august 18, 2014

28
Jaguar 101: Your guide to a new school year t’s a new y y yea ar and a ne e ew w w opportunity y y to m m ma a ake fr ri i ie e en n nd d ds s s , , , get involved d d, , b b b br r ri i in n ng g g g u u up p p y y your grad d des or tr y som me e et t th h hing n n ne e ew w w . W eve g g o o ot t t all the infor r r m m matio o on n n y y yo ou u u n n ne e eed d d to o o make this ye ea a ar r r t t th h he e e e b b b be e e e es s st t t t t o o o o on n n n ne e e e e o o o o of f f f f your college c c ca a ar r re e ee e er r r . . . L L L L Lo o o o oo o o ok k k k k f f f f fo o o or r r r r t t t t th h h h he e e pawprints for b b ba a ac ck k k-t t t to o o o- -s s s sc c c ch h h ho o oo o ol l l l l l t t t ti i i i ip p p p s s s . . LIFE SPORTS OPINION Dear Whomever Anonymous answers to anonymous questions 24 Athletic Director talks fall sports Dr. Joel Erdmann gives insight into upcoming year 16 Intramural sports New events and new ways to get involved 11

Upload: the-vanguard

Post on 02-Apr-2016

224 views

Category:

Documents


2 download

DESCRIPTION

Jaguar 101: Your guide to a new school year, Jagmail is for more than just email, New year new expectations for JagTran Program, Get more from Counseling and Testing, A guide to parking at USA, South welcomes students with open arms, Bringing down the House lights:Let’s Be Cops, Intramural sports offers new ways to get involved, Jaguar Productions is one stop shop for all student events, Great in-town eateries, Interview with Dr. Erdmann, South Alabama football Media Day 2014, The only swag you need: South Alabama JagSwag, South Alabama football has first scrimage “away”, What we can learn from the suicide of Robin Williams, The truth behind getting involved at South.

TRANSCRIPT

Page 1: August 18, 2014

Jaguar 101:Your guide to a new schoolyear

tt’’ss aa nneeww yyyeeaarr aanndd aa nneeewww ooppppoorrttuunniittyyy ttoo mmmaaakkee ffrriiieeennndddsss,,,,

ggeett iinnvvoollvveeddd,, bbbbrrriiinnngggg uuuppp yyyoouurr ggrraadddeess oorr ttrryy ssoommeeettthhhiinngg nnneeewww.. WWee’’vvee gggooottt aallll tthhee iinnffoorrrmmmaattiiooonnn yyyoouuu nnneeeeeddd ttooo mmaakkee tthhiiss yyeeaaarrr ttthhheeee bbbbeeeeesssttttt ooooonnnnneeeee ooooofffff yyoouurr ccoolllleeggee cccaaarrreeeeeerrr... LLLLLoooooooookkkkk fffffoooorrrrr ttttthhhhheee ppaawwpprriinnttss ffoorr bbbaaacckkk--ttttoooo--sssscccchhhhoooooollllll ttttiiiiipppppsss..

LIFE SPORTS OPINIONDear Whomever

Anonymous answers to anonymous questions24

Athletic Director talks fall sportsDr. Joel Erdmann gives insight into upcoming year

16

Intramural sportsNew events and new ways to get involved

11

Page 2: August 18, 2014

2 AUG.18, 2014

Page 3: August 18, 2014

Editor in ChiefManaging Editor

Copy Editor Opinion Editor

Sports EditorJagLife Editor

Staff Reporters

Matthew Rex StricklandKarie FugettAlexander MoylanJordan KnoxAlyssa NewtonMitchell KahalleyLaura HavardJenna MundayDrew ScelsiAaron Poiroux

Editorial

Distribution Bobby FaulkAlan Smith

Distribution

Advertising Graphic Designer

Justine BurbankRyan Keller

Advertising

Advising

Accounting

J. SellersJ. AucoinKathy Brannan

Management

MissionThe Vanguard, the student-run newspaper of the

University of South Alabama, serves its readership by reporting the news involving the campus community and surrounding areas. The Vanguard strives to be impartial in its reporting and believes fi rmly in its First Amendment rights.

Send letters and guest columns to: The Vanguard

University of South Alabama P.O. Drawer U-1057 Mobile, Ala., 36688.

[email protected]

Letters and guest columns must be received by 7 p.m. on the Wednesday prior to the Monday publication. Submissions should be typed and must include the writer’s name, year, school and telephone number. All submissions become the property of The Vanguard. The Vanguard reserves the right to edit letters and guest columns for length and clarity. Letters will be limited to 300 words. Letters and guest columns are the opinion of the writer. The Staff Editorial represents the consensus opinion of the Editorial Board. All members of the Editorial Board have the same weight. The Vanguard has a commitment to accuracy and clarity and will print any corrections or clarifi cations. To report a mistake, e-mail [email protected]. The Vanguard is published Mondays during the academic year, except for exam periods and vacations, and is published twice each summer. The Vanguard is supported in part by an allocation from student activity fees and operates in the Student Media Department of the Division of Student Affairs. Issues are available at most University buildings and select off-campus locations. The fi rst copy is free. Additional copies are $1 each. Freelance writers will receive payment at the discretion of the section editor and will be notifi ed.

To request additional issues at a stand near you, email:

[email protected]

3AUG.18, 2014

PATRICK BIGBIE | STAFF METEOROLOGISTPATRICK BIGBIE | STAFF METEOROLOGIST

If you SEE somethingSAY something!

251-460-6312

USAPD crime blotter6/5/20141:00 p.m.

Visual Arts parking lotProperty damage

6/5/20148:51 p.m.

USA Medical CenterPublic intoxication

6/7/20148:00 a.m.

Dialysis ClinicTerrorist threat

6/10/20147:23 p.m.

The GroveDisorderly conduct

6/17/201410:29 p.m.The Grove

Residential building fi re

6/18/20143:15 p.m.

Jack Brunson Dr.Drug traffi cking, possession of a

concealed weapon, drug para-phernalia, attempting to elude

a police offi cer, altering fi rearm identifi cation.

6/25/20149:52 a.m.

The GroveHarassment, criminal trespass

second degree, criminal mischief third degree

7/8/20142:30 p.m.

The GroveCriminal trespass 3rd degree, violation of disciplinary sanc-

tions, unauthorized use of con-trolled substance, unauthorized presence on university premises

7/18/20141:30 a.m.

The GroveFailure to comply with directions

of university offi cials

Page 4: August 18, 2014

4 AUG.18, 2014

In 2012 the University of South Ala-bama began using Google to host its

email system. Similar to its own email ser-vice, Gmail, Jagmail provides many ways to organize and categorize incoming emails.

Students can create what are called la-bels to aid in the organization of the many emails that they may receive during the school year. Labels can be color coded and arranged into a hierarchy of labels and sub labels. Any labels created by a student can

be found in the sidebar of the Jagmail win-dow, and one can simply drag-and-drop emails onto these labels to organize them.

Along with Jagmail comes a few of the many services also offered by Google. Their slogan, “One account. All of Google,” re-fers to the ability to access everything with just one email address.

Students with a Jagmail account have ac-cess to Google Docs, a service that acts much like Microsoft Offi ce.

Google Docs is an online program that allows students to create everything they might need for a class. Accessible from the Google homepage, students can make word documents, presentations and spread-

ByBy M MATATTHTHEWEW S STRTRICICKLKLANANDDyyEdEdititoror-i-in-n-ChChieieff

Jagmail is for more than just emailsheets. All of these fi les can be saved on-line and accessed from anywhere through another Google service, Google Drive, us-ing the same Jagmail account used to create the document.

Google Drive acts as an online storage device for any electronic fi les one might need and can be accessed from any com-puter, tablet, or phone connected to the internet. Students are given 15 gigabytes of storage for free and can purchase additional storage as needed.

Students can also share access to any fi les or documents uploaded to Google Drive with anyone that also has a google account.

Multiple people can access the same document in Google Drive at the same time from remote locations and collaborate on any changes in real time. A chat feature is also available to help with the collaboration process.

Jagmail users can also use Google Calen-dar to sync events and homework assign-ments across computers and even to their smartphone. With the ability to color code events one could keep personal events, school, work and reminders well organized.

With the ability to use all of these fea-tures Jagmail can be useful far beyond just for email. For any additional help with Google apps go to support.google.com.

STAFF ILLUSTRATION

Page 5: August 18, 2014

5VOL 55 #3

New year, new expectations for JagTran Program

The JagTran system provides stu-dents and faculty with an alter-

native method of transportation around South Alabama’s campus. JagTran ve-hicles run continuously throughout the day and give students a free and easy way to travel from place to place throughout their week. This saves many students from the hassle of finding a different parking spot during their schedule and also helps the students conserve gas.

