aptamer-mediated ‘turn-off/turn-on’ nanozyme · 2014-10-03 · mohammadtaheri,a hemant kumar...
TRANSCRIPT
![Page 1: Aptamer-mediated ‘turn-off/turn-on’ nanozyme · 2014-10-03 · Mohammadtaheri,a Hemant Kumar Daima,a,c Ravi Shuklaa and Vipul Bansala,* aIan Potter NanoBioSensing Facility, NanoBiotechnology](https://reader033.vdocument.in/reader033/viewer/2022050104/5f432ed80c9ca755ab444dd2/html5/thumbnails/1.jpg)
S1
Electronic Supplementary Information
for
Aptamer-mediated ‘turn-off/turn-on’ nanozyme
activity of gold nanoparticles for kanamycin detection
Tarun Kumar Sharma,a,b,
* Rajesh Ramanathan,a Pabudi Weerathunge,
a Mahsa
Mohammadtaheri,a Hemant Kumar Daima,
a,c Ravi Shukla
a and Vipul Bansal
a,*
aIan Potter NanoBioSensing Facility, NanoBiotechnology Research Laboratory, School of Applied
Science, RMIT University, GPO Box 2476V, Melbourne VIC 3001, Australia.
bCentre for Biodesign and Diagnostics, Translational Health Science and Technology Research Institute,
Gurgaon, Haryana 247667, India.
cDepartment of Biotechnology, Siddaganga Institute of Technology, Tumkur, Karnataka 572103, India.
*Email: [email protected] (V. B.); [email protected] (T. K. S.)
Fax: +61 3 99253747; Tel: +61 3 99252121
Electronic Supplementary Material (ESI) for ChemComm.This journal is © The Royal Society of Chemistry 2014
![Page 2: Aptamer-mediated ‘turn-off/turn-on’ nanozyme · 2014-10-03 · Mohammadtaheri,a Hemant Kumar Daima,a,c Ravi Shuklaa and Vipul Bansala,* aIan Potter NanoBioSensing Facility, NanoBiotechnology](https://reader033.vdocument.in/reader033/viewer/2022050104/5f432ed80c9ca755ab444dd2/html5/thumbnails/2.jpg)
S2
Experimental Details.
Materials. Gold (III) chloride (HAuCl4.3H2O), tyrosine, kanamycin, ampicillin, penicillin,
streptomycin and other reagents used in this study were procured from Sigma-Aldrich (St. Louis,
USA). Two component TMB kit containing 3,3,5,5-Tetramethylbenzidine (TMB) and H2O2 kit was
obtained from BD Bioscience and used as per the supplier’s protocol. The sequence for kanamycin
aptamer Ky2 [5’TGGGGGTTGAGGCTAAGCCGA3’] was obtained from a previous study.1 Ky2
aptamer and its three mutants viz. Ky2 M-1 [5’TGGGGGTTGAAACTAAGCCGA3’], Ky2 M-2
[5’TGGGGGGTGAGGCTACGCCGA3’] and Ky2 M3 [5’TGGGGGTTTTTTTTTAGCCGA3’] were
custom-synthesised through Integrated DNA Technologies (IDT, USA). Notably, in Ky2 M-1, GG
sequence in the Ky2 aptamer loop was mutated to AA; in Ky2 M-2, AT sequence in the original stem
was mutated to GC; while in Ky2 M-3, all nucleotides in the original loop region were replaced with T.
These mutations allowed the importance of nucleotides present in the Ky2 aptamer’s loop as well as
stem regions in kanamycin sensing to be systematically studied.
Synthesis of gold nanoparticles (GNPs). GNPs were synthesised using tyrosine amino acid as a
reducing and capping agent, as elaborated in our previous studies.2,3
Briefly, 300 mL aqueous solution
comprising of 0.1 mM L-tyrosine and 0.1 mM KOH were allowed to boil. Under alkaline boiling
conditions, 0.2 mM equivalent of [AuCl4]- ions were added to the above solution with subsequent
boiling for further 5 min. This resulted in a ruby-red coloured solution consisting of GNPs. To prepare
concentrated GNP solution, as-synthesised nanoparticles were boiled to reduce the volume to 30 mL.
