Supporting information

for

Grain size tunes microbial community assembly and nitrogen transformation activity under frequent hyporheic exchange: A column experiment

Yi Li 1, Jinxin Zhu 1, Longfei Wang 1*, Yu Gao 1, Wenlong Zhang 1, Huanjun Zhang 1, Lihua Niu 1

1 Key Laboratory of Integrated Regulation and Resource Development on Shallow Lakes, Ministry of Education, College of Environment, Hohai University,

Nanjing, Jiangsu, 210098, PR China

List of supporting information:

Figure S1. Schematic diagram of sampling location (118° 35′ 56.97″ E, 31° 54′ 27.11″ N; 20–30 m above sea level).

Figure S2. Temporal variation of normalized hydraulic conductivity for each individual column.

Figure S3. Experimental results of column experiments (Coarse-Fine column and Fine-Coarse column). All columns were alternatively eluted with AGW from the bottom and ASW from the top for six cycles. In each plot, the left-hand panel presents effluent concentrations of NO3

-, NO2-, NH4

+; and the right-hand panel presents distribution profiles of soluble NO3

- and NO2- and exchangeable NH4

+ in the columns (-30 cm is the AGW inlet and 0 is the ASW inlet) after the experiments were completed. The middle panel in each panel presents the different fillers of columns. PV refers to the pore volume in each column.

Figure S4. Dissolved oxygen in the effluent of each column. The upper part and the bottom part of each graph represent cases in the upstream and downstream flow period, respectively. Each drawing represents (a) Coarse column, (b) Mix column, (c) Fine column, (d) Coarse-fine column, and (e) Fine-coarse column.

Figure S5. Relative abundance of 58 phyla across sediment samples. The words at the top represent different sampling sites. 1-30 represent samples in different depths of each column (each group has 6 samples, a total of 30), sample 31 represents sediments in situ and sample 32 represents bacterial inoculum.

Figure S6. Highly differential taxonomy with linear discriminant analysis (LDA) values greater than 3.

Figure S7. The co-occurrence network interactions of bacteria communities in the Coarse column (a), Mix column (b), and Fine column (c). The connection stands for a strong (Spearman’s ρ>0.8) and significant (P-value < 0.001) correlation. The nodes represent unique sequences in the data sets. The size of each node is proportional to the degree of the OTU. The nodes colored by modularity class, colored nodes (except light gray) represent the eight major groups and light gray represents all modules except the eight main major modules.

Table S1. Water quality and sediment grain size parameters of sediment samples in the Nanjing Reach of the Yangtze River

Table S2. AGW and ASW chemical compositions (mM)

Table S3. Values of porosity in each column sample

Table S4. Primers and thermal profiles for absolute qPCR analysis of targeted genes

Table S5. Alpha diversity estimates of bacterial populations

Table S6. Absolute quantitative PCR results of functional gene abundancy (copies/g) in each column sample

Absolute qPCR analysis for N transformation Functional Genes

Amplicons were extracted from 2% agarose gels and purified using the AxyPrep DNA Gel Extraction Kit (Axygen Biosciences, Union City, CA, U.S.) according to the manufacturer’s instructions and quantified using QuantiFluor™ -ST (Promega,

U.S.). The constructed plasmid was linearized, then it was purified and quantified and converted into a copy number (copies/μL) by formula, and a 10-fold gradient dilution of the constructed standard, 90 μL of the dilution + 10 μL of the plasmid, generally 4-6 points. A 10-2 to 10-2 dilution of the standard was separately prepared by preliminary experiments to prepare a standard curve. The detection of fluorescence quantitative PCR (95 °C for 3 min, followed by 30 cycles at 94 °C for 30 s, 50 °C for 30 s) reactions were performed in triplicate 30 μL mixture containing 15 μL of qPCR Mix, 2 μL of Mg2+(25 mM), 0.5 μL of each primer (10 μM), 2 μL of template DNA, and 0.5 μL of Dyestuff. The functional genes, Primer sequences and qPCR procedures are summarized in Table S4.

Figure S1. Schematic diagram of sampling location (118° 35′ 56.97″ E, 31° 54′ 27.11″ N; 20–30 m above sea level).

Figure S2. Temporal variation of normalized hydraulic conductivity for each individual column.

