arabidopsis caprice-like myb 3 cpl3) controls … · caprice (cpc) encodes a small protein with an...

1335RESEARCH ARTICLE

INTRODUCTIONThe specification and patterning of cell types is a crucial feature ofdevelopment in multicellular organisms. In Arabidopsis thaliana,the differentiation of epidermal cells has been used extensively as arelatively simple model for analyzing cell fate specification. Severaltypes of epidermal cells are differentiated in Arabidopsis. Forexample, root epidermal cells differentiate into either root hair cellsor hairless cells (Dolan et al., 1993). Leaf epidermal cells ofArabidopsis can differentiate into trichomes, stomate guard cells andpavement cells. Several regulatory factors are known to be involvedin this epidermal cell differentiation. For example, the glabra 2 (gl2)and werewolf (wer) mutant phenotypes show conversion of hairlesscells to root hair cells (Masucci et al., 1996; Lee and Schiefelbein,1999). GL2 encodes a homeodomain leucine-zipper protein, andWER encodes an R2R3-type MYB protein that activates GL2expression (Rerie et al., 1994; Di Cristina et al., 1996; Masucci etal., 1996; Lee and Schiefelbein, 1999). GLABRA 3 (GL3) andENHANCER OF GLABRA 3 (EGL3) encode basic helix-loop-helix(bHLH) proteins that affect hairless cell differentiation in aredundant manner (Bernhardt et al., 2003). There are two otherbHLH genes, AtMYC1 (Urao et al., 1996) and TRANSPARENTTESTA 8 (TT8) (Nesi et al., 2000), that are in the same subgroup asGL3 and EGL3 (Heim, 2003).

CAPRICE (CPC) encodes a small protein with an R3 MYB motif,and promotes root hair cell differentiation in Arabidopsis (Wada etal., 1997). CPC protein moves from hairless cells to neighboringhair-forming cells and represses expression of GL2 (Wada et al.,2002). Arabidopsis has several additional CPC-like MYB sequencesin the Arabidopsis genome, including TRIPTYCHON (TRY),

ENHANCER OF TRY AND CPC 1, 2 and 3 (ETC1, ETC2 andETC3) (Schellmann et al., 2002; Kirik et al., 2004a; Kirik et al.,2004b; Esch et al., 2004; Simon et al., 2007). The clustered trichomephenotype of the try mutant indicates that TRY protein has aregulatory role in trichome formation (Hulskamp et al., 1994;Schellmann et al., 2002). ETC1 and ETC2 have been characterizedand their relationship with CPC and TRY genetically examined(Kirik et al., 2004a; Kirik et al., 2004b; Esch et al., 2004). We haverecently identified a fourth CPC-like MYB, At4g01060,independently of Simon et al. (Simon et al., 2007), and have namedit CPC-LIKE MYB 3 (CPL3).

Here, we examine the functions of the CPL3 gene in Arabidopsis.CPL3 redundantly regulates root hair and trichome developmentalong with other CPC homologs. Notably, among the homologs,only CPL3 has pleiotropic effects on flowering development andepidermal cell size through the regulation of endoreduplication.

MATERIALS AND METHODSPlant materials and growth conditionsThe Arabidopsis thaliana Col-0 ecotype was used as wild type. The cpc-2 mutant used in this study was described previously (Kurata et al., 2005).The cpl3-1 mutant was isolated from a Wisconsin T-DNA population. Webackcrossed cpl3-1 to wild type and confirmed that all of the phenotypesassociated with cpl3-1 co-segregate with the T-DNA insertion. Weisolated the try-29760, etc1-1 and etc2-2 mutants from a SALK T-DNApopulation. All mutants were in the Col-0 background. Double, triple andquadruple mutants of cpc, try, etc1, etc2 and cpl3 were screened from F2

progeny using PCR to identify homozygous cpc-2, try-29760, etc1-1,etc2-2 and cpl3-1 plants. Selected double, triple and quadruple mutantswere checked and documented in the F3 generation. The 35S::CPC andCPCp::GUS transgenic lines were described previously (Wada et al.,1997; Wada et al., 2002). Seeds were surface-sterilized and sown on 1.5%agar plates as described previously (Okada and Shimura, 1990) andgrown out for observation of seedling phenotypes. Seeded plates werekept at 4°C for 2 days and then incubated at 22°C under constant whitelight. For each mutant line, at least ten individual 5-day-old seedlingswere assayed for root epidermis changes, and at least five 2-week-oldthird leaves were assayed for trichomes. Plants were grown in soil at 22°Cunder continuous light for determining flowering time, leaf size and

Arabidopsis CAPRICE-LIKE MYB 3 (CPL3) controlsendoreduplication and flowering development in addition totrichome and root hair formationRumi Tominaga, Mineko Iwata, Ryosuke Sano, Kayoko Inoue, Kiyotaka Okada* and Takuji Wada†

CAPRICE (CPC) encodes a small protein with an R3 MYB motif and promotes root hair cell differentiation in Arabidopsis thaliana.Three additional CPC-like MYB genes, TRY (TRIPTYCHON), ETC1 (ENHANCER OF TRY AND CPC 1) and ETC2 (ENHANCER OF TRY ANDCPC 2) act in a redundant manner with CPC in trichome and root hair patterning. In this study, we identified an additional homolog,CPC-LIKE MYB 3 (CPL3), which has high sequence similarity to CPC, TRY, ETC1 and ETC2. Overexpression of CPL3 results in thesuppression of trichomes and overproduction of root hairs, as has been observed for CPC, TRY, ETC1 and ETC2. Morphologicalstudies with double, triple and quadruple homolog mutants indicate that the CPL3 gene cooperatively regulates epidermal celldifferentiation with other CPC homologs. Promoter-GUS analyses indicate that CPL3 is specifically expressed in leaf epidermal cells,including stomate guard cells. Notably, the CPL3 gene has pleiotropic effects on flowering development, epidermal cell size andtrichome branching through the regulation of endoreduplication.

KEY WORDS: Arabidopsis, Epidermis, MYB, Endoreduplication, Flowering

Development 135, 1335-1345 (2008) doi:10.1242/dev.017947

Plant Science Center, RIKEN, 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama, Kanagawa230-0045, Japan.

*Present address: National Institute for Basic Biology, 38 Nishigonaka, Myodaiji,Okazaki, Aichi 444-8585, Japan†Author for correspondence (e-mail: [email protected])

Accepted 15 January 2008 DEVELO

PMENT

1336

ploidy. For flowering-related gene expression analyses (CO, FT andSOC1), plants were grown in soil under long-day conditions (16 hourslight/8 hours dark).

Gene constructsPrimersPrimer sequences are listed in Table 1.

35S::CPL3 constructA 0.8 kb PCR-amplified linear CPL3 genomic fragment (primersTW1167/TW1168) was subcloned into pBluescript SK+ (pBS; Stratagene)using Pyrobest DNA polymerase (Takara, Tokyo, Japan) to make pBS-CPL3. Next, the Acc65I to SalI fragment of pBS-CPL3 was ligated into theAcc65I and SalI sites of the pCHF3 binary vector (Jarvis et al., 1998) tocreate 35S::CPL3. PCR-generated constructs were completely sequencedfollowing isolation of the clones to check for amplification-induced errors.Finally, the amplified and ligated constructs were cloned intotransformation vector pJHA212K (Yoo et al., 2005).

CPL3p::CPL3:GFP constructsA 3.0 kb PCR-amplified linear CPL3 genomic fragment (primersRT71/RT72) was digested with SalI and EcoRV and ligated into the SalIand EcoRV sites of pBS-2xGFP (Kurata et al., 2005) to create pBS-CPL3:2xGFP. PCR-generated constructs were completely sequencedfollowing isolation of the clones to check for amplification-induced errors.Finally, the SalI to SacI fragment of pBS-CPL3:2xGFP was ligated into theSalI and SacI sites of the pJHA212K binary vector (Yoo et al., 2005) tocreate CPL3p::CPL3:GFP.

CPL3p::GUS constructsA 2.4 kb PCR-amplified promoter region of CPL3 (primers RT50/RT51)was digested with NotI and AccI and subcloned into pBS to create pBS-CPL3p. PCR-generated constructs were completely sequenced followingisolation of the clones to check for amplification-induced errors. The SalIand BamHI-digested fragment of pBS-CPL3p was ligated into the SalI andBamHI sites of binary vector pBI101 (Clontech Laboratories, CA) to createthe CPL3p::GUS construct.

