired discrimination of temperature) of L1 and aBromage score between 1 and 2 on the contralateralside. Incidence of urinary retention and subsequenttemporary catheterization was 35% in the bilateralversus 30% in the unilateral group (P � 0.05). Abladder volume �300 mL was assessed in 4/7 patientsin the bilateral and 5/6 patients in the unilateral groupimmediately at the end of surgery. None of thesepatients was able to void spontaneously, and a tem-porary catheter had to be inserted when the urinarybladder volume exceeded 500 mL. In the unilateralgroup, occurrence of a partial motor block was notassociated with urinary retention. The mean � sd time(h:min) until patients were able to void spontaneouslywas not statistically different in the bilateral versusunilateral group (4:16 � 1:13 vs 3:36 � 1:07) as was thetime of complete neurologic recovery defined as thetime until ambulation in both groups (3:41 � 1:04 vs3:21 � 0:52).

DISCUSSIONThe observed incidence of postoperative urinary re-

tention and subsequent catheterization was approxi-mately 30% after both low-dose bilateral and unilateral

spinal anesthesia. The incidence of bladder overdis-tention was not decreased by maintaining the patientsin a lateral decubitus position for 20 min after injec-tion. In addition, the time until complete recoveryfrom spinal anesthesia defined as unimpeded ambu-lation and mean time until spontaneous voiding didnot differ significantly. However, one major finding ofour study was the observation that a bladder volume�300 mL immediately after surgery was a strongindicator for postoperative urinary retention. Ourresults demonstrate that even when unilateral spinalanesthesia is achieved, bladder innervation will becompromised and consequently, strict monitoring ofthe bladder volume is important. A lower incidence ofurinary retention in previous studies4,5 may be simplyexplained by the fact that an ultrasound was not used.

Postoperative urinary retention is a significant prob-lem,6 and repeated assessment of the bladder volumewith an ultrasound device has been shown to beaccurate and effective in detecting bladder overdisten-sion.2,7 When a bladder scan is used, routine catheter-ization after low-dose spinal anesthesia for minorknee surgery is not warranted5,8 but close monitoringis mandatory in all patients.9

In conclusion, even unilateral low-dose spinal an-esthesia does not prevent the risk of postoperativeurinary retention. Our results suggest the standard-ized use of a portable ultrasound device to evaluatebladder volume in patients at risk of urinary retention.

REFERENCES

1. Tammela T, Kontturi M, Lukkarinen O. Postoperative urinaryretention. II. Micturition problems after the first catheterization.Scand J Urol Nephrol 1986;20:257–60

2. Lamonerie L, Marret E, Deleuze A, Lembert N, Dupont M,Bonnet F. Prevalence of post-operative bladder distension andurinary retention detected by ultrasound measurement. Br JAnaesth 2004;92:544–6

3. Rosseland LA, Stubhaug A, Breivik H. Detecting postoperativeurinary retention with an ultrasound scanner. Acta AnaesthesiolScand 2002;46:279–82

4. Fanelli G, Borghi B, Casati A, Bertini L, Montebugnoli M, Torri G.Unilateral bupivacaine spinal anesthesia for outpatient kneearthroscopy. Italian Study Group on Unilateral Spinal Anesthe-sia. Can J Anaesth 2000;47:746–51

5. Esmaoglu A, Karaoglu S, Mizrak A, Boyaci A. Bilateral vs.unilateral spinal anesthesia for outpatient knee arthroscopies.Knee Surg Sports Traumatol Arthrosc 2004;12:155–8

6. Pappalardo GB, Aranzulla F, Di Santo S, Barrera A, Beltrutti D.Complications of super-selective subarachnoid anesthesia (SSA)with hyperbaric bupivacaine: experiences with 355 patients ingeneral and orthopaedic surgery. Panminerva Med 1997;39:41–5

7. Rosseland LA, Stubhaug A, Breivik H, Medby PC, Larsen HH.[Postoperative urinary retention]. Tidsskr Nor Laegeforen2002;122:902–4

8. Ng KO, Tsou MY, Chao YH, Mui WC, Chow LH, Chan KH.Urinary catheterization may not be necessary in minor surgeryunder spinal anesthesia with long-acting local anesthetics. ActaAnaesthesiol Taiwan 2006;44:199–204

9. Luger TJ, Garoscio I, Rehder P, Oberladstatter J, Voelckel W.Management of temporary urinary retention after arthroscopicknee surgery in low-dose spinal anesthesia: development of asimple algorithm. Arch Orthop Trauma Surg 2008;128:607–12

Table 1. Demographic Data of Patients Receiving UnilateralVersus Bilateral Low-Dose Spinal Anesthesia

Unilateralgroup

N � 20

Bilateralgroup

N � 20Age (yr) 54.5 � 11.5 56.5 � 16.5Body mass index (kg/m2) 27.2 � 4.8 29 � 4.2Gender (M/F) 11/9 13/7Duration of surgery (min) 27 � 9 29 � 8Volume infused (mL)

Until end of surgery 622 � 160 655 � 165Until 60 min postoperatively 950 � 280 980 � 300

There were no significant differences between the groups.


Letters to the Editor

Airway Topical Anesthesia

To the Editor:Although we appreciate the ref-

erence to our recent article describ-ing topical anesthesia to the airwayin morbidly obese patients using2% vs 4% lidocaine administeredvia an atomizer,1 we believe thatXue et al.2 have misrepresented ourfindings. Contrary to their asser-tion, excellent intubating conditionswere achieved in the majority ofour cases. The gagging observedwas mild in all but one instance(1/27). Although Xue et al. con-clude that they achieved superiorintubating conditions comparedwith those in our study, they none-theless report a 61.5%–73.1% inci-dence of grimacing and coughingduring intubation. We, however,observed mild gagging during intu-bation in 42% and 18% of patientsreceiving 2% and 4% lidocaine, re-spectively. This being said, it isdifficult to compare intubating con-ditions in the two studies becauseof differences in the degree of airwaymanipulation during applicationof the topical anesthetic and intu-bation, patient populations stud-ied, and in the grading systemsthat were employed. Given thesecaveats, it is difficult to supporttheir conclusion that the “spray-as-you-go-technique” offers superior in-tubating conditions compared withour technique using an atomizer.

