aptamer conjugated quantum dots for imaging cellular...

IP: 95.181.182.42 On: Sat, 16 Mar 2019 23:47:56Copyright: American Scientific Publishers

Delivered by Ingenta

Copyright © 2019 American Scientific PublishersAll rights reservedPrinted in the United States of America

ArticleJournal of

Nanoscience and NanotechnologyVol. 19, 3798–3803, 2019

www.aspbs.com/jnn

Aptamer Conjugated Quantum Dots for ImagingCellular Uptake in Cancer Cells

Harleen KaurAstraZeneca, One MedImmune Way, Gaithersburg, Maryland, 20878, USA

The fluorescence labeling of aptamers is a useful technology for aptamer tracking and imagingon the cells. The aptamer SL2-B, against the heparin binding domain (HBD) of VEGF165 protein,was linked to QDs, producing the QD-SL2-B aptamer conjugate. The QDs and the QD-aptamerconjugate were characterized and photobleaching effect was studied prior to the cellular incubation.Fluorescence imaging showed that the QD-SL2-B aptamer conjugate could specifically recognizeHep G2 liver cancer cells and is taken up by the cells without addition of any external transfecting orcell permeabilizing agent. In addition, the results also indicate that incubation time is important forthe aptamer cellular uptake and to exhibit its antiproliferative activity on Hep G2 liver cancer cells.This QDs labeling technique provides a new strategy for labeling aptamer molecules for aptamerdetection, imaging and understanding their cellular uptake.

Keywords: Aptamer, Quantum Dots, VEGF, Fluorescence, Cellular Uptake.

1. INTRODUCTIONIn 1990, an in vitro selection process called systematicevolution of ligands by exponential enrichment (SELEX)was developed to screen single-stranded nucleic acidmolecules from random pool of library against the tar-get ligand.1�2 This class of single-stranded molecules isreferred to as “aptamers.” They possess high binding affin-ity and specificity that are comparable to monoclonal anti-bodies. However, unlike prevalent monoclonal antibodies,aptamers are small in size, non-immunogenic and can beeasily modified which makes them promising candidateson therapeutic front.3�4 Furthermore, different SELEXmethods have been developed to meet the needs of theresearchers such as cell-SELEX, microfluidic SELEX andcapillary electrophoresis SELEX (CE-SELEX).5�6�7

Apart from susceptibility to degradation by nucleasesattack and rapid renal filtration, another limitation forin vitro and in vivo application of aptamers is theirinefficient cellular uptake.8�9 However, this limitation isapplicable to aptamers where cellular uptake is impor-tant for its therapeutic functions. Presently, most of theselected aptamers have very poor cellular uptake and can-not be taken up by the cells without external aid oftransfecting and cell permeabilizing agents. Several inher-ent factors such as size and nucleic acid charge acts as

potent barrier to cellular uptake.10 Due to the presence ofnegatively-charged phosphate backbone, aptamer experi-ence electrostatic repulsion from negatively-charged cellmembrane surface and thereby resulting in inadequate cel-lular association and hence, affecting their cellular uptake.Moreover, sequences more than 25 bases are difficult toimport into the living cells because of their size andself-hybridization tendency. To date, very few aptamers,such as anti-PSMA (prostate-specific membrane antigen)aptamer, ACT-GRO-777 (or AS1411) aptamer that bindsto nucleolin protein, and sgc8 aptamer that binds toacute lymphoblastic leukemia (ALL) T-cells, can directlybe internalized without the use of external agents.11–13

Moreover, the cell internalization property of anti-PSMAaptamer has enabled them to deliver siRNAs and anti-cancer drugs into the cells.14�15 For other aptamers, cur-rently the cellular uptake problem is countered by use ofvarious transfection methods such as complexation withliposomes and vector delivery systems.16–19

In the past few years, nanometer sized semiconduct-ing crystals referred to as quantum dots (QDs) areattracting more and more attention for their potentialapplications in biosensors, cell labeling, and biologicalimaging.20–22 QDs exhibit several advantages over theconventional organic fluorophores such as high quantum