These colloidal solutions were found to be highly stable even after concentration, signifying the
strong tyrosine capping. Further, concentrated solution of GNPs was dialysed overnight against
deionised MilliQ water using 12 kDa molecular weight cut-off cellulose dialysis membranes, followed
by exchange of water twice to remove the excess amount of KOH, potentially unreduced metal ions
and unbound tyrosine, if any. The concentration of gold in GNPs was determined using atomic
absorption spectroscopy (Varian) after digesting GNPs in aqua-regia, followed by preparation of an
aqueous GNP stock solution with 1 mM equivalent of gold. This GNP solution was further used for
characterisation and subsequent biosensing experiments.
Materials characterisation. The homogeneous colloidal solution obtained after removal of unbound
amino acids and ions was characterized by UV−visible absorbance spectroscopy using Envision
multilabel plate reader (PerkinElmer). The samples for transmission electron microscopy (TEM) were
prepared by drop-coating the solutions on to carbon-coated copper grids, followed by TEM
measurements using a JEOL 1010 TEM instrument operated at an accelerating voltage of 100 kV.
![Page 3: Aptamer-mediated ‘turn-off/turn-on’ nanozyme · 2014-10-03 · Mohammadtaheri,a Hemant Kumar Daima,a,c Ravi Shuklaa and Vipul Bansala,* aIan Potter NanoBioSensing Facility, NanoBiotechnology](https://reader033.vdocument.in/reader033/viewer/2022050104/5f432ed80c9ca755ab444dd2/html5/thumbnails/3.jpg)
S3
Dynamic light scattering (DLS) measurements on different GNP solutions were carried out using a
Malvern Nano-Zs/Zen3600 zetasizer instrument.
Functionalisation of GNPs with Ky2 aptamer and its mutants. It has been well-established that in
the presence of GNPs, ssDNA can uncoil sufficiently due to the structural flexibility exposing its
nitrogenous bases to GNPs, whereas dsDNA presents its negatively charged phosphate backbone to the
surface of GNPs due to its stable double helical geometry.4 Therefore, the coordination interaction
between the nitrogenous bases of the unfolded ssDNA and GNPs is stronger than the electrostatic
repulsion between the negatively charged phosphate backbone of dsDNA and GNPs. This concept has
also been previously employed for conductometric detection of DNA hybridization by exploiting the
self-catalytic glucose oxidase-like activity of GNPs.5 In the current study, similar concept was utilised
for efficient non-covalent adsorption of ssDNA Ky2 aptamer onto the GNP surface. For GNP-aptamer
binding, before incubation of Ky2 aptamer with GNPs, the appropriate secondary structure of Ky2 was
ascertained by its heat-treatment at 92 °C for 10 min, followed by snap-chilling on ice for 5 min and
bringing it back to room temperature. Following this, different concentrations of Ky2 aptamer (100-
750 nM) were incubated with a fixed concentration of GNPs (75 µM) for 10 min. In a similar manner,
the ability of three mutated versions of Ky2 aptamer viz. Ky2 M-1, Ky2 M-2 and Ky2 M3 to bind to
GNPs was also studied.
Biosensing of kanamycin using aptamer-conjugated GNPs. To achieve high sensitivity without
compromising specificity during biosensing, a number of experiments were performed to optimise
experimental parameters such as the concentration of Ky2 aptamer relative to GNP concentration, as
well as the reaction temperature. To determine the optimum temperature for peroxidase-like activity of
GNPs, in a 200 µL reaction volume, 75 µM GNPs were incubated with components provided in the
TMB kit as per the supplier’s (BD Biosciences) protocol, and activity was assessed at three different
temperatures (25, 37 and 55 ºC) after 8 min of reaction by measuring oxidation product of TMB
through UV-visible absorbance spectroscopy at 650 nm. Among these, 37 ºC showed the highest
degree of oxidation of TMB. Therefore all further experiments in the current study were performed at
37 ºC. The optimum concentration of Ky2 aptamer relative to GNP concentration was optimised by
incubating a range of aptamer concentrations (100-750 nM) with fixed concentration of GNPs (75 µM)
for 10 min, followed by addition of TMB and H2O2 in 200 µL reaction volume and evaluation of
peroxidase-like activity of aptamer-functionalised GNPs after 8 min. From above experiments, 500 nM
Ky2 aptamer concentration showed the highest inhibition of nanozyme activity of GNPs, beyond which
no further inhibition of activity was observed. Therefore all further experiments employed 500 nM Ky2
aptamer functionalised on to the surface of 75 µM GNPs at 37 ºC in 200 µL volume, either in the
![Page 4: Aptamer-mediated ‘turn-off/turn-on’ nanozyme · 2014-10-03 · Mohammadtaheri,a Hemant Kumar Daima,a,c Ravi Shuklaa and Vipul Bansala,* aIan Potter NanoBioSensing Facility, NanoBiotechnology](https://reader033.vdocument.in/reader033/viewer/2022050104/5f432ed80c9ca755ab444dd2/html5/thumbnails/4.jpg)
S4
presence or absence of different analytes (kanamycin, ampicillin, penicillin and streptomycin). The
above experiments involving wild-type Ky2 aptamer conjugated on to GNPs were also performed in a
concentration- and time-dependent manner, wherein the influence of different concentrations of
analytes on peroxidase-like activity of Ky2-GNPs was studied as a function of time. In addition to the
spectroscopic examination, optical photographs of the reactions were also captured using a digital
camera (Canon) to allow a visual readout of the biosensing event. To further ascertain that GNP-Ky2
mediated kanamycin detection is governed by specific ssDNA sequence of Ky2 aptamer, control
experiments were performed under similar condition, wherein the kanamycin sensing performance of
GNPs functionalised with three mutated Ky2 aptamers viz. Ky2 M-1, Ky2 M-2 and Ky2 M-3 was
evaluated.