As stated online at southalabama.edu/jagtran, “No tickets, money or reserva-tions are needed. Students park their cars in color coded lots, which they choose, and then walk or ride JagTran.”

According to the USA Transportation Coordinator, Cindy Montee, the Jagtran office aims for a vehicle to reach the des-ignated stops every 7 minutes. There are 16 buses in total and 4 routes. With ap-proximately 3 buses to each route during the day, running from 7:10 a.m. until 2:30 p.m., then switching to the late route, the system usually runs smoothly. The routes are posted on the web site and there are maps outside the student center.

Brochures that detail the routes will be available on the buses during the be-ginning of the semester. These are free and will be with the driver who will give them out when requested.

The drivers take the riders’ safety very seriously and will only stop at the des-ignated areas. This is to avoid accidents or injury. The drivers do everything they can to ensure everyone gets where they need to be in a timely fashion. It is sug-gested that you leave adequate time in your schedule for traffic and the other stops.

Patrick Downing, the USA Transpor-tation Services Director, speaks very highly of the JagTran drivers. He said, “All of our JagTran drivers are hand-picked, dedicated professionals who un-derstand the importance of transport-ing our students throughout the campus in a safe manner as quickly as possible. Another quality our drivers possess is customer focus. They recognize that our students are our customers and our drivers go to great lengths to ensure our customer service is tops. More than 50% of our drivers have been driving for Jag-

HoHoHoHoHooopepppppeepppppppppppppppppppppppppppppppppppp fufulllly y ararririvivingng eeeeevevevveveveveryry s sevevenen m mininututeses, , stssstststsstttsstttstttudududuuududdudduduuuddddddddenentsts c canan h hopop o on n ananananannny yyyy yy JaJagTgTraran n fofor r frfreeee t to o trttrtrtrrravavavavavvavvvavveleeeleeeeeee t to o vavaririouous s lolocacatittttit ononononnnnnns s onon c camampupus.s.

See JAGTRAN Page 8

SOUTHALABAMA.EDU/JAGTRANSOUTHALABAMA.EDU/JAGTRAN

ByBy J JAMAMIEIE R REIEIDDyyReRepoportrterer

Page 6: August 18, 2014

Twitter

6 AUG.18, 2014

CCCaaallllll UUUsssToTT day For

SPECIAL DEALS

Call UsToday For

SPECIAL DEALS

All Companies Above Under Same Ownership

A-Cool Storage 251-662-1275www.acoolstoragemobile.com

All American Self Storage 251-639-0444www.allamericanstoragemobile.com

Dawes Stor-All 251-607-0655www.dawesstorallmobile.com

Grand Slam Storage 251-607-0775www.grandslamstoragemobile.com

Magnolia Storage 251-343-7867www.magnoliastoragemobile.com

StorageMax University 251-660-5058www.storagemaxmobile.com

USA Storage 251-341-4585www.usa-storage.net

WWW.MOBILESBESTSTORAGE.COMMOBILE’S BEST STORAGE

(some locations)

6520 Grelot RoadMobile, AL 36695

Phone: 251-607-0775

8601 Jeff Hamilton Road EastMobile, AL 36695

Phone: 251-607-0655

684 So. University BlvdMobile, AL 36695

Phone: 251-660-5058

5827 Old Shell RoadMobile, AL 36695

Phone: 251-341-4585

5010 Moffett RoadMobile, AL 36695

Phone: 251-343-7867

7870 Tanner Williams RoadMobile, AL 36608

Phone: 251-639-04443310 Demetropolis Road

Mobile, AL 36693Phone: 251-662-1275

10%StudentDiscountwith this ad

Get more from Counseling and Testing

USA Counseling and Testing Services offers a number of programs and

counseling sessions to help students bet-ter their college experiences and handle any problems they’re facing. These services in-clude individual and relationship counseling, group counseling, career counseling, sub-stance abuse assessment, sexual assault coun-seling, consultation for faculty and staff, stan-dardized test administration and proctoring and referrals to other mental health providers and resources as needed.

When coming in for an appointment, one can expect to fi ll out a short information sheet. This gives counselors an idea of fam-ily history and background. Next, there will be an assessment counseling session. During this session, the counselor will learn more about the student and the problems at hand. Finally, a plan will be made as to what steps the student(s) should do to try resolving said problem(s).

According to the Director of Counseling and Testing Services Dr. Robert Hanks, con-fi dentiality in the Counseling and Testing center is just as if a student went off campus to speak with a counselor; no one will be told that a student has been scheduled for coun-

seling. Nor will it be refl ected on any academ-ic transcripts or letters of recommendation.

Even if parents or guardians of a student call the offi ce and directly ask if a student is seeking counseling, that information is kept confi dential and cannot legally be told to any-one.

There is a large misconception that coun-seling is only for the mentally ill. Dr Hanks says this is not true. There are a number of “normal” students who seek counseling. There are several options of counseling pro-grams that students can choose from.

“We have students ranging with problems such as test anxiety through major depres-sion,” Hanks said. “Students just need some-one to talk to.”

Recently, a new counselor, Shanta Jenkins, was added to the counseling staff. That brings the total count of counselors in the depart-ment up to four. Jenkins is a USA graduate, and she has much to bring to the depart-ment. With experience in group counseling, co-occurring disorders; life transitions and coping skills; emotional, mental and physical health; self-esteem issues; anger, stress, and time management; anxiety; depression, she specializes in substance and mental abuse.

“Being in college can be stressful; there

MATTHEW STRICKLANDMATTHEW STRICKLAND

CoCoCooooooCooooooununununuununnnnunuunu sesesesesesessssss lililillilingnngng aaandndnd TTesestitiiiiiiiiiiiiiiiiiiingngngngngngnggngngngngngnngnnggngnnnngnnnnnnnnnnggggggggg SSSSSSSSSSSerererererrrererererrreerrrerrerviviviviviviviviviviiviivviivv cecceccececececececcc s sss s sssss DiDiDiDiDiDiDDDDiDiDiDiDiiDDiDiDDDiDiiDiDiD rererererererrerererererererrrrereeereererectctctctcctcccctcctctctctcccctctc ororororoooroo DrDr. . RoRRoRoRRoRoRoRoRoRRRoRoRoRRRoRoRRoRRRoRoR bebebebbebebebebebebebeeebebebb rtrtrtrtrtrtrtrttrtrtrtrttrtt HHHHHHHHHHHHHHHHHanaananksksks ddddetetetetaiaia lsls ttttttttthehehhehehhheheeheheheheehehhhehheehehehheheeeheheeeheehheheeeeehee sssssssssssssssssstattatatatatatattttat ndndndndndndndndddndndnndararararararararaaraarra d d d d ddddd ddddd prprprprprprprprprprrrrprprp o-o-o-o--o-o-o-ooooocecedududuuuuuurererererrereeeeeeeerereeererereeererreeeeererees sssssssssss fofofofofffor r r r cocococococounununuu seseseelillililililingngng tttthohohohohohohoseseseseseseeeseess wwwwwwwwwwwwwwwwwwwwwwwwwhohohohohohhohohohohohhhhhhhhhh nnnnnnnnnnnnnnnnnneeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeed d d ddddddddddddddddd itititititttititititittittt........

ByBy L LAUAURARA H HAVAVARARDDyyReRepoportrterer

See COUNSELING Page 8

Page 7: August 18, 2014

7AUG.18, 2014

A guide to parking at USAIf you weren’t already aware, you’ll realize quickly that parking space on USA’s campus is limited, something that has frustrated students for years. To make your life a little easier, and to help you make it to class on time, we’ve com-

piled some parking tips.

Students who live on campus (or nearby): There are few reasons to take up already limited space if you live in the

area. So, if you do, take one for the team, and let the students who have no other choice but to drive in to class fi ght over parking.

Walk: It’s pretty self-explanatory. If your class is close by, walk to it. It’s hard fi tting exercise in between classes, anyway. This will not only free up space in the parking lots, but will also give you a chance to burn a few calories without even thinking about it.

Ride your bike: If your classes are a little too far away to walk to, then ride your bike. The school is equipped with bike racks all over campus. You can also rent a JagBike from the campus recreation center for $5 a semester.

Use the Jagtran: It runs from 7:10 am to 7:30 pm. You can fi nd and print route maps on USA’s website atsouthalabama.edu/departments/jagtran/index.

Commuters:

Carpool: It’s one of the most underrated and under-used options we have. Many of us are roommates with fellow students or know students who live close by. A little extra effort goes a long way. If we all practiced this, I sus-pect we would see a huge difference.

Choose your parking section wisely: Before you choose, fi gure out where all of your classes for the semes-ter are located. Park in an area that is closest to the majority of your classes. You can fi nd a map of all of the parking sections here: southalabama.edu/departments/parking-services/map. And you can fi nd a map of the buildings on campus here: southalabama.edu/maps.