Promoter::GUS constructsA 1.9 kb PCR-amplified promoter region of ETC1 (primers RT46/RT47),a 3.0 kb PCR-amplified promoter region of ETC2 (primers RT48/RT49)and a 3.0 kb PCR-amplified promoter region of TRY (primers RT88/RT89),were digested with NotI and AccI and subcloned into pBS to create pBS-ETC1, -ETC2 and -TRY. The SalI and BamHI-digested fragment of pBS-ETC1 was ligated into the SalI and BamHI sites of binary vector pBI101(Clontech Laboratories) to create ETC1p::GUS. The SalI and XbaI-digested fragments of pBS-ETC2 and pBS-TRY were ligated into SalI andXbaI of binary vector pBI101 to create ETC2p::GUS and TRYp::GUSconstructs. At least three T3 lines were isolated on the basis of theirsegregation ratios for kanamycin resistance for each transgenic line.

Transgenic plantsPlant transformation was performed by a floral dip method (Clough and Bent,1998), and transformants were selected on a 0.5�MS agar plates containing50 mg/l kanamycin. Homozygous transgenic lines were selected bykanamycin resistance. We isolated at least twelve T1 lines for each constructand selected at least six T2 and three T3 lines on the basis of their segregationratios for kanamycin resistance. For each transgenic line, at least ten individual5-day-old seedlings were assayed for root hair numbers, and at least five 2-week-old third leaves were assayed for trichome numbers. Promoter::GUStransgenic lines were analyzed by PCR (primers GUS+00+/GUS+09–). Atleast three individual plants were assayed for GUS activity in each of the threetransgenic lines. The CPL3p::GUS construct was introduced into the cpc-2,try-29760, etc1-1, etc2-1 and cpl3-1 mutants by conventional crosses and F2seedlings were analyzed by PCR. At least five plants from each transgenic linewere assayed for GUS activity.

HistologyPromoter::GUS plants were excised from the growth medium andimmersed in X-Gluc solution containing 1.0 mM X-Gluc (5-bromo-4-chloro-3-indolyl-�-glucuronide), 1.0 mM K3Fe(CN)6, 1.0 mM K4Fe(CN)6,100 mM NaPi (pH 7.0), 100 mM EDTA and 0.1% Triton X-100. Primaryroots of 5-day-old seedlings were incubated at 37°C overnight. Cotyledonsof 5-day-old seedlings, 2-week-old rosette leaves and hypocotyls, and 4-week-old inflorescences and siliques were incubated at 37°C for 3.5 hours.

In situ hybridizationIn situ hybridization was as described (Kurata et al., 2003). DIG-labeledantisense RNA probes for CPC, ETC1, ETC2 and CPL3 were generated bytranscribing pBS-cDNA (pBS-CPC, -ETC1, -ETC2 and -CPL3) digestedwith HindIII, SpeI, XhoI and SpeI, respectively. T3 polymerase was usedfor CPC, ETC1 and CPL3 probes, T7 polymerase for the ETC2 probe.

Semi-quantitative RT-PCRRNA extraction and semi-quantitative RT-PCR reactions were as described(Kurata et al., 2003). The CPL3 fragment was amplified with theRT73/RT92 primer pair. EF (At1g07930) was amplified with the EF1�-F/EF1�-R primer pair as described (Kurata et al., 2005).

Real-time PCRTotal RNA was extracted using the RNeasy Plant Mini Kit (Qiagen). On-column DNase I digestion was performed during RNA purification followingthe protocol described in the RNeasy Mini Kit handbook. First-strand cDNAwas synthesized from 1 �g total RNA in a 20 �l reaction mixture using thePrime Script RT Regent Kit (Takara). Real-time PCR was performed in aChromo4 Real-Time PCR Detection System (Bio-Rad, Hercules, CA) usingSYBR Premix Ex Taq (Takara). PCR amplification employed a 30 seconddenaturing step at 95°C, followed by 5 seconds at 95°C and 30 seconds at60°C with 45 cycles for CPL3 and 40 cycles for CYCA2;1, CYCA2;2,

RESEARCH ARTICLE Development 135 (7)

Table 1. Primers used in this studyPrimer Sequence (5� to 3�)

TW1167 ATATGGTACCTTTAACATAGAAACCGACTW1168 ATATGTCGACATCTACGACTTAGCTTCRT46 GGCCAGTCGACAGAAAACTCACTCACTATTCACATCRT47 CGAGGATCCACGCTGCGTATTCATCTCAART48 GGCCAGTCGACGCTTGGCTAGCTCATAAACGRT49 CGATCTAGAACGGTTGGTATTATCCATAACTACTRT50 GGCCAGTCGACCAGCCCTGAAAACAGCTAAGAART51 CGAGGATCCGCGATGGTTATCCATGTCAAACRT71 ATATGTCGACCAGCCCTGAAAACAGCTAAGAART72 ATATGATATCATTTTTCATGACCCAAAACCTCTRT88 ATATGGATCCACGGTCAGTGTTATCCATTACTATTRT89 ATATGTCGACCTCAATATATCAAATTCAAACATTCART126 GATAACCATCGCAGGACTAAGCRT127 TACAACGGAATATAATCGAAACAATCEF1�-F ATGCCCCAGGACATCGTGATTTCATEF1�-R TTGGCGGCACCCTTAGCTGGATCAGUS+00+ ATGTTACGTCCTGTAGAAACCCCAA GUS+09– CGTGCACCATCAGCACGTTATCycA2;1-F CGCTTCAGCGGTTTTCTTAGCycA2;1-R ATCCTCCATTGCAAGTACCGCycA2;2-F TGTATGTGTTGGCCGTAATGCycA2;2-R TGGTGTCTCTTGCATGCTTACycA2;3-F CTCTATGCCCCTGAAATCCACycA2;3-R ACCTCCACAAGCAATCAACCycA2;4-F CAAAGCCTCCGATCTCAAAGCycA2;4-R CTTGTCCGGTAGCTCTCCAGCycA1;1-F CGATGACGAAGAAACGAGCACycA1;1-R TGGCATTAACGCAAACACTTGAct2-F CTGGATCGGTGGTTCCATTCAct2-R CCTGGACCTGCCTCATCATACSIM-F TTCCGACCACAAGATTCCTCSIM-R AGAAGAACCGCTCGATCTCACO-F TGGCTCCTCAGGGACTCACTACAACO-R TTGACTCCGGCACAACACCAGTFT-F GATACGAGTAACGAACGGTGATFT-R CCCCCTCTCATTTTTATTACACSOC1-F ATGAATTCGCCAGCTCCAATSOC1-R GCTTCATATTTCAAATGCTGCA D

EVELO

PMENT

CYCA2;3, CYCA2;4, CYCA1;1, SIM, CO, FT, SOC1 and ACT2. RelativemRNA levels were calculated by iQ5 software (Bio-Rad), and normalized tothe concentration of ACT2 mRNA. The primers were: CYCA2;1-F andCYCA2;1-R for CYCA2;1; CYCA2;2-F and CYCA2;2-R for CYCA2;2;CYCA2;3-F and CYCA2;3-R for CYCA2;3; CYCA2;4-F and CYCA2;4-R forCYCA2;4; CYCA1;1-F and CYCA1;1-R for CYCA1;1; SIM-F and SIM-R forSIM; CO-F and CO-R for CO; FT-F and FT-R for FT; SOC1-F and SOC1-Rfor SOC1; and ACT2-F and ACT2-R for ACT2 (Czechowski et al., 2004;Huang et al., 2005; Yoshizumi et al., 2006).

ANOVA (analysis of variance) was performed to determine the significanceof differences between cpl3, 35S::CPL3 or CPL3p::CPL3, and wild type.

Ploidy analysisNuclei were extracted and stained with CyStain UV Precise P (Partec,Münster, Germany) following the manufacturer’s protocol. Flowcytometric analysis was performed by a Ploidy Analyzer PA flow cytometer(Partec), according to the manufacturer’s instructions.

MicroscopyLight microscopyRoot phenotypes were observed using an Olympus Provis AX70microscope and an Olympus SZH binocular microscope. For each mutantor transgenic line, at least ten individual 5-day-old seedlings were analyzed

for root hair number and root GUS activity. For the observation oftrichomes, images were recorded with a VC4500 3D digital finemicroscope (Omron, Kyoto, Japan) or digital microscope (VH-8000;Keyence, Osaka, Japan). At least five 2-week-old third true leaves wereanalyzed for trichome number and GUS activity for each mutant ortransgenic line. For measurement of epidermal cell numbers, five 2-week-old third leaves were cleared with chloral hydrate:glycerol:water (8:2:1,w:v:v) (Yadegari et al., 1994), and visualized using a Zeiss Axio-plan2microscope (Carl Zeiss, Germany).

