4029Research Article

IntroductionAquaporins are a family of water channel proteins that provide amajor pathway for osmotically driven water transport through cellmembranes. So far, 13 aquaporin isoforms (AQP0-AQP12) havebeen identified in mammalian species (Verkman, 2005). AQP4, thepredominant isoform in adult brain, is primarily expressed at theborder between brain parenchyma and major fluid compartments,including astrocyte foot processes and glia limitans, as well asependymal cells and subependymal astrocytes (Venero et al., 2001).The bidirectional water channel AQP4 has an important role in waterhomeostasis in the brain. It probably helps in the redistribution andabsorption of edema fluid, because disruption of AQP4 is found tocontribute to the pathophysiology of brain edema (Zador et al.,2007). AQP4 knockout markedly reduced brain swelling in mousemodels of cytotoxic brain edema, whereas it significantly worsenedoutcome in mouse models of vasogenic brain edema (Papadopoulosand Verkman, 2007). Thus, AQP4 appears to facilitate watermovement into astroglia in cytotoxic edema, as well as watermovement out of the brain in vasogenic edema. An intriguingdiscovery is the detection of AQP4 autoantibodies in the sera ofhuman patients with neuromyelitis optica (NMO; Devic’ssyndrome), which is a demyelinating condition (Lennon et al.,2005). This finding has led to the development of an objectivediagnostic test for NMO. AQP4 knockout increased seizurethreshold and duration (Binder et al., 2004; Binder et al., 2006),suggesting that astroglial AQP4 modulates neuronal excitability byregulating osmotic and ionic environments surrounding neurons.

In addition to providing structural and trophic supports for neurons,astrocytes are known to modulate the local environment around neuralstem cells (Doetsch, 2003). Moreover, astrocytes also have animportant role in supporting adult neurogenesis through the secretionof neurotrophic factors (Song et al., 2002). Since AQP4 ispredominantly expressed in astrocytes, we hypothesize that astrocytic

functions in adult neurogenesis may depend on the function of AQP4.This hypothesis is based on the following observations. First, AQP4has a vital role in the regulation of astrocytic function, including localion and pH homeostasis and neurotransmission regulation. Forexample, AQP4 knockout alters the basal level of amino acids (Fanet al., 2005), slows the cellular K+ release and uptake in the brain(Padmawar et al., 2005) and downregulates glutamate uptake andglutamate transporter-1 (GLT-1) expression in astrocytes (Zeng et al.,2007). These microenvironmental changes induced by AQP4knockout are potential factors influencing adult neurogenesis. Second,AQP4 knockout strongly inhibits the formation of glial-derivedneurotrophic factor (GDNF) in 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-treated Parkinson disease (PD) mice (Fanet al., 2008). GDNF is a member of the TGFβ superfamily, signalsvia the tyrosine kinase receptor c-Ret and the GDNF receptors GFRα.It augments survival and differentiation of TH-positive neurons inneural progenitor cells in vitro (Sun et al., 2004) and promotes adultneurogenesis in vivo (Chen et al., 2007). Third, AQP4 is extensivelyexpressed in the brain regions where adult neurogenesis is found(Venero et al., 2001). In the normal brain, they are the subventricularzone (SVZ) in the lateral wall of the lateral ventricle and thesubgranular zone (SGZ) of the hippocampus (Ming and Song, 2005).In the damaged brain, adult neurogenesis is also found in theneocortex, striatum, amygdala and substantia nigra (Gould, 2007)where AQP4 has a high level of expression. Finally, it is reportedthat AQP4 is the main subtype of aquaporin in adult neural stem cells(ANSCs) (Cavazzin et al., 2006; La Porta et al., 2006; Schwartz etal., 2005).

The main purpose of the present study was to test the hypothesisthat AQP4 played a critical role in regulating the fundamentalproperties of ANSCs and to delineate the mechanisms underlyingits action. Under osmotic stress, water flux through AQP4 isbidirectional and driven solely by osmotic gradients. AQP4

Aquaporin-4 (AQP4), a key molecule for maintaining water andion homeostasis in the central nervous system, is expressed inadult neural stem cells (ANSCs) as well as astrocytes. However,little is known about the functions of AQP4 in the ANSCs invitro. Here we show that AQP4 knockout inhibits theproliferation, survival, migration and neuronal differentiationof ANSCs derived from the subventricular zone of adult mice.Flow cytometric cell cycle analysis revealed that AQP4 knockoutincreased the basal apoptosis and induced a G2-M arrest inANSCs. Using Fluo-3 Ca2+ imaging, we show that AQP4knockout alters the spontaneous Ca2+ oscillations by frequency

enhancement and amplitude suppression, and suppresses KCl-induced Ca2+ influx. AQP4 knockout downregulated theexpression of connexin43 and the L-type voltage-gated Ca2+

channel CaV1.2 subtype in ANSCs. Together, these findingssuggest that AQP4 plays a crucial role in regulating theproliferation, migration and differentiation of ANSCs, and thisfunction of AQP4 is probably mediated by its action onintracellular Ca2+ dynamics.

Key words: Aquaporin-4, Adult neural stem cells, Calciumoscillations, Connexin43, L-type calcium channel

Summary

AQP4 knockout impairs proliferation, migration andneuronal differentiation of adult neural stem cellsHui Kong, Yi Fan, Juan Xie, Jianhua Ding, Luolin Sha, Xueru Shi, Xiulan Sun and Gang Hu*Jiangsu Key Laboratory of Neurodegeneration, Department of Pharmacology, Nanjing Medical University, 140 Hanzhong Road, Nanjing,Jiangsu 210029, China*Author for correspondence (e-mail: ghu@njmu.edu.cn)

Accepted 12 August 2008Journal of Cell Science 121, 4029-4036 Published by The Company of Biologists 2008doi:10.1242/jcs.035758

Jour

nal o

f Cel

l Sci

ence

4030

knockdown or knockout slowed the kinetics of astrocyte volumechanges after hypo-osmotic challenge (Nicchia et al., 2000; Solenovet al., 2004). Meanwhile, hypotonic conditions induced intracellularCa2+ ([Ca2+]i) increases in different cell types (Pasantes-Morales etal., 2000). Therefore, we hypothesized that AQP4 might influenceadult neurogenesis by modulating Ca2+ signaling in ANSCs. Ca2+

is a universal ionic second messenger that regulates a great numberof diverse cellular processes including cell proliferation, motility,differentiation, development, learning and memory (Berridge et al.,2003; Berridge et al., 2000). Spontaneous Ca2+ oscillations areobserved in some cell types during proliferation or differentiation(Parri et al., 2001; Sauer et al., 1998; Scemes et al., 2003). It isthought that Ca2+ oscillations can change the threshold for theactivation of Ca2+-dependent transcription factors and prevent thetoxic effects of a sustained increase in [Ca2+]i (Hu et al., 1999;Thellung et al., 2000). Ca2+ oscillations reduce in frequency andamplitude, reducing the threshold for activation of Ca2+-dependenttranscription factors, suggesting that this signaling system has a highlevel of specificity for cellular functions (Dolmetsch et al., 1997;Tomida et al., 2003; Uhlen et al., 2006).

In the present study, we investigated the proliferation, migrationand differentiation of Aqp4+/+ and Aqp4–/– ANSCs in vitro todetermine whether AQP4 regulates the fundamental properties ofANSCs. Spontaneous Ca2+ oscillations and KCl-depolarization-induced Ca2+ transients were also investigated using Fluo-3 Ca2+

imaging.