We agree that the lidocaine pla-sma concentrations are lower withthe spray-as-you-go-technique, butthis advantage is achieved at the ex-pense of a considerably longer timerequired for topical airway anesthesia(approximately 23 min compared with4.5 min). This may be unacceptable incertain critical situations.

We have successfully used theatomizer technique to achieve topi-cal airway anesthesia for awakefiberoptic intubation in hundredsof cases and have invariably foundthis to be rapid, effective, andsafe. The technique described by

Xue et al.2 is another strategy toachieve a similar end, and, in fact,may be combined with the atom-izer technique.

Paul M. Wieczorek, MDCM

Steven B. Backman, MDCM, PhDDepartment of Anesthesia

McGill UniversityMontreal, Quebec, [email protected]

REFERENCES

1. Wieczorek PM, Schricker T, Vinet B,Backman SB. Airway topicalisation inmorbidly obese patients using atomizedlidocaine: 2% compared with 4%. Anaes-thesia 2007;62:984–8

2. Xue FS, Liu HP, He N, Xu YC, Yang QY,Liao X, Xu XZ, Guo XL, Zhang YM.Spray-as-you-go airway topical anesthe-sia in patients with a difficult airway: arandomized, double blind comparison of2% and 4% lidocaine. Anesth Analg 2009;108:536–43

DOI: 10.1213/ane.0b013e3181add3b0

In Response:We agree with Wieczorek et al.1

that the comparison of the intubat-ing conditions between our andtheir studies is difficult because ofdifferences in the study subjects,observed methods, and airway ma-nipulation during application of thetopical anesthetic and intubation.2,3

In our study, 61%–73% of patientsdid display grimacing and cough-ing responses during awake fiber-optic orotracheal intubation, butmost of these responses were slightand did not significantly impedefiberscopy or tracheal intubation.Our results also showed that therange of patient reaction andcoughing scores were only 1.9–2.0and 1.7–1.9, respectively. Accord-ing to evaluation criteria of trachealintubating conditions used in ourstudy, excellent and acceptable in-tubating conditions were obtainedin 27% and 73% of patients, respec-tively, in the 2% lidocaine groupand 35% and 65% of patients, re-spectively, in the 4% lidocaine gr-oup. Therefore, we concluded thatunder adequate sedation with fen-tanyl and midazolam, both 2% and4% lidocaine administered to the

airway by a spray-as-you-go tech-nique can provide clinically ac-ceptable (not excellent) intubatingconditions for awake fiberoptic oro-tracheal intubation.2

One main disadvantage of thistechnique is that it is time-consumingbecause it requires repeated lido-caine spraying of the different tar-geted areas. Because the primaryaims of our study were to comparesafety and efficacy of 2% and 4%lidocaine during airway topical anes-thesia with a spray-as-you-go tech-nique, we allowed a 3–5-min waitingperiod after each lidocaine spray toprovide adequate penetration of localanesthetic into the airway mucosa formaximal effect.4 Therefore, our pro-tocol required 21–24 min from thefirst application of lidocaine to intu-bation of the trachea.

One major advantage of the tech-nique of Wieczorek et al. using atom-ized lidocaine is the rapidity withwhich the airway can be anesthe-tized.3 However, although they havesuccessfully used this technique toachieve airway anesthesia for awakefiberoptic intubation in hundreds ofcases, we remain concerned that therelatively large doses of lidocaine(800–1600 mg) administered over ashort time (5 min) may increase therisk of local anesthetic toxicity.

Practically speaking, to imp-rove effectiveness of topical air-way anesthesia, a combination ofvarious methods (e.g., applying agel or ointment, gargling a viscoussolution, depositing local anes-thetic droplets via anatomizer ornebulizer, utilizing a transtrachealinjection, or direct deposit of alocal anesthetic to the airway withthe spray-as-you-go technique througha fiberoptic bronchoscope) is oftenrequired.5–8 Overall, providing topi-cal anesthesia to the nasal and/ororal mucosa in combination with amethod to anesthetize the laryngeal/tracheal structures is the most ef-fective and the most commonlychosen plan. Because patient safety isalways of paramount importance


Section Editor: Lawrence Saidman

in management of difficult airwayand each case is different, theanesthesiologist must weigh therisks and benefits of all the meth-odologies to arrive at the planthat is optimal for that particularpatient.9

Fu S. Xue, MDDepartment of Anesthesiology, Plastic Surgery

HospitalChinese Academy of Medical Sciences and

Peking Union Medical CollegeBeijing, People’s Republic of China

[email protected]

Nong He, MDDepartment of Anesthesiology

Shougang Hospital, Peking UniversityBeijing, People’s Republic of China

He P. Liu, MDDepartment of Anesthesiology

Third Affiliated Hospital, Xinxiang MedicalCollege

Xinxiang, Henan, People’s Republic of China

REFERENCES

1. Wieczorek PM, Backman SB. Airway tropi-cal anesthesia. Anesth Analg 2009;109:991

2. Xue FS, Liu HP, He N, Xu YC, Yang QY,Liao X, Xu XZ, Guo XL, Zhang YM.Spray-as-you-go airway topical anesthe-sia in patients with a difficult airway: arandomized, double blind comparison of2% and 4% lidocaine. Anesth Analg2009;108:536–43

3. Wieczorek PM, Schricker T, Vinet B,Backman SB. Airway topicalisation inmorbidly obese patients using atomisedlidocaine: 2% compared with 4%. Anaes-thesia 2007;62:984–8

4. Morris IR. Pharmacologic aids to intuba-tion and the rapid sequence induction.Emerg Med Clin North Am 1988;6:753–68

5. Sanchez A, Iyer RR, Morrison DE. Prepa-ration of the patient for awake intubation.In: Hagberg CA, ed. Benumof’s airwaymanagement. Principles and practice. 2nded. St. Louis: Mosby-Year Book Inc, 2007:263–77

6. Williams KA, Barker GL, Harwood RJ,Woodall NM. Combined nebulizationand spray-as-you-go topical local anaes-thesia of the airway. Br J Anaesth 2005;95:549–53

7. Kundra P, Kutralam S, Ravishankar M.Local anaesthesia for awake fibreopticnasotracheal intubation. Acta Anaesthe-siol Scand 2000;44:511–6

8. Sutherland AD, Williams RT. Cardiovas-cular responses and lidocaine absorptionin fiberoptic-assisted awake intubation.Anesth Analg 1986;65:389–91