Look for Open Parking: On the map above, you’ll fi nd sections with open parking. If you’re in a bind and simply cannot fi nd something in your section, see if one of those lots will work for you.

Get to class early: Parking is a little less daunting in the morning, for starters. But even if you can’t get in that early, get there as early as you can so that you have plenty of time to fi nd a spot.

Walk between classes: You can do it. I believe in you. Don’t let the students who live on campus be the only ones getting a workout.

Bring a bike: This especially goes for students whose classes are spread out. Once you’ve found your spot, keep it, and take your bike everywhere else. If you park in sec-tions other than your own, you will get a ticket (I’ve gotten many…they don’t mess around). Besides, you don’t want to spend the majority of your day fi ghting for parking spots.

You can use the Jagtran, too: If you have a stellar spot, but one of your classes is far away and you don’t have a bike, jump on the Jagtran. A link to their routes can be found in the “Students who live on campus” section.

Page 8: August 18, 2014

8 AUG.18, 2014

Tran for more than five years. Most of our students appreciate what our drivers do for them and many drivers have been invited by students to their graduation ceremony.”

The mission statement states their purpose,

“To maintain and operate a safe and reliable transportation system for the movement of students and faculty

throughout the University of South Alabama campus,” and “to plan and co-ordinate all external transportation re-quirements for all University of South Alabama departments.”

They would like to inform everyone that the Student Center Circle will be closed August 18-25, 2014 due to road work. All routes will load and unload on the south side of the student center until the road work is cleared up.

The officials behind the JagTran sys-tem want you to feel free to direct any questions or concerns to the hotline number at 460-7777.

JagTrancontinued from pg. 5

SOUTHALABAMA.EDU/JAGTRANSOUTHALABAMA.EDU/JAGTRAN

Counselingcontinued from pg. 6

are more pressures,” Jenkins said. “For a lot of students, it’s their fi rst time away from home. I’m just here to help them fi nd a good outlet.”

Diversity is what she is hoping to bring to the staff. Jenkins said that sometimes minor-ity students often feel as though they cannot connect as well as others. She is hoping to change this and make all the students feel as though they can have a place to go.

“Students can come to me if they need variety or just someone to share the same cultural background with,” Jenkins said. “I just want to help people.”

All students are encouraged, by the coun-selors, to call 460-7051 to schedule an ap-pointment. Business hours are Monday through Friday from 8 a.m. to 5 p.m. in Al-pha Hall East Room 326. Currently enrolled USA students are eligible for free counseling services, and there is no limit to the number of sessions one can schedule each semester. There are some instances such as the stan-dardized test that can charges may be appli-cable.

MATTHEW STRICKLANDMATTHEW STRICKLAND

MsMs. . ShShanantata J Jenenkikikikikik nsnsnsns, ,, ththththhe e e nenenenewewewewew stststst aaaadddddddditititi ioioiooi n nn n n nn tototototototo ththe e CoCoununseselilingng aaaaaandndndnd TTTTTesesesstitititingngngng CCCCenenenenteteteer,r,r,r, hhhhopopoppopeseses toto o offfferer d diviverersisityty ttttttto o o stststttudududuu enenenentstststs aaandndndndd fffacacacaculullultytytyt ...

ThTTThThe e e JaJaJaJaJaJaJaJagTgTggg raran n nn n n prpprprprp ogogogoggrararam m hahahas s s 161616 vvehehe icicleles s s anand d opoppererratatatesesesess ffffouououo r r r r didididifffffffferererenenenent ttt rorororoututututesesseses ddddurururiniining gg g thththththe eeee dadadadadadaday.yyyy.y.y.y.

Page 9: August 18, 2014

MITCHELL KAHALLEY LIFE EDITOR

[email protected]

AUG.18, 2014LIFE

MATTHEW STRICKLAND

EVENTS THIS WEEK

18 OMSA “Line Dance Night”7-8 p.m.Student Center

19 Kickoff Cookout 4-7 p.m.Sorority Commons

20 CPC Recruitment Orien-tation 5:30 p.m.Student Center Ballroom

21 CPC Recruitment Round One Parties 5:30 p.m.Sorority Commons

Jaguar Productions Out-door Movie “Godzilla”8 p.m.Student Center Amphitheater Free

22

Jaguar Productions Movie Night “Divergent” 8 p.m.Student Center Ballroom Free

Th e Grove Pool Party 2 p.m.Th e Grove Free

On Saturday, the University of South Alabama welcomed hundreds of new

freshmen for the 2014-15 school year. This year is the twentieth anniversary of JagFest, an all day event to welcome incoming students to the Uni-versity held on the Saturday before the school year starts. The morning opened with move-in day, which featured over 700 USA faculty, staff, alumni and students helping new students move into the residence halls. At the start of his fi rst full academic year as president of South Alabama, Dr. Tony G.Waldrop and his wife Dr. Julee Waldrop greeted new students and their parents and helped them move into their dorms.

Later in the afternoon, student organizations were allowed to set up booths in the concourse of the Mitchell Center to offer information to all freshmen and transfer students. The Campus Fair featured over 100 student organizations, highlighting the diversity of interests within the student body.

After the Campus Fair, new students and their families were treated to a dinner buffet hosted by President Waldrop in the Mitchell Center.

JagFest was the fi rst in a long line of wel-come events planned by the university. On Tuesday Aug. 19, Jaguar Productions is holding a “Kickoff Cookout” on the Sorority Com-mons. This is a great place for new students to get to know each other and have all their ques-tions about life on campus answered by students that already live at South.The cookout will have

ByBy M MITITCHCHELELL L KAKAHAHALLLLEYEY yyLiLifefe E Ediditotorr

South welcomes students with open arms

FACEBOOK FACEBOOK

FACEBOOK FACEBOOK NeNeNeNeNew w w w w SoSoSoSoSoutututututh h hhh h AlAlAlAlA abababamamama a a stststuddudenenentsttts

ononon MMMMovovovove-e-e-e-e InInInIIIIIII DDDayayay 2220101014.4.4

ByBy aaaftftfftf ereerrnononon ononon, , , , thththhhththtt e ee rerereeeeeresisis dedededeencncnnnce e hahahalllllls s wewerere fififififi lllllelleleed d d ddd d wiwwiwiwiwwiwiwiiwiw thththhhtt ssstutut dedentnts s momomomoviviviviv ngng iiintntn o o ththeieieie r r r hohohohhh mememee ffforororrr tttthehehee nnnexext t sesememeststererr....

free food, music and games. The annual Football Fan Day will be held on

Aug 24.,on the fl oor of the Mitchell Center. This gives everyone a chance to meet Jaguars head coach Joey Jones and the Jaguar football team. The Jags fi rst home game this season is against Mississippi State on Sept. 13.

On Aug. 27, the university will be sponsoring Get on Board Day. Get on Board Day is simi-lar to the Campus Fair, however it will feature over 200 student organizations, twice as many that were in the Mitchell Center concourse dur-ing JagFest. It gives students the opportunity

to meet with clubs and organizations they may have missed during JagFest, or the chance to go back to the ones they liked and get even more info. All students are encouraged to come to Get on Board Day and fi nd a group to get in-volved with.

Getting involved on campus is the best way to meet new people and start to feel at home. With so many student organizations, there’s bound to be something for you. Take the op-portunities provided to you and get involved. The college experience is so much more than what you do in the classroom.

Page 10: August 18, 2014

10 AUG.18, 2014

Bringing down the House lights:Let’s Be Cops

Let’s Be Cops” is the latest police comedy that debuted

Wednesday, Aug. 13. Jake John-son and Damon Wayans Jr. from FOX’s “New Girl,” star as two down-on-their-luck friends/room-mates from college who go to a masquerade party during their col-lege reunion thinking it is instead a costume party. The two arrive as cops and when leaving they real-ize that everyone, including cops, thinks they are real cops. The pair decide to see how far they can take their shenanigans by buying an old police car, taking weed from teen-agers (to smoke for themselves), and stopping a gang from terror-izing local business owners.

While packed with below-the-belt jokes and comic conventions that are sure to please the masses, I feel “Let’s Be Cops” was more of a poor man’s “21 Jump Street.” The plot could be seen from miles away and viewers had to have a

ByBy S SHAHANNNNONON H HOUOUSESEyyCoContntriribubutitingng W Wririteter r

WIKI COMMONS WIKI COMMONS

high suspension of disbelief in order to accept the plot holes and convenience of much of the story. Rob Riggle—Mr. Walters from “21 Jump Street”—arrives as a slight fresh breath of air only to pull Johnson and Wayans Jr. into their con even more.

