bax/bak independentmitoptosisduringcelldeath ... · abolished (17).bax-deficient human colon...

BAX/BAK–Independent Mitoptosis during Cell DeathInduced by Proteasome Inhibition?

Elena Lomonosova,1 Jan Ryerse,2 and G. Chinnadurai1

1Institute for Molecular Virology and 2Department of Pathology, Saint Louis UniversitySchool of Medicine, St. Louis, Missouri

AbstractProteasome inhibitors induce rapid death of cancer cells.We show that in epithelial cancer cells, such death isassociated with dramatic and simultaneous up-regulation ofseveral BH3-only proteins, including BIK, BIM, MCL-1S,NOXA, and PUMA, as well as p53. Elevated levels of theseproteins seem to be the result of direct inhibition of theirproteasomal degradation, induction of transcription, andactive translation. Subsequent cell death is independent ofBAX, and probably BAK, and proceeds through the intrinsicmitochondrial apoptosis pathway. We identify the cascade ofmolecular events responsible for cell death induced by aprototypical proteasome inhibitor, MG132, starting with rapidaccumulation of BH3-only proteins in the mitochondria,proceeding through mitochondrial membranepermeabilization and subsequent loss of ΔΨm, and leadingto irreversible changes of mitochondrial ultrastructure,degradation of mitochondrial network, and detrimentalimpairment of crucial mitochondrial functions. Our resultsalso establish a rationale for the broader use ofproteasome inhibitors to kill apoptosis-resistant tumorcells that lack functional BAX/BAK proteins. (Mol CancerRes 2009;7(8):1268–84)

IntroductionProteasome inhibitors have emerged as promising chemo-

therapeutic agents and can induce a range of antitumor activi-ties, including induction of cell cycle arrest, restoration ofsensitivity to standard chemotherapy and irradiation, and prov-ocation of apoptosis (1). One of these agents, bortezomib (Vel-cade), is in clinical trials. It has been proposed that theantitumor activity of proteasome inhibitors mostly resultedfrom impeded degradation of regulatory proteins such as p21,IκBα, and p53 (1, 2). In addition, several studies have shownthat proteasome inhibition leads to apoptosis in various cancer

cells (3-6). However, the molecular basis of such apoptotic re-sponse is still the subject of intense investigation. In general, itis well established that the complex process of apoptotic celldeath is governed by opposing activities of BCL-2-family pro-teins (see refs. 7, 8 for recent reviews). One group of this familypromotes cell survival, which includes BCL-2, BCL-xL, BCL-w,A1, and MCL-1L, whereas the other endorses cell demolition.This proapoptotic group consists of two subgroups: those thatshare three BCL-2 homology domains (e.g., BAX and BAK)and a diverse group of BH3-only proteins, including but notlimited to BIK, BIM, BAD, BID, HRK, NOXA, PUMA, andBNIP3, which share only one BCL-2 homology domain. It iswidely accepted that BH3-only proteins are the apical sensorsof stress signals and the key initiators of apoptotic cell death.In agreement with this, proapoptotic BH3-only proteins wereshown to play a critical role as initiators of the apoptotic pro-gram of cell death by some proteasome inhibitors (9-11). Theinvolvement of particular BH3-only protein seems to vary withcell type and p53 status. BH1-3 proteins BAX and BAK areconsidered to be essential mediators of apoptotic cell death. Ac-cording to the current widely accepted model, the BH3-onlyproteins regulate core apoptotic machinery through activationof BAX and BAK, which undergo oligomerization in the outermitochondrial membrane and cause the release of apoptogenicfactors such as cytochrome c. Thus, mitochondria are prominentparticipants and most likely are obligate organelles in the apo-ptotic pathway (12). In addition to the release of apoptogenicfactors involved in activation of caspase-dependent andcaspase-independent cell death mechanisms, mitochondrialdamage per se and loss of vital mitochondrial functions play asignificant role in apoptotic cell death progression. Mitoptosiswas described as a phenomenon of mitochondrial death program(13) and represents a pathway by which mitochondria undergoextensive fragmentation and subsequent elimination duringapoptosis (14-16). However, the molecular mechanisms of theseprocesses remain unclear.