9. Simmons ST, Schleich AR. Airway re-gional anesthesia for awake fiberoptic in-tubation. Reg Anesth Pain Med 2002;27:180–92

DOI: 10.1213/ane.0b013e3181add3cb

Levosimendan for CalciumChannel Blocker Poisoningin Humans

To the Editor:For several reasons, we question

the appropriateness of using levosi-mendan for treatment of calciumchannel blocker (CCB) toxicity asrecently reported by Varpula et al.1

First, despite the “intensive conven-tional therapy” reportedly utilizedin their cases, subtherapeutic insu-lin dosing was used. In a previ-ous report of life-threatening CCBpoisoning, insulin therapy was ef-fective at 0.5–1.0 U � kg�1 � h�12 incontrast to the 20 and 10 U/h in thetwo patients reported by Varpula et al.Second, hyperinsulinemia-euglycemiatherapy is a safe and effective treat-ment for CCB overdose3,4 and is sug-gested as an adjunct therapy in currentresuscitation guidelines.5 Third,the authors refer to a study byGraudins et al.6 and correctly statedthat the levosimendan group had im-proved hemodynamics over placebobut omitted they did worse than thosereceiving calcium alone. Finally, a re-cent study investigating the effect oflevosidmendan in verapamil toxic-ity in dogs demonstrated trendstoward more pronounced brady-cardia and earlier death.7

Levosimendan has not beendemonstrated to be an effectivetherapy for CCB poisoning in ani-mals and we question its use inhuman cases of CCB poisoning.

Tamara R. Espinoza, MDDepartment of Emergency Medicine

Cook County-Stroger HospitalChicago, Illinois

[email protected]

Allan R. Mottram, MDDepartment of Emergency Medicine

Cook County-Stroger HospitalToxikon Consortium

Chicago, Illinois

Sean M. Bryant, MDDepartment of Emergency Medicine

Cook County-Stroger HospitalToxikon Consortium

Illinois Poison CenterChicago, Illinois

REFERENCES

1. Varpula T, Rapola J, Sallisalmi M, Kurola J.Treatment of serious calcium channelblocker overdose with levosimendan, a cal-cium sensitizer. Anesth Analg 2009;108:790–2

2. Boyer EW, Shannon M. Treatment ofcalcium-channel-blocker intoxication withinsulin infusion. N Engl J Med 2001;344:1721–2

3. Yuan TH, Kerns WP II, Tomaszewski CA,Ford MD, Kline JA. Insulin-glucose asadjunctive therapy for severe calciumchannel antagonist poisoning. J ToxicolClin Toxicol 1999;37:463–74

4. Kline JA, Tomaszewski CA, Schroeder JD,Raymond RM. Insulin is a superior anti-dote for cardiovascular toxicity inducedby verapamil in the anesthetized canine.J Pharmacol Exp Ther 1993;267:744–50

5. Mottram AR, Erickson TE. Toxicology inemergency cardiovascular care. In Field J,ed. The textbook of emergency cardiovas-cular care and CPR. Philadelphia: Lippin-cott Williams & Wilkins, 2009:443–67

6. Graudins A, Najafi J, Rur-SC MP. Treat-ment of experimental verapamil poison-ing with levosimendan utilizing a rodentmodel of drug toxicity. Clin Toxicol(Phila) 2008;46:50–6

7. Abraham MK, Scott SB, Meltzer A,Barrueto F Jr. Levosimendan does notimprove survival time in a rat model ofverapamil toxicity. J Med Toxicol 2009;5:3–7

DOI: 10.1213/ane.0b013e3181add57d

In Response:Espinoza et al.1 question the ra-

tionale of using levosimendan insevere calcium channel poisoningas described in our case report. Previ-ously published experimental modelsof calcium channel blocker poisoninghave investigated levosimendan asa solitary treatment2 or togetherwith calcium substitution.3 In prac-tice, these severely ill patients re-ceive many treatments that havean effect on overall hemodynamics.Besides levosimendan, our patientswere treated with large doses ofcatecholamines and vasopressin tomaintain blood pressure. Because va-sodilatation was counteracted withvasoconstrictors, improved cardiacfunction after levosimendan wasseen, which has also been demon-strated in an experimental setting.2

Convincing evidence of the ef-fect of interventions is difficult toachieve in such life-threatening clini-cal scenarios. This is also the casewith hyperinsulinaemia/euglycaemiatherapy in calcium channel blockerpoisoning. The exact mechanism is

992 Letters to the Editor ANESTHESIA & ANALGESIA


poorly defined and current evidenceconsists of few isolated cases or smallseries.4,5 Hyperinsulinaemia/eugly-caemia therapy is recommended bysome guidelines, whereas others, in-cluding our national guidelines, donot recognize it. Our first patients didreceive insulin at a dose of approxi-mately 0.35 IU � kg�1 � h�1, which is70% of the dose recommended.5

Tero Varpula, MD, PhDDepartment of Anesthesiology and Intensive

Care MedicineJorvi Hospital, Helsinki University Hospital

Espoo, [email protected]

Janne Rapola, MD, PhDDepartment of Cardiology

Helsinki University HospitalHelsinki, Finland

Marko Sallisalmi, MDDepartment of Anesthesiology and Intensive

Care MedicineHelsinki University Hospital

Helsinki, Finland

Jouni Kurola, MD, PhDIntensive Care Unit

Kuopio University HospitalKuopio, Finland

REFERENCES

1. Espinoza TR, Mottram AR, Bryant SM. Le-vosimendan for calcium channel bloc-ker poisoning in humans. Anesth Analg2009;109:992

2. Abraham MK, Scott SB, Meltzer A, Barrueto FJr. Levosimendan does not improve survivaltime in a rat model of verapamil toxicity.J Med Toxicol 2009;5:3–7

3. Graudins A, Najafi J, Rur-SC MP. Treat-ment of experimental verapamil poison-ing with levosimendan utilizing a rodentmodel of drug toxicity. Clin Toxicol(Phila) 2007;46:50–6

4. Boyer EW, Shannon M. Treatment ofcalcium-channel-blocker intoxication withinsulin infusion. N Engl J Med 2001;344:1721–2

5. Yuan TH, Kerns WP II, Tomaszewski CA,Ford MD, Kline JA. Insulin-glucose asadjunctive therapy for severe calciumchannel antagonist poisoning. J ToxicolClin Toxicol 1999;37:463–74

DOI: 10.1213/ane.0b013e3181add5eb

Limitations in UltrasoundImaging Techniques inAnesthesia: Obesity andMuscle Atrophy?