3798 J. Nanosci. Nanotechnol. 2019, Vol. 19, No. 7 1533-4880/2019/19/3798/006 doi:10.1166/jnn.2019.16735

http://www.aspbs.com/jnn



Kaur Aptamer Conjugated Quantum Dots for Imaging Cellular Uptake in Cancer Cells

yields, long-term photostability, single-wavelength excita-tion, and size-dependent tunable emission. More recently,several groups have engineered QDs and conjugated themwith antibodies, peptides, and oligonucleotides resultingin the development of highly sensitive imaging probes forin vitro or in vivo applications.23–26 However, the pres-ence of toxic elements such as cadmium and selenium inthe core part of QDs makes these nanoparticles inherentlytoxic and, and concerns have been raised about the toxic-ity effects of QDs to both cell cultures and live animals.27

This problem has been mitigated by use of mechanismsuch as polymer encapsulation and core-coatings, whichreduces the toxicity to certain extent.28�29

In our previous work, a SL2-B aptamer sequence wasidentified that binds to VEGF165 protein with Kd =0.5 nM.30 The aptamer was further chemically modifiedto enhance its stability against nucleases enzymes in thebiological fluids and antiproliferative potential of modi-fied aptamer was demonstrated in Hep G2 liver cancercells under hypoxia conditions. This chemically modifiedaptamer was referred to as PS-modified SL2-B aptamer.In the current study, the cellular fate of PS-modified SL2-Baptamer was investigated after binding to VEGF165 pro-tein in Hep G2 cancer cells using confocal imaging. QDswere used as fluorescent probes for imaging purpose due totheir superior fluorescent properties above-mentioned. Dif-ferent techniques including transmission electron micro-scope (TEM), dynamic light scattering (DLS), agarose gelelectrophoresis, and fluorescence spectroscopy were firstused to characterize QDs and QD-aptamer conjugates. Thecellular uptake of the synthesized QD-aptamer conjugateswas imaged using laser scanning confocal microscopy. Theresults demonstrate that PS-modified SL2-B aptamer afterbinding to VEGF165 protein can be taken up by Hep G2cancer cells without the presence of any external transfect-ing or cell permeabilizing agent in the medium. Further-more, the data suggest this cellular uptake may be involvedfor SL2-B aptamer to exhibit its antiproliferative activityon Hep G2 cancer cells.

2. EXPERIMENTAL DETAILS2.1. MaterialsCadmium oxide (CdO, 99.99%), selenium powder (Se,100 mesh, 99.99%), trioctylphosphine (TOP, >90%),trioctylphosphine oxide (TOPO, 90%), hexadecylamine(HDA, >99%), diethylzinc solution, tetramethyldisilithi-ane, 1-ethyl-3-(3-dimethylaminopropyl) carbodimmidehydrochloride (EDC) and N-hydroxysuccimide (NHS),fluorescein were purchased from Sigma-Aldrich. Glu-tathione (GSH, reduced) and tetramethylammoniumhydroxide (TMAH) were purchased from Merck. TheHPLC grade unlabeled and Texas red-labeled PS-modified SL2-B aptamer sequence (5′-[NH2-C6-C∗AATTGGGCCCGTCCGTATGGTGGG∗T]-3′, where ∗ is phos-phorothioate linkage) were purchased from Sigma-Aldrich.