ResultsAQP4 knockout impaired ANSC proliferation and self-renewalin vitroFig. 1A shows the number and diameter of neurospheres derivedfrom Aqp4+/+ and Aqp4–/– ANSCs observed under a microscope.The adult Aqp4–/– SVZ cultures generated fewer neurospheres thatwere smaller in diameter than those derived from Aqp4+/+ mice. Tofurther determine the effect of AQP4 knockout on self-renewal ofANSCs, secondary and tertiary neurosphere formation efficiencieswere assayed. Aqp4–/– ANSCs exhibited a decreased capacity togenerate neurospheres following serial subcloning, suggesting animpaired self-renewal (P<0.05 vs Aqp4+/+ genotype) (Fig. 1A-C).Furthermore, AQP4 knockout resulted in a significantly reducedproliferation of ANSCs (Aqp4+/+, 22±1.3%; Aqp4–/–, 8.5±0.8%; n=4,P<0.05) (Fig. 1D,E) as shown by lower BrdU incorporation intocultured ANSCs.

AQP4 knockout increases basal apoptosis and induces G2-Marrest in ANSCsThe cell cycle characteristics of Aqp4+/+ and Aqp4–/– ANSCs wereexamined by using flow cytometric analysis of propidium iodidefluorescence. Frequency histograms of the DNA content revealedno significant differences in the proportion of G0-G1 phase and Sphase between Aqp4+/+ and Aqp4–/– ANSCs (Fig. 2A). However,the proportion of cells in G2-M phase was increased in Aqp4–/–

ANSCs (6.7±0.3%) compared with the Aqp4+/+ cells (5.2±0.3%,n=3, P<0.05 vs Aqp4–/–). AQP4 knockout also significantlyincreased the basal apoptosis of ANSCs (Aqp4+/+, 0.9±0.3%;Aqp4–/–, 4.0±0.2%; n=3, P<0.05) (Fig. 2B), suggesting that AQP4is essential for the survival of ANSCs.

AQP4 knockout disrupts migration of ANSCsAn in vitro migration assay was used to determine whether AQP4knockout could alter the mobility of ANSCs. Neurospheres with

similar diameters were initially selected (Aqp4+/+, 211.4±8.3 μm;n=19 neurospheres; Aqp4–/–, 206.9±7. 1 μm; n=18 neurospheresfrom three independent experiments; P=0.68) and plated on coatedcoverslips. Neurospheres cultured on coverslips migrated outwardsradially after adhesion (Fig. 3A). As shown in Fig. 3B, AQP4knockout significantly attenuated radial migration of ANSCs outof neurospheres compared with the Aqp4+/+ control (Aqp4–/–,357.3±17.5 μm; n=18 neurospheres; Aqp4+/+, 701.2±23.6 μm;n=19 neurospheres, P<0.001).

AQP4 knockout decreases neuronal differentiation of ANSCsDissociated ANSCs were differentiated for 7 days to determine theirability to generate multiple neural cell lineages. As shown in Fig.4A, both genotypic ANSCs could generate neurons (TUJ1),astrocytes (GFAP) and oligodendrocytes (GalC) in vitro. Toinvestigate the role of AQP4 in neuronal and astroglialdifferentiation of ANSCs, the percentage of TUJ1+ and GFAP+ cellswas quantified by normalizing total TUJ1+ or GFAP+ cells to thetotal number of cell nuclei labeled with Hoechst 33342. AQP4knockout significantly decreased the neuronal differentiation ofANSCs compared with the Aqp4+/+ control (Aqp4+/+, 14.9±2.3%;Aqp4–/–, 7.6±1.3%; n=3, P<0.05) (Fig. 4B,C). The proportion ofGFAP+ cells was not significantly different between these twogenotypes (Aqp4+/+, 70.5±2.2%; Aqp4–/–, 75.5±4.1%; n=3, P=0.35)(Fig. 4D).

Journal of Cell Science 121 (24)

Fig. 1. AQP4 is required for ANSC self-renewal and proliferation in vitro.(A) Morphological examination showed the reduced number and size ofAqp4–/– primary, secondary and tertiary neurospheres compared with theAqp4+/+ control. Primary neurospheres were initiated from dissociated adultrostral periventricular tissue. Cells obtained by dissociating primaryneurospheres proliferated and yielded secondary neurospheres. Single cellsobtained after dissociation of secondary neurospheres proliferated and yieldedtertiary neurospheres. Scale bar: 200 μm. (B,C) Neurosphere assay. Thenumber and size of neurospheres were determined after 7 days for primary,secondary and tertiary neurospheres (*P<0.05 vs Aqp4+/+, n=3). (D,E) BrdUincorporation assay. The percentage of BrdU+ cells in Aqp4–/– ANSCs wassignificantly lower than that in Aqp4+/+ cells (*P<0.05, n=4).

Jour

nal o

f Cel

l Sci

ence

4031AQP4 regulates functions of ANSCs

AQP4 knockout alters Ca2+ oscillations and suppressesdepolarization-induced Ca2+ transient in ANSCsAfter 24 hours in culture, the cells that had emigrated out of theremaining neurospheres expressed nestin, an intermediate filamentprotein of undifferentiated neural cells (Fig. 5A). Therefore, thesecells were classed ANSCs. In the Aqp4+/+ cell population, morethan 95% of Hoechst-33342-labeled cells were also labeled withboth AQP4 and nestin (Fig. 5A). After 24 hours in culture, 80%(151 of 189) of Aqp4+/+ and 54% (105 of 194) of Aqp4–/– ANSCsdisplayed spontaneous Ca2+ activity. The spontaneous intracellularCa2+ oscillations observed in ANSCs exhibited variable durationsand amplitudes (Fig. 5B). Student’s t-tests of the data obtained fromthree independent experiments indicated that the mean amplitude(ΔF/F0) of spontaneous Ca2+ oscillations in Aqp4–/– ANSCs(0.46±0.03; n=41 cells) was significantly lower than that of Aqp4+/+

ANSCs (0.78±0.08; n=40 cells from three independent experiments,P<0.001). However, the frequency of spontaneous Ca2+ oscillationsof Aqp4–/– ANSCs (0.026±0.0013; n=41 cells) was significantlyhigher than that of Aqp4+/+ ANSCs (0.017±0.001; n=40 cells,P<0.001) (Fig. 5C).

Proliferating neural stem cells sensed the excitation induced bydepolarization through the voltage-gated Ca2+ channels. In thepresent experiment, Aqp4+/+ ANSCs respond to 100 mM KCl withelevations in [Ca2+]i containing an initial peak amplitude and a latersustained phase (Fig. 5D,E). However, AQP4 knockout significantlydecreased peak amplitude of KCl-induced Ca2+ transient (ΔF/F0,Aqp4+/+, 1.58±0.14; n=45 cells; AQP4–/–, 0.76±0.07, n=39 fromthree independent experiments, P<0.01). No evident sustained phaseof the KCl-induced Ca2+ transient was observed in Aqp4–/– ANSCs(Fig. 5F).