To the Editor:Ota et al.1 concludes that, when

using ultrasound guidance (US), theanterior approach to sciatic nerve

block is performed as easily and suc-cessfully as the posterior approach.The authors stated that, in elderlyindividuals, sciatic nerve identifica-tion is less successful because ofmuscle atrophy in which fasciamay not be distinguishable withUS imaging. Additionally, the au-thors implied that in obese patients,the sciatic nerve is not clearly visual-ized because of its deep anatomiclocation. On the basis of above con-siderations, I would like to commenton a few issues.

Ultrasound imaged muscle bundlesare seen as hypoechoic zones, whereasthe perimysium and aponeurosis areseen as hyperechoic structures. In thecase of muscle atrophy, “hypoechoic”muscle bundles degenerate, whereasperimisium and aponeurosis remainintact. The atrophic muscles, depictedas hyperechoic structures, reflect USenergy, thus decreasing the ability ofthe US beam to penetrate in deepertissues.2,3

In obese patients, because of deepanatomic location of nerves, theUS beam travels a greater dis-tance, resulting in beam attenua-tion. In addition, other factors mayaffect imaging quality through fat,which are as follows: 1) Exagger-ated attenuation, i.e., the adiposetissue, has a nonlinear relationshipto frequency as opposed to the usu-ally assumed linear relationship inmost biological tissues; 2) Phase ab-erration of the sound field becauseof uneven speed of sound in theirregularly-shaped adipose layers.This is due to differing speeds ofsound in the overlying, nonhomo-geneous tissue above the focus ofthe transducer; and 3) Reflection be-cause of mismatch of acoustic im-pedance at the fat/muscle interfaces.When the US beam crosses a bound-ary between muscle layer and fat, aportion of energy is reflected backto the transducer because of differ-ent acoustic velocity between thetwo tissues (pure fat 1450 m/s andmuscle 1580 m/s).4–6

In these cases, image quality maybe improved by using different te-chnical approaches which reduce

speckling, clutter, or other acousticartifacts.7 Advanced US imagingtechniques, such as compound andharmonic imaging, improve the im-age because of a reduction of theseartifacts. For example, harmonicimaging reduces phase aberrationartifacts from overlying tissue andcompound imaging reduces similarartifacts by averaging multiple scanlines from different directions.7,8

Additionally, compression of fat,location of the fat in the focus of thetransducer, and large beam widthof the US signal may improve im-aging quality through fat.4,9

Among the major US innova-tions of recent years, 3D US is theideal tool to avoid the limitationsaffecting the diffusion and reliabil-ity associated with traditional US.10

However, many studies are requiredto ascertain its utility in the imagingof nerve structures.

In conclusion, obesity and muscleatrophy mainly increase the numberof reflective interfaces not onlyleading to more echoes but alsodecreasing incident sound avail-able to penetrate deeper tissues,such as nerves, vessels, or othertargeted structures.

Theodosios Saranteas, PhD2nd Department of Anesthesiology, School of

MedicineUniversity of Athens, Attikon Hospital

Athens, Greece, [email protected]

REFERENCES

1. Ota J, Sakura S, Hara K, Saito Y.Ultrasound-guided anterior approach tosciatic nerve block: a comparison withthe posterior approach. Anesth Analg2009;108:660–65

2. Chhem R, Kaplan P, Dussault R. Ultra-sonography of the musculoskeletalsystem. Radiol Clin North Am 1994;32:275– 89

3. Saranteas T, Chantzi C, Iatrou C, Kosto-panagiotou G, Dimitriou V. Ultrasoundand regional anaesthesia techniques—isthere any limitation? Reg Anesth PainMed 2007;32:546–7

4. Fiegler W, Felix R, Langer M, Schultz E.Fat as a factor affecting resolution indiagnostic ultrasound: possibilities forimproving picture quality. Eur J Radiol1985;5:304–9

5. Feigenbaum H. Physics and instrumen-tation. In Feingenbaum H, ArmstrongWF, Rayan T, eds. Feigenbaum’s echo-cardiography. Philadelphia: LippincottWilliam and Wilkins, 2005:12–5



6. Shmulewitz A, Teefey SA, Robinson BS.Factors affecting image quality and di-agnostic efficacy in abdominal sonogra-phy: a prospective study of 140 patients.J Clin Ultrasound 1993;21:623–30

7. Entrekin RR, Porter BA, Sillesen HH,Wong AD, Cooperberg PL, Fix CH. Realtime spatial compound imaging: appli-cations to breast, vascular and musculo-skeletal ultrasound. Semin UltrasoundCT MR 2001;22:65–77

8. Shapiro RS, Wagreich J, Parsons RB,Stancato-Pasik A, Yeh HC, Lao R. Tissueharmonic imaging sonography: evalua-tion of image quality compared withconventional sonography. AJR Am JRoentgenol 1998;171:1203–6

9. Browne JE, Watson AJ, Hoskins PR, ElliottAT. Investigation of the effect of subcuta-neous fat on image quality performance of2D conventional imaging and tissue har-monic. Imaging Ultrasound Med Biol2005;31:957–64

10. Cimmino M, Grassi W. What is new inultrasound and magnetic resonance imag-ing for musculoskeletal disorders? BestPract Res Clin Rheumatol 2008;22:1141–8

DOI: 10.1213/ane.0b013e3181ae09a4

Surrogate Outcomes: TheyDon’t Get It

To the Editor:The recent Letter to the Editor by

Kranke et al.1 regarding postopera-tive nausea and vomiting (PONV)“dispute[s] the notion that PONVshould be described as a ‘surrogateoutcome,’ as suggested by frequentlycited editorials, only because qualityof life measures and scores for pa-tient satisfaction are not consistentlyaffected by preventive measures inan unselected patient population.”As the author of both “frequentlycited editorials,”2,3 I counter Krankeet al. with an example of the “ulti-mate” antiemetic, pancuronium plusmidazolam. Paralysis assures thatvomiting is absent, whereas sedationprevents assessment of nausea. Theoutcome measure accepted by Krankeand co-workers4 and common toPONV studies, counting the numberof emetic episodes, would yield re-markable success for such a regimen.Kranke et al. rightly criticize myproposal as absurd and irrelevant:antiemesis would have been ac-complished at enormous cost andrisk and without benefiting thepatient.