Various studies have suggested multiple mechanisms of can-cer cell death induced by proteasome inhibitors, and the processis far from being fully understood. It remains important to iden-tify additional downstream targets of proteasome inhibitors andto elucidate the significance of new signaling pathways in celldeath by the proteasome inhibitors. In this study, we used can-cer cells with different sensitivity to classic antitumor drugs—aset of isogenic HCT116 human colon carcinoma cell lines—which contain targeted disruption of the Bax gene (Bax−/−;ref. 17) or the p53 gene (p53−/−; ref. 18), as well as immortal-ized bax/bak double-knockout (BAX/BAK DKO) mouseembryonic fibroblasts (MEF), to investigate the molecularmechanisms involved in the antitumor action of proteasome

Received 4/14/08; revised 4/27/09; accepted 5/11/09; published OnlineFirst 8/11/09.Grant support: National Cancer Institute grants CA-33616 and CA-73803.The costs of publication of this article were defrayed in part by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.Note: Supplementary data for this article are available at Molecular CancerResearch Online (http://mcr.aacrjournals.org/).Current address for E. Lomonosova: Department of Molecular Microbiology andImmunology, Saint Louis University School of Medicine, St. Louis, Missouri.Requests for reprints: G. Chinnadurai, Doisy Research Center, Room 623, 1100South Grand Boulevard, St. Louis, MO 63104. Phone: 314-977-8794; Fax:314-977-8798. E-mail: [email protected] © 2009 American Association for Cancer Research.doi:10.1158/1541-7786.MCR-08-0183

Mol Cancer Res 2009;7(8). August 20091268

Research. on September 21, 2020. © 2009 American Association for Cancermcr.aacrjournals.org Downloaded from

Published OnlineFirst August 20, 2009; DOI: 10.1158/1541-7786.MCR-08-0183

http://mcr.aacrjournals.org/

inhibitors. Here, we provide evidence that proteasomal inhibi-tion in epithelial cancer cells activates an apoptotic pathwaythat occurs in a BAX/BAK–independent manner involvingmultiple BH3-only proteins (BIK, BIM, MCL-1S, NOXA,and PUMA) and p53 and the mitochondria, suggesting a novelrole for these proteins in execution of an apoptotic death para-digm. We show that together several BH3-only proteins andp53 can overcome BAX/BAK dependency to mediate celldeath induced by proteasome inhibitors. Thus, our findings re-veal an additional level of redundancy between proapoptoticproteins in regulation of life and death of the cell. Such regu-lation seems to be more complex than it is currently believed toensure the effective elimination of damaged or excess cells.

Resultsp53- and BAX-Independent Cell Death Induced byMG132

We chose to investigate the role of various mammalian ap-optosis effectors on cell death induced by a most widely used

proteasome inhibitor, MG132. Despite the availability of differ-ent proteasome inhibitors, MG132 still remains the agent ofchoice to study proteasome involvement in different cellularprocesses (19). As expected, treatment with MG132 caused sig-nificant cell death in wild-type (wt) HCT116 colon cancer cellswith characteristic features of rounded detached cells visible asearly as 24 hours after the addition of MG132 (Fig. 1A). Celldeath was markedly increased during the time (to ∼60% after48 hours) compared with cells treated with vehicle (DMSO;Fig. 1B). The cell death was attributable to apoptosis becausethe proteolytic cleavage of two key enzymes involved in apo-ptosis, caspase-3 and poly(ADP-ribose) polymerase (PARP),was clearly detectable at 24 hours after MG132 treatment(Fig. 1C). Similarly, DNA fragmentation was also observedin MG132-treated cells but not in vehicle-treated cells(Fig. 1D). Analysis of p53-deficient (p53−/−) cells treated withMG132 revealed no marked differences in sensitivity to theproteasome inhibition compared with p53-proficient (p53+/+)cells (Fig. 1A and B), although PARP cleavage was somewhatdelayed and the extent of DNA fragmentation was reduced

FIGURE 1. BAX- and p53-independent cell death by MG132. A. Representative light microscopic images (×120) of HCT116 wt, Bax−/−, or p53−/− cells24 h after treatment with DMSO or MG132. B. The cell viability was determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT)method. Columns, mean from three independent experiments; bars, SD. C. Effect on caspase-3 activation and PARP cleavage. The Western blots wereprobed with antibodies specific for procaspase-3 or PARP. D. Effect on fragmentation of chromosomal DNA. The low molecular weight DNA isolated fromtreated cells was analyzed by agarose gel electrophoresis.