AQP4 knockout decreases expression of Cav1.2 andconnexin43KCl depolarization-induced Ca2+ influx depends on the opening ofvoltage-gated Ca2+ channels. The transcription of two main voltage-gated Ca2+ channels, L-type (Cav1.2 and Cav1.3) and T-type(Cav3.1, Cav3.2 and Cav3.3), in both genotypic ANSCs werescreened by reverse transcription polymerase chain reaction (RT-PCR). The transient receptor potential channel 1 (TRPC1), a non-voltage-gated Ca2+ channel was also examined. As shown in Fig.6A, both Aqp4+/+ and Aqp4–/– ANSCs expressed mRNA encodingCav1.2 (668 bp), Cav3.1 (578 bp) and TRPC1 (372 bp). By contrast,mRNAs of genes encoding Cav1.3 (326 bp), Cav3.2 (298 bp) andCav3.3 (404 bp) were not detectable. In Aqp4–/– ANSCs, Cav1.2and Cav3.1 mRNA was significantly decreased when normalizedby comparison with mRNA from the housekeeping gene GAPDH(Fig. 6B). However, no significant difference was found in thetranscription of TRPC1 between Aqp4–/– and Aqp4+/+ ANSCs.Western blot analysis showed that AQP4 knockout significantlyinhibited the production of Cav1.2 protein to 50.7% of that inAqp4+/+ ANSCs (P<0.05, n=3). Cav3.1 was not detectable in eitherAqp4+/+ or Aqp4–/– ANSCs.

Connexin43 (Cx43), one isoform of the connexin family, is themajor connexin expressed in neural stem cells and has a vital rolein cellular communication and cell proliferation or differentiation(Scemes et al., 2003). As shown in Fig. 6D, AQP4 knockout alsosignificantly inhibited the expression of Cx43 in ANSCs to 39%of that in the Aqp4+/+ control (P<0.05, n=3).

DiscussionAQP4 is one of the predominant aquaporins in ANSCs as well asin astrocytes in the brain (Cavazzin et al., 2006). In the presentstudy, we showed that AQP4 knockout inhibited proliferation,migration and neuronal differentiation of ANSCs in vitro. Ca2+

imaging analysis revealed that AQP4 knockout enhanced thefrequency and suppressed the amplitude of spontaneous Ca2+

oscillation and inhibited the Ca2+ transient induced by highconcentration KCl depolarization in ANSCs. Furthermore, AQP4

Fig. 2. AQP4 modulates the cell cycle characteristics of cultured SVZ ANSCs.(A) Representative flow-cytometric histograms of DNA content of Aqp4+/+ andAqp4–/– ANSCs population. (B) There was no significant difference in theproportion of cells at G0-G1 phase and S phase between Aqp4+/+ and Aqp4–/–

ANSC populations. The proportion of G2-M phase cells was increased inAqp4–/– ANSCs compared with the wild type (*P<0.05, n=3). Moreover,AQP4 knockout significantly increased the basal apoptosis of ANSCs(*P<0.05, n=3).

Fig. 3. In vitro neurosphere migration assay. (A) SVZ neurospheres culturedon poly-L-ornithine and laminin-coated coverslips migrate outwards radially.Scale bar: 200 μm. (B) 48 hours after adhesion, AQP4 knockout significantlydecreased the distance of radial migration of SVZ neurospheres compared withthe Aqp4+/+ control (*P<0.05).

Jour

nal o

f Cel

l Sci

ence

4032

knockout caused significant downregulation of the expression ofconnexin43 and Cav1.2 in ANSCs. These findings suggest thatAQP4 might regulate fundamental properties of ANSCs throughthe Ca2+-related signaling pathway.

The spatial and temporal pattern of Ca2+ influx is crucial in theregulation of several cellular processes (Clapham, 2007; Schusteret al., 2002). The stable increase in [Ca2+]i and oscillations of [Ca2+]i

are a nearly universal mode of signaling in both excitable and non-excitable cells (Dupont et al., 2007). In neural stem cells,spontaneous Ca2+ oscillations occur without stimulation by agonists(Scemes et al., 2003). AQP4 knockout altered the rhythm ofspontaneous Ca2+ oscillations by frequency enhancement andamplitude suppression, which might inhibit activation of some Ca2+-dependent transcription factors (Kupzig et al., 2005; Lipskaia andLompre, 2004). For example, nuclear factor of activated T cells(NFAT) is a well documented transcription factor regulated by Ca2+

oscillations (Kawano et al., 2006; Tomida et al., 2003). It is clearthat NFAT activates transcription of a large number of genes (Hoganet al., 2003), including the genes encoding Cx43 and Cav1.2 (Daiet al., 2002; Glover et al., 2003). Recently, a negative correlationbetween the frequency of Ca2+ oscillations and NFAT activity wasreported (Uhlen et al., 2006). Therefore, alterations of Ca2+

oscillations in Aqp4–/– ANSCs might suppress the activities of somespecific transcriptional factors, which would subsequentlydownregulate the expression of Cx43 and Cav1.2.

Connexins, a family of proteins that form gap junctions, allowcells to share small molecules (<1 kDa), such as metabolites andions (Nakase and Naus, 2004). Functional gap junction channelsare formed by docking and opening of two hemichannels in

contacting membranes of adjacent cells. It is well recognized thatgap junctional intercellular communication has an important rolein the control of cell growth and differentiation in different celltypes and tissues (Cheng et al., 2004; Duval et al., 2002; Saez etal., 2003). Cx43, an isoform of connexins, is abundantly expressedin either undifferentiated neural stem cells or neurospheres (Scemeset al., 2003). It was demonstrated that Cx43 knockout inhibitedproliferation and migration of neural progenitors in vitro (Chenget al., 2004; Scemes et al., 2003). In the present study, we showthat AQP4 knockout resulted in a significant downregulation ofCx43 expression in ANSCs. Therefore, it is reasonable that thedownregulation of Cx43 might contribute to the inhibition ofproliferation and migration in Aqp4–/– ANSCs.

Our study shows that AQP4 knockout altered spontaneous Ca2+

oscillations in ANSCs and inhibited the KCl-induced Ca2+ transient.Depolarization-induced Ca2+ influx depends on the opening ofvoltage-gated Ca2+ channels (Lacinova, 2005). Consistently, AQP4knockout also resulted in a significant downregulation of the Cav1.2subunit of L-type Ca2+ channel at both mRNA and protein levels.The Cav1.2 channel is a high-voltage-activated Ca2+ channel. Inmature neurons, this channel opens primarily in response to thedepolarization provided by excitatory synaptic inputs (Weisskopfet al., 1999). Measurements of resting potential indicate that neuralstem cells maintain resting potentials in the –55 mV range (Wanget al., 2003). Since neural stem cells tend to be more depolarizedthan mature quiescent neurons, Cav1.2 channels might partially openwithout depolarization stimulus (Wang et al., 2003; Westerlund etal., 2003). Blockade of L-type Ca2+ channels inhibits neurogenesisboth in vivo and in vitro (D’Ascenzo et al., 2006; Deisseroth et al.,

Journal of Cell Science 121 (24)

Fig. 4. AQP4 knockout impairs neuronaldifferentiation of ANSCs. (A) ANSCs derivedfrom SVZ could generate into neurons (TUJ1),astrocytes (GFAP) and oligodendrocytes (GalC)after 7 days of culture in differentiation medium.Scale bar: 100 μm. (B,C) The proportion ofTUJ1+ cells in the Aqp4–/– cell population wassignificantly lower than that of Aqp4+/+ cells(*P<0.05, n=3). Scale bar: 50 μm. (D) Nosignificant difference was found in the proportionof GFAP+ cells between Aqp4–/– and Aqp4+/+ cellpopulations.