Many antiemetic/PONV articlescite a study by Gold et al.5 showingthat PONV increased recovery

room stay and led to unplannedhospital admission. Unfortunately,these studies either did not mea-sure recovery room stay and theincidence of unplanned hospital ad-mission or failed to demonstratethat antiemetics influenced theseoutcomes. Such studies remain tobe done.

In the present cost-containmentenvironment, therapeutic decisionsshould be evidence based. One ob-vious true outcome is patient satis-faction. Scuderi et al.6 evaluatedthe effect of antiemetics on patientsatisfaction; prophylactic treatmentimproved satisfaction only 4%.Based on that value, 25 patients mustbe treated to create one additional“happy customer”; in turn, whenKranke et al. administer antiemeticsprophylactically, they should con-sider this calculation in assessingcost-benefit ratio.

Kranke’s claim that “quality oflife measures and scores for patientsatisfaction are not consistently af-fected by preventive measures in anunselected patient population” isanecdotal. If Kranke et al. are con-vinced that failure to demonstrateimproved patient satisfaction re-sults from the patient populationsbeing “unselected,” I encouragethem (or others) to perform a pro-spective randomized clinical trialusing a “selected” patient popula-tion. Perhaps this might put theissue to rest. Meanwhile, I preferthat clinicians make decisions basedon meaningful outcomes.

Dennis Fisher, MDP Less Than

San Francisco, [email protected]

REFERENCES

1. Kranke P, Roewer N, Smith AF, Piper SN,Wallenborn J, Eberhart LHJ. Postopera-tive nausea and vomiting: what are wewaiting for? Anesth Analg 2009;108:1049 –50

2. Fisher DM. Surrogate end points, are theymeaningful? Anesthesiology 1994;81:795–6

3. Fisher DM. Surrogate outcomes: mean-ingful not! Anestheiolosgy 1999;90:355– 6

4. Jokela RM, Cakmakkaya OS, DanzeisenO, Korttila KT, Kranke P, Malhotra A,Paura A, Radke OC, Sessler DI, SoikkeliA, Roewer N, Apfel CC. Ondansetron has

similar clinical efficacy against both nau-sea and vomiting. Anaesthesia 2009;64:147–51

5. Gold BS, Kitz DS, Lecky JH, Neuhaus JM.Unanticipated admission to the hospitalfollowing ambulatory surgery. JAMA1989;262:3008–10

6. Scuderi PE, James RL, Harris L, Mims GR.Antiemetic prophylaxis does not improveoutcomes after outpatient surgery whencompared to symptomatic treatment.Anesthesiology 1999;90:360 –71

DOI: 10.1213/ane.0b013e3181b08193

In Response:We fully support the notion es-

poused by Fisher1 that “clinicians(should) make decisions based onmeaningful outcomes.” Dr. Fishersuggests that nausea and vomitingare not meaningful outcomes be-cause pancuronium and midazo-lam reduce nausea and vomiting tozero. True. However, his “reductioad absurdum” argument could bemade about many meaningful out-comes. Is pain the fifth vital sign ormerely a surrogate? Like nauseaand vomiting, pain scores could bereduced to zero from a combinationof midazolam and pancuronium.Does that make pain not a mean-ingful outcome?

We contend that nausea andvomiting are meaningful outcomes.“Throwing up” is universally con-sidered unpleasant. We will not of-fer a reference, but invite anyonewho enjoys vomiting to disprove usby counterexample. Additionally,

1. Anesthesiologists consider post-operative nausea and vomiting(PONV) a relevant outcome2

and have dubbed it our “big littleproblem.”3

2. PONV matters to our pa-tients.4,5 Patients are willingto pay US$56–US$100 out oftheir own pocket for a totallyeffective antiemetic.6

3. Similar to the occurrence of se-vere postoperative pain, inad-equate management of PONVmay imply medico-legal conse-quences because PONV is con-sidered at least as troublesomeas postoperative pain.4,7

4. The forceful expulsion of gastriccontents in the course of severe



vomiting or PONV may lead tolife-threatening complications.8

5. There may be economic conse-quences of PONV, especially inan outpatient setting, becausethe occurrence of PONV is aleading factor for unplannedhospital admissions.9,10

Eliminating the “big little prob-lem”3 may be our “big little chance.”11

Peter KrankeDepartment of Anaesthesia and Critical Care

University Hospitals of WurzburgWurzburg, Germany

[email protected]

Andrew F. SmithDepartment of Anaesthesia and Lancaster

Patient Safety Research UnitLancaster, UK

Swen N. PiperDepartment of Anesthesiology and Intensive Care

Hospital of Ludwigshafen/RhineGermany

Jan WallenbornDepartment of Anesthesiology and Intensive Care

University Hospitals of LeipzigLeipzig, Germany

Norbert RoewerDepartment of Anaesthesia and Critical Care

University Hospitals of WurzburgWurzburg, Germany

Leopold H. J. EberhartDepartment of Anesthesiology and Intensive Care

University Hospitals of Marburg and GießenMarburg, Germany

REFERENCES

1. Fisher DM. Surrogate outcomes: theydon’t get it. Anesth Analg 2009;109:994

2. Macario A, Weinger M, Truong P, LeeM. Which clinical anesthesia outcomesare both common and important toavoid? The perspective of a panel ofexpert anesthesiologists. Anesth Analg1999;88:1085–91

3. Kapur PA. The big “little problem.”Anesth Analg 1991;73:243–5

4. Macario A, Weinger M, Carney S, KimA. Which clinical anesthesia outcomesare important to avoid? The perspectiveof patients. Anesth Analg 1999;89:652–8

5. Eberhart LH, Mauch M, Morin AM,Wulf H, Geldner G. Impact of a multi-modal anti-emetic prophylaxis on pa-tient satisfaction in high-risk patients forpostoperative nausea and vomiting. An-aesthesia 2002;57:1022–7

6. Gan T, Sloan F, Dear Gde L, El-MoalemHE, Lubarsky DA. How much are pa-tients willing to pay to avoid postopera-tive nausea and vomiting? Anesth Analg2001;92:393–400