1269Multiple BH3-Only Proteins in Mitochondrial Dysfunction





compared with wt HCT116 cells (Fig. 1C and D). Thus, celldeath by proteasome inhibition in HCT116 colon cancer cellsseems to be independent of p53, in contrast to previous resultswith mammary cancer cells (20). Surprisingly, deletion of theBax gene (Bax−/−) also had no effect on MG132 toxicity(Fig. 1A). Both wt and Bax−/− cell lines underwent rapid celldeath, about 60% in 48 hours (Fig. 1B). Consistent with theseresults, caspase-3 was also activated in Bax-deficient cells aftertreatment with MG132 (Fig. 1C). Interestingly, similar to p53-negative cells, PARP cleavage was delayed and DNA was lessfragmentized in Bax−/− cells treated with MG132 comparedwith wt cells (Fig. 1C and D). Previous studies with p53−/−

or Bax−/− HCT116 cells clearly showed that p53 and BAXhad profound influence on cell responses to therapeutic agents,but the response varied considerably depending on the drug.Thus, the p53-deficient cells were sensitive to the effects ofDNA-damaging agents, had the same apoptotic response to su-lindac as wt cells, but became resistant to the toxicity of theantimetabolite 5-fluorouracil (17, 21). In contrast, Bax-deficientcells were only partially resistant to the apoptotic effects of5-fluorouracil, but their apoptotic response to sulindac andother nonsteroidal anti-inflammatory drugs was completelyabolished (17). Bax-deficient human colon carcinoma cellswere also resistant to apoptosis induced by multiple stimulisuch as death-receptor ligands, UV, staurosporine, andthapsigargin (22, 23). Our present results indicate thatMG132 has a unique ability to induce colon cancer cell deathindependently of either p53 or BAX, suggesting thatproteasome inhibitors may have a broad therapeutic potentialfor treating cancers with different genetic abnormalities in thecomponents of the core apoptotic machinery.

Expression of BH3-Only Proteins, MCL-1 and p53To characterize the components mediating MG132-induced

apoptosis, we first determined expression profiles of the BCL-2-family BH3-only members in HCT116 wt, p53−/−, or Bax−/−

cells (Fig. 2A). Cells were cultured for 24 hours in the presenceof 1 μmol/L MG132 or DMSO, and total lysates were subjectedto Western blot analysis. This analysis showed marked enhance-ment in the levels of several BH3-only proteins including BIK,BIM, and NOXA. The levels of the other proteins, BID, HRK,and BAD (not shown), showed no significant changes, whereasthe level of PUMA was marginally increased (Fig. 2A, left).Among the BH3-only proteins, the most pronounced effectwas noted in the accumulation of NOXA (Fig. 2A, left). Addi-tionally, we also observed enhanced accumulation of BIK andall major isoforms of BIM (BIM-S, BIM-L, and BIM-EL; Fig.2A, left). We next examined the levels of expression of BH1-3proapoptotic members. There were no significant alterations inthe expression of BAX and BAK on exposure to MG132(Fig. 2A, bottom right), suggesting that the effect of MG132might be primarily specific for BH3-only proteins.

We also investigated the effect of MG132 on the expressionof antiapoptotic members: A1, BCL-2, BCL-xL, BCL-w, andMCL-1. Expression of A1 showed a small increase afterMG132 treatment whereas the levels of BCL-2, BCL-xL, andBCL-w did not change significantly. We noticed the appearanceof an additional, more slowly migrating band in BCL-xLWest-ern blot analysis, probably indicating a modified form of

BCL-xL. Among the prosurvival BCL-2-family proteins, themost striking effect was observed with MCL-1. In addition tothe antiapoptotic isoform (MCL-1L), a short proapoptotic iso-form (MCL-1S) has also been previously identified (24, 25).We observed strong accumulation of both isoforms (Fig. 2A).In addition to the effect on BH3-only proteins and MCL-1,MG132 also induced accumulation of p53 in wt HCT116 cells(Fig. 2A).

To further characterize the effect of MG132 on proapopto-tic proteins induction, we evaluated the kinetics of accumula-tion of these proteins (Fig. 2B). HCT116 wt cells were treatedwith 1 μmol/L MG132, and lysates were collected at varioustime points for immunoblot analysis. Dramatic elevation inthe levels of NOXA and MCL-1S was evident at 3 hours afterexposure to MG132. Levels of BIM and p53 were also sig-nificantly increased at 3 hours after MG132 treatment, andaccumulation of BIK was noticeable at 6 hours. The levelsof all tested proteins continued to increase for several hours,reaching the maximum at 24 hours. In addition, the Westernblot analysis showed that activation of caspase-3 was first de-tectable at 24 hours after MG132 treatment (Fig. 2C), signif-icantly later than induction of proapoptotic proteins, and thisactivation of caspase-3 was accompanied by increased proces-sing of PARP. Thus, it is conceivable that rapid and sustainedaccumulation of BH3-only proteins and p53 was the apoptosisinitiation event, but not the result of cell death caused byMG132.

Together, our results showed that treatment of colon cancercells with MG132 resulted in simultaneous increase in expres-sion of several proapoptotic proteins, suggesting their syner-gistic involvement in the potent death-inducing activity ofMG132 even in cells deficient in p53 (p53−/−) or BAX(Bax−/−).