Jour

nal o

f Cel

l Sci

ence

4033AQP4 regulates functions of ANSCs

2004; Luo et al., 2005; Wang et al., 2005). Nifedipine, a L-typeCa2+ channel blocker, inhibits the proliferation of neural stem cellsunder the resting, non-stimulated condition (Deisseroth et al.,2004). Thus, our finding that downregulation of Cav1.2 by knockoutof AQP4 provides additional evidence for the functionalinvolvement of L-type Ca2+ channel in the proliferation inhibitionof ANSCs in vitro. In the cell cycle, Ca2+ regulates progressionthrough several checkpoints, including the G1-S-phase transition,G2-M-phase transition and the exit of mitosis (Kahl and Means,2003; Takuwa et al., 1995; Whitaker and Patel, 1990). Especiallyin G2-M-phase cells, Ca2+ influx via L-type channels promotesprogression through mitosis (Ramsdell, 1991; Uehara et al., 1992).Accordingly, G2-M-phase arrest in Aqp4–/– ANSCs was consistentwith the finding of Cav1.2 downregulation. Furthermore, the L-type Ca2+ channel is essential for cell survival. Blockage or deletionof the L-type Ca2+ channel increases apoptosis in a variety of cells(Benoff et al., 2005; Florio et al., 1998; Galli et al., 1995; Marshallet al., 2003; Thellung et al., 2000). Therefore, the increased basalapoptosis of Aqp4–/– ANSCs might be associated with thedownregulation of Cav1.2.

Intracellular Ca2+ spikes trigger cell differentiation as well asproliferation. Alterations in the intracellular Ca2+ activities could

induce embryonic stem cells to differentiate into neuronalphenotypes (Ulrich and Majumder, 2006). In the nervous systems,the pathways underlying Ca2+ influx involve voltage-dependent andtransmitter-activated channels (Arundine and Tymianski, 2003).Neural stem cells possess functional L-type voltage-dependent Ca2+

channels, which are strongly correlated with neuronal differentiation(D’Ascenzo et al., 2006). In cultured neural stem cells, blockadeof L-type Ca2+ channel abolishes the enhancement of neuronaldifferentiation by different stimuli (D’Ascenzo et al., 2006; Liu etal., 2007; Piacentini et al., 2008). Moreover, blockade of L-typeCa2+ channel also inhibits neuronal differentiation even in resting,nonstimulated conditions (Deisseroth et al., 2004). Ca2+ influxthrough the L-type Ca2+ channel inhibits expression of the glial fategenes Hes1 and Id2 and increases expression of NeuroD, a positiveregulator of neuronal differentiation (Deisseroth et al., 2004). Thus,the reduced neuronal differentiation of Aqp4–/– ANSCs could be aresult of the downregulated expression of Cav1.2. Furthermore,our study showed that AQP4 knockout failed to alter glialdifferentiation. These findings suggest that AQP4 preferentiallyregulates the neuronal differentiation rather than glial differentiation.

It has been demonstrated that aquaporins facilitate cell migration(Papadopoulos et al., 2007). AQP-dependent cell migration has been

Fig. 5. AQP4 knockout altersspontaneous Ca2+ oscillations andsuppresses high concentration KCl-induced Ca2+ transient in ANSCs.(A) Double immunocytochemistry ofnestin (green) and AQP4 (red) in cellsmigrated out of adherent neurospheres24 hours after plating. (B) SpontaneousCa2+ oscillations recorded from threeAqp4+/+ and Aqp4–/– ANSCs (theoscillations of each cell are representedby a different color) loaded with fluo-3AM. (C) Statistical analysis of dataobtained from three independentexperiments indicated that the meanamplitude (ΔF/F0) of spontaneousCa2+ oscillations in Aqp4–/– ANSCswas significantly lower than that ofAqp4+/+ control (*P<0.01). Thefrequency of spontaneous Ca2+

oscillations recorded from Aqp4–/–

ANSCs was significantly enhancedcompared with that of Aqp4+/+ control(*P<0.01). (D) Sequence of imagesrecorded over 90 seconds fromAqp4+/+ and Aqp4–/– ANSCs loadedwith fluo-3 AM following KCl-induced depolarization. (E) Fluo-3fluorescence expressed as ΔF/F0;increased fluorescence indicateselevated [Ca2+]i. There was asignificant inhibition of peakamplitudes and no significantsustained phase durations in Aqp4–/–

ANSCs compared with Aqp4+/+

control. (F) Peak amplitudes of theKCl-induced Ca2+ transient show asignificant decrease in Aqp4–/– ANSCscompared with that in the Aqp4+/+

control (*P<0.001). Scale bars: 50 μm.

Jour

nal o

f Cel

l Sci

ence

4034

found in a variety of cell types in vitro and in vivo (Papadopouloset al., 2007). Based on our results and evidence from other reports,we propose the following potential mechanism whereby AQP4regulates the migration of ANSCs. At the initial stage of cellmigration, AQP4 might facilitate Ca2+ influx (Faux and Parnavelas,2007), which directly regulates actin depolymerization (Disanza etal., 2005; Yoneda et al., 2000). Ion influx increases cytoplasmicosmolality followed by water influx via AQP4 at the front end ofthe migrating cell (Papadopoulos et al., 2007). Water influx increaseslocal hydrostatic pressure causing cell membrane expansion, whichforms a protrusion subsequently (Papadopoulos et al., 2007). Atthe final stage, actin re-polymerizes to stabilize the emergingprotrusion (Papadopoulos et al., 2007). AQP4 knockout could slowthe migration of astrocytes in vivo and in vitro (Auguste et al., 2007;Saadoun et al., 2005). Similarly, blockade of L-type Ca2+ channelalso inhibits migration of different cells in vitro (Ruiz-Torres et al.,2003; Yang and Huang, 2005) and impairs glia migration in vivo(Lohr et al., 2005). Therefore, downregulation of Cav1.2 inducedby AQP4 knockout in ANSCs might involve the inhibition ofmigration in vitro.

In conclusion, our study demonstrates that AQP4 might beinvolved in the proliferation, survival, migration and neuronaldifferentiation of ANSCs by regulating intracellular Ca2+ dynamicsin ANSCs, including spontaneous Ca2+ oscillations and Ca2+

transients.

Materials and MethodsGeneration of Aqp4–/– miceAQP4-knockout mice were generated as previously described (Fan et al., 2005). Micewere kept under environmentally controlled conditions (ambient temperature, 22±1°C;humidity, 40%) on a 12 hour light-dark cycle with food and water ad libitum. Allexperiments were approved by IACUC (Institutional Animal Care and UseCommittee) of Nanjing Medical University. All efforts were made to minimize animalsuffering and to reduce the number of animals used for the experiments.

