application checking

5
Long-Term Recruitment AIESEC in Ukraine Long Long Long Long-term recruitment 2010 term recruitment 2010 term recruitment 2010 term recruitment 2010 AIESEC in Ukraine A A p p p p l l i i c c a a t t i i o o n n F F r r a a m m e e w w o o r r k k 2 2 0 0 1 1 0 0 - - 2 2 0 0 1 1 1 1 AIESEC in Ukraine 1. Introduction 2. Application Form 3. Online Application Form or “Google form for Dummies”

Upload: rita-nemesh

Post on 23-Mar-2016

224 views

Category:

Documents


2 download

DESCRIPTION

doc about how to check application form for memebrship

TRANSCRIPT

Page 1: Application checking

Long-Term Recruitment

AIESEC in Ukraine

LongLongLongLong----term recruitment 2010term recruitment 2010term recruitment 2010term recruitment 2010 AIESEC in Ukraine

AAAAAAAApppppppppppppppplllllllliiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn FFFFFFFFrrrrrrrraaaaaaaammmmmmmmeeeeeeeewwwwwwwwoooooooorrrrrrrrkkkkkkkk 22222222000000001111111100000000--------22222222000000001111111111111111 AAIIEESSEECC iinn UUkkrraaiinnee

11.. IInnttrroodduuccttiioonn 22.. AApppplliiccaattiioonn FFoorrmm 33.. OOnnlliinnee AApppplliiccaattiioonn FFoorrmm oorr

““GGooooggllee ffoorrmm ffoorr DDuummmmiieess”” ☺☺

Page 2: Application checking

Long-Term Recruitment

AIESEC in Ukraine

AApppplliiccaattiioonn ffoorrmm is a first part of formalized selection into AIESEC.

It gives us possibility to gather basic information about each person as well

as to build right expectations within the organization (e.g. going for

exchange or taking professional development in IT). There is one more,

additional, objective known as “psychological selection” or “pre-selection”

when by certain questions/information/note in application we influence

person‘s decision: to apply or not to apply. The simplest example: by

designing application in English we obviously expect that person will be

able to understand & fill it in. Another words, we cut of people who doesn’t

know English at all and with level „basic“ as they simply won’t be able to fill

it. The benefit of using an application form from the organization's

perspective is that it ensures that the same information is gained from

candidates which help to achieve a level of consistency in the short listing

process. We doesn’t measure competencies & don’t select people by

application forms!

Taking into consideration that this selection method will be used by

ALL LCs & is based on National Member Profile, application form will be

similar for all AIESEC in Ukraine & will contain two types:

II.. AAIIEESSEECC MMeemmbbeerr AApppplliiccaattiioonn FFoorrmm

IIII.. MMeemmbbeerr AApppplliiccaattiioonn FFoorrmm ffoorr AAIIEESSEECC EExxcchhaannggee PPrrooggrraamm

AAiimm ooff tthhiiss gguuiiddee iiss ttoo pprroovviiddee ssaammee ccrriitteerriiaa aanndd ccoommmmoonn uunnddeerrssttaannddiinngg ooff iittss aapppprraaiissaall..

SSoo pplleeaassee,, rreeaadd iitt ccaarreeffuullllyy bbeeffoorree sseelleeccttiioonn ooff aapppplliiccaannttss ffoorr nneexxtt ssttaaggee!!

For additional questions, please, approach:

Rita Nemesh (MC VPTM 2010-2011) – [email protected]

Constantine Shevchuk (NTCo 2010-2011) – [email protected]

11.. IInnttrroodduuccttiioonn 22..

Page 3: Application checking

Long-Term Recruitment

AIESEC in Ukraine

What to measure?

Characteristic for measure Application form

Personal data X

English X

Background X

Motivation for AIESEC X

Past Experience X

How to measure?

1. Personal information

General main information that you need to know. In evaluation sheet just put main data. Pay attention on: 1) year of study 2) background.

2. Which languages do you speak? At what level?

Remember that according to our profile we are focusing only on people who have excellent and good English what means that the person is at least able to communicate easily and describe opinion and thoughts clearly. In the tracking sheet put level of English proficiency.

3. Why have you decided to apply to AIESEC?

Aim of this question is to evaluate level of motivation for AIESEC. If candidate doesn’t have enough motivation or you see that expectations are wrong - most probably, there is no need in selecting & later on - investing & relying on this person as he/she might leave very soon. Assess according to following criteria: A: – Person is highly motivated to join & stay in organization; there are listed benefits & visible inner desire connected with personal goals & ambitions. All of them are 100% applicable with what AIESEC really provide. B & C: – Person is motivated but not so much, or expectations are partly different with the one that we expect (e.g. learning languages). There might be two types of people in this category: those who doesn’t really know yet what AIESEC provide (that’s why cannot name something concrete) & the ones who doesn’t know themselves – there goals & plans for the future (it often happens, especially, when person is 1

st or 2

nd year student).

D: – Person is not motivated or has absolutely wrong expectations comparing with opportunities AIESEC provide. High possibility to leave soon.

4. What is your previous experience? (companies, students’ organizations etc.)

In national profile we appreciate if the person had an active past performance and had an experience of work in a team at school, university, other as well as he or she is experienced in certain issue or field. Assess according to following criteria: A: - was active in divers activities, had a teamwork experience; B: - there was relevant experience but not that much, there was a team experience but very little period of time (not more than a month); C: - probably there was a team experience (we can guess from the information mentioned); D: - the person is not experienced at all.

33.. AApppplliiccaattiioonn FFoorrmm

Page 4: Application checking

Long-Term Recruitment

AIESEC in Ukraine

Here is detail explanation how to create online application from!1. Go to: https://spreadsheets.google.com/ccc?key=0AnWlyxHX5rI9dG1lWVhqLU5SZ2. Select File -> Create Copy

3. Type your Form Name in new dialog window and press “OK”

4. Go to https://docs.google.com/

5. Press “Share” button there and select “Get link for sharing”

6. Select sharing settings in new window and press “Save and Exit”:

44.. OOnnlliinnee AApppplliiccaattiioonn FFoorrmm

detail explanation how to create online application from!https://spreadsheets.google.com/ccc?key=0AnWlyxHX5rI9dG1lWVhqLU5SZ

> Create Copy

Form Name in new dialog window and press “OK”

https://docs.google.com/ and click on your newly created form (in 3

Press “Share” button there and select “Get link for sharing”

in new window and press “Save and Exit”:

mm ““GGooooggllee ffoorrmm ffoorr DDuummmmiieess”” ☺☺

detail explanation how to create online application from! https://spreadsheets.google.com/ccc?key=0AnWlyxHX5rI9dG1lWVhqLU5SZ

and click on your newly created form (in 3rd step)

Page 5: Application checking

Long-Term Recruitment

AIESEC in Ukraine

7. Click “Form” and select “Edit Form”:

8. In new window opened you can modify your form. In the page bottom you can see link for filling in this form:

HH

Click “Form” and select “Edit Form”:

In new window opened you can modify your form. In the page bottom you can see link

HHaappppyy RReeccrruuttiinngg!!

In new window opened you can modify your form. In the page bottom you can see link