We also investigated whether treatment with other majorclasses of proteasome inhibitors (19) would result in enhancedlevels of multiple BH3-only proteins (Supplementary Fig.S1A). Among the tested proteasome inhibitors, PSI, epoxomi-cin, ALLN, and MG262 induced strong up-regulation of BIK,BIM, NOXA, MCL-1L, MCL-1S, p53, and, to a lesser degree,PUMA (Supplementary Fig. S1A) in a fashion that resembledthe pattern induced by MG132. In contrast, AdaAhX3L3VS andα-MOL did not have detectable effect on the accumulation ofBH3-only proteins. Interestingly, AdaAhX3L3VS and α-MOLalso failed to activate caspase-3 and had no cytotoxic effect inHCT116 cells (Supplementary Fig. S1C). These results suggesta direct correlation between the ability of the proteasome inhi-bitors to elevate expression of BH3-only proapoptotic proteinsand their cell death activity. Elevated levels of multiple BH3-only proteins, MCL-1 (MCL-1L and MCL-1S) and p53, ac-companied by significant cell death, were observed in othertumor cell lines such as Saos2, LoVo, H1299, and C-33A(Supplementary Figs. S2 and S3), suggesting that proteasomeinhibitors might be effective anticancer drugs for differentneoplasms of epithelial origin.

Mode of Accumulation of BH3-Only ProteinsFirst, we determined whether up-regulation of BH3-only

proteins and p53 reflected inhibition of proteasome-mediatedprotein degradation. We tested whether ubiquitinated forms of

1270 Lomonosova et al.





endogenous BH3-only proteins accumulated in response toMG132. We used a specific ubiquitin-binding affinity matrix(UbiQapture-Q, Biomol) to capture ubiquitinated proteins,followed by Western blot analysis (Supplementary Fig. S4A).There were marked increases in the levels of ubiquitinatedNOXA, MCL-1, p53, BIM, BIK, and, to a lesser extent, PU-MA. Thus, up-regulation of BH3-only proteins in HCT116cells by MG132 is at least partially mediated by inhibition oftheir proteasomal degradation and accumulation of ubiquiti-nated forms of these proteins.

We then determined whether up-regulation of the BH3-onlymembers might also be regulated at the level of transcription.We examined the mRNA levels of various BH3-only membersby reverse transcription-PCR (RT-PCR) analysis at 20 hours af-ter treatment with MG132 (Supplementary Fig. S4B). Therewas significant induction of Noxa, Mcl-1L, Mcl-1S, Bim, Puma,

and p53 mRNAs, whereas Bik mRNA level remained un-changed. Thus, transcriptional activation of several BH3-onlyproteins and p53 may also contribute to the overall accumula-tion of the apoptotic effectors in response to treatment withMG132. Because p53 is known to transcriptionally activateBH3-only members PUMA, NOXA (26), and human BIK(27), we determined whether the transcriptional activity ofp53 is activated by MG132. HCT116 cells were transientlytransfected with a luciferase reporter plasmid containing ap53-responsive element for 24 hours and then treated withMG132 or DMSO. As shown in Supplementary Fig. S4C, therewas an activation of luciferase expression at 6 hours followingMG132 treatment in p53+/+ cells but not in p53−/− cells, sug-gesting stabilization of a transcriptionally active form of p53.However, analysis of the mRNA levels of the BH3-only mem-bers by RT-PCR analysis of transcripts revealed no major

F IGURE 2 . E f f e c t o fMG 132 on expressi on ofBCL-2-family proteins andp53. A. Western blot analysisof HCT116 wt, Bax− /− , orp53−/− cells 24 h after MG132treatment. B. Time-courseanalysis of protein levels dur-ing MG132 treatment. C.T i m e - c o u r s e a n a l y s i s o fcaspase-3 act ivat ion andP A R P c l e a v a g e d u r i n gMG132 treatment.






differences between p53+/+ and p53−/− cells (data not shown).The transcription factor E2F1 is also a candidate to mediateup-regulation of BH3-only members such as PUMA, NOXA,BIM, and HRK that have previously been reported to beactivated by E2F1 (28). To determine whether MG132 inducedE2F1 expression, we examined the level of E2F1 by Westernblot analysis. As seen in Supplementary Fig. S4D, E2F1 ex-pression was up-regulated by treatment with MG132. In addi-tion, we carried out a luciferase reporter assay to determine theeffect of MG132 on E2F1 transcriptional activity (Supplemen-tary Fig. S4E). The E2F1 promoter activity was increased incells treated with MG132. These results suggest that E2F1may function as an additional transcriptional mediator ofMG132-induced cell death. Interestingly, E2F1 transcriptionalactivity as well as protein levels were induced to a greater ex-tent in p53−/− cells than in p53+/+ cells (SupplementaryFig. S4D and E), suggesting that some level of redundancy

may exist between the transcription factors involved in theprocess of cell death.