NSC culture and neurosphere assayPrimary cultures of ANSCs were established as described (Ferron et al., 2007; Grittiet al., 1999). Briefly, brains of 2- to 3-month-old male CD1 mice were microdissectedto obtain the rostral periventricular region upon coronal sectioning. Tissues were finelyminced and dissociated with papain enzymatic solution by incubation at 37°C for 30minutes. After centrifugation, cells were carefully dissociated by passaging in fire-polished Pasteur pipettes and resuspended in serum-free medium consisting ofDMEM/F12 (1:1) medium (Gibco), supplemented with 2% B27 (Gibco), and 20 ng/mlof EGF and 20 ng/ml of bFGF (Peprotech). The primary cell culture technique usedfor this study was the neurosphere assay (Reynolds and Weiss, 1992; Seaberg andvan der Kooy, 2002). Cell viability was assessed using trypan blue exclusion (0.4%,Sigma) and was >85%. Primary tissue was plated at 10,000 cells per well in uncoated24-well culture plates. The total number and size of spheres that formed in each wellwas counted after 7 days in vitro (DIV). Self-renewal was also assayed by dissociatingneurospheres in bulk and reculturing the cells at a constant density of 10,000 cellsper well. The number and size of secondary or tertiary spheres were determined after7 DIV. Neurospheres were counted under an optical microscope, with a minimumcutoff of 40 μm in diameter. The diameter of randomly chosen neurospheres wasdetermined using Image-Pro Plus software.

Cell proliferation assaysProliferation was determined using 5-bromodeoxyuridine (BrdU) incorporation(Ferron et al., 2007). Briefly, neurospheres were collected and gently mechanicallydissociated. Dissociated cells were plated on 24-well culture plates coated with poly-

Journal of Cell Science 121 (24)

Fig. 6. AQP4 knockout downregulates theexpression of Cav1.2 and connexin43 in ANSCs.(A) RT-PCR analysis shows Cav1.2, Cav3.1 andTRPC1 mRNA is present in the ANSCs. Thetranscripts of Cav1.3, Cav3.2 and Cav3.3 were notdetectable. (B) In Aqp4–/– ANSCs, the mRNAs ofgenes encoding Cav1.2 and Cav3.1 weresignificantly decreased when normalized toGAPDH (*P<0.05, n=3). There was no significantinhibition in the transcription of TRPC1 in Aqp4–/–

ANSCs compared with the Aqp4+/+ control.(C) Western blot confirms that AQP4 knockoutdecreased the expression of Cav1.2 channel proteinin the ANSCs compared with the wild type(*P<0.05, n=3). Cav3.1 channel protein was notdetected. (D) Western blotting (top panel) showingthat the expression level of Cx43 protein in Aqp4–/–

ANSCs decreased to 39% of the level in theAqp4+/+ genotype (lower panel) (*P<0.01, n=3).

Jour

nal o

f Cel

l Sci

ence

4035AQP4 regulates functions of ANSCs

L-ornithine (10 mg/ml) and laminin (5 μg/ml) and cultured for 48 hours. Cells wereincubated for exactly 60 minutes with 10 μM BrdU, and then fixed and washed.DNA was denatured by treating the cells for 30 minutes with 2 N HCl at 37°C. Cellswere extensively washed and blocked with 5% bovine serum albumin (40 minutes),and the primary mouse anti-BrdU antibody (1:15,000, Chemicon) was applied andincubated for 1 hour at 37°C followed by goat anti-mouse FITC antibody (1:200,Chemicon). The cells were mounted with anti-fade medium (DakoCytomation) andHoechst 33342 (Sigma).

Cell cycle analysisDissociated ANSCs were fixed overnight in 70% ethanol in PBS, resuspended in PBSand treated with 25 μg/ml ribonuclease A (Sigma) for 1 hour at room temperature,followed by staining with 50 μg/ml propidium iodide (PI; Sigma). Argon-ion laserexcitation (488 nm) was used to measure PI fluorescence with a 620 nm band-passfilter. Proliferating ANSCs were analyzed by flow cytometry (FACSCalibur).

Adult neural stem cell migration assayTo evaluate the contribution of AQP4 during migration of ANSCs, floating Aqp4+/+

and Aqp4–/– neurospheres of similar diameter were selected and plated on coated 24-well culture plates containing DMEM-F12 supplemented with 2% B27 but withoutbFGF and EGF for 48 hours. Migration was quantified as the mean difference betweenthe leading edge of radially migrating cells and the original neurosphere diameter.

Adult neural stem cell differentiationDissociated ANSCs from neurospheres were seeded on coated coverslips at a densityof 10,000 cells/ml in DMEM/F12, containing 1% fetal bovine serum (BSA, Gibco).After 7 days of differentiation, cells were probed with antibodies against neuron-specificbeta-3 tubulin (TUJ1; 1:500, Chemicon), GFAP (1:4000, ABCam), galactocerebroside(GalC; 1:200, Chemicon). The percentages of TUJ1+ and GFAP+ cells were quantifiedby normalizing total TUJ1+ or GFAP+ cells to the total number of cell nuclei labeledwith Hoechst 33342 (approximately 500 cells counted per well, n=3 dissections).

Assay of spontaneous Ca2+ oscillations and KCl-induced Ca2+

transient for cultured ANSCsNeurospheres were plated on coated coverslips in DMEM/F12 with mitogens for 24hours. Spontaneous Ca2+ oscillations were measured in cells outgrowing from adherentneurospheres loaded for 30 minutes at 37°C with fluo-3 AM (5 μM; MolecularProbes). Intracellular Ca2+ measurements were performed on cells bathed in imagingbuffer comprising 141 mM NaCl, 2.5 mM KCl, 1.3 mM MgCl2, 2.4 mM CaCl2, 1.25mM NaH2PO4, 11 mM glucose, 10 mM HEPES, pH 7.4. Confocal series-scan imagingwas performed by using a Zeiss LSM 510 confocal microscope. Images were acquiredwith a CCD camera (Orca-ER; Hamamatsu, Japan). Fluo-3 fluorescence images wereacquired continuously at rate of 0.2 Hz. At least three independent cultures ofneurospheres from three different litters were used for analysis. Measurements wereobtained from regions of interest placed on cells (nestin-positive cells) that migratedfrom the neurospheres. For investigating the KCl-induced Ca2+ transient, cells wereloaded with Fluo-3 and depolarized in imaging buffer with a high concentration ofKCl (100 mM). Fluorescence was measured every 5 seconds for 5 minutes.

ImmunocytochemistryAdherent neurospheres were fixed with 4% paraformaldehyde, rinsed in PBS andblocked with 5% BSA for 60 minutes. Then, cells were incubated in a cocktail solutioncontaining goat anti-AQP4 antibody (1:500; Santa Cruz Biotechnology) and mouseanti-nestin antibody (1:200; Chemicon) at 4°C overnight. The cells were washed inPBS three times and incubated in another cocktail solution containing goat anti-rabbitTRITC (1:200; Chemicon) and goat anti-mouse FITC (1:200; Chemicon) antibodiesat room temperature for 1 hour. Cell nuclei were stained in PBS containing 5 μg/mlHoechst 33342. The coverslips were washed and mounted with anti-fade medium(DakoCytomation). Specimens were observed under a confocal microscope (ZeissAxiovert LSM510) for visualization and photography.