Figure S3. Experimental results of column experiments (Coarse-Fine column and Fine-Coarse column). All columns were alternatively eluted with AGW from the bottom and ASW from the top for six cycles. In each plot, the left-hand panel presents effluent concentrations of NO3

-, NO2-, NH4

+; and the right-hand panel presents distribution profiles of soluble NO3

- and NO2- and exchangeable NH4

+ in the columns (-30 cm is the AGW inlet and 0 is the ASW inlet) after the experiments were completed. The middle panel in each panel presents the different fillers of columns. PV refers to the pore volume in each column.

Figure S4. Dissolved oxygen in the effluent of each column. The upper part and the bottom part of each graph represent cases in the upstream and downstream flow period, respectively. Each drawing represents (a) Coarse column, (b) Mix column, (c) Fine column, (d) Coarse-fine column, and (e) Fine-coarse column.

Figure S5. Relative abundance of 58 phyla across sediment samples. The words at the top represent different sampling sites. 1-30 represent samples in different depths of each column (each group has 6 samples, a total of 30), sample 31 represents sediments in situ and sample 32 represents bacterial inoculum.

Figure S6. Highly differential taxonomy with linear discriminant analysis (LDA) values greater than 3.

Figure S7. The co-occurrence network interactions of bacteria communities in the Coarse column (a), Mix column (b), and Fine column (c). The connection stands for a strong (Spearman’s ρ>0.8) and significant (P-value < 0.001) correlation. The nodes represent unique sequences in the data sets. The size of each node is proportional to the degree of the OTU. The nodes colored by modularity class, colored nodes (except light gray) represent the eight major groups and light gray represents all modules except the eight main major modules.

Table S1. Water quality and sediment grain size parameters of sediment samples in the Nanjing Reach of the Yangtze River

Median grain

size(μm)

Grain size (μm) Average water

depth (m)<2 2~1616~6

363~12

5125~2

50 >250252.9 2.1 6.2 2.4 2.7 35.3 51.3 14.4

The contents of NO3-, NH4+, DO, and TP in the surface water in Nanjing Reach of the Yangtze River were 0.44, 0.003~0.018, 0.19~0.24 and 0.005~0.007 mM, respectively.

Reference:

Xu, W., Cheng, H.Q., Zheng, S.W. et al. Evolution of Nanjing Channel in the Yangtze River and Its Response to Human Activities During the Last 20 Years. Scientia Geographica Sinica, 2019, 39(4), 663-670. doi: 10.13249/j.cnki.sgs.2019.04.016 (in Chinese)

Table S2. AGW and ASW chemical compositions (mM)

Mg Na K Cl NO3- S

O42- DO p

H

AGW 0.51 1.44 0.16 1.30 0.44 0.63 0 8.1

ASW 0.18 0.936 0.02 1.05 0.044 0.09 0.25 7.8

Table S3. Values of porosity in each column sample

Sample ID Porosity Sample ID Porosity Sample ID PorosityC1 0.41±0.02 M1 0.35±0.01 F1 0.33±0.01C2 0.41±0.01 M2 0.35±0.02 F2 0.33±0.02C3 0.40±0.02 M3 0.34±0.01 F3 0.32±0.02C4 0.40±0.01 M4 0.34±0.01 F4 0.32±0.01C5 0.39±0.02 M5 0.34±0.01 F5 0.32±0.02C6 0.39±0.01 M6 0.34±0.02 F6 0.32±0.01

Table S4. Primers and thermal profiles for absolute qPCR analysis of targeted genes

Target gene Function Primer I.D. Primer sequences Thermal

profileNo. of cycles

amoA_AOB

ammonia oxidation

amoA-1F 5'-GGGGTTTCTACTGGTGGT-3' 95°C-30s/60°C-30s/72°C-30s

40amoA-2R 5'-CCCCTCKGSAAAGCCTTCTTC-3'