The duo’s main adversary is a group of Eastern-European gang-sters who prey on small business owners through their brute force. Insert Nina Dobrev, from the CW’s “Vampire Diaries,” as the waitress that always serves Johnson and Wayans Jr. at her family’s restau-rant Georgie’s. Georgie’s is the lat-est restaurant hit by the gangsters, and Johnson and Wayans Jr. carry out their false bravado by investi-gating their true intentions in Los Angeles which includes the usual money laundering, illegal sub-stances, and confi scated weapons commonly found in these buddy cop movies such as “The Heat” or “21 Jump Street”. At the end of the day, the duo realize that their actions have real-life consequences and they in turn act as real cops to take down the bad guys.

This movie was not a total fail-ure due to Johnson and Wayans Jr.’s on-air chemistry. Luke Green-fi eld, the director of “Let’s Be Cops,” seemed to know this pair would work from their previous grouping on “New Girl,” and the pair have an antagonistic, but play-ful banter throughout as Johnson truly wants to be a cop while Way-ans Jr. tries to stop the ploy on multiple occasions.

This comedy arrives at the tail-end of summer, so it didn’t have to compete with some of the bigger comedy titles—save “Guardians of the Galaxy”—such as “Neigh-bors,” “22 Jump Street” and “Tammy.” However, these buddy comedies have devolved into a string of clichés that not even big names like Melissa McCarthy or Channing Tatum can save. Ac-cording to IMDB, the R-rated fl ick has already produce $5.3 million for a Wednesday release and is ex-pected to make around $30 million for the weekend. This movie might be entertaining enough for most audiences, but I would recom-mend waiting to rent it at Redbox.

“L“L““L“L“L“L“L““L“LLLetetetetettettte ’s’s’s’s’s’ss BBBBBBBBBBBBBe ee e e eeee CoCooopspspp ” ” stststtstsssss arararararararaarr JJJJJJJJJJakakakaakakakakkaaakake ee e eee JoJoJJoJoJoJoJJJoooohnhhhhhhnhnhh sosoon.n.n.n

Page 11: August 18, 2014

11AUG.18, 2014

Intramural sports offers new ways to get involved

The Department of Campus Recre-ation provides students with many

opportunities to get active and a chance to get involved on campus. One of the best ways to do that is to play intramu-

ByBy M MITITCHCHELELL L KAKAHAHALLLLEYEY yyLiLifefe E Ediditotorr

OvOvOvOOvOOvvererereerrerr 1111111111111111,2,2,,2,22,2,2222222222,22,22222222222222250505050505050505505505550500550505055005050500050500055 ssssstututututuudeddededededed ntntntnts sssss pappppapapapapappppapappppppappaaaaaaaapp rtrtrtrtrtrrrtrtrrrrrrrtrr iciiiciciciiiiiiiiiiiciiiiiicccpapapapapapapapp teteteeeteed ddddddd inininininininninininnnntrtrtrttramamammma urururururralalalallalalal flflflflflflfl aaaaaag g g gg fofofofofof ototototototbabbbbbbbbaaabbababbbbbb llllllllllllllllllllllllllll iiiiiin n n n 2020202020202020202013131313131313...FACEBOOK | COLIN MCGEE FACEBOOK | COLIN MCGEE

ral sports. They are a great way to spend time with friends, make new ones and play your favorites sports. This year, the intramural schedule features new events alongside the usual favorites.

The first event on the intramural cal-endar is the Slip Slide Showdown to be held on Aug. 24. The Showdown will fea-ture multiple water slides, each with dif-

ferent challenges. “It’s more than just slipping and slid-

ing,” says Brian Allred, the Assistant Di-rector of Campus Recreation. “For exam-ple, as you slide you might be throwing something at a target and there will be prizes for the best.”

The Slip Slide Showdown is free to play, and open to all students.

This year, in collaboration with the Department of International Students, there will be an 11 on 11 World Cup style soccer tournament. Allred says the tour-nament will have a limited number of teams that will represent the diversity of the student body. If you and your friends want to be one of the teams to represent your country or region, you will have to play through a qualifying process. How-ever, don’t worry if your team doesn’t qualify for the World Cup, you can still participate in the seven on seven league that is held every year. The registration deadline for the World Cup ends on Sept. 12, while the registration deadline for the seven on seven league is Aug. 29.

Usually, if you wanted to play intramu-ral basketball you would have to wait until the spring semester. Luckily for roundball fans, there will be a chance to play in the fall. The 3 on 3 Streetball Jam will be held outside as opposed to playing on the

hardwood courts inside the rec center. The Streetball Jam will be held twice this semester, the registration deadline for the first tournament is Oct. 3. and Oct. 24 for the second.

Even with all the new sports to choose from this year, the biggest intramural sport at South is still flag football. Last year over 1,250 students participated. The traditional seven on seven league starts Oct. 12, but for those students who want to play flag football all semester, Redzone Flag Football, a variant of flag football played on a smaller field that acts as a preseason for teams and referees be-fore the traditional seven on seven league begins, starts on Sept. 7.

On Nov. 7, the Rec Center will be hosting Midnight Glow Games. They will feature volleyball, basketball, dodge-ball, twister, ultimate kickball and others played late at night with glowing equip-ment. This event requires no registration and is free to play.

For more information on how to reg-ister a team or register yourself as a free agent, and for the full intramural sched-ule for the fall sememster, visit the in-tramural website,southalabama.edu/intramurals/index, their Facebook page, facebook.com/usaintramurals and on Twitter @jagintramurals.

Page 12: August 18, 2014

12 AUG.18, 2014

Jaguar Productions is one stop shop for all student events

ByBy J JENENNANA M MUNUNDADAYYyyReRepoportrterer

What do seeing Christmas lights at Bellingrath Gardens, catching

the premiere of a new blockbuster hit at the movies on a Friday night and singing along to your favorite bands at BayFest all have in common? Well, Jaguar Pro-ductions offers discount tickets to all of these events, including many more.

Recently relocated to the new Student Center, Jaguar Productions is the stu-dents’ one stop shop for all things that are going on around campus. From plan-ning massages for the students in the food court, to “Old School Skate Night,” Jaguar Productions makes it their mission to help students get involved.

One way that Jaguar Productions gets students involved is by hosting movie nights right here on campus. In the past, Jaguar Productions has shown “Captain America,” “Robo Cop” and “Frozen,” to name a few.

Jaguar Productions will be hosting two movie nights this week and everyone is invited to attend.

The movie “Godzilla” will be shown

FLICKR

on Tuesday, Aug. 19 at 8 p.m. in the Student Center Amphitheater and the new hit blockbuster “Divergent” will be shown on Wednesday, Aug. 20 at 8 p.m. in the Student Center Ballroom.

This is a great way for students to get involved, meet some new people and watch a great movie in the process. Jaguar Productions will also be giving away free popcorn and drinks to those who attend.

If you’re ever in the mood to see a movie and Jag Productions isn’t offering one that night, don’t worry; they are still there to help.

Each semester, Jag Productions offers students $5 movie tickets that can be used at any Carmike Cinemas theater. These passes are good for all showings at the theater and will save you a good amount of money, especially for those that are huge movie buffs. The limit is fifteen tickets per student, per semester.

To find out more about what Jaguar Productions is up to this month, stop by their window to pick up the new Au-gust Campus Calendar or follow them on Twitter @JPSouthAL.

You can also text “JPTEXT” to 71441 to get messages sent to your phone about polls, prizes and upcoming events offered by Jaguar Productions.

Jaguar Productions discount tickets in-clude those to the Mobile Symphony, the Mobile Ballet, Bellingrath Gardens, Bay-Fest and Carmike Cinemas. These tickets are available to any USA student, faculty or staff member.

For those enrolled in the fall semester, discount tickets become available on the first day of classes. The office accepts cash, check, debit/credit cards and Jag Cash. So, stop by the Jag Productions window in the Student Center to pick up your discount tickets today.

JaJaJaaJaguggugguugugugugggguggugguuggguguguguuggggggggguggggugggg araaaaararaaaaaaaaaaaaaaaaaaaaaa PPProroroduduductctctioioionsnsns hhhhhololollololdsdsdsdssd eeeeveveveveentntntn s ss thththroroorougugughohohoututut ththththththhthhhhhhhhhthhhhhhe ee eee eeeeeeeeeeeee yeyyyyyyyeyeeeeyeeeyyeeeyyeyyyyeyyyeeyyyyyy ararar ttto oo hehehelplplp ssssstutututudedededentntntnts s s s gegegeget t t ininvovoolvlvllvededed...

Page 13: August 18, 2014

13AUG.18, 2014

Question

of Editionthe

Incoming Incoming freshmen,freshmen,

what clubs or what clubs or organizationsorganizations do you plan do you plan on joining?on joining?

Landon Miller

“Rugby”

Leeonna Buckhannon“Alpha Kappa Alpha”

Marcel Ross“Biomedical

Science Society”

Are you looking for something to help boost the marketability of your degree?