The sequence of scrambled aptamer used in the studyis 5′-[NH2-C6-T∗TTCGGTCGTGAACCGCGTTACGGG∗G]-3′.Nanosep spin filters were purchased from Pall Filtrations.Agarose gel and tris-borate-EDTA buffer (0.089 M tris,0.089 M borate and 0.002 M EDTA) were purchased from1st Base. Human hepatocellular carcinoma (Hep G2) cellline was a gift from Dr. Tong Yen Wah’s lab. The hypoxiachamber was purchased from Billups-Rothenberg. Dul-becco’s modified eagle’s media (DMEM) and fetal bovineserum (FBS) were purchased from Caisson Laboratories.Trypsin-EDTA and 1% penicillin/streptomycin mixturewere purchased from PAN biotech. The chamber slideswere purchased from Thermo Fischer Scientific. Hoechst33342 trihydrochloride trihydrate dye and wheat germagglutinin, Alexa Fluor 488 conjugate dye were purchasedfrom Invitrogen. Para-formaldehyde was purchased fromSigma-Aldrich. Phosphate buffer saline (PBS, 137 mMNaCl, 2.7 mM KCl, and 10 mM phosphate buffer) waspurchased from 1st Base. Deionized water was used forall the experiments.

2.2. Synthesis of Core–Shell CdSe/ZnS QDsCore–shell CdSe/ZnS QDs were synthesized by reactingorganometallic precursors at high temperatures in a coor-dinating solvent mixture. 0.068 g of CdO, 5.91 g of TOPOand 6.02 g of HDA were kept under vacuum for 1 hourand the heated at 110 �C for 2 hours. After degassing,the cadmium precursor solution was then heated at 330 �Cunder nitrogen atmosphere until it forms colorless solutionand then cooled to 300 �C for stabilization for 2 hours.The degassed Se powder dissolved in 3.5 ml of TOPwas rapidly injected into cadmium solution. Subsequently,overcoating CdSe core with thin layer of ZnS formed aCdSe/ZnS core–shell QDs. The ZnS precursor solutionwas added drop wise to passivate CdSe core surface. Whenthe temperature reaches 80 �C, toluene was added to theproduct mixture. The synthesized organic QDs were cen-trifuged at 10,000 rpm for 15 minutes to remove excess ofTOPO and redissolved back in toluene.

2.3. Synthesis of Glutathione (GSH)-CappedCdSe/ZnS QDs

The organic QDs were made hydrophilic using GSH ascapping agent by ligand exchange. The GSH consisting ofboth the sulphydryl and carboxylic group forms a disul-phide (S–S) bond with ZnS coating on CdSe/ZnS QDsthereby exposing the carboxylic group. GSH dissolved inTMAH, a phase transfer reagent, was added dropwise to1 ml of organic QDs dissolved in 10 ml of chloroform.Obtained upper aqueous layer was centrifuged twice at7500 rpm for 5 minutes and finally the pellet was dis-solved in 8 ml of DI water. The quantum yield of QDs wascalculated relative to fluorescein (whose quantum yield is95%) by measuring integrated fluorescence intensity ofQDs and the fluorescein and then plotting graph between

J. Nanosci. Nanotechnol. 19, 3798–3803, 2019 3799



Aptamer Conjugated Quantum Dots for Imaging Cellular Uptake in Cancer Cells Kaur

absorbance versus integrated fluorescence intensity. Theslope obtained from the graph was used to calculate quan-tum yield using the equation,

� =�fluorescein�S/Sfluorescein��2/�2

fluorescein�

where � = quantum yield of the QDs, �fluorescein =quantum yield of fluorescein, S = slope of the graph, and� = refractive index of the solution.

2.4. Conjugation of PS-Modified SL2-B AptamerSequence to QDs

The GSH-capped CdSe/ZnS core–shell QDs were conju-gated with SL2-B aptamer sequence using EDC/NHS acti-vation chemistry. The aptamer was added to the activatedQDs in molar ratio of 1:10, followed by incubation for3 hours at room temperature. The unconjugated aptamersequence was removed through Nanosep filters by cen-trifuging at 10,000 g for 5 minutes. The final QD-aptamerbioconjugates were resuspended in PBS buffer (pH 7.4).