Determination of apparent dissociation constant (Kd) of Ky2 aptamer. To determine the Kd of
Ky2-kanamycin interaction, different concentrations of kanamycin (1-200 nM) were incubated with
GNP-Ky2 nanoconjugate prepared as per the aforementioned protocol. Peroxidase-like activity of these
nanoconjugates was monitored as a function of kanamycin concentration, which correlated to the
dissociation of Ky2 aptamer from GNP surface to allow aptamer-kanamycin interaction. The obtained
data was fitted using a Michaelis-Menten model and apparent dissociation constant (Kd) of kanamycin
with Ky2 aptamer was determined.
Evaluation of the biosensing performance of the proposed nanozyme assay. Important biosensor
parameters such as limit of detection (LoD), limit of quantification (LoQ), linearity, accuracy and
precision of the proposed assay were also determined. LoD was determined as quotient of 3.3*SD to S
whereas, LoQ was expressed as quotient of 10*SD to S, wherein SD corresponds to standard deviation
of y-intercepts and S is the slope of the specific calibration curve obtained from data in the linear range.
Since the response of biosensor to kanamycin followed a typical Michaelis-Menten behaviour, the
linearity of the biosensor was determined by plotting kanamycin concentration (x-axis) dependent
response (y-axis) in the form of a log-linear (x-y) curve. The accuracy and the precision of the proposed
biosensor were tested by exposing 5 nM kanamycin to the GNP-Ky2 nanoconjugates in 20 independent
experiments, followed by obtaining the sensor response. Thereafter, the % accuracy was calculated at
5% and 10% confidence interval levels as (n/N)*100, wherein n is the number of sensing events that
fall within the target concentration (5 nM) and N is the total number of test events. The % precision
was calculated by the coefficient of variation (CoV) method by using the formula %Precision = 100 -
%CoV.
![Page 5: Aptamer-mediated ‘turn-off/turn-on’ nanozyme · 2014-10-03 · Mohammadtaheri,a Hemant Kumar Daima,a,c Ravi Shuklaa and Vipul Bansala,* aIan Potter NanoBioSensing Facility, NanoBiotechnology](https://reader033.vdocument.in/reader033/viewer/2022050104/5f432ed80c9ca755ab444dd2/html5/thumbnails/5.jpg)
S5
References
1 K. M. Song, M. Cho, H. Jo, K. Min, S. H. Jeon, T. Kim, M. S. Han, J. K. Ku and C. Ban, Anal.
Biochem., 2011, 415, 175–181
2 H. K. Daima, P. R. Selvakannan, R. Shukla, S. K. Bhargava and V. Bansal, PLoS ONE 2013, 8,
e79676.
3 P. R. Selvakannan, R. Ramanathan, B. J. Plowman, Y. M. Sabri, H. K. Daima, A. P. O'Mullane,
V. Bansal and S. K. Bhargava, Phys. Chem. Chem. Phys. 2013, 15, 12920-12929.
4 H. Li and L. Rothberg, Proc. Natl. Acad. Sci. U. S. A. 2004, 101, 14036-14039.
5 J. Zhang, H. Nie, Z. Wu, Z. Yang, L. Zhang, X. Xu and S. Huang. Anal. Chem. 2013, 86, 1178-
1185.