Confocal laser scanning microscopy (CLSM)CPL3p::CPL3:GFP transgenic lines were stained with 5 �g/ml propidiumiodide (PI) for 30 seconds and mounted in water. Confocal images wereobtained with a 40� water-immersion objective on a Zeiss LSM-Pascal ora Zeiss LSM-510 Meta confocal laser scanning microscope using 488 nmlaser lines for GFP excitation. Image processing was with Photoshopversion 7.0 (Adobe Systems, CA).

Scanning electron microscopy (SEM)To observe the phenotype of trichomes, rosette leaves or inflorescenceswere attached to the stage and cooled in liquid nitrogen. Observations weremade in low vacuum with a scanning electron microscope (modelJSM5610-LV; JEOL, Akishima, Japan).

1337RESEARCH ARTICLECPL3 gene controls ploidy and flowering

Fig. 1. Gene structure and amino acidsequences of Arabidopsis CPChomologs.(A) Sequence alignment of CPC-homologous MYB proteins (CPL3, CPC, TRY,ETC1, ETC2, Os01g43180 andOs01g43230). Red outlined letters indicateidentical residues. (B) Phylogenetic treebased on the amino acid sequences.Numbers above branches are geneticdistances based on 10,000 bootstrapreplicates. The tree was obtained by theneighbor-joining method using Genetyx ver.11.2.7 software (Genetyx, Tokyo, Japan).(C) Structure of CPC-homologous genes andpositions of mutations. The locations ofstart and stop codons are indicated. Threeexon (boxes) and two intron (lines) positionswere determined by comparing thegenomic sequences with the cDNAsequences. Positions of T-DNA insertionsand the identity of mutations are indicated(cpc-2, try-029760, etc1-1, etc2-2 and cpl3-1). (D) Semi-quantitative RT-PCR analysis ofCPL3. EF (At1g07930) was used as acontrol.

DEVELO

PMENT

1338

Yeast two-hybrid assayVectors and yeast strains were obtained from Clontech (Mountain View,CA; MATCHMAKER Two-Hybrid System). CPC, TRY, ETC1, ETC2 andCPL3 full-length proteins were fused to the GAL4 DNA-binding domainin pGBT9. GL3, EGL3, AtMYC1 and TT8 full-length proteins were fusedwith the GAL4 activation domain in pGAD424. Yeast strain Y187 wastransformed with the appropriate plasmids using carrier DNA and thelithium acetate method (Kallal and Kurjan, 1997). Following the YeastProtocols Handbook (Clontech), a �-galactosidase assay was performed oneach transformant using O-nitrophenyl �-D-galactopyranoside (Sigma) assubstrate.

RESULTSIdentification of the CPL3 geneA search of the Arabidopsis genome sequence revealed four MYBgene sequences with high homology to CPC: TRY, ETC1, ETC2and CPL3. The CPL3-encoded protein is closely related to theproteins encoded by CPC-like MYB family members CPC, TRY,ETC1 and ETC2, and two rice (Oryza sativa) homologs,Os01g43180 and Os01g43230 (Fig. 1A). A phylogenetic tree basedon the alignment of amino acid sequences with the R2R3-typeMYB family members WER, GL1 and MYB23, indicated that thetwo rice homologs are more closely related to the CPC-like MYBfamily than to the R2R3-type MYB family, and that CPL3 is moreclosely related to ETC1 than to the other CPC-homologous proteins(Fig. 1B).

To assess the function of the CPL3 gene, we identified a T-DNAmutant allele, cpl3-1, in the Wisconsin T-DNA collection. cpl3plants have a T-DNA insertion in the first exon (Fig. 1C). Usingsemi-quantitative RT-PCR, no CPL3 mRNA could be detected in thecpl3 mutant, indicating that transcription of the CPL3 gene isdisrupted by the T-DNA insertion (Fig. 1D). We also screenedseveral T-DNA-tagged pools for knockouts of CPC-like MYBgenes, and identified the mutant lines etc1-1 (Kirik et al., 2004a) andetc2-2. Additionally, ecotype Col-0 alleles of cpc and try mutantswere found and named cpc-2 (Kurata et al., 2005) and try-029760.Thus, all of the mutants used in this study are in a Col-0 background.

Epidermis phenotypes of CPL3 loss-of-functionmutantsThe root hair phenotype of the cpc-1 (WS background) (Wada et al.,1997) and cpc-2 (Col-0 background) mutant lines is characterizedby the formation of approximately one-fourth as many root hairs asthe wild type (see Fig. S1A in the supplementary material),respectively. In the cpl3-1 line, the relative number of root hairs wasabout 80% that of wild type (Fig. 2B, Table 2). There is a distinctpossibility that functional redundancy provided by the presence ofsimilar genes obscures the phenotype of each individual knockoutmutant. Therefore, we made cpl3 double mutants with each of theother CPC-like MYB mutants (Table 2). It had already been reportedthat the cpc-1 try-82 and cpc-1 etc1-1 double mutants have very fewroot hairs (Schellmann et al., 2002; Kirik et al., 2004b). Weconfirmed these observations using the cpc-2, try-29760 and etc1-1alleles (see Fig. S1A in the supplementary material). Root hairproduction in the cpl3 cpc double mutant was about 50% of that inthe cpc single mutant (see Fig. S1A in the supplementary material).However, root hair production in cpl3 try, cpl3 etc1 and cpl3 etc2double mutants was not significantly different to that in wild type(Table 2).

Trichome formation in the double mutants is more complicatedthan root hair formation because of the three developmental aspectsof trichome formation: number, clustering and branching. There


Fig. 2. Phenotypes associated with CPC-homolog gain- and loss-of-function mutants. (A-L) Root hair formation of a 5-day-oldArabidopsis seedling showing no root hair phenotype (G,H), reducednumber of root hairs (B,C) and increased number of root hairs (I-L).(M-X) Trichome formation on the 2-week-old third leaves showingincreased number of trichomes (N-T). No trichome formation wasobserved in gain-of-function plants (U-X). Scale bars: 100 �m in A forA-L; 1 mm in M-X.

Table 2. Phenotypes of root epidermal cellsLength of epidermal Number of root Relative

Genotype cell (�m) hairs per mm hair number*

Col-0 180±10 41.3±4.3 74.2

cpl3 192±5 31.1±1.1 59.7cpl3 cpc 182±7 6.0±0.8 10.9cpl3 try 183±9 43.6±0.8 79.8cpl3 etc1 189±7 41.5±0.8 78.4cpl3 etc2 193±18 38.4±1.5 74.1

35S::CPL3#1 156±6 57.2±3.9 89.235S::CPL3#2 151±12 65.4±4.1 98.8CPL3p::CPL3#1 171±14 46.8±1.1 80.0CPL3p::CPL3#2 166±13 50.9±1.4 84.5

Data, including s.d., were obtained from at least ten 5-day-old roots from each line.*Relative hair number indicates the number of root hairs formed on a segment ofroot with average length epidermal cells calculated from [length of epidermal cell(�m) � number of root hairs per mm]/100. D

EVELO

PMENT

were more trichomes on cpc-2 than on wild type (see Fig. S1B in thesupplementary material), as had been reported using the WS allele,cpc-1 (Schellmann et al., 2002). As was the case with cpc mutantalleles, cpl3 plants also had more trichomes: roughly 80% more thanwild type (Table 3, Fig. 2N). The cpl3 cpc and cpl3 etc2 doublemutants had more trichomes than the parental single-mutant lines(Table 3, Fig. 2O,Q). The combination of try-EM1 (Folkers et al.,1997) with cpc-1 resulted in an increase in trichome clustering(Schellmann et al., 2002). The cpl3 try double mutant had a slightlyincreased percentage of clustered trichomes compared with the trysingle mutant (Table 3). By contrast, there were no clusters on thecpl3 single mutant, cpl3 cpc, cpl3 etc1, or cpl3 etc2 double mutants(Fig. 2N,O,Q, Table 3).

The etc1-1 try-82 cpc-1 triple mutant produced a large number oftrichomes (Kirik et al., 2004b). In our experiment, the cpl3 try etc1triple mutant had more clusters, though the trichome number wassimilar to that of cpl3 (Fig. 2R, Table 3). The cpl3 cpc try triplemutant had a more extreme phenotype, with heavy marginal clusters(Fig. 2S). Each cluster in cpl3 cpc try was larger than any on cpc try,but it was difficult to distinguish individual trichomes so they couldnot be accurately counted (see Fig. S2 in the supplementarymaterial). The leaves of the cpl3 cpc try etc1 quadruple mutant wereentirely covered by trichomes (Fig. 2T), which is similar to that seenin the transformant line 35S:GL1 35S:R (Larkin et al., 1994). Unlikethe etc1-1 try-82 cpc-1 triple mutant (Kirik et al., 2004b), the cpl3cpc try etc1 quadruple mutant developed a large trichome clustercovering even the midvein. Almost all of the adaxial epidermal cellsappeared to have differentiated into trichomes (Fig. 3A). Differentialinterference contrast (DIC) images of the quadruple mutant showedthat the epidermal layer was completely made up of trichome cells,to the exclusion of pavement cells, socket cells and guard cells (Fig.