Role of Translation in Up-Regulation of BH3-Only ProteinsWe next asked whether active protein synthesis is required

for the accumulation of proapoptotic proteins during MG132treatment. First, we determined the level of protein expressionby treating HCT116 Bax−/− cells with translational inhibitor cy-cloheximide alone or in combination with MG132 (Fig. 3A).Addition of cycloheximide alone resulted in the disappearance(as measured by Western blot analysis) of MCL-1, NOXA, andp53 and a significant reduction of the level of expression ofBIK as early as 6 hours after treatment. The level of BIM-ELdid not change during this time point. At 24 hours after cyclo-heximide treatment, the levels of expression of BIK and BIMwere also decreased substantially. Combination of MG132 andcycloheximide led to some accumulation of BIK, BIM, and

FIGURE 3. Effect of pro-tein synthesis inhibition andsiRNA-mediated knockdownof BH3-only proteins and p53.A. Western blot analysis ofprotein levels. HCT116 Bax−/−

cells were treated with cyclo-heximide (CHX), DMSO, andMG132 alone or in combina-tion as indicated and proteinswere analyzed 6 and 24 h aftertreatment. B. Effect on apo-ptosis. The treated cells werestained with Annexin V and7-amino-actinomycin D (7-AAD) and analyzed by flow cy-tometry. The percentages ofAnnexin V–positive (apoptotic)cells within the two right quad-rants are indicated. C. West-ern blot analysis of proteindepletion. HCT116 wt cellswere transfected with siRNAsagainst BIK, BIM, NOXA, PU-MA, and p53 or with negativecontrol siRNA or mock trans-fected. Twenty-four hours lat-er, the cells were treated withDMSO or MG132. The proteinlevels (top) and caspase-3 ac-tivation and cell viability (bot-tom) were determined 24 hafter treatment.






MCL-1 compared with the mock treatment, but proteins levelswere still significantly lower when compared with MG132 treat-ment alone. The level of expression of NOXA and p53 (Fig. 3A)remained undetectable during combined treatment of MG132and cycloheximide, suggesting that these two proteins have theshortest half-life among the proteins analyzed and their levels ofexpression seem to rely on active translation. In contrast to theeffect on BH3-only proteins, the level of BH1-3 proapoptoticprotein BAK remained unchanged after cycloheximidetreatment alone or in combination with MG132 (Fig. 3A). Next,we examined the effect of cycloheximide on MG132-inducedapoptosis and showed that cycloheximide considerably inhibitedMG132-dependent phosphatidyl-serine externalization byanalysis of Annexin V–positive cells by flow cytometry at48 hours after treatment (Fig. 3B). Thus, the reduction in thelevels of BH3-only proteins seems to correlate with the suppres-sion of MG132-dependent cell death despite the presence ofadditional proapoptotic BH1-3 proteins.

Effect of Depletion of BH3-Only ProteinsTo show the role of BH3-only proteins in MG132-induced

cell death more directly, we performed loss-of-function anal-ysis by knockdown of various BH3-only members and p53using specific siRNAs. We assessed the levels of the knock-down by Western blot analysis. We found that simultaneoustransfection of siRNAs for BIK, BIM, NOXA, PUMA, andp53 caused partial reduction of proteins expression (Fig. 3C,top) in DMSO-treated as well as MG132-treated cells. Thispartial depletion led to reduction of caspase-3 activation andpartial increase in cell viability during exposure to MG132(Fig. 3C, bottom). Interestingly, omitting p53 siRNA fromthe mixture of transfected siRNAs abolished the protectiveeffect of siRNAs (not shown). Taken together, our data sug-gest a strong role for BH3-only proteins and p53 in MG132-induced cell death.

Thus, we conclude that enhanced expression of BH3-onlyproteins and p53 by the proteasome inhibitor MG132 is medi-ated by two distinct mechanisms: posttranslational protein sta-bilization and transcriptional activation. In addition, activeprotein synthesis is also essential for maintaining high levelsof these proteins during proteasome inhibition.