2.5. Characterization of QDs andQD-Aptamer Bioconjugates

The fluorescence spectrum of QDs was obtained with aPerkin Elmer LS 55 fluorescence spectrometer using 1 cmquartz cuvette, 480 nm excitation wavelength with exci-tation and emission slit width set at 10 nm. The sizeof QDs was determined by using a JEOL 2010F high-resolution transmission electron microscope. The samples(15 �l) were dropped on carbon-coated copper grid anddried overnight before taking the measurement. The zetapotential of QDs and QD-aptamer conjugates was mea-sured using a Malvern Instruments Nano-ZS zeta sizermachine. 15 �l of QDs and QD-aptamer conjugates wereloaded to separate wells and ran on 0.7% agarose gel at100 V in TBE buffer for 1.5 hour using BIORAD gel elec-trophoresis apparatus and gel was illuminated using theGeneSnap software from a Syngene bioimaging gel docu-mentation system. The photobleaching experiment of QDsand QD-aptamer conjugates was performed using a NikonA1Rsi laser scanning spectral confocal microscope system.

2.6. Cell Binding Studies and FluorescenceQuenching Assay

Human hepatocellular carcinoma Hep G2 cells (0.1×105 cells/ml) were grown on chamber slides in DMEMmedia supplemented with 10% FBS and 1% penicillin-streptomycin. The cells were incubated with 100 �lof 0.01 nM of QD-aptamer conjugates and Texas red-labeled aptamer conjugates at 37 �C in hypoxia condi-tion (5% CO2, 1% O2, and 94% N2) inside the hypoxiachamber. No transfecting or cell permeabilizing agentwas added to enhance the cellular uptake. After incuba-tion, cells were washed with PBS buffer (pH 7.4) threetimes. The cell nuclei were stained with Hoechst dye and

plasma membrane with Alexa fluor dye using standardstaining procedures. The cells were then fixed using 4%paraformaldehyde solution. Localization of QDs and QD-aptamer conjugates were performed using laser scanningspectral confocal microscopy (Nikon A1Rsi, 60× objec-tive). The cellular uptake was determined by measuring thefluorescence intensity of the conjugates in 50 cells usingImage J software.

3. RESULTS AND DISCUSSION3.1. Characterization of QDsBefore using QDs for biological studies, their optical prop-erties should first be characterized. Highly photolumines-cent aqueous core–shell CdSe/ZnS QDs were synthesizedwith bright red color emission at 610 nm wavelength(Fig. 1(A)). The QDs were photostable for more than2 months, with narrow emission spectra and full widthhalf maximum (FWHM) as narrow as 28 nm. Figure 1(B)illustrates the high resolution TEM image of synthe-sized QDs. The TEM images confirm the size of QDsin 3–5 nm range. The TEM images shows well resolved

(a)

(b)

Figure 1. (a) Fluorescence emission spectra of CdSe/ZnS aqueousQDs. (b) High resolution TEM image showing well-monodisperseCdSe/ZnS aqueous QDs.

3800 J. Nanosci. Nanotechnol. 19, 3798–3803, 2019




lattice structure of monodisperse QDs. However, no infor-mation can be deduced about the CdSe/ZnS interface fromthe images.

Quantum yield calculations of QDs determine the qual-ity of the synthesized QDs. The quantum yield is highlyinfluenced by the coating agent used, its charge, and typeof solvent in organic QDs. According to the reported liter-ature, the quantum yield of aqueous QDs decreases dras-tically in comparison to the original organic QDs uponphase transfer. In this work, QDs showed very high quan-tum efficiency with quantum yield dropping by only 13.4%on phase transfer from organic to aqueous phase (�organic=70.11%, �aqueous = 57.71%). These values are better orcomparable to the reported quantum yield results for aque-ous QDs.31�32

3.2. Characterization of QD-Aptamer ConjugatesThe formation of QD-aptamer conjugates was confirmedusing agarose gel electrophoresis and zeta potential mea-surements. Lane 1 and Lane 2 in Figure 2 show the gelimages of QDs before and after the conjugation with theaptamer respectively. It is apparent that the electrophoreticmobility of the QD-aptamer conjugates is faster than theQDs alone, confirming the formation of QD-aptamer con-jugates. The conjugates run faster due to higher charge tomass ratio after the attachment of the negatively-chargedDNA aptamer molecules to the QDs surface. In addition,conjugation of 5′end NH2-modified aptamer with –COOHgroup of aqueous QDs increased zeta potential by 57.3 mV(Fig. 3). The increase is due to the conjugation of highlynegatively-charged DNA aptamer molecule to the QDs sur-face that increases the overall surface charge on QDs.