Reverse transcription PCRRNA was isolated from collected neurospheres by homogenization in Trizol Reagent,as detailed by the supplier. cDNA was generated by reverse transcription of 1 μg oftotal RNA and the cDNA fragments were amplified using the specific PCR primers.PCR amplification was carried out with 1 μl cDNA product in a 20 μl reaction volumecontaining specific primer as follows: Cav1.2 forward, ACACAGCCAATAAAGC-CCTCCTG and reverse, GGCCAGCTTCTTCCTCTCCTT; Cav1.3 forward, CAA-GATTTTGGGAAATTTCTGG and reverse, TTTATCCTCATGATTTGCTAT; Cav3.1forward, ATTGCCAGAAAAGAAAGCCTAGA and reverse, AATGAGCTTGTG-GCAACCCAC; Cav3.2 forward, AGGGGAAGGGCAGCACGG and reverse,TGCAGGCGGAAGCAGCAG; Cav3.3 forward, ATCTGCTCCCTGTCGG andreverse, GAGAACTGGGTCGCTATG; TRPC1 forward, CAAGATT TTGGGAA -ATTTCTGG and reverse, TTTATCCTCATGATTTGCTAT. For all of the reactions,preliminary experiments were performed to determine the number of PCR cycles atwhich saturation occurred. The experiments were carried out with a number of cyclesthat precedes saturation. PCR products (5 μl) were separated by electrophoresis on a1.2% agarose gel and visualized after ethidium bromide staining under UV radiation.

The expression of each gene was normalized to the amount of GAPDH in order tocalculate relative levels of mRNA.

Western blottingTotal cellular proteins of neurospheres were extracted with homogenization buffer.Equivalent amounts of extracted proteins (50 μg) were resolved on 12% (forconnexin43) or 6% (for Cav1.2 and Cav3.1) SDS-PAGE and electroblotted to PVDFmembrane (Amersham Biosciences). After blocking the background staining with5% skimmed milk in PBS, the membranes were incubated in a mouse anti-connexin43 antibody (1:500; Chemicom), rabbit anti-Cav1.2 (1:300; Chemicon) andrabbit anti-Cav3.1 (1:200; Chemicon). Antibody against β-actin (1:1000; Sigma) wasused as an internal control for the concentration of protein loaded. Immunoreactiveproteins were detected using HRP-conjugated secondary antibodies and an ECL kit(Amersham Biosciences) according to the manufacturer’s instructions. The membraneswere scanned and analyzed in an Omega 16ic Chemiluminescence Imaging System(Ultra-Lum, Claremont, CA).

StatisticsAll values are expressed as the mean ± s.e.m. Differences between means wereanalyzed using Student’s t-test. P<0.05 was defined as significant.

We thank Ming Li (University of Nebraska, Lincoln, NE) forimproving the English of the manuscript. This study was supportedby the grants from the National Natural Science Foundation of China(No.30625038, No.30701017 and No.30700216) and the NationalKey Basic Research Program of China (No.2009CB521906 andNo.2006CB500706).

ReferencesArundine, M. and Tymianski, M. (2003). Molecular mechanisms of calcium-dependent

neurodegeneration in excitotoxicity. Cell Calcium 34, 325-337.Auguste, K. I., Jin, S., Uchida, K., Yan, D., Manley, G. T., Papadopoulos, M. C. and

Verkman, A. S. (2007). Greatly impaired migration of implanted aquaporin-4-deficientastroglial cells in mouse brain toward a site of injury. FASEB J. 21, 108-116.

Benoff, S., Goodwin, L. O., Millan, C., Hurley, I. R., Pergolizzi, R. G. and Marmar,J. L. (2005). Deletions in L-type calcium channel alpha1 subunit testicular transcriptscorrelate with testicular cadmium and apoptosis in infertile men with varicoceles. Fertil.Steril. 83, 622-634.

Berridge, M. J., Lipp, P. and Bootman, M. D. (2000). The versatility and universalityof calcium signalling. Nat. Rev. Mol. Cell. Biol. 1, 11-21.

Berridge, M. J., Bootman, M. D. and Roderick, H. L. (2003). Calcium signalling:dynamics, homeostasis and remodelling. Nat. Rev. Mol. Cell. Biol. 4, 517-529.

Binder, D. K., Oshio, K., Ma, T., Verkman, A. S. and Manley, G. T. (2004). Increasedseizure threshold in mice lacking aquaporin-4 water channels. NeuroReport 15, 259-262.

Binder, D. K., Yao, X., Zador, Z., Sick, T. J., Verkman, A. S. and Manley, G. T. (2006).Increased seizure duration and slowed potassium kinetics in mice lacking aquaporin-4water channels. Glia 53, 631-636.

Cavazzin, C., Ferrari, D., Facchetti, F., Russignan, A., Vescovi, A. L., La Porta, C. A.and Gritti, A. (2006). Unique expression and localization of aquaporin-4 and aquaporin-9 in murine and human neural stem cells and in their glial progeny. Glia 53, 167-181.

Chen, H., Tung, Y. C., Li, B., Iqbal, K. and Grundke-Iqbal, I. (2007). Trophic factorscounteract elevated FGF-2-induced inhibition of adult neurogenesis. Neurobiol. Aging28, 1148-1162.

Cheng, A., Tang, H., Cai, J., Zhu, M., Zhang, X., Rao, M. and Mattson, M. P. (2004).Gap junctional communication is required to maintain mouse cortical neural progenitorcells in a proliferative state. Dev. Biol. 272, 203-216.

Clapham, D. E. (2007). Calcium signaling. Cell 131, 1047-1058.D’Ascenzo, M., Piacentini, R., Casalbore, P., Budoni, M., Pallini, R., Azzena, G. B.

and Grassi, C. (2006). Role of L-type Ca2+ channels in neural stem/progenitor celldifferentiation. Eur. J. Neurosci. 23, 935-944.

Dai, B., Saada, N., Echetebu, C., Dettbarn, C. and Palade, P. (2002). A new promoterfor alpha1C subunit of human L-type cardiac calcium channel Ca(V)1.2. Biochem.Biophys. Res. Commun. 296, 429-433.

Deisseroth, K., Singla, S., Toda, H., Monje, M., Palmer, T. D. and Malenka, R. C.(2004). Excitation-neurogenesis coupling in adult neural stem/progenitor cells. Neuron42, 535-552.

Disanza, A., Steffen, A., Hertzog, M., Frittoli, E., Rottner, K. and Scita, G. (2005).Actin polymerization machinery: the finish line of signaling networks, the starting pointof cellular movement. Cell Mol. Life Sci. 62, 955-970.

Doetsch, F. (2003). A niche for adult neural stem cells. Curr. Opin. Genet. Dev. 13, 543-550.

Dolmetsch, R. E., Lewis, R. S., Goodnow, C. C. and Healy, J. I. (1997). Differentialactivation of transcription factors induced by Ca2+ response amplitude and duration.Nature 386, 855-858.

Dupont, G., Combettes, L. and Leybaert, L. (2007). Calcium dynamics: spatio-temporalorganization from the subcellular to the organ level. Int. Rev. Cytol. 261, 193-245.

Duval, N., Gomes, D., Calaora, V., Calabrese, A., Meda, P. and Bruzzone, R. (2002).Cell coupling and Cx43 expression in embryonic mouse neural progenitor cells. J. CellSci. 115, 3241-3251.

Fan, Y., Zhang, J., Sun, X. L., Gao, L., Zeng, X. N., Ding, J. H., Cao, C., Niu, L.and Hu, G. (2005). Sex- and region-specific alterations of basal amino acid and

Jour

nal o

f Cel

l Sci

ence

4036

monoamine metabolism in the brain of aquaporin-4 knockout mice. J. Neurosci. Res.82, 458-464.