3C). Hypocotyls and inflorescences were also covered withtrichomes (Fig. 3B and see Fig. S3A in the supplementary material),and almost every hypocotyl epidermal cell had differentiated intotrichomes (see Fig. S3B in the supplementary material). SEMimages of the adaxial surface of a true leaf showed that there was alarge variation in the size and branch number of individual trichomeson the quadruple mutant (Fig. 3D).

try mutant trichomes have increased DNA content and morebranches than wild type (Hulskamp et al., 1994). By contrast, cpl3mutant trichomes had consistently fewer branches than wild type,with 55% of cpl3 trichomes having two branches (Table 4, Fig.3E,F). These trichome phenotypes were also found on plants grownin soil (see Fig. S4 in the supplementary material). Double mutantswith cpl3 and the other CPC homologs did not significantly furtherreduce the branching observed in cpl3 (Table 4).

CPL3 has a similar function to CPC, TRY, ETC1 andETC2CPL3 was expressed under the control of the 35S promoter toproduce an overexpressing line for comparison with the 35S::CPC,35S::TRY, 35S::ETC1 and 35S::ETC2 lines (Wada et al., 1997;Schellmann et al., 2002; Kirik et al., 2004a; Kirik et al., 2004b). Aswith the overexpression lines of its homologs, 35S::CPL3 had morethan the normal number of root hairs, and no trichomes (Fig.2I,J,U,V, Tables 2, 3, and see Fig. S5 in the supplementary material).These results indicate that each of the CPC-like MYB homologs hasa similar function for root hair and trichome formation whenoverexpressed under the control of the 35S promoter. When theCPL3 gene’s own promoter was used to increase CPL3 expression(CPL3p::CPL3), a relatively small amount of ectopic root hairformation was observed (Fig. 2K,L, Table 2, and see Fig. S5A in the


Table 3. Leaf trichome number and cluster formationGenotype Trichomes per leaf % Trichomes in clusters

Col-0 39.4±3.6 0cpl3 72.5±4.6 0try 42.4±2.8 23.7±3.6 cpl3 try 53.3±1.8 29.9±3.2 cpl3 cpc 106.3±9.3 0cpl3 etc1 67.4±4.2 0 cpl3 etc2 94.6±3.4 0 cpl3 try etc1 68.2±3.5 55.4±6.2

35S::CPL3#1 0 035S::CPL3#2 0 0CPL3p::CPL3#1 0 0CPL3p::CPL3#2 0 0

Data, including s.d., were obtained from at least ten 2-week-old third leaves fromeach line.

Fig. 3. cpl3 cpc try etc1 quadruple mutant phenotype. (A) Theadaxial surface of rosette leaf of a cpl3 cpc try etc1 quadruple mutantArabidopsis was entirely covered by trichomes. (B) Pistil and stamen ofa cpl3 cpc try etc1 quadruple mutant were surrounded by trichomes.(C) Adaxial epidermis of a rosette leaf of the cpl3 cpc try etc1quadruple mutant. (D) Trichome phenotypes of a cpl3 cpc try etc1quadruple mutant. Trichome phenotype of Col-0 (E) and cpl3 mutant(F). Scale bars: 200 �m in A; 100 �m in B-F.

Table 4. Trichome branch numbersBranches (br) / Trichome (%)

Genotype 1 br 2 br 3 br 4 br 5 br 6 br

Col-0 2±1 13±2 82±3 3±1 0 0cpl3 10±1 55±2 35±1 0 0 0try 0 2±1 55±3 33±2 10±2 1±0.4

cpl3 try 1±0.3 4±1 53±3 36±3 7±1 0cpl3 cpc 9±1 37±2 54±2 0 0 0cpl3 etc1 3±1 51±8 46±6 0 0 0cpl3 etc2 10±1 49±2 41±2 0 0 0

Data, including s.d., were obtained from at least five 2-week-old third leaves fromeach line.

DEVELO

PMENT

1340

supplementary material), and there were no trichomes produced(Fig. 2W,X, Table 3, and see Fig. S5B in the supplementarymaterial).

Previous analyses in yeast have shown that CPC protein binds tothe bHLH domain of the maize R protein (Wada et al., 2002), andthat CPC, TRY, ETC1 and ETC2 bind to the bHLH-domain-containing GL3 protein (Kirik et al., 2004a; Kirik et al., 2004b; Eschet al., 2003). To test whether CPL3 can also interact with GL3, weperformed a yeast two-hybrid analysis. All of the CPC homologousproteins (CPC-BD, TRY-BD, ETC1-BD, ETC2-BD and CPL3-BD)bound strongly to GL3-AD, and there also was significant bindingto EGL3-AD and AtMYC1-AD (see Fig. S6 in the supplementarymaterial).

Expression pattern of the CPL3 geneCPL3 expression was examined in plant tissues using real-timePCR. CPL3 was more strongly expressed in shoots (including a fewsmall true leaves) than in roots of seedlings (Fig. 4A). The relativelystrong expression of CPL3 in mature plants was specificallyobserved in siliques and buds (Fig. 4A). Shellman et al. reported thatin trichomes, TRY expression was strongest, followed by CPC(Schellmann et al., 2002). In our hands, in situ hybridization of shootmeristem tissue indicated that the expression of CPC was strongerthan that of ETC1 in trichomes (Fig. 4B,C). We could not detectETC2 or CPL3 expression in young trichomes (Fig. 4D,E).

To analyze expression at the cellular level, we made CPL3promoter-GUS fusions. CPL3p::GUS was expressed in youngleaves and mostly restricted to stomate guard cells in leaves,

cotyledons and hypocotyls (Fig. 4F-H). We could not detectCPL3p::GUS in trichomes. CPL3 was detectable in roots by real-time PCR (Fig. 4A), but no CPL3p::GUS was detected in roots (Fig.4I). Consistent with real-time PCR, strong CPL3p::GUS expressionwas observed in inflorescences and developing seeds in siliques(Fig. 4J-M).

Protein localization was determined using protein-2XGFP fusionconstructs driven by the CPL3 promoter (Fig. 4N). InCPL3p::CPL3:GFP transgenic plants, a strong GFP signal wasobserved in the guard cells (Fig. 4N), which was also consistent withthe expression pattern of the CPL3p::GUS construct (Fig. 4F). Wecould not check for GFP localization in trichomes of these transgenicplants because increased CPL3 gene dosage prevents the formationof trichomes (Fig. 2W,X, Table 3, and see Fig. S5B in thesupplementary material). There was also no GFP signal in rootepidermis of CPL3p::CPL3:GFP plants, which is consistent withthe CPL3p::GUS data.

Intriguing features of the CPL3 geneThe guard cell-specific protein localization of CPL3 (Fig. 4N)indicates some specific involvement with stomate initiation ordevelopment, but there was no difference in the distribution orcluster formation of guard cells among cpl3, 35S::CPL3,CPL3p::CPL3 or wild-type plants (Table 5, and see Tables S1 andS2 in the supplementary material). Also, the double mutant cpl3 etc2did not show any aberrant stomata phenotype (see Table S3 in thesupplementary material). Similar to root hairs, stomates ofhypocotyls in wild-type Arabidopsis develop from epidermal cells


Fig. 4. CPL3 gene expression. (A) Real-time PCRanalysis of CPL3 gene expression in Arabidopsisorgans. Total RNA was isolated from the indicatedtissues. (B-E) In situ hybridization patterns of CPC-homologous genes at the shoot apex. Arrowheads inB and C indicate CPC and ETC1 signals evident inyoung trichomes. No signal for either ETC2 or CPL3was detected in D and E. (F-M) Activity of CPL3p::GUSreporter in 2-week-old leaves (F), in 5-day-oldcotyledons (G), hypocotyls (H) and roots (I), in 4-week-old inflorescence (J,K) and silique (L,M). (N) Localization of CPL3-GFP fusion protein.Fluorescence from the GFP fusion protein (green) andpropidium iodide (red) was observed with confocallaser scanning microscopy. CPL3p::CPL3:GFP signallocalization in 2-week-old leaves. Scale bars: 50 �m inB for B-E and in G,H,N; 100 �m in I; 200 �m in K,M; 1mm in F,J,L.