7. van Wijk MG, Smalhout B. A postopera-tive analysis of the patient’s view ofanaesthesia in a Netherlands’ teachinghospital. Anaesthesia 1990;45:679–82

8. Schumann R, Polaner DM. Massive sub-cutaneous emphysema and sudden air-way compromise after postoperativevomiting. Anesth Analg 1999;89:796

9. Kokinsky E, Thornberg E, Ostlund AL,Larsson LE. Postoperative comfort inpaediatric outpatient surgery. PaediatrAnaesth 1999;9:243–51

10. Blacoe DA, Cunning E, Bell G. Paediatricday-case surgery: an audit of unplannedhospital admission Royal Hospital forSick Children, Glasgow. Anaesthesia 2008;63:610–5

11. Kranke P, Roewer N, Smith AF, Piper SN,Wallenborn J, Eberhart LH. Postoperativenausea and vomiting: what are we waitingfor? Anesth Analg 2009;108:1049–50

DOI: 10.1213/ane.0b013e3181b081aa

Decrease in BispectralIndex While CorrectingHyperglycemia and anIncrease in BispectralIndex with Correctionof Hypoglycemia

To the Editor:The Bispectral Index (BIS), a pa-

rameter derived from the electroen-cephalogram, is currently used toassess depth of anesthesia. Severehypoglycemia may induce a decreasein electroencephalogram in eitherdiabetic or nondiabetic patients.1,2

This report describes a sudden de-crease in BIS with hypoglycemiaand an increase in BIS with thecorrection of the hypoglycemia. A74-yr-old 74-kg woman was admit-ted on the day of surgery for repairof an internal iliac aneurysm. Shehad Type 2 diabetes mellitus, hy-pertension, and stable angina, whichwas treated medically. Medicationsincluded metformin (500 mg bid),glibenclamide (2.5 mg/d), meto-prolol (25 mg bid), aspirin (100mg/d), and atorvastatin (20 mg/d).Her blood sugar level was 14.7mmol/L before induction. She hadomitted her oral hypoglycemics onthe day of surgery.

Anesthesia was induced with 2-mgmidazolam, 120-mg propofol, and100-�g fentanyl, and muscle relax-ation was accomplished with 40-mgrocuronium. The patient’s tracheawas intubated with a Size 7 endo-tracheal tube. The BIS was continu-ously monitored using an A-2000XP monitor (Aspect MS, Natick,MA). Anesthesia was maintained

with O2/air and end-tidal sevoflu-rane 1.1%. The BIS was in the rangeof 38–46. Actrapid� 6 iu (purifiedhuman neutral insulin) was givenbecause the blood sugar was 14.7mmol/L and over the next 8–12min a rapid decrease in BIS to 12–16was observed. During this time,there had been no change in venti-latory or hemodynamic parametersor sevofurane concentration. A fin-ger stick blood glucose measure-ment showed severe hypoglycemia(2.3 mmol/L). Glucose 35 mL 50%over 1 min was administered. Arapid increase in BIS to 35–39 over4–8 min was noted. As before,there were no changes in ventila-tion, hemodynamic parameters, oranesthetic depth. Glucose measure-ment revealed a blood sugar of 7.2mmol/L.

A rapid change in BIS with correc-tion of hypoglycemia has been re-ported in a patient in an intensivecare unit setting wherein the patientwas sedated with midazolam andsufentanil.3 However, this appears tobe the first report of a decrease in BISrelated to correction of hyperglyce-mia followed by a rapid increase in theBIS with the correction of the hypogly-cemia. This observation suggests thata sudden decrease in BIS could be anindication of severe hypoglycemiaand should prompt a measurementof blood sugar concentration.

Manu Narayanaswamy, MBBS,FANZCA

Department of AnesthesiaGosford Hospital, Gosford

New South Wales, [email protected]

REFERENCES

1. Gilbert TT, Wagner MR, HalukurikeV, Paz HL, Garland A. Use of bispec-tral electroencephalogram monitoring toassess neurologic status in unsedated,critically ill patients. Crit Care Med 2001;29:1996–2000

2. Pramming S, Thorsteinsson B, Stigsby B,Binder C. Glycaemic threshold for changesin electroencephalograms during hypogly-cemia in patients with insulin dependentdiabetes. BMJ 1988;296:665–7

3. Vivien B, Olivier Langeron O, Bruno RiouB. Increase in bispectral index (BIS) whilecorrecting a severe hypoglycemia. AnesthAnalg 2002;95:1824–5

DOI: 10.1213/ane.0b013e3181adf919



Stroke Volume Calculationby Esophageal DopplerIntegrates Velocity OverTime and Multiplies This“Area Under The Curve”by the Cross Sectional Areaof the Aorta

To the Editor:In our recent review1 we wish to

acknowledge an error that was as-tutely observed by Dr. Archer.

In describing the calculation ofstroke volume by means of esopha-geal Doppler, we state that the areaunder the curve of the velocity-timegraph “is computed mathematicallyas the integral of the derivative ofvelocity over time (dV/dt) from T0to T1 (where T0 is the start of aorticblood flow and T1 is the end offlow).” This is not accurate.

The area under the curve for thevelocity-time graph should be de-scribed as the integral of the velocitycurve over time, not the integral of itsderivative. The area under this curveis the distance traveled by blood dur-ing systole, also called the strokedistance, measured in cm. Strokevolume is then obtained by multiply-ing stroke distance by the cross sec-tional area of aorta (cm2) to obtainstroke volume (cm3).

We thank Dr. Archer for pointingout this error and apologize for anyconfusion this may have caused.

Thomas L. Archer, MD, MBAUniversity of California

San Diego, [email protected]

Duane J. Funk, MD, FRCP(C)University of Manitoba

Winnipeg, Manitoba, Canada

Eugene Moretti, MD

Tong J. Gan, MD, FRCADepartment of Anesthesia

Duke University Medical CenterDurham, North Carolina

REFERENCE

1. Funk DJ, Moretti EW, Gan TJ. Minimallyinvasive cardiac output monitoring in theperioperative setting. Anesth Analg 2009;108:887–97

DOI: 10.1213/ane.0b013e3181ae901c

Ultrasound-GuidedIntercostal Approach toThoracic Paravertebral Block

To the Editor:In the first report of ultrasound-

guided thoracic paravertebral block(USG-TPVB),1 the authors imagedthe transverse process and the tho-racic paravertebral space (TPVS) ina longitudinal parasagittal plane,the needle was inserted out-of-planeto the probe using a conventionaltechnique, and loss-of-resistance tosaline was used as the end point

for needle placement rather than ul-trasonographic visualization of needle-tip position. Our USG-TPVB tech-nique is typically performed usingin-plane technique that utilizes directvisualization of needle-tip positionand local anesthetic spread as theend point.