Savannah Adams “Greek Life”

Page 14: August 18, 2014

14 AUG.18, 2014

Page 15: August 18, 2014

15AUG.18, 2014

Great in-town eateries

Ilove food. It is one of my favorite pas-times and I typically fi nd myself plan-

ning my day around meals. I even try to schedule my classes to where I’ll have a de-cent lunch break. While I may be the only one that does this, I’m not entirely convinced.

At the start of my freshman year, a few of my friends and I started having “Fat Fri-day’s”: a weekly tradition that involved us go-ing out to eat every Friday night. While this may have hurt my bank account, I learned a lot about the restaurant scene in Mobile, so here are some recommendations for the next time you’re looking to go out to eat.

You have your Mobile staples such as The Dew Drop Inn, the oldest restaurant in city, that Jimmy Buffett listed as having one of his all-time favorite cheeseburgers (also where he claims the Heinz 57 from “Cheeseburger in Paradise” comes in).

And then you have your new favorites. Mirko Pasta, which is known for its made-from-scratch Italian cuisine and The Brick Pit, which is located around the corner from campus and known for their delicious BBQ. The Brick Pit has also been featured on the show “Man vs. Food Nation.”

For my fellow sushi lovers, Konnitiwa Su-shi Seafood & Steakhouse has been my go-to spot for years. Located at the intersection of Cottage Hill and University, Konnitiwa has delicious sushi at affordable prices. Just be sure to check their hours before you go; they close for lunch at 2 p.m. and reopen for din-ner at 5 p.m.

As I am a bit biased with my own favorite restaurant choices, I decided to ask around campus to fi nd out other students’ favorite places to eat. When asked what her favorite restaurant and menu item around Mobile was, occupational therapy major Whitney McDevitt didn’t hesitate to say Mugshots.

“The McDonald burger from Mugshots!”

said Whitney McDevitt. “It’s so delicious; I think it’s the best burger in Mobile.”

If you go, you can always try the McDon-ald burger that Whitney recommends (I’m partial to The Come-Back burger) or you can attempt to fi nish The Mugshot.

The Mugshot is a burger that has three patties, six strips of bacon, two types of cheese, mayo, mustard, lettuce, tomato and onion. As if that wasn’t enough, it also comes with beer battered fries, plus an onion ring and a pickle.

If you fi nish The Mugshot challenge in 12 minutes or less, the meal is on the house. If not, you’re left with a $20 bill and a full stom-ach.

While Mugshots is a big hit with many stu-dents, especially since we can now pay for our meal using Jag Cash, plenty of restaurants around town are also being noticed for their good food and reasonable prices.

“Big Time Diner is defi nitely one of my favorites,” said marketing major Kara Crook. “It’s good for students that live away from home because it has great home cooked meals at decent prices. I love their mac n’ cheese!”

If you’re looking for somewhere to eat outside of the usual university atmosphere, try going to midtown or Downtown Mobile and take your pick of all the choices.

For midtown, I would recommend Butch Cassidy’s, home of the famous “Butch Burg-er” and Fuego: a trendy Mexican restaurant that’s served with a “Cali Coast fi re.” If you need to put out the fi re of Fuego’s food, then you can head a few minutes back down Old Shell Road and visit the neighborhood hot spot that is Cammie’s Old Dutch Ice Cream Shoppe.

And if you’re going downtown, be sure to stop in at Spot of Tea: an adorable restaurant in Cathedral Square known for its atmo-sphere, delicious food and strawberry tea.

While I only listed a few, there are many delicious places to eat around town that offer great food and reasonable prices.

ByBy JJENENNANA M MUNUNDADAYYyyReRepoportrterer

FACEBOOK FACEBOOK ThThThThThhTThhhTTThThhhThThhThTTTTThThThTThhTThTTTThTTThTThTTTThTThTThT e eeeeeeeeee eeeee BrBBBBBBBrBrBBBrBBrBBBrBrrBBrBrBrBrrrBBrBrBBrBBrBrBrrrBrBrBrBBrBrBBrriciciciiiiiiiiciiiciiiciciciciiciciciciciiiciciciciiciciccciccccccccccccciicck kkkkkkkkkkkkkk kkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkkk PiPPPPiPiPiPPiPiPiPPiPPiPPiPiPiPiPPPiPiPPiPPiPiPiPPiPPiPiiPPiPPiiPiPiPiiPiPPit ttttttt tttt ttttttttttt isiiiiiisssisiisisiisisisssiiisisssiisiiisiiissisiissiisisiisssiss hhhhhhhhhhhhhhhhhhhhhhhhhhhomoooomoommommmomomomomoooooommoooooomooommoooooomomoooooommmmmoomooommmmoooooomooooooooooo e eeeeeeeeeeeeeeeeeeeeeeee eeee eeeeeeeeeeee tottototootootototoototootototttot sssssssssssssssssomomomommomomommmmmommmomommmmoommmommmomoommmme eeeeeeeeeeeeeeee eeeeee ee ofoofofofoffofofofofofofofofofoffoffoffoffoofffofffofofoffooffooooof MMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMMobobobobobobobobobobbbobbobobobobooobbobobobbboboboboobbooobbooooobbbbbbbobbbboboooo iliilililillliiilillilililililillliliililiilililililililillllile’ee’e’e’e’e’’’’ee’ee’e’e’e’e’e’eee’eee’eee’eeeee’’eeeeeeeeeeeeee s sssssssssssssssssssssssss bebebebbebeebebebbebbbeebbbbebebeeeeeeebeeeeeebeebbbbebeebbeebbeebbeeeeestsststststststststttsststtssststststststsssststststststsssststssstssttssststststtsttttssttsssstt bbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbbaraaaaararararararaaaaaaaaraaaaaaaaaaaaararara bebebebebebebbebebbbebebeeeeeeeeeeebeebebebeecucccucucuuuucucucucuuccuccucccuuuucuuuccccucuucucucucucuucucucuuuuuuuuuuuuucucucuuuucuuucuucuuue.eee.eeeeeeeeeeeeeeeeeee.eee.ee.e.e.ee.eee.ee.eeeeeeeeee.ee...

Page 16: August 18, 2014

ALYSSA NEWTONSPORTS EDITOR

[email protected], 2014

By ALYSSA NEWTONSports Editor

With a bowl eligible football team, a Sun

Belt champion soccer team, a nationally ranked softball team and more prestigious honors earned by South Alabama athletics this past year, we have one question: What’s next at South Alabama?

We sat down with Athletic Director Dr. Joel Erdmann and discussed what is coming this year for USA athletics.

The Vanguard: We’ve seen you tweet about all of the renovations and improvements made to various athletic facillities. What does that consist of ?

Dr. Joel Erdmann: We have our building and, soon to be completed, new bench shelters and elevated operations press area. All of which is made with brick and steel. … This provides us with a more stable structure and it looks more professional. It needed to be done, but we are also holding the Sun Belt Soccer Championship this year. We want to make sure when other teams come to us we are representing the school and the sport appropriately.

We are fortunate to install new seating in the Jaguar Gym. We were able to add seating in at the baselines of volleyball and replace old wooden bleachers with some more contemporary and properly colored seating.

We are also in the midst of a locker room renovation for men and women’s basketball. The locker rooms needed some updating, and along with that, a lounge room for the men and women.

As some projects are completed, some are on the horizon. We need to start to look at men and women’s tennis. Hopefully that a year from now we will generate enough money for renovation of the locker rooms as well as other smaller projects.

We don’t have to be extravagant and the best, but we try to make sure it looks the right way. It helps us recruit.

VG: With the addition of JagNationTV and the new

multimedia aspect of USAJaguars it gives fans a new outlet for USA athletics. Can you tell us about that?

JE: We have just completed a 5-year partnership with IMG

who has all of our marketing and sponsorship rights. To replace that partnership we have Jaguar Sports Properties.