BAX/BAK–Independent Cell Death Induced by MG132Because the mammalian apoptotic death machinery is criti-

cally dependent on the functionally redundant BH1-3 proteinsBAX and/or BAK, we undertook a study to determine the re-quirement of BAX and BAK in MG132-induced cell death. Forthese studies, we first exploited a HCT116 Bax−/− (BAXKO)cell line (17). We generated derivatives of the BAXKO cell linethat are deficient for BAK by stable transfection of vectors thatexpress shRNA against BAK. We choose two cell lines, #5 and#11, with different levels of BAK depletion and a control (C1)cell line from cells transfected with control shRNA for analysis(Fig. 4A). We first performed a short-term cell viability assay tocompare MG132 toxicity in different HCT116 cell lines. Strik-ingly, we found that MG132 induced similar levels of toxicityin various cell lines (Fig. 4B), suggesting that cell death wasindependent of both BAX and BAK. In addition, analysis ofAnnexin V–positive cells (Fig. 4C) showed significant apopto-

sis in BAXKO/BAK #5 cell line in response to MG132. Wealso examined microscopic images of HCT116 cells treatedwith MG132 for nuclear morphology characteristic of apopto-sis. We observed numerous apoptotic cells showing chromatincondensation and margination with sharply circumscribed,dense crescents, again independently of the presence of BAXand BAK (Fig. 4D, image 1: wt cells, image 2: #5 cell line).Additional electron microscopic analysis revealed that expo-sure of both cell lines to MG132 resulted, regardless of thepresence of BAX and BAK, in extensive cytoplasmic vacuoli-zation clearly visible as early as 6 hours after treatment (Sup-plementary Fig. S5A). These distended vacuoles weredelimited by electron-dense ribosomes (SupplementaryFig. S5B), a morphology consistent with the presence of mark-edly dilated rough ER. Electron micrographs after treatment ofHCT116 cells with MG132 for 24 hours indicate an increase ofvolume of vacuoles. To determine whether this would result inincrease of cellular volumes, we performed particle analysis forcellular sizes in light microscope images at 24 hours. Values formajor and minor axes were acquired for individual cells tocalculate an average diameter of cells treated with DMSO orMG132. MG132-treated cells (both HCT116 wt and BAX-KO/BAK ) showed marginal (statistically not significant) in-crease in size compared with control DMSO-treated cells(Supplementary Fig. S5C), arguing that as a population, theyare not swollen, but with big deviation for different cells. Thus,the observed morphologic changes were not typical necroticalterations characterized by nuclear and cytoplasmic swelling.A different proteasome inhibitor, epoxomicin, also efficientlykilled the colon cancer cells, independently of their BAX andBAK status, as determined by clonogenic survival assay(Fig. 4E). A short-term dose-response viability study indicatedthat BAX-positive HCT116 cells were more sensitive to the re-versible inhibitor MG132 compared with BAX- and BAX/BAK–negative cells at a low concentration of the inhibitor(0.5 μmol/L; Supplementary Fig. S6A). MG132 and epoxomi-cin (an irreversible inhibitor) at concentrations of 1 μmol/L andhigher induced similar levels of cell death in different HCT116cell lines (Supplementary Fig. S6A).

We next extended these studies to wt MEFs and BAX/BAKDKO MEFs (Fig. 4F). Microscopic examination (Fig. 4G) andcell viability assay (Fig. 4H) revealed that, similar to humancancer cells, wt and BAX/BAK DKO MEFs were effectivelykilled by MG132, whereas only wt MEFs, but not BAX/BAK DKO MEFs, were sensitive to etoposide, a well-knownanticancer drug whose activity was shown to be dependent onBAX and BAK proteins in MEFs (29). To further characterizecell death in MEFs by MG132, we assessed the activities ofcaspase-3/caspase-7 (Fig. 4I). We found that MG132 causedsignificant increase in caspase-3/caspase-7 activity, comparableto both wt and BAX/BAK DKO MEFs. In contrast, etoposideactivated caspase-3/caspase-7 only in wt MEFs. Additionally,MG132, but not etoposide, induced the appearance of AnnexinV–positive BAX/BAK DKO MEFs (Fig. 4J).

BCL-2 is up-regulated in various cancers and seems to be amajor factor that contributes to chemoresistance in human can-cers (30). We asked whether overexpression of BCL-2 inHCT116 cells affects the cytotoxicity of MG132. We estab-lished HCT116 cell lines that stably overexpressed BCL-2






(Supplementary Fig. S6B) and compared their susceptibility toMG132 with that of the parental cells. Figures S6C and D re-veal that constitutive overexpression of BCL-2 (in HCT116BAXKO) did not increase the viability of MG132-treated cells.Similar results were also obtained with HCT116 wt cells (datanot shown).