USG-TPVB is performed using ahigh-frequency linear array probe.A convex probe is also useful inobese patients. The patient is placedin a lateral decubitus position withthe side to be blocked uppermost orin a prone position. After asepticpreparation of the skin and theprobe, the probe is placed on the rib

Figure 1. Ultrasound image of the thoracic paravertebral space at the level of T3.TP � transverse process; TPVS � apex of thoracic paravertebral space; IICM �internal intercostal membrane; EICM � external intercostal muscle; PL �pleura.

Figure 2. Ultrasound image of the needle-tip placement into the thoracic paraver-tebral space. TP � transverse process; EICM � external intercostal muscle; N �Tuohy needle; PL � pleura.



at the selected level with the medialedge of probe in contact with thespinous process, so that the hori-zontal view of the rib is visualizedas a hyperechoic line with posterioracoustic shadowing. The probe isthen moved caudally into the inter-costal space between adjacent ribs.The inferior part of transverse pro-cess is visualized as a hyperechoicconvex line with posterior acousticshadowing. The apex of TPVS isvisualized as a wedge-shaped hypo-echoic space surrounded by the hy-perechoic line of the pleura belowand the internal intercostal mem-brane above (Fig. 1). The apex ofTPVS is laterally continuous with theintercostal space2 (Fig. 2). The inter-nal intercostal ligament is mediallycontinuous with the superior cos-totransverse membrane; these two

membranes cannot be distinguis-hed by ultrasonography. A 20-gauge Tuohy needle is inserted in alateral-to-medial direction from theouter edge of probe with the bevelfacing the probe using an in-planeapproach and advanced until theneedle tip penetrates through the in-ternal intercostal membrane. After anegative aspiration test for blood,15–20 mL of local anesthetic is in-jected into the TPVS slowly. Thepleura is seen being pressed ven-trally during local anesthetic injec-tion (Fig. 3).

The technique we describe hasbeen modified from that reportedby Kappis3 in 1912. A 10-cm needlewas introduced three finger breadthsfrom the midline at an angle of 45°to the skin and advanced into theTPVS until the needle tip was in

contact with the posterolateral as-pect of the vertebral body. Kappis’stechnique was eventually aban-doned because of the risk of needlepenetration through the interverte-bral foramen resulting in intrathe-cal injection or spinal cord injury.With the ultrasound-guided te-chnique, however, needle contactwith the vertebral body is not nec-essary, and the complications asso-ciated with Kappis’s technique canbe avoided. Moreover, Tuohy needleinsertion and advancement tan-gential to the pleura can lessen therisk of pleural and intercostal vas-cular puncture. The safety and reli-ability of USG-TPVB await futureconfirmation.

Yasuyuki Shibata, MD

Kimitoshi Nishiwaki, MD, PhDDepartment of Anesthesiology

Nagoya University, School of MedicineNagoya, Japan

[email protected]

REFERENCES

1. Hara K, Sakura S, Nomura T, Saito Y.Ultrasound guided thoracic paravertebralblock in breast surgery. Anaesthesia2009;64:223–5

2. Burns DA, Ben-David B, Chelly JE,Greensmith JE. Intercostally placedparavertebral catheterization: an alter-native approach to continuous paraver-tebral blockade. Anesth Analg 2008;107:339 – 41

3. MacIntosh RR. Paravertebral block. In:MacIntosh RR, Brycle-Smith R, eds. Localanalgesia: abdominal surgery. Baltimore,MD: Williams and Wilkins Co., 1953:60–3

DOI: 10.1213/ane.0b013e3181af7e7b

Figure 3. Ultrasound image of local anesthetic spread. N � Tuohy needle; EICM �external intercostal muscle; LA � local anesthetic; PL � pleura.



Book, Multimedia, and Meeting ReviewsAnesthesia Crash CourseHorton CN. New York: Oxford Univer-sity Press, 2009. ISBN-10: 0195371879,ISBN-13: 978-0195371871. 192 pages.$19.95.

For newcomers to the field of anesthe-siology, the first few days of training

can be a daunting experience, requiringrapid acquisition of basic knowledge ofa broad range of topics requiring anunderstanding of physiology and phar-macology. Anesthesia Crash Course is aunique book that provides incomingstudents (e.g., residents, interns, andexterns [medical students]) with a con-cise and easy-to-read overview of thefield of anesthesiology. While its formatand scope are similar to the now out-of-print Anesthesia for the Uninterestedby Birch and Tolmie, Anesthesia CrashCourse is clearly directed at a differentaudience—those who are actually inter-ested in the practice of anesthesiology.

Anesthesia Crash Course is divided into14 bite-sized chapters, many of whichhave pithy titles such as “Better Livingthrough Chemistry” and “Don’t LaunchYour Lunch.” By and large, the chaptersare logically sequenced, starting with abasic introduction to the anesthesia ma-chine and checkout procedures, pro-gressing through basic pharmacologyand preoperative preparation of the pa-tient, and culminating with technicalskills, such as airway management, vas-cular access, and regional anesthetic tech-niques. Each chapter is designed to guidea complete novice, with little or no pre-vious knowledge of the topic, to a pointwhere he or she is comfortable with basicprinciples and terminology. For example,the chapter on “Sharp Objects” devotes 7pages to starting an IV; it begins with a“bill of materials” and includes sugges-tions regarding how to affix a tourniquet,how to locate a suitable vein, how toavoid pulling the needle out while ad-vancing the catheter, and how to tape thefinished product. Two of the chaptersof Anesthesia Crash Course deviate fromthis “step-by-step” approach. The first ofthese, “Less Filling, Tastes Great,” pro-vides point-counterpoint discussions ofcontroversial topics that beginning anes-thesiologists are likely to encounter dur-ing patient-based discussions with theirmentors. Examples include, “How muchfluid should I give my patients?” “Shouldwe use low flow anesthetic techniqueswhen possible?” and “What is the bestway to secure an endotracheal tube?”The chapter entitled, “What IF? —A Brief

Guide to Various Situations” providesuseful guidance on some common (e.g.,What if I can’t start the IV), not so com-mon (e.g., What if the patient won’t wakeup at the end of the case?) and downrightrare (What if the hospital catches fire orthere is some other hospital-wide emer-gency?) problems which a new residentmight encounter in the operating room.