DEVELO

PMENT

that overlie two cortical cell files (Berger et al., 1998; Hung et al.,1998), a location known as the ‘S’ (stomate) position. Therefore, wealso checked the position of stomates on hypocotyls. About 84% ofstomates are located in the S position and 16% in the ‘N’ (non-stomate) position in Col-0 plants (Table 6). There was no significantdifference in the positions of hypocotyl stomata among cpl3,CPL3p::CPL3 and wild-type plants (Table 6, and see Table S4 in thesupplementary material). 35S:CPL3 transgenic lines, however,showed a significant difference in hypocotyl stomate distribution,with 54% of its stomata at the S position and 46% at the N position(Table 6, and see Table S5 in the supplementary material). Theseobservations suggest that CPL3 is involved in the distribution ofhypocotyl guard cells.

In addition to the effects on root hair and trichome formation, cpl3mutant plants were affected in flowering time. As shown in Table 7,cpl3 mutant plants flowered earlier than wild type (28.9±0.5 versus37.6±0.5 days) and with fewer leaves (8.2±0.3 versus 17.4±0.6). Bycontrast, cpc, try, etc1 and etc2 mutant plants were not significantlydifferent from wild type (Table 7). 35S::CPL3 transgenic plantsflowered slightly later than wild type (41.1±1.1 versus 37.6±0.5days) and with more leaves (28.5±1.7 versus 17.4±0.6) (Table 7, andsee Table S6 in the supplementary material). To clarify the effect ofthe CPL3 gene on flowering, the expression of some flowering-related genes was examined in plant lines with altered CPL3expression by real-time PCR. FLOWERING LOCUS T (FT),SUPPRESSOR OF OVEREXPRESSION OF CO 1 (SOC1) andCONSTANS (CO) play a central role in controlling floral transition(flowering) (Bagnall, 1993; Lee et al., 2000; Koornneef et al., 1991).Expression of FT and SOC1 were higher in the cpl3 mutant than inwild type under long-day (LD) conditions during leaf development(Fig. 5A,B). In 21-day-old leaves, expression of FT was about 9.5-

fold higher, and that of SOC1 3.2-fold higher in cpl3 than in wildtype (Fig. 5A,B). Expression of CO in cpl3 was not significantlydifferent from that in wild type (Fig. 5C). These results suggest theinvolvement of CPL3 in flowering regulation by repressing FT andSOC1 expression.

In addition to the altered flowering phenotype, cpl3 mutant plantswere much larger and CPL3-overexpressing plants were much smallerthan wild type (Fig. 6A). We confirmed this dwarf phenotype ofCPL3-overexpressing plants with three 35S::CPL3 and fiveCPL3p::CPL3 independent transgenic lines. The fresh weight of cpl3mutants was about 50% greater than that of wild type, andCPL3p::CPL3 plants were about 30% the fresh weight of wild type(Fig. 6B). Leaf epidermal cells in the cpl3 mutant were remarkablylarger, and cells from CPL3p::CPL3 were smaller than those of wildtype (Fig. 6C-E). This translates into a significant difference in overallplant size. For example, the cpl3 mutant third leaf was about 13%larger, and the CPL3p::CPL3-overexpressing line was about half thesize, of wild type. However, there was no significant difference in leafcell numbers (Table 8). These observations demonstrate that enhanced


Table 5. Stomatal density on cotyledons of the cpl3 mutantand CPL3 overexpressing linesGenotype Stomata per mm2 Stomate index (%) Clusters per mm2

Col 213±14 26.0±1.7 0cpl3 218±11 25.4±0.9 035S::CPL3#1 256±15 24.1±1.4 0CPL3p::CPL3#1 256±17 27.5±1.5 0

Data represent the mean±s.d. of at least five leaves per experiment.

Table 6. Effect of CPL3 on hypocotyl stomate patternsNumber of Stomata in Stomata in

Genotype stomata S position (%) N position (%)

Col-0 1.8±0.3 84±12 16±11cpl3 1.8±0.4 73±15 27±735S::CPL3#1 2.0±0.4 54±16 46±10CPL3p::CPL3#1 2.4±0.4 77±12 23±10

Data represent the mean±s.d. of ten hypocotyls per experiment.

Table 7. Flowering time and leaf numbers at flowering time ofthe cpc, try, etc1, etc2 and cpl3 knockout mutants and of the35S::CPL3-overexpressing transformant line Genotype Flowering time (days) Number of leaves

Col-0 37.6±0.5 17.4±0.6cpl3 28.9±0.5 8.2±0.3cpc 39.6±0.5 19.2±0.6try 36.0±0.8 14.3±0.6etc1 40.6±0.8 19.3±0.8etc2 39.0±0.5 14.1±1.935S::CPL3#1 41.1±1.1 28.5±1.7

Data represent the mean±s.d. of at least ten plants per experiment.

A

B

C

D

FT

SOC1

CO

CPL3

Fig. 5. Expression of flowering-related genes in the cpl3 mutantand transgenic Arabidopsis plants expressing CPL3. Real-time PCRanalyses of FT (A), SOC1 (B), CO (C) and CPL3 (D) genes at threedevelopmental stages. Expression levels were normalized to ACT2expression. Relative expression levels: expression levels of each gene incpl3, 35S::CPL3 and CPL3p::CPL3 relative to wild type at 7 days. RNAwas isolated from 7-, 14- and 21-day-old rosette leaves grown underlong-day conditions. The experiment was repeated four times. Errorbars indicate s.d.

DEVELO

PMENT

1342

growth of cpl3 was caused by hypertrophy rather than hyperplasia ofleaf cells. In addition, hypocotyl cells and hypocotyls of cpl3 wereelongated, but those of 35S::CPL3 were rounded, resulting in slightlyshortened hypocotyls (Fig. 6F-K).

Because endoreduplication is generally thought to provide amechanism for increasing cell size, and the try mutation increasestrichome endoreduplication (Szymanski and Marks, 1998), weanalyzed the ploidy of leaf cells from wild-type, cpl3, 35S::CPL3and CPL3p::CPL3 plants. In the cpl3 mutant, the number of 32Cand 16C cells was increased in 16-day-old first leaves (Fig. 7A;the proportions of 32C and 16C were 0% and 26.9% for Col-0,and 2.6% and 29.2% for cpl3, respectively). This result suggeststhat the altered phenotypes of the cpl3 mutant, includinghypertrophic cell growth, are associated with an increase inendoreduplication. By contrast, 35S:CPL3 and CPL3p::CPL3 hadreduced DNA levels in 16-day-old first leaves (Fig. 7A; theproportions of 4C and 2C for Col-0 were 19.6% and 16.9%, for35S::CPL3 24.3% and 27.4%, and for CPL3p::CPL3 33.1% and26.4%, respectively). In 3-week-old third leaves, the ploidydifferences were observed more clearly (Fig. 7B; the proportionsof 16C for Col-0, cpl3, 35S::CPL3 and CPL3p::CPL3 were 2.1%,12.0%, 0.7% and 1.0%, respectively). This study demonstratesthat CPL3 is likely to have some role in ploidy-dependentepidermal cell growth in Arabidopsis.

Endoreduplication is a type of cell cycle that skips the celldivision steps of mitosis and thus affects cell cycle-related geneexpression. We examined the expression of the cell cycle-related

genes CYCA2;1, CYCA2;2, CYCA2;3, CYCA2;4 and CYCA1;1,which have been reported to be involved in endoreduplication inArabidopsis (Yoshizumi et al., 2006; Imai et al., 2006), and of SIM,which is a cell cycle regulator controlling the onset ofendoreduplication (Churchman et al., 2006). Expression of thesegenes in Col-0, cpl3, 35S::CPL3 and CPL3p::CPL3 was analyzedby real-time PCR (Fig. 8). Although expression of CYCA2;1 andCYCA2;2 in the cpl3 mutant seemed to be somewhat reduced, andin overexpressers (35S::CPL3 and CPL3p::CPL3) seemed to beincreased, compared with wild type (Fig. 8A,B), no significantchanges were observed for any of the CYCA genes (Fig. 8A-E).Compared with wild type, expression of SIM was higher in the cpl3mutant and lower in 35S::CPL3 and CPL3p::CPL3 during leafdevelopment (Fig. 8F). Significant reduction in expression wasobserved in 30-day-old 35S::CPL3 and 12-day-old CPL3p::CPL3plants compared with wild type (Fig. 8F). These results suggest thatincreased ploidy in the cpl3 mutant and decreased ploidy in CPL3overexpressers are involved in the function of SIM.