We next asked whether carbobenzoxy-Val-Ala-Asp-fluoro-methylketone (zVAD-fmk) would also protect HCT116 cellsand MEFs against MG132-induced cell death. Cell viability as-say revealed that zVAD-fmk had no significant effect onMG132 toxicity (Supplementary Figs. S6E and S7A). At thesame time, zVAD-fmk completely inhibited caspase-3 activa-tion by MG132 as seen in DKO MEFs (SupplementaryFig. S7B) and prevented cleavage and activation of PARP inHCT cells (not shown), but had no effect on the appearance ofbiochemical markers of apoptosis induced by MG132 in DKOMEFs: mitochondrial outer membrane permeabilization, phos-phatidyl-serine externalization, and loss of membrane potential(Supplementary Fig. S7C-E). Taken together, these observationssuggested that the mere inhibition of caspase activities byzVAD-fmk is not enough to prevent MG132-induced cell deathand that caspase-independent pathways are also involved in theapoptotic process. Thus, we speculate that proteasome inhibi-tors activate other proteases (e.g., cathepsins and granzyme B)in addition to caspases to promote the cleavage of crucialsubstrates and ultimate cell death, as many noncaspaseproteases can cleave at least some of the classic caspase sub-strates and might mimic the cellular effects of caspases (31).

Mitochondrial Membrane Permeabilization by BH3-OnlyProteins and p53

A key question was how apoptosis occurred in cells lackingtwo major death effectors—BAX and BAK. As mitochondriaplay a pivotal role in the regulation of apoptosis, we hypothe-sized that cell death would be initiated from activation ofa cell-intrinsic pathway involving mitochondria resulting in mi-tochondrial membrane permeabilization (MMP). One of thewell-characterized manifestations of MMP is the release of in-termembrane proteins such as cytochrome c and apoptosis-inducing factor (AIF) into the cytosol. Therefore, we askedwhether treatment of HCT116 cells with MG132 would inducethis phenomenon. We isolated cytosolic and mitochondrial frac-tions from cells treated with MG132 or DMSO and performedWestern blot analysis to determine the distributions of mitochon-drial proteins. As early as 6 hours after treatment, we found sig-nificant amounts of cytochrome c and AIF proteins in the cytosolof MG132-treated cells but not in the cytosol of DMSO-treatedcells (Fig. 5A, data are shown for HCT116 Bax−/− cells). Similar

results were obtained in different HCT116 cell lines, regardlessof the presence of BAX and BAK, as well as in BAX/BAKDKOMEFs (Supplementary Fig. S7D).

What are the mitochondria-specific cell-death mediators inMG132-treated cells? Because we observed dramatic overex-pression of several BH3-only proteins, we decided to examinewhether the various BH3-only proteins activated by MG132treatment were localized in the mitochondria. Western blotanalysis of the mitochondrial fraction from Bax−/− HCT116cells revealed that BH3-only proteins BIK, BIM, NOXA,PUMA, and MCL-1S, as well as MCL-1L and p53, were accu-mulated in the mitochondrial fraction, and dramatic differencesin mitochondria from DMSO and MG132-treated cells wereeasily detectable as early as 6 hours after treatment (Fig. 5B).In contrast, there was no significant difference in the level ofmitochondrial localization of BAK (Fig. 5B, bottom).

Multiple signaling pathways converge to cause MMP (32).We explored the interaction between BCL-2-family apoptosisregulators and mitochondrial proteins involved in vital cellularfunctions (e.g., VDAC, hexokinase, or glucokinase). VDACproteins are attractive candidates for interactions with BH3-only proteins because they are constitutively anchored at theouter mitochondrial membrane and are essential componentsof the permeability transition pore complex. Moreover, it seemsthat Ca2+-induced permeability transition can occur efficientlyin mitochondria from BAX/BAK deficient cells (33). To testwhether complexes between VDAC and BH3-only proteins ex-ist in our model system, we carried out coimmunoprecipitationanalysis of mitochondrial fractions from DMSO- or MG132-treated cells. Specific endogenous complexes of VDAC/NOXAand VDAC/BIM-L were detected when extracts from MG132-treated, but not DMSO-treated, cells were precipitated withanti-VDAC and blotted with anti-NOXA or anti-BIMantibodies (Fig. 5C). In contrast, no complexes between VDACand BIK, PUMA, MCL-1, or p53 were detected (data notshown). It is worth noting that the observed interaction betweenVDAC and BIM agrees with a previous report (34), whereasthe VDAC/NOXA interaction is novel.