Figure 2. Agarose gel electrophoresis analysis of QDs conjugationwith aptamer. Shown here is QDs (Lane 1) and QD-aptamer conjugates(Lane 2).

Figure 3. Zeta potential distribution of QDs (−25.1 mV) and QD-aptamer conjugates (−82.4 mV).

3.3. Photobleaching Effect of QD-AptamerConjugates and Texas Red-Labeled Conjugates

Photobleaching is one of the major limitations of theconventional organic dyes and fluorescent proteins beingused for cellular and medical imaging. The photobleach-ing effect was compared on the synthesized QD-aptamerconjugates and commercially available Texas red-labeledaptamer conjugates. Both conjugates were exposed tolaser light continuously using laser scanning confocalmicroscopy. The fluorescence intensity of the Texas redaptamer conjugates dropped to zero within 5 minutes butthe fluorescence intensity of the QD-aptamer conjugateswas stable even after more than 60 minutes of contin-uous exposure to laser light (Fig. 4). The result clearlyindicates the high photostability of QD-aptamer conjugatescompared to the Texas red-labeled aptamer conjugates andtheir potential as fluorescent probe for long period cellularimaging.

3.4. Confocal Imaging of QD-Aptamer Conjugates inHep G2 Cancer Cells

As demonstrated in the previous study, the PS-modifiedSL2-B aptamer displays sequence dependent inhibitionon cellular proliferation of Hep G2 cells by bindingto VEGF165 protein.33 Keeping this in consideration, thecellular uptake of this aptamer in Hep G2 cells wasinvestigated using synthesized QD-aptamer conjugates.To quantitate the conjugates uptake by Hep G2 cells,a time interval experiment was conducted and evaluated

Figure 4. Comparison of fluorescence emission intensity of QD-aptamer conjugates (smooth line) and Texas red-labeled aptamer conju-gate (dashed line) on continuous exposure of laser light (�= 488 nm).




Aptamer Conjugated Quantum Dots for Imaging Cellular Uptake in Cancer Cells Kaur

by measuring the fluorescence intensity signal obtainedusing laser scanning confocal microscopy. Results shownin Figure 5 demonstrated significant differences in thecellular uptake of conjugates based on the incubationtime. After 24 hours of incubation, the confocal imageindicated the presence of conjugates on the cell mem-brane surface without any substantial cellular uptake ofconjugates (Fig. 5(A)). However, the amount of intra-cellular conjugate population increased with the increasein incubation time. The percentage of conjugates insidethe Hep G2 cells increased by 6-fold after 36 hoursof incubation (Fig. 5(B)). After 48 hours, the cellularuptake was further increased by 2-fold (Fig. 5(C)). Theenhanced uptake of conjugates with increase in the incu-bation time correlates with the stronger antiproliferativeactivity observed at 72 hours of incubation in the previousstudy. The data shows that PS-modified SL2-B aptamerafter binding to VEGF165 protein get internalized with-out any external aid and appears to exhibit its antipro-liferative activity in Hep G2 cells with increase in thecellular uptake. This finding is in agreement with the

Figure 5. Confocal image analysis. Fluorescent confocal microscopicimages of Hep G2 incubated with QD-aptamer conjugates for differ-ent time intervals (a) 24 hours (b) 36 hours (c) 48 hours, (d) Hep G2cells incubated with QD-scrambled aptamer conjugates for 48 hours.(e) Hep G2 cells incubated with texas red labeled aptamer conjugate for48 hours. (f) Hep G2 cells only. For all the images, the nuclei werestained with Hoechst 33342 (blue color) and cell membrane with AlexaFluor 488 dye (green color). Cells were fixed using 4% paraformaldeyde.