Fan, Y., Kong, H., Shi, X., Sun, X., Ding, J., Wu, J. and Hu, G. (2008). Hypersensitivityof aquaporin 4-deficient mice to 1-methyl-4-phenyl-1,2,3,6-tetrahydropyrindine andastrocytic modulation. Neurobiol. Aging 29, 1226-1236.

Faux, C. H. and Parnavelas, J. G. (2007). The role of intracellular calcium and RhoAin neuronal migration. Sci STKE 2007, pe62.

Ferron, S. R., Andreu-Agullo, C., Mira, H., Sanchez, P., Marques-Torrejon, M. A.and Farinas, I. (2007). A combined ex/in vivo assay to detect effects of exogenouslyadded factors in neural stem cells. Nat. Protoc. 2, 849-859.

Florio, T., Thellung, S., Amico, C., Robello, M., Salmona, M., Bugiani, O., Tagliavini,F., Forloni, G. and Schettini, G. (1998). Prion protein fragment 106-126 inducesapoptotic cell death and impairment of L-type voltage-sensitive calcium channel activityin the GH3 cell line. J. Neurosci. Res. 54, 341-352.

Galli, C., Meucci, O., Scorziello, A., Werge, T. M., Calissano, P. and Schettini, G.(1995). Apoptosis in cerebellar granule cells is blocked by high KCl, forskolin, and IGF-1 through distinct mechanisms of action: the involvement of intracellular calcium andRNA synthesis. J. Neurosci. 15, 1172-1179.

Glover, D., Little, J. B., Lavin, M. F. and Gueven, N. (2003). Low dose ionizing radiation-induced activation of connexin 43 expression. Int. J. Radiat. Biol. 79, 955-964.

Gould, E. (2007). How widespread is adult neurogenesis in mammals? Nat. Rev. Neurosci.8, 481-488.

Gritti, A., Frolichsthal-Schoeller, P., Galli, R., Parati, E. A., Cova, L., Pagano, S. F.,Bjornson, C. R. and Vescovi, A. L. (1999). Epidermal and fibroblast growth factorsbehave as mitogenic regulators for a single multipotent stem cell-like population fromthe subventricular region of the adult mouse forebrain. J. Neurosci. 19, 3287-3297.

Hogan, P. G., Chen, L., Nardone, J. and Rao, A. (2003). Transcriptional regulation bycalcium, calcineurin, and NFAT. Genes Dev. 17, 2205-2232.

Hu, Q., Deshpande, S., Irani, K. and Ziegelstein, R. C. (1999). [Ca(2+)](i) oscillationfrequency regulates agonist-stimulated NF-kappaB transcriptional activity. J. Biol. Chem.274, 33995-33998.

Kahl, C. R. and Means, A. R. (2003). Regulation of cell cycle progression bycalcium/calmodulin-dependent pathways. Endocr. Rev. 24, 719-736.

Kawano, S., Otsu, K., Kuruma, A., Shoji, S., Yanagida, E., Muto, Y., Yoshikawa, F.,Hirayama, Y., Mikoshiba, K. and Furuichi, T. (2006). ATP autocrine/paracrinesignaling induces calcium oscillations and NFAT activation in human mesenchymal stemcells. Cell Calcium 39, 313-324.

Kupzig, S., Walker, S. A. and Cullen, P. J. (2005). The frequencies of calciumoscillations are optimized for efficient calcium-mediated activation of Ras and theERK/MAPK cascade. Proc. Natl. Acad. Sci. USA 102, 7577-7582.

La Porta, C. A., Gena, P., Gritti, A., Fascio, U., Svelto, M. and Calamita, G. (2006).Adult murine CNS stem cells express aquaporin channels. Biol. Cell 98, 89-94.

Lacinova, L. (2005). Voltage-dependent calcium channels. Gen. Physiol. Biophys. 24 Suppl.1, 1-78.

Lennon, V. A., Kryzer, T. J., Pittock, S. J., Verkman, A. S. and Hinson, S. R. (2005).IgG marker of optic-spinal multiple sclerosis binds to the aquaporin-4 water channel.J. Exp. Med. 202, 473-477.

Lipskaia, L. and Lompre, A. M. (2004). Alteration in temporal kinetics of Ca2+ signalingand control of growth and proliferation. Biol. Cell 96, 55-68.

Liu, J. W., Tian, S. J., de Barry, J. and Luu, B. (2007). Panaxadiol glycosides that induceneuronal differentiation in neurosphere stem cells. J. Nat. Prod. 70, 1329-1334.

Lohr, C., Heil, J. E. and Deitmer, J. W. (2005). Blockage of voltage-gated calciumsignaling impairs migration of glial cells in vivo. Glia 50, 198-211.

Luo, C. X., Zhu, X. J., Zhang, A. X., Wang, W., Yang, X. M., Liu, S. H., Han, X., Sun,J., Zhang, S. G., Lu, Y. et al. (2005). Blockade of L-type voltage-gated Ca channelinhibits ischemia-induced neurogenesis by down-regulating iNOS expression in adultmouse. J. Neurochem. 94, 1077-1086.

Marshall, J., Dolan, B. M., Garcia, E. P., Sathe, S., Tang, X., Mao, Z. and Blair, L.A. (2003). Calcium channel and NMDA receptor activities differentially regulate nuclearC/EBPbeta levels to control neuronal survival. Neuron 39, 625-639.

Ming, G. L. and Song, H. (2005). Adult neurogenesis in the mammalian central nervoussystem. Annu. Rev. Neurosci. 28, 223-250.

Nakase, T. and Naus, C. C. (2004). Gap junctions and neurological disorders of the centralnervous system. Biochim. Biophys. Acta 1662, 149-158.

Nicchia, G. P., Frigeri, A., Liuzzi, G. M., Santacroce, M. P., Nico, B., Procino, G.,Quondamatteo, F., Herken, R., Roncali, L. and Svelto, M. (2000). Aquaporin-4-containing astrocytes sustain a temperature- and mercury-insensitive swelling in vitro.Glia 31, 29-38.

Padmawar, P., Yao, X., Bloch, O., Manley, G. T. and Verkman, A. S. (2005). K+ wavesin brain cortex visualized using a long-wavelength K+-sensing fluorescent indicator.Nat. Methods 2, 825-827.

Papadopoulos, M. C. and Verkman, A. S. (2007). Aquaporin-4 and brain edema. Pediatr.Nephrol. 22, 778-784.

Papadopoulos, M. C., Saadoun, S. and Verkman, A. S. (2007). Aquaporins and cellmigration. Pflugers Arch. 456, 693-700.

Parri, H. R., Gould, T. M. and Crunelli, V. (2001). Spontaneous astrocytic Ca2+ oscillationsin situ drive NMDAR-mediated neuronal excitation. Nat. Neurosci. 4, 803-812.

Pasantes-Morales, H., Cardin, V. and Tuz, K. (2000). Signaling events during swellingand regulatory volume decrease. Neurochem. Res. 25, 1301-1314.

Piacentini, R., Ripoli, C., Mezzogori, D., Azzena, G. B. and Grassi, C. (2008). Extremelylow-frequency electromagnetic fields promote in vitro neurogenesis via upregulation ofCa(v)1-channel activity. J. Cell Physiol. 215, 129-139.