Fig. 6. Phenotypes of cpl3 mutant and transgenicplants expressing CPL3. (A) Soil-grown rosettes from4-week-old Col-0, cpl3, etc2 cpl3, 35S::CPL3,CPL3p::CPL3#1 and CPL3p::CPL3#2 Arabidopsis plants.(B) Fresh weight of rosette leaves per plant wascalculated from the means (±s.d.) of a minimum of fiverosettes from each line. (C-E) Microscopic analysis of leafepidermis of Col-0, cpl3 and CPL3p::CPL3. The studywas carried out in the middle region of the leaf blade of2-week-old plants. (F-H) Hypocotyls from 2-week-oldCol-0, cpl3 and 35S::CPL3. (I-K) Hypocotyl epidermis ofCol-0, cpl3 and 35S::CPL3. Scale bars: 5 mm in A; 100�m in C,I; 200 �m in F.

Table 8. Number of leaf epidermal cells in the cpl3 knockoutmutant and CPL3p::CPL3-overexpressing transformant line

Pavement cells Pavement Genotype Leaf size (mm2) (per mm2) cells/leaf

Col-0 16.8±0.3 181±19 3035±311cpl3 19.0±1.3 158±26 3014±535CPL3p::CPL3#1 9.5±0.9 311±14 2960±306

Data represent the mean±s.d. of five leaves and at least 20 cells per experiment. DEVELO

PMENT

DISCUSSIONRedundancy of CPL3 and CPC-like MYB genes inepidermal differentiationHistorically, cpc was isolated as a mutant with few root hairs (Wadaet al., 1997). Although the typical plant MYB gene encodes a R2-R3 type MYB region (Rosinski and Atchley, 1998), CPC encodes asmall R3-type MYB of only 94 amino acids. Not long after isolationof CPC, TRY was isolated as a CPC-homologous gene from atrichome-clustering mutant (Schellmann et al., 2002). More recently,ETC1, ETC2 and ETC3 were isolated as enhancers of try and cpc(Kirik et al., 2004a; Kirik et al., 2004b; Esch et al., 2004; Simon etal., 2007). We also independently isolated these three genes byhomology with CPC. In this paper, we describe the isolation ofCPL3, and provide evidence that it has a redundant function with theother homologs of CPC. In addition to its MYB function, CPL3 hasepistatic effects on a number of crucial plant development andgrowth mechanisms. From the observation of double, triple andquadruple mutant phenotypes, it is clear that CPC plays thedominant role in the regulation of root hair formation, and TRYplays the dominant role in trichome formation, but all five CPC-likeMYB genes, including CPL3, have a redundant function in root hairand trichome formation (Figs 2, 3, Tables 2, 3, and see Fig. S1 in thesupplementary material). The reduction in root hair numbercompared with wild type was significant in the cpl3-1 single mutant,but not in cpl3 try, cpl3 etc1 or cpl3 etc2 double mutants (Table 2).Because CPC represses its own expression (Wada et el., 2002), it ispossible that CPC-homologous genes also repress CPC expression.Thus, disruption of the other CPC-homologous genes in the cpl3mutant background may enhance CPC expression, which leads tothe formation of many root hairs. The conversion of almost alladaxial surface leaf cells and hypocotyl cells into trichome cells in

the cpc try etc1 cpl3 quadruple mutant indicates that CPL3 eitherdirectly or indirectly shares a similar function with its homologs,because the cpc try etc1 triple mutant had a number of epidermal celltypes other than trichome cells (Fig. 3, and see Fig. S3A in thesupplementary material).

When CaMV 35S is used as a promoter for the expression of CPL3,the number of root hairs is increased, and no trichomes are formed intransformant lines, as observed in 35S::CPC, 35S::TRY, 35S::ETC1and 35S::ETC2 transformants (Fig. 2, Tables 2, 3) (Wada et al., 1997;Schellmann et al., 2002; Kirik et al., 2004a; Kirik et al., 2004b). Yeasttwo-hybrid analyses showed that CPC, TRY, ETC1, ETC2 and CPL3are capable of interacting with GL3, EGL3 and AtMYC1 (see Fig. S6in the supplementary material). These findings demonstrate that CPL3and the other CPC-like MYB proteins have a similar binding function.Although EGL3 had higher promoter activity and RNA accumulationthan GL3, the mutant phenotype of egl3 was ‘weaker’ than that of gl3(Bernhardt et al., 2003; Bernhardt et al., 2005). The strong trichomedeficiency and proliferation of root hair phenotypes of the gl3 mutantare probably due to the strong binding activity of GL3 with the CPC-like MYB proteins.

CPL3p::GUS was mainly expressed around stomata (Fig. 4F-H), but the cpl3 mutant, cpl3 etc2 double mutant and CPL3overexpressors did not have aberrant stomatal phenotypes (Table5, and see Tables S1, S2, S3 in the supplementary material). Wecounted stomates on cotyledons, which do not differ much in sizeregardless of their genotype. Therefore, stomatal density isapparently relatively constant (Table 5). The stomatal phenotypesof true leaves were also observed several times. Thus, weconcluded that CPL3 did not affect stomate formation in leaves,although the gene is expressed there. The expression patterns ofCPC homologs have been roughly classified into two groups.CPCp::GUS, TRYp::GUS and ETC1p::GUS are expressed mainlyin roots and trichomes, and ETC2p::GUS and CPL3p::GUS areexpressed in young leaves and guard cells (see Fig. S7 in thesupplementary material). Thus, GUS expression by the CPC-likeMYB family is found in tissues throughout the entire plant body.CPL3p::GUS expression was reduced in the cpc and etc1backgrounds (see Fig. S8 in the supplementary material). Theseresults suggest that the members of this regulatory proteinfamily play different roles. Given the complexity of regulatorycascades and the contributions of phytohormones, cell-wall-associated proteins and cytoskeleton structures, it is nonethelesslikely that this gene family has fairly direct control overepidermal differentiation, development and integration for theentire plant.

Intriguing features of the CPL3 geneAlthough the general effect of CPL3 on cell fate is similar to thatof CPC, TRY, ETC1 and ETC2, CPL3 has several characteristicsthat make it distinct from the other CPC homologs. First, the cpl3-1 mutant itself has a reduced number of root hairs, whereas etc1-1 and etc2-2 have normal root hair numbers (Fig. 2B, and see Fig.S1A in the supplementary material). cpl3-1 also produces anincreased number of trichomes, similar to cpc-2 (Fig. 2N, and seeFig. S1B in the supplementary material). Secondly, most stomataare distributed in the S position in wild-type hypocotyls, buttransformant line 35S::CPL3 trichomes are evenly distributed inboth the S and N positions (Table 6, and see Table S4, S5 in thesupplementary material). Thirdly, cpl3 plants have an earlyflowering phenotype (Table 7, and see Table S6 in thesupplementary material). Expression of the FT and SOC1 genesin the cpl3 mutant was increased compared with wild type (Fig.


(%)

0

20

40

60

80

100

8d 16d 8d 16d 8d 16d 8d 16d

32C16C8C4C2C

Col cpl3 35S::CPL3 CPL3p::CPL3

0

20

40

60

80

100

120

A

B

32C16C8C4C2C

Col cpl3 35S::CPL3 CPL3p::CPL3

(%)

Fig. 7. Loss of CPL3 function increases polyploidy levels.(A) Relative ratios of each cell ploidy of 8- and 16-day-old first leaves ofCol-0, cpl3, 35S::CPL3 and CPL3p::CPL3 Arabidopsis plants. (B) Relativeratios of each cell ploidy of 3-week-old third leaves of Col-0, cpl3,35S::CPL3 and CPL3p::CPL3. Approximately 5000 nuclei were countedin Col-0, cpl3, 35S::CPL3 and CPL3p::CPL3 tissues.

DEVELO

PMENT

1344

5A,B). A flowering regulatory cascade model would thus includerepression of FT and SOC1 by CPL3. CPL3 expression issignificantly higher in 35S::CPL3 and CPL3p::CPL3transformant lines than in wild type during leaf development (Fig.5D). If CPL3 directly represses FT and SOC1, their expression in35S::CPL3 and CPL3p::CPL3 plants would be reducedsignificantly (Fig. 5A,B). One possibility is that CO or some otherfactor overcomes the function of CPL3 to repress FT and SOC1.Fourthly, cpl3 plants have an abnormally large growth phenotype,and CPL3 overexpressers have a dwarf phenotype (Fig. 6). Thehypertrophic cell phenotype of cpl3 is associated with an increasein endoreduplication (Fig. 7). CPL3 is thus likely to play anessential role in ploidy-dependent epidermal cell growth inArabidopsis. Endoreduplication is generally thought to provide amechanism for increasing cell size (Sugimoto-Shirasu andRoberts, 2003), although the correlation between ploidy level andcell size is not always high (Leiva-Neto et al., 2004; Gendreau etal., 1998; Schnittger et al., 2003).