correlation observed between cellular uptake and antipro-liferative activity in ACT-GRO-777 (AS1411) aptamer tar-geted against nucleolin protein.34–36 Moreover, no cellularuptake was observed with scrambled aptamer conjugates(Fig. 5(D)). This confirms the cellular internalization ofconjugates is aptamer-specific and not dependent on QDs.However, further experimental studies are warranted toelucidate the correlation between cellular uptake of SL2-Baptamer and its antiproliferative activity in Hep G2 cells.Moreover, from the confocal images, the conjugates appearto be localized in the cell cytoplasm and around the nuclei.Compared to QD-aptamer conjugates, a weak fluores-

cence signal was observed for Texas red-labeled aptameron incubation for 48 hours with Hep G2 cells (Fig. 5(E)).Furthermore, autofluorescence effect studied using onlyHep G2 cells as control displayed a negligible fluorescencein comparison to the QD-aptamer conjugates (Fig. 5(F)).These results illustrate the use of QD-aptamer as fluores-cent probes for cellular imaging and demonstrate the effecton the cellular uptake of aptamer at the extended time peri-ods in cancer cells. However, further studies are neededto elucidate the molecular mechanism of the PS-modifiedSL2-B aptamer for its antiproliferative activity in cancercells.

4. CONCLUSIONIn conclusion, this study shows that Hep G2 cancer cellscan uptake PS-modified SL2-B aptamer without additionof any external transfecting or cell permeabilizing agentsin the medium. Moreover, this cellular uptake study pro-vides valuable information that cellular uptake of aptamerwith increase in incubation time seems to be importantfor it to exhibit its antiproliferative activity in cancer cells.Thus, conjugation of this aptamer with other anti-cancerdrugs can be useful for specific intracellular delivery andto further enhance the inhibitory action on cancer cells.Furthermore, long-term photostability of the QDs probesmakes them potentially useful for in vitro studies whenlong periods of monitoring are required. Thus, the cou-pling of high fluorescence emission and photostability ofthe QDs with high degree of specificity of the aptamers canbe a powerful tool for biolabeling and targeting studies.

References and Notes1. A.-D. Ellington and J.-W. Szostak, Nature 346, 818 (1990).2. C. Tuerk and L. Gold, Science 249, 505 (1990).3. S.-D. Jayasena, Clin. Chem. 45, 1628 (1999).4. H. Kaur, J.-G. Bruno, A. Kumar, and T.-K. Sharma, Theranostics

8, 4016 (2018).5. H. Kaur, BBA-General Subjects 1862, 2323 (2018).6. L.-Y. Hung, C.-H. Wang, K.-F. Hsu, C.-Y. Cho, and G.-B. Lee, Lab

Chip 14, 4017 (2014).7. J. Yang and M.-T. Bowser, Anal Chem. 85, 1525 (2013).8. S. Agrawal, J. Temsamani, W. Galbraith, and J. Tang, Clin Pharma-

cokinet. 28, 7 (1995).9. M. Rimmele, ChemBioChem. 4, 963 (2003).

3802 J. Nanosci. Nanotechnol. 19, 3798–3803, 2019




10. S.-D. Patil, D.-G. Rhodes, and D.-J. Burgess, AAPS J. 7, E61 (2005).11. E.-W. Choi, L.-V. Nayak, and P.-J. Bates, Nucleic Acids Res.

38, 1623 (2009).12. O.-C. Farokhzad, S. Jon, A. Khademhosseini, T.-N.-T. Tran, D.-A.

LaVan, and R. Langer, Cancer Res. 64, 7668 (2004).13. Z. Xiao, D. Shangguan, Z. Cao, X. Fang, and W. Tan, Chemistry

(Weinheim an derBergstrasse, Germany) 14, 1769 (2008).14. T.-C. Chu, J.-W. MarksIII, L.-A. Lavery, S. Faulkner, M.-G.