![Page 6: Aptamer-mediated ‘turn-off/turn-on’ nanozyme · 2014-10-03 · Mohammadtaheri,a Hemant Kumar Daima,a,c Ravi Shuklaa and Vipul Bansala,* aIan Potter NanoBioSensing Facility, NanoBiotechnology](https://reader033.vdocument.in/reader033/viewer/2022050104/5f432ed80c9ca755ab444dd2/html5/thumbnails/6.jpg)
S6
Figure S1. Secondary structure of aptamer Ky2 as predicted by M-Fold tool based on Zuker algorithm.
![Page 7: Aptamer-mediated ‘turn-off/turn-on’ nanozyme · 2014-10-03 · Mohammadtaheri,a Hemant Kumar Daima,a,c Ravi Shuklaa and Vipul Bansala,* aIan Potter NanoBioSensing Facility, NanoBiotechnology](https://reader033.vdocument.in/reader033/viewer/2022050104/5f432ed80c9ca755ab444dd2/html5/thumbnails/7.jpg)
S7
Figure S2. (a) UV-visible absorbance spectra, (b-d) TEM images, and (e) dynamic light scattering
measurements on (b) pristine GNPs, (c) Ky2 aptamer-bound GNPs and (d) Ky2 aptamer-bound GNPs
on exposure to kanamycin. Scale bars in TEM images correspond to 50 nm. The UV-visible
absorbance spectra of pristine GNPs, aptamer-functionalised GNPs before (GNP+Ky2) and after
kanamycin exposure (GNP+Ky2+Kan) show characteristic SPR peaks with maxima at ca. 520 nm,
confirming the stability of GNPs during aptamer functionalisation as well as in the presence of the
cognate target. Dynamic light scattering measurements reveal that while the hydrodynamic radius of
GNPs increases slightly after Ky2 functionalisation, the GNPs revert back to their original size on
exposure to aptamers’ cognate target kanamycin, indicating removal of aptamers from GNP surface in
the presence of kanamycin. TEM images further confirm that the adsorption of aptamers on the GNP
surface followed by aptamer desorption in the presence of the target does not lead to any aggregation.
![Page 8: Aptamer-mediated ‘turn-off/turn-on’ nanozyme · 2014-10-03 · Mohammadtaheri,a Hemant Kumar Daima,a,c Ravi Shuklaa and Vipul Bansala,* aIan Potter NanoBioSensing Facility, NanoBiotechnology](https://reader033.vdocument.in/reader033/viewer/2022050104/5f432ed80c9ca755ab444dd2/html5/thumbnails/8.jpg)
S8
Figure S3. Effect of reaction temperature on peroxidase-like activity of GNPs. 37 °C is the most
optimum temperature that shows the highest peroxidase-like activity of GNPs.
![Page 9: Aptamer-mediated ‘turn-off/turn-on’ nanozyme · 2014-10-03 · Mohammadtaheri,a Hemant Kumar Daima,a,c Ravi Shuklaa and Vipul Bansala,* aIan Potter NanoBioSensing Facility, NanoBiotechnology](https://reader033.vdocument.in/reader033/viewer/2022050104/5f432ed80c9ca755ab444dd2/html5/thumbnails/9.jpg)
S9
Figure S4. Effect of different concentrations of Ky2 aptamer exposed to 75 µM GNPs in reducing the
peroxidase-like activity of GNPs. 500 nM concentration of Ky2 aptamer is the optimum concentration
as it is the lowest concentration that causes the highest reduction in peroxidase activity.
![Page 10: Aptamer-mediated ‘turn-off/turn-on’ nanozyme · 2014-10-03 · Mohammadtaheri,a Hemant Kumar Daima,a,c Ravi Shuklaa and Vipul Bansala,* aIan Potter NanoBioSensing Facility, NanoBiotechnology](https://reader033.vdocument.in/reader033/viewer/2022050104/5f432ed80c9ca755ab444dd2/html5/thumbnails/10.jpg)
S10
Figure S5. Chemical structures of different antibiotics (ampicillin, penicillin, streptomycin and
kanamycin) used in the current study.