JagSwag Rewards program for athletics

ggg gggggggggTTTThThThThThTThThThThThTTThThhThThThThThhThThTThThTThThhhThTThThThhe eeeeeeeeeeeeeeeeeeeeee e nenenenenenenennennenenenennenennnenenennenenenenennneneewlwwwwwwwwwwlwlwlwwwwwlwlwlwwlwwwwlwwwwlwlwwwwwwwwlwwlwwwlwlwlwwwwlwlwlwllw y yyyyyyyyyyyyyyyyyyyyy y yy bububububububbubbububububbbbubububuububbuububub ilililililllllliilliililililllillilliiiliilililililililt ttttttttttttttttttttt tt sosssososooososososososoososososoosooosoosoooooooososoosooososososoosooccccccccccccccccccccccccccccccccccc erererererererereeererrererrerrererererer pppppppppppppppppppprerererererereererereereerereeeerrereresssssssssssssssssssssssssssssssssssss bbbbbbbbbbbbbbbbbbbboxoooxoxoxoxxxxxxxxoxoxoxxoooxxoxxxxxxoxxxxxxxxxxooxoxoxxxxoxoxoxxxxxooxoxooxxxxxooxoxooxxxxoxxxxoxoxooxxxoxoxxxxxxxxoxxx fffffffffffffffffffffffffffffffforororororrrorrororrrorrorrorororrrororrorrroroororororrorrororororrrorrororororrroroorooroooorroroooororooororroororoooooooo tttttttttttttttttttttttttttttttttttttttttttheheheheheheheeeeeeheeeeeheheheheeheehehehehhehheheheheehehehheheheheh uuuuuuuuuuuuuuuuuuuuuuuuuuuupcpcpcpcpcpcpcpcpcpccpcpppcpcpccppcpcpcpcpcpppppppppppppppppppppp omoooomomomomommmmmomommmmooommmmooommoommmmmmmmmoomommmomomommmmommmmomo ininiiinininininininnnnnniniininniinniinininnnninininiinininininininiinninnnnnnnnnnnininininninninininninininiing gggggggggggggggggg gggg gg ggg gggggggggSSSuSuSuSuSuSuSuSuSSuSuSuSuuuuuSuS n nnnn n nnnnn BeBeBeBeBBeBBBBeBeBeBBeBBeB ltltltltlttlltltltltltlttlt CCCCCCCCCCCCCCCononononono fefffffffffffefefefferererererencncncncncn e eeee SoSoSoSoSoSSSSSSSSS ccccccccccc ererererererree CCCCCChahahahahahhhhhhanpnpnpnpnpnnpnpppppppnppppppnppppppioioioioioioiiiiiiiiiiiiiii nsnsnsnsnsnshihihihihihihihihihihihhihhhhhihhhihhihihip.ppppppppppppppp.p.pp.ppppp

pg. 19 pg. 20 pg. 21 pg. 22USA football media day

Coaches, players talk 2014 seasonFirst fall scrimmage Football has“away game”

JagNation 101 Top 5 things to be a JagFan

Alyssa Newton

TWITTER TWITTER Jaguar Gym renovations completed.

Interview with Dr. ErdmannInterview with Dr. Erdmann

See ERDMANN Page 18

Page 17: August 18, 2014

17AUG.18, 2014

Alyssa Newton

#JagTweets

Finding the best tweets from South Finding the best tweets from South Alabama athletes. Make sure you follow Alabama athletes. Make sure you follow us on Twitter for sports updates and us on Twitter for sports updates and liveplay-by-plays. liveplay-by-plays. #JagNation#JagNation

USA Vanguard Sports@USAVGSports

Austin Karazsia @AKarazsia

Tyler Klava @tylerklava

Amanda Minahan @MandaMiniVan

Hunter Vaughn @HVaughn3

Derek Westbrook @thederekwestbrook

Sarah Hay @sarahhayUSA02

Most annoying thing in the world is automatic sinks.

New year, new parking permit. Ready to be back with my Jag fam. #JagNation

The bachelor in paradise is a phenomenal show! I wanna go on it! #clutch

Who needs a man when you’re the one making the dough?

I love walking outside and immediately starting to sweat

I know that everyone is on this Frozen craze, but let’s please not forget Tangled. Such a great movie.

QB

F

IN

XC

K

FOOTBALL

BASKETBALL

GOLF

Softball

SOCCERChloe Rathurn @ChloeRathburnThe soundtrack to Holes in underrated

IN Softball

Track and Field

G

Page 18: August 18, 2014

18 AUG.18, 2014

It is Jaguar Sports Properties’ mission to raise money through corporate sales, ticket sales, donations. But also we have some very skilled broadcasting people who double as sales people, JD Byars, director of broadcasting, and Pat Greenwood who came to us from Channel 15.

Part of Pat’s responsibilities as director of multimedia is to help develop JAGNATION TV.

It is an online conduit to real time video feed whether it is a streaming of games or frequent reports through presentations of sports highlights or student athletes.

Our hope is to provide easy access to fans to get them to have a video update daily. We want them to get to know our coaches and our kids. … Hopefully people get in the habit of checking it daily. It won’t just be live programming, but also archiving.

VG: With big games such as Mississippi State and Navy coming to Ladd-Peebles Stadium, are there any changes being made with these games in mind?

JE: Little things, nothing significant. We will play the alma mater prior to the games as well as after the game. Which is somewhat of a traditional practice I

believe. Immediately after the national anthem we will go into the alma mater. That’ll be prior to the run out. I think where we are we need to continue to get our fans in a rhythm or cheering and chanting ... I don’t think we will bring in anything necessarily new, but try to reinforce the traditions. I think it’ll be a lot of fun.

VG: The Jags will be doing a lot of traveling, especially with new Sun Belt Conference additions Idaho and Appalachian State. What can you tell us about our a few of the new conference members and traveling?

JE: We are flying to 5 of our 6 road games. Idaho is one of the new Sun Belt members; they are football only. It will be an interesting trip. They play in a dome, a closed facility. They will have a loud environment. We travel to Appalachian State which has a very collegiate tradition game day environment. They have been playing football for a long time. Their students and fans really rally around their program so they’ll have a full stadium and it’ll be a fun game environment.

Georgia Southern comes to u this year. They beat Florida at Florida last year. The teams that are coming in have very strong traditions in football and in other sports programs as well. The addition of these teams is a very good thing.

VG: This year all Sun Belt basketball games will be doubleheaders with men’s

ERDMANNERDMANNContinued from Page 16

and women’s games back-to-back . What does this mean for South basketball?

JE: One of the reasons to go to doubleheaders this year is the concern of missed class time. In some ways they are good and in some ways they are bad. We think Saturday doubleheaders are attractive because we will look to play more afternoon games.

Doubleheaders during weekdays will be a potential negative; the first game would tip off at about five and then the next game after. But the crowd for the second half of the first game will be large. With that crossover traffic fans will be able to see both teams play. I think both teams are poised to show improvements this year.

Basketball locker room renovations.TWITTER

Page 19: August 18, 2014

19AUG.18, 2014

South Alabama football South Alabama football Media Day 2014 Media Day 2014 “We’re going to win this daggum ballgame”

DREW SCELESI Sports Reporter

South Alabama coaches and players held their media day Tuesday, Aug. 12

to talk about the upcoming 2014 football season.

The Jaguars, who closed out the 2013 season by reeling off three straight wins and achieving bowl eligibility for the fi rst time in school history, look to keep that momentum going. The Jags were voted to fi nish third in the Sun Belt Conference in 2014.

Head coach Joey Jones was the fi rst to be interviewed and spoke about the upcoming year:

“We’re very excited about this season, and our guys are ready to get after it. We’ve been practicing six or seven days. [We’re] bringing a lot of energy to practice and a lot of energy to this season, so we’re excited about where we are at this point, and looking forward to the schedule we have … We know about all the teams in the Sun Belt, [we’re] playing Mississippi State, South Carolina, Navy and Kent State.”

The Jaguars’ schedule for 2014 is among the toughest in the Sun Belt, with trips to South Carolina, Arkansas State and reigning Sun Belt champion Louisiana-Lafayette, as well as the home matchups against Mississippi State and Navy. “First of all, our guys want to play the best,” Jones said, “They want to play the SEC schools, they want to play the ACC schools, and they enjoy playing in those venues … Our goal is to go out and do the very best we can.”

Wide receiver Jake Howton and offensive tackle Ucambre Williams made it clear that the Jags are not fazed by this year’s tough schedule. “Last year at Tennessee, it was

like, ‘Wow, we can play with these guys,’” Williams said. “Sometimes the media portrays the SEC teams as Goliath, but we can compete with anyone in the nation.”

“We have a lot of high expectations,” Howton said, “We fi nished last year strong, and we felt like we were a really good football team towards the last four or fi ve games of the year … We have a lot of starters back: a lot of guys that have been here for a long time.”

Nose tackle Jesse Kelley and safety Terrell Brigham closed out the interviews, with Kelley expounding on the team’s high expectations. “Expectations going into the season this year are pretty high,” he said, “For myself, I want to win a championship, and I want to win a bowl game. That’s just simple.”

“We’ve got three seniors and a sophomore [in the secondary],” Brigham said, “We pretty much [all] got playing time last year, so with us having all that experience, I feel like we have high expectations.”

Coach Jones stressed that closing out games will be an area of focus for South Alabama this year. Four of the Jaguars’ six losses in 2013 came by a combined fi ve points, with three of those decided in the fi nal minute of the game.

“Last year we were a little thin in our depth at times, and we were tired at the end of games; now we have more depth, and that does factor into it,” Jones said, “Also, it’s just a mentality. A mentality of, ‘We’re going to fi nish this daggum ball game and we’re going to win it,’ and I think that comes with time. Our program was growing … and now we need to learn how to close out close games.”