Rosenblum, A.-D. Ellington, and M. Levy, Cancer Res. 66, 5989(2006).

15. T.-C. Chu, K.-Y. Twu, A.-D. Ellington, and M. Levy, Nucleic AcidsRes. 34, e73 (2006b).

16. L. Chaloin, M.-J. Lehmann, G. Sczakiel, and T. Restle, Nucleic AcidsRes. 30, 4001 (2002).

17. P.-D. Good, A.-J. Krikos, S.-X.-L. Li, E. Bertrand, N.-S. Lee,L. Giver, A. Ellington, J.-A. Zaia, J.-J. Rossi, and D.-R. Engelke,Gene Ther. 4, 45 (1997).

18. M.-J. Mann and V.-J. Dzau, J. Clin. Invest. 106, 1071 (2000).19. R.-R. White, B.-A. Sullenger, and C.-P. Rusconi, J. Clin. Invest.

106, 929 (2000).20. I.-L. Medintz, H. Mattousi, and A.-R. Clapp, Int. J. Nanomed. 3, 151

(2008).21. H. Zhang, D. Yee, and C. Wang, Nanomed. 3, 91 (2008).22. R. Singh and H. S. Nalwa, J. Biomed. Nanotechnol. 7, 489 (2011).23. L. Chaloin, M.-J. Lehmann, G. Sczakiel, and T. Restle, Nucleic Acids

Res. 30, 4001 (2002).

24. X. Gao, Y. Cui, R.-M. Levenson, L.-W.-K. Chung, and S. Nie,Nature Biotechnol. 22, 969 (2004).

25. M. Ikanovic, W.-E. Rudzinski, J.-G. Bruno, A. Allman, M.-P.Carrillo, S. Dwarakanath, S. Bhahdigadi, P. Rao, J.-L. Kiel, and C.-J.Andrews, J. Fluoresc. 17, 193 (2007).

26. M.-H. Ko, S. Kim, W.-J. Kang, J.-H. Lee, H. Kang, S.-H. Moon,D.-W. Hwang, H.-Y. Ko, and D.-S. Lee, Small 5, 1207 (2009).

27. A.-M. Derfus, W.-C.-W. Chan, and S.-N. Bhatia, Nano Lett. 4, 11(2004).

28. B. Ballou, B.-C. Lagerholm, L.-A. Ernst, M.-P. Bruchez, and A.-S.Waggoner, Bioconjugate Chem. 15, 79 (2004).

29. Y. Su, Y. He, H. Lu, L. Sai, Q. Li, W. Li, L. Wang, P. Shen,Q. Huang, and C. Fan, Biomaterials 30, 19 (2009).

30. H. Kaur and L.-Y.-L. Yung, PLoS ONE 7, e31196 (2012).31. M. Bäumle, D. Stamou, J.-M. Segura, R. Hovius, and H. Vogel,

Langmuir 20, 3828 (2004).32. H.-Q. Wang, Y.-Q. Li, J.-H. Wang, Q. Xu, X.-Q. Li, and Y.-D. Zhao,

Anal. Chim. Acta. 610, 68 (2008).33. H. Kaur, J.-J. Li, B.-H. Bay, and L.-Y.-L. Yung, PLoS One 8, e50964

(2013).34. P.-J. Bates, D.-A. Laber, D.-M. Miller, S.-D. Thomas, and J.-O.

Trent, Exp. Mol. Pathol. 86, 151 (2009).35. E.-W. Choi, L.-V. Nayak, and P.-J. Bates, Nucleic Acids Res.

38, 1623 (2009).36. S. Soundararajan, W. Chen, E.-K. Spicer, N.-C. Luck, and D.-J.

Fernandes, Cancer Res. 68, 2358 (2008).

Received: 3 September 2018. Accepted: 10 November 2018.


aptamer conjugated quantum dots for imaging cellular...

Documents