Previous studies have shown that a mutation in TRY leads toincreased endoreduplication in trichomes and reducedendoreduplication in the epidermis (Szymanski and Marks, 1998).This is the opposite of what happens in the cpl3 mutant. Because amutation in CPL3 leads to an increase in endoreduplication in theepidermis (Fig. 7), a decrease in trichome branching might be theresult of reduced endoreduplication in trichomes (Fig. 3F, Table 4).It has been postulated that TRY is expressed in trichomes, reducingendoreduplication in those cells, followed by diffusion intoneighboring cells to mediate lateral inhibition (Schellmann et al.,2002). Thus, we propose a model in which CPL3 is expressed inyoung leaf epidermal cells and represses endoreduplication, afterwhich it affects neighboring trichome cells by slightly promotingendoreduplication.

A2-type cyclins play an important role in regulatingendoreduplication in Arabidopsis (Burssens et al., 2000; Imai et al.,2006; Yoshizumi et al., 2006). CYCA2;1 is expressed in variousdifferentiated cells, such as guard cells (Burssens et al., 2000), andloss of CYCA2;3 increases polyploidy in mature true leaves (Imai etal., 2006). However, we could not detect any significant change inthe expression of CYCA genes in cpl3 mutant and transgenicArabidopsis plants expressing CPL3. SIM is a cell cycle regulatorthat controls endoreduplication onset in Arabidopsis (Churchman etal., 2006). SIM transcript levels are increased in GL3-overexpressinglines and decreased in the gl3 egl3 double mutant (Churchman et al.,2006). Because CPL3 can bind to GL3 and EGL3 (see Fig. S6 in thesupplementary material), it might inhibit GL3 and/or EGL3 functionto induce expression of SIM (Fig. 8F).

The CPC-like MYB gene families are thought to have evolved bygene duplication (Fig. 1C). Gene family members that have notcompletely diverged functionally and thus retain some functionalredundancy may represent intermediate stages of regulatoryspecification (Thomas, 1993; Cooke et al., 1997). As such, they canprovide considerable potential for adaptive or evolutionaryresponses to environmental changes or occupation of a newecological niche through selection for the most advantageous cellsize and flowering time.

We thank Dr Yoshizumi for technical advice, M. Sato, K. Toyooka, M.Wakazaki, Y. Miyazaki, H. Oka and T. Gohara for technical assistance, and T.Araki, S. Yamaguch, Y. Kamiya, T. Ishida and T. Kurata for useful suggestions.This work was supported in part by Grants-in-Aid from the Ministry ofEducation, Science, Sports and Culture of Japan (15770152).

Supplementary materialSupplementary material for this article is available athttp://dev.biologists.org/cgi/content/full/135/7/1335/DC1


CYCA2;1

0

0.5

1

1.5

2

2.5

CYCA2;2

0

1

2

3

CYCA2;3

0

0.5

1

1.5

2

Col-0 cpl3 35S::CPL3 CPL3p::CPL3 Col-0 cpl3 35S::CPL3 CPL3p::CPL3

A

B

C

12 days16 days20 days30 days



Col-0 cpl3 35S::CPL3 CPL3p::CPL3


CYCA2;4

0

0.5

1

1.512 days16 days20 days30 days

CYCA1;1

0

0.5

1

1.5

SIM

0

1

2

3

D

E

F





Rel

ativ

e ex

pres

sion

leve

ls

Rel

ativ

e ex

pres

sion

leve

ls

*

*

Fig. 8. CYCA and SIM expression in cpl3 mutantand transgenic Arabidopsis plants expressingCPL3. Real-time PCR analysis of CYCA2;1 (A),CYCA2;2 (B), CYCA2;3 (C), CYCA2;4 (D), CYCA1;1 (E)and SIM (F) in wild type, cpl3, 35S::CPL3 andCPL3p::CPL3 at four developmental stages. Expressionlevels of each gene were normalized to ACT2expression. Relative expression levels: expression levelsof each gene relative to wild type at 12 days. Theexperiment was repeated four times. Error barsindicate s.d. Student’s t-test, *P<0.020 versus wildtype.

DEVELO

PMENT

ReferencesBagnall, D. J. (1993). Light quality and vernalization interact in controlling late

flowering in Arabidopsis ecotypes and mutants. Ann. Bot. 71, 75.Berger, F., Linstead, P., Dolan, L. and Haseloff, J. (1998). Stomata patterning on

the hypocotyl of Arabidopsis thaliana is controlled by genes involved in thecontrol of root epidermis patterning. Dev. Biol. 194, 226-234.

Bernhardt, C., Lee, M. M., Gonzalez, A., Zhang, F., Lloyd, A. andSchiefelbein, J. (2003). The bHLH genes GLABRA3 (GL3) and ENHANCER OFGLABRA3 (EGL3) specify epidermal cell fate in the Arabidopsis root.Development 130, 6431-6439.

Bernhardt, C., Zhao, M., Gonzalez, A., Lloyd, A. and Schiefelbein, J. (2005).The bHLH genes GL3 and EGL3 participate in an intercellular regulatory circuitthat controls cell patterning in the Arabidopsis root epidermis. Development132, 291-298.

Burssens, S., de Almeida Engler, J., Beeckman, T., Richard, C., Shaul, O.,Ferreira, P., Van Montagu, M. and Inze, D. (2000). Developmental expressionof the Arabidopsis thaliana CycA2;1 gene. Planta 211, 623-631.

Churchman, M. L., Brown, M. L., Kato, N., Kirik, V., Hulskamp, M., Inze, D.,De Veylder, L., Walker, J. D., Zheng, Z., Oppenheimer, D. G. et al. (2006).SIAMESE, a plant-specific cell cycle regulator, controls endoreplication onset inArabidopsis thaliana. Plant Cell 18, 3145-3157.

Clough, S. J. and Bent, A. F. (1998). Floral dip: a simplified method forAgrobacterium-mediated transformation of Arabidopsis thaliana. Plant J. 16,735-743.

Cooke, J., Nowak, M. A., Boerlijst, M. and Maynard-Smith, J. (1997).Evolutionary origins and maintenance of redundant gene expression duringmetazoan development. Trends Genet. 13, 360-364.

Czechowski, T., Bari, R. P., Stitt, M., Scheible, W. R. and Udvardi, M. K.(2004). Real-time RT-PCR profiling of over 1400 Arabidopsis transcriptionfactors: unprecedented sensitivity reveals novel root- and shoot-specific genes.Plant J. 38, 366-379.

Di Cristina, M., Sessa, G., Dolan, L., Linstead, P., Baima, S., Ruberti, I. andMorelli, G. (1996). The Arabidopsis Athb-10 (GLABRA2) is an HD-Zip proteinrequired for regulation of root hair development. Plant J. 10, 393-402.

Dolan, L., Janmaat, K., Willemsen, V., Linstead, P., Poethig, S., Roberts, K.and Scheres, B. (1993). Cellular organisation of the Arabidopsis thaliana root.Development 119, 71-84.

Esch, J. J., Chen, M., Sanders, M., Hillestad, M., Ndkium, S., Idelkope, B.,Neizer, J. and Marks, M. D. (2003). A contradictory GLABRA3 allele helpsdefine gene interactions controlling trichome development in Arabidopsis.Development 130, 5885-5894.

Esch, J. J., Chen, M. A., Hillestad, M. and Marks, M. D. (2004). Comparison ofTRY and the closely related At1g01380 gene in controlling Arabidopsis trichomepatterning. Plant J. 40, 860-869.

Folkers, U., Berger, J. and Hulskamp, M. (1997). Cell morphogenesis oftrichomes in Arabidopsis: differential control of primary and secondarybranching by branch initiation regulators and cell growth. Development 124,3779-3786.

Gendreau, E., Hofte, H., Grandjean, O., Brown, S. and Traas, J. (1998).Phytochrome controls the number of endoreduplication cycles in the Arabidopsisthaliana hypocotyl. Plant J. 13, 221-230.

Heim, M. A., Jakoby, M., Werber, M., Martin, C., Weisshaar, B. and Bailey, P.C. (2003). The basic helix-loop-helix transcription factor family in plants: agenome-wide study of protein structure and functional diversity. Mol. Biol. Evol.20, 735-747.