ALYSSA NEWTON ALYSSA NEWTON

Page 20: August 18, 2014

20 AUG.18, 2014

The only swag you need:South Alabama JagSwag App that rewards you for going to free events

At South Alabama not only can you attend athletic events free of

charge, but you are also rewarded for the games and events you attend.

How? With JagSwag.JagSwag is an app that rewards

students for attending games at the push of a button. The first event is the soccer game against UAB at The Cage on Friday, Aug. 22. To gain the points for this event, all a student has to do is attend the game and check-in. The app uses your GPS location and gives you points once it has verified that you are there.

“We were really pleasantly surprised,” Athletic Director Joel Erdmann said. “It really drove our student attendance up last year. With JagSwag I think we are ahead of the curve.”

Last year prizes ranged from a pair of South Alabama sunglasses to a chance to win an iPad at the end of the year.

“JagSwag is just another reason to come out and support Jaguar athletics,” senior Regan Dyal said. “It encouraged me to attend other athletic events I might not normally go to. The rewards offered really gave incentives to come out to games.” Dyal ended last year with

161 JagSwag points with prizes, food and apparel to show for it.

According to Erdmann, last year was just the beginning. He anticipates this year to be even bigger and better.

“What we are doing this year (with JagSwag) is, since now we are in control of our sponsorships, we will be able to use them at a greater level within JagSwag,” Erdmann said. “I think you will see more variety in what we are able to offer students.”

The app isn’t only a way to check into events, but it also offers other cool features. On the main screen there is a menu of what the entire app contains. You can change your username, check out your awards, see where you stand on the leaderboard and more.

One of the most popular parts of JagSwag is the fancam. Students and fans are able to share pictures of themselves at games and events with other Jag fans.

Or you can hit the social button and check out South Alabama Athletics Facebook, Twitter and YouTube account and keep up-to-date with all Jaguar sports, including the newly added JagNationTV.

So if you are planning on attending any South Alabama games this year, download the app, share pictures with fellow Jag fans, and go out and support your Jaguar athletics.

AARON POIROUXSports Reporter

STAFF ILLISTRATION STAFF ILLISTRATION

Page 21: August 18, 2014

21AUG.18, 2014

ALYSSANEWTON Sports Editor

With less than a month from the first South

Alabama football game at Kent State, the Jaguars took a trip down Old Shell Road to St. Paul’s E.E. Delaney Field for their first fall scrimmage.

The Jaguars held an open 75 minute scrimmage Saturday where the Jags ran 81 plays with 562 yards of offense.

Head coach Joey Jones wanted to give the team an “away game” atmosphere away from the familiar South Alabama practice field. South Alabama will have six road games this season, the first being their season opener at Kent State.

“We needed to come over here to St. Paul’s for a different atmosphere and get our kids used to playing on a different field,” Jones said. “I think if we can do that, we can go to Kent

State and go to South Carolina and experience these things before we get into the season. We want to get our guys used to being on a different field and not just our own field.”

“Our guys understand that playing time is on the line and it is what it is,’’ Jones said.”I don’t care who the mamas are and the daddies are, the best players are going to play. That’s just the way it works.’’

Starting quarterback Brandon Bridge completed the scrimmage with 10 of 18 passes for 131 yards with three touchdowns. These included a 1-yard touchdown to Jereme Jones, a 25-yarder to Wes Saxton and a 15-yarder to Shavarez Smith.

“I feel great, I’m more confident,” Bridge said on his progress. “I feel good about my reads and about our receivers; I’m building great chemistry with Shavarez [Smith] and Wes [Saxton]. I’m way more

confident than last year.”Backups Matt Floyd and

Hunter Vaughn were given the reps behind Bridge in the scrimmage with Floyd going 5 of 7 and passing for 42 yards and Vaughn 6 of 9 passing for 173 with two touchdown passes. Vaughn connected a 44-yard pass to T.J. Glover and a 35-yard pass to wide receiver Tony Ray Parnell. Trey Fetner did not participate in the scrimmage.

Running back T.J. Glover had 7 carries for 64 yards and two catches for 59 yards.

“It felt really good,” Glover said on making plays during the scrimmage. “I haven’t done that in a while. To be back on the field and have touchdowns feels really good.”

The Jags had 11 straight days at least one practice on the field that started with the first day of fall drills on Aug. 6. The team took Sunday off before returning to practice on Monday Aug. 18,

the first day of fall classes. Saturday, Aug. 23 South

Alabama will hold the scrimmage

South Alabama football has first scrimage “away”South Alabama football has first scrimage “away”The Jaguars travel down Old Shell Road for first fall scrimmage at St. Paul’s Episcopal school

at Fairhope Municipal Stadium before taking part in Fan Day at the Mitchell center at 4 p.m. on Sunday, Aug. 24.

Quaterback Brandon Bridge ALYSSA NEWTON ALYSSA NEWTON

Page 22: August 18, 2014

22 AUG.18, 2014

101

South! Alabama South! Alabama We’re the Pride We’re the Pride

of the red white blue. of the red white blue. Loyal, strong and faithful Loyal, strong and faithful

to our alma mater true.to our alma mater true.(GO JAGS!)(GO JAGS!)

SoutH! Alabama SoutH! Alabama we will cheer youwe will cheer you to win the Day. to win the Day.

for it’s j-a-g-u-a-r-s for it’s j-a-g-u-a-r-s for u-s-a!for u-s-a!

USA FIGHT SONGUSA FIGHT SONG

112233

44

55

Top 5 things to being a JagFan

Know the fi ght song

Stock up on JagSwagAttend the games!

Let out your inner super-fan

Know your team

This one is a no brainer. Go to as many games as you can. THEY ARE FREE. How many college students can say that? Rain or shine, go out and support YOUR South Alabama Jaguars.

No matter who you are, we all have an inner “super-fan.” South has seen everything from afros and togas to Gumby and Frank the Rabbit. Have an idea? Try it out at the next game. Maybe you could be the next super-fan.

Get to know players! They’re not just athletes, they’re fellow students. Don’t be afraid to say ‘hey’ in class, or maybe if you’re a little shy just go to USAJaguars.com and read the rosters. Know your Jaguars!

Throw away the other collegiate gear, you’re now a South Alabama Jaguar. You can’t get more patriotic than red, white and blue so stock up, especially around Fourth of July. For the ladies, cheetah, lepard and all other spotted feline prints are now Jagprint. Cheer in style, the USA Bookstore always has the hottest JagGear for all South Alabama athletics.

You know, the song you learned at orientation. You’re going to be hearing it a lot, so you might at well learn it.

Page 23: August 18, 2014

23AUG.18, 2014

South! Alabama We’re the Pride

of the red white blue. Loyal, strong and faithful

to our alma mater true.(GO JAGS!)

SoutH! Alabama we will cheer you to win the Day.

for it’s j-a-g-u-a-r-s for u-s-a!

Page 24: August 18, 2014

JORDAN KNOX OPINION EDITOR

[email protected]

AUG.18, 2014OPINION

Whether he was a man trapped inside a board

game, a janitor or a magical genie, Robin Williams dominated the silver screen. Since the late 70s, he brought life to each and every role he was given.

He was a brilliant actor, comedian and even writer. To the world, he seemed unstoppable. However, what we didn’t always see was the darker, more desolate side of him.

The news of Robin Williams’ suicide broke around noon on Monday, Aug. 11, and it didn’t take long for the word to spread across the globe. His fans were left in shock and desperately sought answers.

However, no one could have been more heartbroken than his family and friends. His daughter, Zelda Williams, has had a particularly hard time since

the earth-shattering news of her father’s death. Instead of fans coming together to support the family of Robin Williams, some took to verbal abuse.

Zelda Williams has declared that she will be taking a very long break from social media platforms such as Twitter and Instagram because of the amount of hate mail she received from people via these sites.

People blamed her for her father’s suicide and even went as far as to photoshop pictures of her father’s body and send them to her. Not only is this kind of behavior unwarranted but how heartless could a person be?

It’s important for people to know that depression is a real medical condition and often times cannot be helped without professional attention.

Most everyone has been sad at one point in their lives but depression is totally different. Sadness is circumstantial and can be fixed rather easily. Clinical depression, like Robin Williams had, is a chemical imbalance in the brain that makes it almost physically impossible to function as a normal, happy person.

Robin Williams kept a lively facade, but underneath he housed a daunting depression that would eventually push him to his breaking point.

From my own experience, I know what a struggle depression

can be. I have gone through it and continue to struggle with it everyday.

Although I have been able to conquer my own battle with depression, some people don’t have the emotional support that they need to pull through. There are several ways that you can help yourself get through your own struggle.

I have learned that being open and honest with my family and close friends helps tremendously. There are some days where I just feel like totally giving up and it’s during those times that I cling tightest to my friends.