amoA_AOA

ammonia oxidation

Arch-amoA-F

GCTCTAATTATGACAGTATAC 95°C-30s/50°C-30s/70°C-30s

40Arch-amoA-

RAYCATGTTGAAYAATGGTAATGAC

nirSnitrite

respirationCd3aF AACGYSAAGGARACSGG 95°C-30s/

60°C-30s/72°C-30s

40R3cd GASTTCGGRTGSGTCTTSAYGAA

nirKnitrite

respiration

Copper583F5′-TCATGGTGCTGCCGCGYGANGG-

3′95°C-30s/70°C-30s

8

Copper909R 5′-GAACTTGCCGGTKGCCCAGAC-3′95°C-30s/65°C-30s/72°C-30s

32

nrfAnitrite

reduction to ammonia

Nrf-6F 5′-GAYTGCCAYATGCCRAAAGT-3′ 95°C-30s/55°C-30s/72°C-30s

45Nrf-6R 5′-GCBKCTTTYGCTTCRAAGTG-3′

Table S5. Alpha diversity estimates of bacterial populations

Sample ID

Number of OTUs

Number of observed species

Shannon index

Simpson index Coverage

C1 5080 3665 8.86 0.99 0.93C2 5754 4490 9.25 0.97 0.92C3 6206 4997 10.44 1.00 0.92C4 5727 4563 10.09 1.00 0.92C5 6436 5075 10.48 1.00 0.91C6 6495 4971 10.39 1.00 0.91

CF1 3146 2831 7.95 0.97 0.95CF2 5084 4991 10.32 1.00 0.91CF3 6765 5003 10.47 1.00 0.92CF4 5583 5278 10.61 1.00 0.91CF5 5165 5125 10.53 1.00 0.91CF6 5694 4972 10.44 1.00 0.92FC1 5427 4785 10.08 1.00 0.91FC2 5513 5314 10.53 1.00 0.91FC3 6281 5503 10.70 1.00 0.90FC4 6215 4966 10.39 1.00 0.92FC5 6517 4962 10.35 1.00 0.92FC6 4677 4078 9.66 0.99 0.94M1 6561 4968 10.47 1.00 0.91M2 5986 5505 10.69 1.00 0.90M3 4960 4959 10.26 1.00 0.91M4 6444 4645 10.11 1.00 0.92M5 5305 5083 10.43 1.00 0.91M6 6019 4830 10.29 1.00 0.92F1 6416 4655 10.00 1.00 0.92F2 5125 4902 10.34 1.00 0.92F3 6605 4931 10.34 1.00 0.91F4 5483 5151 10.54 1.00 0.91F5 6241 4873 10.32 1.00 0.92F6 4801 3671 9.16 0.99 0.93

Sediment 6402 4747 9.51 0.99 0.91Bacteria inoculum

5874 5326 10.56 1.00 0.91

Table S6. Absolute quantitative PCR results of functional gene abundancy (copies/g) in each column sample

Sample ID

amoA_AOA (104 copies/g)

amoA_AOB(104 copies/g)

nirK(105 copies/g)

nirS(106 copies/g)

nrfA(104 copies/g)

C1 0.05±0.03 7.64±0.65 0.87±0.16 0.75±0.10 0.78±0.39C2 0.11±0.08 6.08±1.68 0.32±0.02 1.23±0.08 1.31±0.69C3 0.27±0.17 10.63±1.98 0.33±0.02 1.21±0.22 0.58±0.10C4 0.14±0.07 8.83±0.53 0.38±0.12 1.20±0.24 0.42±0.14C5 0.13±0.06 5.29±1.74 0.25±0.13 0.78±0.09 0.43±0.12C6 0.12±0.08 5.93±1.87 0.34±0.05 1.01±0.18 0.63±0.18M1 0.15±0.23 13.12±0.19 0.84±0.15 0.93±0.07 0.67±0.14M2 0.29±0.09 7.16±1.64 0.26±0.03 0.78±0.08 0.65±0.24M3 0.17±0.15 10.72±3.08 0.21±0.03 1.18±0.10 0.73±0.22M4 0.83±0.30 0.83±0.30 0.46±0.17 0.97±0.16 0.68±0.10M5 1.21±0.39 1.21±0.39 0.73±0.09 1.08±0.32 0.67±0.08M6 1.42±0.65 1.42±0.65 2.29±1.35 1.41±0.47 2.08±0.67F1 1.03±0.50 4.71±0.71 4.39±0.93 3.85±0.63 0.81±0.25F2 1.58±0.24 0.70±0.54 1.14±0.31 1.70±0.27 0.81±0.19F3 1.09±0.13 3.19±0.53 1.81±0.96 4.83±0.28 0.56±0.17F4 2.79±0.47 5.39±0.51 1.95±0.15 4.39±1.01 0.55±0.10F5 0.43±0.26 0.84±0.69 0.57±0.21 1.63±0.14 0.77±0.08F6 0.15±0.03 0.67±0.30 1.62±0.51 1.14±0.75 0.95±0.41

Each sample was analyzed in triplicate, and the results were used for error analysis.