Huang, T., Bohlenius, H., Eriksson, S., Parcy, F. and Nilsson, O. (2005). ThemRNA of the Arabidopsis gene FT moves from leaf to shoot apex and inducesflowering. Science 309, 1694-1696.

Hulskamp, M., Misra, S. and Jurgens, G. (1994). Genetic dissection of trichomecell development in Arabidopsis. Cell 76, 555-566.

Hung, C. Y., Lin, Y., Zhang, M., Pollock, S., Marks, M. D. and Schiefelbein, J.(1998). A common position-dependent mechanism controls cell-type patterningand GLABRA2 regulation in the root and hypocotyl epidermis of Arabidopsis.Plant Physiol. 117, 73-84.

Imai, K. K., Ohashi, Y., Tsuge, T., Yoshizumi, T., Matsui, M., Oka, A. andAoyama, T. (2006). The A-type cyclin CYCA2;3 is a key regulator of ploidylevels in Arabidopsis endoreduplication. Plant Cell 18, 382-396.

Jarvis, P., Chen, L. J., Li, H., Peto, C. A., Fankhauser, C. and Chory, J. (1998).An Arabidopsis mutant defective in the plastid general protein import apparatus.Science 282, 100-103.

Kallal, L. and Kurjan, J. (1997). Analysis of the receptor binding domain ofGpa1p, the G(alpha) subunit involved in the yeast pheromone responsepathway. Mol. Cell. Biol. 17, 2897-2907.

Kirik, V., Simon, M., Wester, K., Schiefelbein, J. and Hulskamp, M. (2004a).The ENHANCER OF TRY AND CPC1 gene acts redundantly with TRIPTYCHONand CAPRICE in trichome and root hair cell patterning in Arabidopsis. Dev. Biol.268, 506-513.

Kirik, V., Simon, M., Huelskamp, M. and Schiefelbein, J. (2004b). ENHANCERof TRY and CPC 2 (ETC2) reveals redundancy in the region-specific control oftrichome development of Arabidopsis. Plant Mol. Biol. 55, 389-398.

Koornneef, M., Hanhart, C. J. and van der Veen, J. H. (1991). A genetic andphysiological analysis of late flowering mutants in Arabidopsis thaliana. Mol.Gen. Genet. 229, 57-66.

Kurata, T., Kawabata-Awai, C., Sakuradani, E., Shimizu, S., Okada, K. andWada, T. (2003). The YORE-YORE gene regulates multiple aspects of epidermalcell differentiation in Arabidopsis. Plant J. 36, 55-66.

Kurata, T., Ishida, T., Kawabata-Awai, C., Noguchi, M., Hattori, S., Sano, R.,Nagasaka, R., Tominaga, R., Koshino-Kimura, Y., Kato, T. et al. (2005). Cell-to-cell movement of the CAPRICE protein in Arabidopsis root epidermal celldifferentiation. Development 132, 5387-5398.

Larkin, J. C., Oppenheimer, D. G., Lloyd, A. M., Paparozzi, E. T. and Marks,M. D. (1994). Roles of the GLABROUS1 and TRANSPARENT TESTA GLABRAGenes in Arabidopsis Trichome Development. Plant Cell 6, 1065-1076.

Lee, H., Suh, S. S., Park, E., Cho, E., Ahn, J. H., Kim, S. G., Lee, J. S., Kwon, Y.M. and Lee, I. (2000). The AGAMOUS-LIKE 20 MADS domain proteinintegrates floral inductive pathways in Arabidopsis. Genes Dev. 14, 2366-2376.

Lee, M. M. and Schiefelbein, J. (1999). WEREWOLF, a MYB-related protein inArabidopsis, is a position-dependent regulator of epidermal cell patterning. Cell99, 473-483.

Leiva-Neto, J. T., Grafi, G., Sabelli, P. A., Dante, R. A., Woo, Y. M., Maddock,S., Gordon-Kamm, W. J. and Larkins, B. A. (2004). A dominant negativemutant of cyclin-dependent kinase A reduces endoreduplication but not cell sizeor gene expression in maize endosperm. Plant Cell 16, 1854-1869.

Masucci, J. D., Rerie, W. G., Foreman, D. R., Zhang, M., Galway, M. E.,Marks, M. D. and Schiefelbein, J. W. (1996). The homeobox gene GLABRA2is required for position-dependent cell differentiation in the root epidermis ofArabidopsis thaliana. Development 122, 1253-1260.

Nesi, N., Debeaujon, I., Jond, C., Pelletier, G., Caboche, M. and Lepiniec, L.(2000). The TT8 gene encodes a basic helix-loop-helix domain protein requiredfor expression of DFR and BAN genes in Arabidopsis siliques. Plant Cell 12,1863-1878.

Okada, K. and Shimura, Y. (1990). Reversible root tip rotation in Arabidopsisseedlings induced by obstacle-touching stimulus. Science 250, 274-276.

Rerie, W. G., Feldmann, K. A. and Marks, M. D. (1994). The GLABRA2 geneencodes a homeo domain protein required for normal trichome development inArabidopsis. Genes Dev. 8, 1388-1399.

Rosinski, J. A. and Atchley, W. R. (1998). Molecular evolution of the Mybfamily of transcription factors: evidence for polyphyletic origin. J. Mol. Evol.46, 74-83.

Schellmann, S., Schnittger, A., Kirik, V., Wada, T., Okada, K., Beermann, A.,Thumfahrt, J., Jurgens, G. and Hulskamp, M. (2002). TRIPTYCHON andCAPRICE mediate lateral inhibition during trichome and root hair patterning inArabidopsis. EMBO J. 21, 5036-5046.

Schnittger, A., Weinl, C., Bouyer, D., Schobinger, U. and Hulskamp, M.(2003). Misexpression of the cyclin-dependent kinase inhibitor ICK1/KRP1 insingle-celled Arabidopsis trichomes reduces endoreduplication and cell size andinduces cell death. Plant Cell 15, 303-315.

Simon, M., Lee, M. M., Lin, Y., Gish, L. and Schiefelbein, J. (2007). Distinct andoverlapping roles of single-repeat MYB genes in root epidermal patterning. Dev.Biol. 311, 566-578.

Sugimoto-Shirasu, K. and Roberts, K. (2003). “Big it up”: endoreduplicationand cell-size control in plants. Curr. Opin. Plant Biol. 6, 544-553.

Szymanski, D. B. and Marks, M. D. (1998). GLABROUS1 overexpression andTRIPTYCHON alter the cell cycle and trichome cell fate in Arabidopsis. Plant Cell10, 2047-2062.

Thomas, J. H. (1993). Thinking about genetic redundancy. Trends Genet. 9, 395-399.

Urao, T., Yamaguchi-Shinozaki, K., Mitsukawa, N., Shibata, D. andShinozaki, K. (1996). Molecular cloning and characterization of a gene thatencodes a MYC-related protein in Arabidopsis. Plant Mol. Biol. 32, 571-576.

Wada, T., Tachibana, T., Shimura, Y. and Okada, K. (1997). Epidermal celldifferentiation in Arabidopsis determined by a Myb homolog, CPC. Science 277,1113-1116.

Wada, T., Kurata, T., Tominaga, R., Koshino-Kimura, Y., Tachibana, T., Goto,K., Marks, M. D., Shimura, Y. and Okada, K. (2002). Role of a positiveregulator of root hair development, CAPRICE, in Arabidopsis root epidermal celldifferentiation. Development 129, 5409-5419.

Yadegari, R., Paiva, G., Laux, T., Koltunow, A. M., Apuya, N., Zimmerman, J.L., Fischer, R. L., Harada, J. J. and Goldberg, R. B. (1994). Cell differentiationand morphogenesis are uncoupled in Arabidopsis raspberry embryos. Plant Cell6, 1713-1729.

Yoo, S. Y., Bomblies, K., Yoo, S. K., Yang, J. W., Choi, M. S., Lee, J. S., Weigel,D. and Ahn, J. H. (2005). The 35S promoter used in a selectable marker geneof a plant transformation vector affects the expression of the transgene. Planta221, 523-530.

Yoshizumi, T., Tsumoto, Y., Takiguchi, T., Nagata, N., Yamamoto, Y. Y.,Kawashima, M., Ichikawa, T., Nakazawa, M., Yamamoto, N. and Matsui,M. (2006). Increased level of polyploidy1, a conserved repressor of CYCLINA2transcription, controls endoreduplication in Arabidopsis. Plant Cell 18, 2452-2468.


DEVELO

PMENT

arabidopsis caprice-like myb 3 cpl3) controls … · caprice (cpc) encodes a small protein with an...

Documents