![Page 11: Aptamer-mediated ‘turn-off/turn-on’ nanozyme · 2014-10-03 · Mohammadtaheri,a Hemant Kumar Daima,a,c Ravi Shuklaa and Vipul Bansala,* aIan Potter NanoBioSensing Facility, NanoBiotechnology](https://reader033.vdocument.in/reader033/viewer/2022050104/5f432ed80c9ca755ab444dd2/html5/thumbnails/11.jpg)
S11
1 10 100
0
20
40
60
80
100
Nan
ozym
e a
cti
vit
y (
%)
Kanamycin concentration (nM)
Equation y = a + b*x
Pearson's r 0.99166
Adj. R-Square 0.98007
Value Standard Error
Nanozyme activity
Intercept 2.53319 3.59322
Slope 50.50494 2.93558
Figure S6. Log-linear response behaviour of GNP-Ky2 nanozyme activity between 1-100 nM
kanamycin concentrations. This data was used to determine the limit of detection (LoD) and the limit
of quantification (LoQ) of kanamycin detection using proposed assay. LoD was calculated using the
formula LoD = 3.3*(Standard Deviation of response in the linear range/Slope), whereas LoQ was
calculated using the formula LoQ = 10*(Standard Deviation of response in the linear range/Slope),
which gave the values of 1.49 nM and 4.52 nM, respectively.
![Page 12: Aptamer-mediated ‘turn-off/turn-on’ nanozyme · 2014-10-03 · Mohammadtaheri,a Hemant Kumar Daima,a,c Ravi Shuklaa and Vipul Bansala,* aIan Potter NanoBioSensing Facility, NanoBiotechnology](https://reader033.vdocument.in/reader033/viewer/2022050104/5f432ed80c9ca755ab444dd2/html5/thumbnails/12.jpg)
S12
0 50 100 150 200
0
20
40
60
80
100
En
zym
e a
cti
vit
y (
%)
Kanamycin concentration (nM)
Model Michaelis-Menten
Equation y = Vmax * x / (Km + x)
Adj. R-Square 0.98934
Value Standard Error
Km 8.3814 0.71766
Figure S7. Peroxidase-like activity of GNP-Ky2 nanoconjugate in the presence of increasing
concentrations of kanamycin after subtracting the background response from GNP-Ky2 aptamer in the
absence of kanamycin. The fitted curve shows a typical Michaelis-Menten behaviour. Since the
nanozyme activity of GNP-Ky2 in the presence of kanamycin results from the dissociation of Ky2
aptamer from the GNP surface to interact with kanamycin, the Michaelis-Menten constant (Km =
8.3814 nM) represents the dissociation constant (Kd) of Ky2-kanamycin interaction.
![Page 13: Aptamer-mediated ‘turn-off/turn-on’ nanozyme · 2014-10-03 · Mohammadtaheri,a Hemant Kumar Daima,a,c Ravi Shuklaa and Vipul Bansala,* aIan Potter NanoBioSensing Facility, NanoBiotechnology](https://reader033.vdocument.in/reader033/viewer/2022050104/5f432ed80c9ca755ab444dd2/html5/thumbnails/13.jpg)
S13
(A) Ky2 Wild 5’ T G G G G G T T G A G G C T A A G C C G A 3’
(B) Ky2 M-1 5’ T G G G G G T T G A A A C T A A G C C G A 3’
(C) Ky2 M-2 5’ T G G G G G G T G A G G C T A C G C C G A 3’
(D) Ky2 M-3 5’ T G G G G G T T T T T T T T T A G C C G A 3’
Figure S8. Change in peroxidase-like activity of GNPs after functionalisation with kanamycin-specific
Ky2 aptamer and three mutated forms of Ky2 aptamers (Ky2 M-1, Ky2 M-2 and Ky2 M-3). It is
evident that among four aptamer sequences, the wild-type Ky2 binds most strongly to GNP leading to
largest reduction in GNP nanozyme activity (middle bars in all the four panels). On exposure of these
four GNP-aptamer conjugates to 100 nM kanamycin, GNP-Ky2 (panel A, last bar) further shows
largest ‘switch-on’ of nanozyme activity, while other three GNP-aptamer systems so almost no
increase in activity (panels B-D, last bars). This supports that mutated forms of Ky2 aptamer lose their
affinity to kanamycin. The table above lists the nucleotide sequence of four aptamers utilised in this
study, wherein the ‘red’ text corresponds to mutated nucleotide w.r.t. Ky2 wild aptamer. Specifically,
in Ky2 M-1, GG sequence in the aptamer loop structure was mutated to AA; in Ky2 M-2, TA sequence
in the stem was mutated to GC; whereas in Ky2 M-3, all the nucleotides in the loop structure were
replaced with T. For the secondary structure of Ky2 wild type, please refer to Figure S1.