Anesthesia Crash Course does havesome notable shortcomings. While thebook is designed to provide a broadoverview, it is “oversimplified” at times.Valuable clinical information, such asdrug dosing, is not included making it aless valuable resource while in the oper-ating room, despite its pocket-sized for-mat. There is minimal information onrespiratory or cardiac physiology andlittle emphasis on the difficult airwayalgorithm. There are numerous technicalerrors; while these are not critical for theabsolute novice, they will lead to incor-rect responses on standardized examina-tions. Examples include a statement thatremifentanil is metabolized by plasmacholinesterases (p.38, should be nonspe-cific tissue esterases); a statement thatanesthetic gases are typically analyzed bymass spectrometry (p.4, should be infra-red analysis); and a recommendation thatpatients older than 55 years shouldreceive a preoperative chest radio-graph (p.55, contradicting the currentASA guidelines).

In summary, we recommend Anes-thesia Crash Course to individuals whorequire a rapid overview of the basicconcepts in anesthesiology, such asmedical students or residents who arebeginning their first real exposure tothe specialty. The writing is concise,and the simple, conversational tonemakes it easy to read the book fromcover-to-cover in a couple of hours. Theauthor uses basic, easy-to-understandterminology and does not assume thatthe reader is familiar with abbrevia-tions and jargon. The pictures anddrawings are simple, well labeled, andeasy to understand. However, whileAnesthesia Crash Course provides a use-ful introduction, it is not a substitute fora more advanced “introductory” text-book, such as Stoelting & Miller’s Basics ofAnesthesia or Barash, Cullen & Stoelting’sHandbook of Clinical Anesthesia.

For new anesthesiology residents be-ginning their training with differingdegrees of previous exposure to the spe-cialty, reading Anesthesia Crash Courseprior to the start of residency will help to“level the playing field.” Therefore, we

recommend sending a copy of AnesthesiaCrash Course to all incoming residents asrequired reading before the start of theirtraining.

Christopher Beyus, MDCA-1 Anesthesiology Resident

Jeffrey B. Gross, MDProfessor of Anesthesiology and PharmacologyUniversity of Connecticut School of MedicineFarmington, [email protected]

A Practical Approach toRegional Anesthesia, 4th ed.Mulroy MF, Bernards CM, McDonald SB,Salinas FV. Philadelphia: Wolters KluwerHealth/Lippincott Williams & Wilkins,2009. ISBN-13: 978-0-7817-6854-2, ISBN-10: 0-7817-6854-3. 356 pages. $85.00(paperback).

Mulroy’s recent publication of APractical Approach to Regional Anes-

thesia, Fourth Edition is a revised andupdated version of Regional Anesthesia:An Illustrated Procedure Guide, Third Edi-tion (2002). The text is part of the “prac-tical approach” series by LippincottWilliams & Wilkins. This edition boastsmany changes from the third edition,including color illustrations and the ad-dition of ultrasound techniques and im-ages. In addition, the book has alsoexpanded the number of contributingauthors, and all chapters now follow anoutline format. Organizationally, thebook maintains the same chapter con-tent and progression as the third edi-tion, beginning logically with chapterson local anesthetics, premedication andequipment, followed by regional anes-thetic block techniques and specialtyprocedures.

A Practical Approach to Regional An-esthesia is an excellent introductorybook for beginning regional anesthesiapractitioners looking for information onspecific block techniques. Each chapteris clearly written and the outline formatintroduces standard regional topics in aconcise and logical fashion. The authorsalso discuss controversial topics involv-ing the use of local anesthetics andadjuvants for regional anesthesia, in-cluding fentanyl use in epidurals, themixing of local anesthetics, and the useof depo-local anesthetic preparations.The chapter content is supported by fre-quent illustrations, tables, and graphsthat reinforce the author’s point and fa-cilitate reader comprehension. Each


Section Editor: Paul White

chapter is well referenced, and the keyreferences are bolded.

Despite its many positive attributesfor the beginning anesthesiologist, somelimitations should be pointed out. Withregard to its sections on ultrasound-guided regional anesthesia, many of therecommendations for probe use andtechnique are subjective with little or nodata to support one approach over an-other. Although the ultrasound imagesare generally of good resolution and ac-ceptable quality, they are fairly small andlack the depth markings that are ex-tremely useful for teaching purposes. Inaddition, some of the illustrations ofprobe positioning lack sufficient detail tohelp inexperienced practitioners withsurface placement of the probe. As withany text that transitions from single tomultiple authors, some internal incon-sistency was found. For example, thequality and clarity of illustrations varies

between chapters, and, in some in-stances, authors differ in their views onthe clinical utility of specific regionalanesthetic practices (e.g., the additionof bicarbonate to local anesthetics).

For the serious book collector, thequality of the published product is av-erage at best. The book is published in aglossy soft-cover, 8 1⁄4 � 11 1⁄4 size format,and the binding is of the modern adhe-sive variety. It contains 356 pages, andthe print size is large enough for easyreading. The paper weight is fairlylight, such that figures and tables fromopposite and subsequent pages aretransparent (although this does notsignificantly impair the readability ofthe text material).

Mulroy’s A Practical Approach toRegional Anesthesia, Fourth Edition is arelatively inexpensive and useful in-troductory textbook on peripheral nerveblockade. It provides the reader with an

easily comprehended discussion ofimportant issues related to regionalanesthesia in an outline format that iswell-referenced and includes manypractical discussion points regardingspecific regional anesthetic techniques.Although the ultrasound informationand images could be improved, the bookdoes provide a good initial exposure toultrasound use in regional anesthesia.Overall, this book is a handy referencesource for anesthesia providers who arelooking for an overview of regionalanesthetic medications, equipment, andtechniques.

Christopher M. Duncan, [email protected]

Hugh M. Smith, MD, PhDDepartment of AnesthesiaMayo ClinicRochester, MN


Book and Multimedia Reviews

anesthesia analgesia september 2009

Documents