Ramsdell, J. S. (1991). Voltage-dependent calcium channels regulate GH4 pituitary cellproliferation at two stages of the cell cycle. J. Cell Physiol. 146, 197-206.

Reynolds, B. A. and Weiss, S. (1992). Generation of neurons and astrocytes from isolatedcells of the adult mammalian central nervous system. Science 255, 1707-1710.

Ruiz-Torres, A., Lozano, R., Melon, J. and Carraro, R. (2003). L-calcium channelblockade induced by diltiazem inhibits proliferation, migration and F-actin membranerearrangements in human vascular smooth muscle cells stimulated with insulin and IGF-1. Int. J. Clin. Pharmacol. Ther. 41, 386-391.

Saadoun, S., Papadopoulos, M. C., Watanabe, H., Yan, D., Manley, G. T. and Verkman,A. S. (2005). Involvement of aquaporin-4 in astroglial cell migration and glial scarformation. J. Cell Sci. 118, 5691-5698.

Saez, J. C., Berthoud, V. M., Branes, M. C., Martinez, A. D. and Beyer, E. C. (2003).Plasma membrane channels formed by connexins: their regulation and functions. Physiol.Rev. 83, 1359-1400.

Sauer, H., Hofmann, C., Wartenberg, M., Wobus, A. M. and Hescheler, J. (1998).Spontaneous calcium oscillations in embryonic stem cell-derived primitive endodermalcells. Exp. Cell Res. 238, 13-22.

Scemes, E., Duval, N. and Meda, P. (2003). Reduced expression of P2Y1 receptors inconnexin43-null mice alters calcium signaling and migration of neural progenitor cells.J. Neurosci. 23, 11444-11452.

Schuster, S., Marhl, M. and Hofer, T. (2002). Modelling of simple and complex calciumoscillations: from single-cell responses to intercellular signalling. Eur. J. Biochem. 269,1333-1355.

Schwartz, P. H., Nethercott, H., Kirov, II, Ziaeian, B., Young, M. J. and Klassen, H.(2005). Expression of neurodevelopmental markers by cultured porcine neural precursorcells. Stem Cells 23, 1286-1294.

Seaberg, R. M. and van der Kooy, D. (2002). Adult rodent neurogenic regions: theventricular subependyma contains neural stem cells, but the dentate gyrus containsrestricted progenitors. J. Neurosci. 22, 1784-1793.

Solenov, E., Watanabe, H., Manley, G. T. and Verkman, A. S. (2004). Sevenfold-reducedosmotic water permeability in primary astrocyte cultures from AQP-4-deficient mice,measured by a fluorescence quenching method. Am. J. Physiol., Cell Physiol. 286, C426-C432.

Song, H., Stevens, C. F. and Gage, F. H. (2002). Astroglia induce neurogenesis fromadult neural stem cells. Nature 417, 39-44.

Sun, Z. H., Lai, Y. L., Li, P., Zuo, H. C. and Xie, Z. P. (2004). GDNF augments survivaland differentiation of TH-positive neurons in neural progenitor cells. Cell Biol. Int. 28,323-325.

Takuwa, N., Zhou, W. and Takuwa, Y. (1995). Calcium, calmodulin and cell cycleprogression. Cell Signal. 7, 93-104.

Thellung, S., Florio, T., Villa, V., Corsaro, A., Arena, S., Amico, C., Robello, M.,Salmona, M., Forloni, G., Bugiani, O. et al. (2000). Apoptotic cell death and impairmentof L-type voltage-sensitive calcium channel activity in rat cerebellar granule cells treatedwith the prion protein fragment 106-126. Neurobiol. Dis. 7, 299-309.

Tomida, T., Hirose, K., Takizawa, A., Shibasaki, F. and Iino, M. (2003). NFAT functionsas a working memory of Ca2+ signals in decoding Ca2+ oscillation. EMBO J. 22, 3825-3832.

Uehara, Y., Kawabata, Y., Hirawa, N., Takada, S., Numabe, A., Matsuoka, H., Ikeda,T., Takabatake, Y., Yagi, S. and Sugimoto, T. (1992). OPC-13340, a newdihydropyridine calcium channel blocker attenuates rapid vascular smooth muscle cellgrowth in spontaneously hypertensive rats. J. Cardiovasc. Pharmacol. 20, 408-415.

Uhlen, P., Burch, P. M., Zito, C. I., Estrada, M., Ehrlich, B. E. and Bennett, A. M.(2006). Gain-of-function/Noonan syndrome SHP-2/Ptpn11 mutants enhance calciumoscillations and impair NFAT signaling. Proc. Natl. Acad. Sci. USA 103, 2160-2165.

Ulrich, H. and Majumder, P. (2006). Neurotransmitter receptor expression and activityduring neuronal differentiation of embryonal carcinoma and stem cells: from basicresearch towards clinical applications. Cell Prolif. 39, 281-300.

Venero, J. L., Vizuete, M. L., Machado, A. and Cano, J. (2001). Aquaporins in thecentral nervous system. Prog. Neurobiol. 63, 321-336.

Verkman, A. S. (2005). More than just water channels: unexpected cellular roles ofaquaporins. J. Cell Sci. 118, 3225-3232.

Wang, D. D., Krueger, D. D. and Bordey, A. (2003). Biophysical properties and ionicsignature of neuronal progenitors of the postnatal subventricular zone in situ. J.Neurophysiol. 90, 2291-2302.

Wang, J. M., Johnston, P. B., Ball, B. G. and Brinton, R. D. (2005). The neurosteroidallopregnanolone promotes proliferation of rodent and human neural progenitor cellsand regulates cell-cycle gene and protein expression. J. Neurosci. 25, 4706-4718.

Weisskopf, M. G., Bauer, E. P. and LeDoux, J. E. (1999). L-type voltage-gated calciumchannels mediate NMDA-independent associative long-term potentiation at thalamicinput synapses to the amygdala. J. Neurosci. 19, 10512-10519.

Westerlund, U., Moe, M. C., Varghese, M., Berg-Johnsen, J., Ohlsson, M., Langmoen,I. A. and Svensson, M. (2003). Stem cells from the adult human brain develop intofunctional neurons in culture. Exp. Cell Res. 289, 378-383.

Whitaker, M. and Patel, R. (1990). Calcium and cell cycle control. Development 108,525-542.

Yang, S. and Huang, X. Y. (2005). Ca2+ influx through L-type Ca2+ channels controls thetrailing tail contraction in growth factor-induced fibroblast cell migration. J. Biol. Chem.280, 27130-27137.

Yoneda, M., Nishizaki, T., Tasaka, K., Kurachi, H., Miyake, A. and Murata, Y. (2000).Changes in actin network during calcium-induced exocytosis in permeabilized GH3 cells:calcium directly regulates F-actin disassembly. J. Endocrinol. 166, 677-687.

Zador, Z., Bloch, O., Yao, X. and Manley, G. T. (2007). Aquaporins: role in cerebraledema and brain water balance. Prog. Brain Res. 161, 185-194.

Zeng, X. N., Sun, X. L., Gao, L., Fan, Y., Ding, J. H. and Hu, G. (2007). Aquaporin-4 deficiency down-regulates glutamate uptake and GLT-1 expression in astrocytes. Mol.Cell Neurosci. 34, 34-39.

Journal of Cell Science 121 (24)

Jour

nal o

f Cel

l Sci

ence