My roommate, Shannon, has often times been my rock and I can’t thank her enough for being there for me. Finding someone you can trust and talk to is a great first step. I know how easy it can be to bottle up my emotions and keep them all hidden but doing so only adds to the mess; don’t be afraid to ask for help.

When my depression first starting getting really bad, I tried convincing myself that I could handle it on my own. That’s a mistake that many people dealing with the same situation make. Don’t be afraid to seek out professional help. I was ashamed and embarrassed about admitting that I needed help, but I was surprised how much better I felt after my first appointment with a counselor. It’s not all, “and how

do you feel about that?” They actually want to help you and can aid in the steps toward recovery.

If you ever feel like the pain is too much to handle, you can call the National Suicide Prevention Lifeline at 1-800-273-8255. They offer trained professional counselors 24/7 so you can call anytime.

You can also call Counseling and Testing services on campus at (251) 460-7051. Counseling services are free to all students and they are open Monday

through Friday.My counselor gave me some

really simple, eye-opening advice, “love yourself.” Instead of zeroing in on every little personal flaw you can find, try thinking of things that you like about yourself. It may be hard at first but even two or three small things can make a world of difference.

Just remember that no matter how dark it seems now, there’s always a light at the end of the tunnel.

By JORDAN KNOXOpinion Editor

What we can learn from the suicide of Robin WilliamsWhat we can learn from the suicide of Robin Williams

Dear Whomever,Dear Whomever,I have a crush on this guy who was in my Bio lab over the summer. I really like his loafers, they actually have pennies in them (so classy…). Well, he didn’t know I existed until we were dissecting a frog and, when its liver popped out, I screamed. My scream instigated a fart (thanks Quiznos) and somehow it outdid the formaldehyde. I’ll never forget the look of disgust in his beautiful green eyes. Do you think I still have a chance? Surely fl atulence can be forgiven.

Sincerely, Gassy in Classy

Dear Gassy,

Ah, great question. I farted in a yoga class once (ok, maybe twice...) and left feeling a strange mix of giddiness and humiliation. A giddiness reminiscent of adolescence, and a humiliation that sticks...kind of like a formaldehyde poot. I later learned that any passing of gas in a yoga class can be played off as a “reverent yoga poot,” and is a rite of passage of sorts. So, in a way I feel, now, more like a channel. However, your situation is a bit more...how shall we say...vacuous. While a part of me wants to see you march up to ole “Bio Boy” and give a small dissertation about the gender biases of passing gas, I can understand your predicament, and recognize maybe it’s not so comfortable just yet...that and

he’s probably long gone. Embrace the new semester! I’m here to remind you: you’re just a normal girl who happened to have a natural and ego-crushing odiferous moment. My suggestion: email your former bio teacher, learn verbatim the molecular structure of human methane, and next time a crush of yours happens to poot in front of YOU, you can easily segue way into a great talking point because you know how it feels. You don’t have to share that last bit though.

In gas we trust,WhomeverNeed some advice? Talk to us! [email protected]

Source | WikiCommons

Page 25: August 18, 2014

25AUG.18, 2014

Why should I get involved? As stu-dents, we hear this question

from day one of our college careers. Think about this though: are there any reasons not to be involved?

As a freshman, I wasn’t involved in anything whatsoever. I didn’t participate in an extracurricular club, you didn’t see me on any intramural sports team and I didn’t even hold a job on campus!

Ironically, my first semester of college, when I didn’t participate in anything, was also the worst semester of my entire col-lege career GPA-wise. So again, why get involved?

It’s simple really. There are a million reasons, but I’m only going to focus on a few. Personally, I found that I actually earned better grades when I had less time on my hands. Less time!

When faced with too much time on my hands, I found myself squandering my time away by playing video games with my roommates.

Conversely, it was only when I joined a club and began working on campus dur-ing my sophomore year that I began to develop a strong sense of time manage-ment.

With less free time I began scheduling

myself more strictly and focused on my studies whenever I had the chance. I found having less time was better for me because it made every second of time I did have much more valuable. Wasting my valuable time on video games was no lon-ger an option.

If becoming a better manager of your own time isn’t enough to convince you to get out and get involved, then consider the following: by participating in some sort of extracurricular function, you open doors to networking opportunities, you give yourself a chance to meet new people and you may find yourself a real resume builder.

You never know when your experience as an active member of a club may be the only thing that differentiates you from someone else vying for the same job post-graduation.

Think of it this way, you and a former classmate of yours are interviewing for one accounting job. You both attended the same school, took the same classes, and graduated with similar GPAs.

What else could you do as a college student to diversify yourself ? Perhaps you join a business-related club, maybe you even hold a treasurer position with a club, or what if you find an internship with a business office on campus?

Those three possibilities are all great examples of experience but if you still need a little more convincing think about how much easier it will be to make friends once you’re in a club full of people who share a similar interest.

College is a lot different than high school and it can be a bit harder to find friends. Especially if all you do is go to class or sit in your dorm room.

Being an involved member of your campus grants you an invaluable, unique experience that can help you grow per-

The truth behind getting involved at SouthThe truth behind getting involved at South

By ALEXANDER MOYLANCopy Editor

MAMAMAMAMAAAAATTTTTTTTTTTHEHEEEW W WWWW STSTSSSS RIRICKCKLALAAAAAAAAANDNDNDNDNDNDNDNDDNNN

What are you most excited or worried about with the beginning of a new school year?

KATELYN GAINES Excited about being in the same classes with my friends. Nervous about my online art

history class, not sure what that is gonna be like.

WILLOW GODFREY Worried about waking up on time... And stairs.

MICAH MESSER I’m concerned that I won’t have actual professors who teach instead of read slides during class.

LINDSAY BYRNE Football and being one step closer to nursing school.

WHITNEY DAVIS I am worried about statistics this semester.

To post your answers to the next JagPulse, be sure to follow us

on Facebook.

Facebook.com/TheVanguardUSA

NICK GRONDIN Dynamic Meteorology and Physical meteorology, need I say more?

CODY MICHAEL STEVANUS I have no lab classes this semester. Which is nice. Have public speaking though.

Don’t look forward to that.KAREN MITCHELL English is gonna be boring

sonally and professionally. As someone who has participated in

clubs and other extracurricular activities throughout most of my entire college ca-reer, I can confidently say my only regret was not getting involved sooner.

It’s never too early, nor is it ever too late to get involved so don’t fret if you’re

entering your last year this fall! If you feel like you can manage your time wisely and commit yourself to your schoolwork and an extracurricular activity, then go for it! You never how many doors you can open for your future by first opening yourself up to the idea of being an involved stu-dent.

tttEvEvenentsts l likike eeee e JaJaJagFgFFFFg eseseeeee t t ofofofofofofffffoffffoffoffffffffofffffffffffffffofffffofffffffffoffofofffofofofofffo fefeffefffffffffeffffffeffefeffefefefefefefefeffefffffffefefeffffffefefeffffffffffefffffer rrrrrrrrrrrr rr r rrr r ststststststtststststststststststsss udddudududduddddduddududududuudenenenentststtss aaaaaa gggggggggrererrrrereeataatatat oooooopppppppppppppppororororororororoorrrorrtuttttuututututtuuuuuuuuninnnininiinininininininin tyttyttyty tttto o o gegegegegeget tt ttt EEininvovovlvleded i in nn nnnn clclclllllclubububububububububububububububububbbbbbbbbbubububu s ssssssssssssssssssssssss anaanand dddddddddddddddd orororrgagagagagag ninininininizazazazazazaatitiitititionononons ss s s onooonon ccccccamamamamamamammamammaa puppupupupupupupupuupupuppupupp s.sss.sss.sss.s.ii

Page 26: August 18, 2014

JORDAN KNOX OPINION EDITOR

[email protected], 2014

ANSWER KEY FOR AUGUST 11

Anderson CooperBarack ObamaBeyonceBill GatesBob MarleyBritney SpearsCharlie SheenChevy ChaseDrew BarrymoreElvis PresleyJennifer AnistonJohnny DeppJulia Roberts

Justin BieberKaty Perry Lady GagaLeonardo DicaprioMarilyn MansonMichael JacksonMiley CyrusNicolas CageOprahQueen LatifaSteve JobsTiger Woods

Unscramble theUnscramble thetelevision showstelevision shows

Celebrities who might be aliensCelebrities who might be aliensCNGANID WIHT ETH SRSAT

JGEUD YUJD

KROM NDA INMYD

ETADSPREE HWIVEUOESS

WLA DAN DEROR

OGD EHT UYNOBT HRNUET

GESYR YMTAOAN

TOLS

EHT TIIUGEFV

CERPI SI GHTRI

MIAYFL EFUD

OEGPNS BBO SUQEAR PNTAS

Page 27: August 18, 2014

27AUG.18, 2014

Page 28: August 18, 2014

28 AUG.18, 2014