We then examined the effect of MG132 on the mitochondri-al inner transmembrane potential (ΔΨm) in different HCT116cells and MEFs. There were no significant differences inΔΨm at 6 hours after treatment (data not shown), but at 16hours, we observed significant decreases in ΔΨm (Fig. 5D). Im-portantly, MG132-induced changes in ΔΨm were very similarin all tested HCT116 cell lines (Fig. 5D and data not shown) aswell as in wt and Bax/Bak DKO MEFs (Supplementary Fig.S7E) regardless of the presence of BAX and BAK, supportingBAX/BAK–independent mode of apoptosis by MG132. Loss

FIGURE 4. BAX/BAK–independent cell death by MG132. A. Western blot analysis of BAX and BAK levels in different HCT116 cell lines. B. The cellviability was determined by MTT assay. Points, mean percent relative to vehicle-treated cell lines; bars, SD. C. Analysis of apoptosis. HCT116 Bax−/−Bak #5cells were stained by Annexin V and analyzed by flow cytometry. Columns, mean percentage of Annexin V–positive (apoptotic) cells from three independentexperiments; bars, SD. D. Photomicrographs of treated cells. Representative light microscopic images (×750) of HCT116 wt (image 1) and Bax−/−Bak #5(image 2) cells 24 h after treatment with MG132. Characteristic apoptotic nuclear morphology is seen in both types of cells. E. Colony survival assay. Thecells were treated with epoxomicin (Epoxo) or DMSO. Twelve days after the treatment, colonies were stained with crystal violet and photographed. F. West-ern blot analysis of BAX and BAK proteins in whole-cell extracts of wt and BAX/BAK DKO MEFs. G. Representative light microscopic images (×120) of BAX/BAK DKO MEFs 24 h after treatment with DMSO or MG132. H. Viability of wt and BAX/BAK DKO MEFs. The viability was determined 48 h after exposure toMG132 or etoposide by the MTT assay. Columns, mean percent relative to vehicle-treated cells (n = 3); bars, SD. I. Caspase-3/caspase-7 activity in wt andBAX/BAK DKO MEFs 24 h after treatment with DMSO, MG132, and etoposide as measured with Caspase-Glo 3/7 kit (Promega). J. Analysis of apoptosis inBAX/BAK DKO MEFs. Cells were treated with DMSO, MG132, and etoposide. Annexin V–positive cells were analyzed by flow cytometry. Columns, meanfrom three independent experiments; bars, SD.






in ΔΨm occurs before significant changes in cell viability in-duced by MG132 but after mitochondrial accumulation ofBH3-only proteins and p53 and release of cytochrome c andother apoptogenic factors from mitochondria (Fig. 5; Supple-mentary Fig. S7). In addition, we examined if the mitochondrialpermeability transition pore inhibitor cyclosporin Awas able toinhibit loss in ΔΨm during MG132-induced apoptosis in BAX/BAK DKO MEFs. We found that cyclosporin Awas ineffectiveagainst MG132-dependent loss in ΔΨm (Supplementary Fig.S7E) and failed to inhibit release of cytochrome c and AIF frommitochondria of MG132-treated BAX/BAK DKO MEFs (Sup-plementary Fig. S7D) and cell death by MG132 (Supplementa-ry Fig. S7A).

Generation of reactive oxygen species (ROS) by mitochon-dria is also believed to contribute to mitochondria-dependentapoptosis. Therefore, we examined whether MG132 treatmentwould result in up-regulation of ROS levels. We measured theROS level using the fluorescent probe 2′,7′-dichlorodihydro-fluorescein diacetate in HCT116 cells with different BAXand BAK backgrounds that were treated with MG132 orDMSO. Elevation of ROS was detected only at 24 hours(Fig. 5E). HCT1116 wt cells and BAXKO/BAK cells showedsimilar patterns of ROS generation on treatment with MG132(Fig. 5E and data not shown). Thus, our results are consis-tent with the interpretation that in HCT116 cells exposed toMG132, ROS generation might be a consequence of apoptoticcascade (cytochrome c release and loss of ΔΨm).

Taken together, our observations provide evidence for a se-quence of events leading to a mitochondrial apoptotic pathwayfollowing proteasome inhibition by MG132. We suggest thatMG132 induces BAX/BAK–independent apoptosis through ac-tivation of multiple BH3-only proteins and p53 and their accu-mulation at mitochondria leading to the release of apoptogenicfactors into the cytosol, followed by loss of ΔΨm and, conse-quently, increased generation of ROS.

MG132-Induced Mitochondrial DegradationTo determine whether the structural changes to mitochondria

accompanied the observed loss of MMP, we collected transmis-sion electron microscopic images of HCT116 wt and BAXKO/BAK cells treated with MG132 or DMSO. We used two timepoints after addition of MG132 or DMSO: 6 hours (stage I, char-acterized by dramatic accumulation of proapoptotic proteins inmitochondria, release of cytochrome c, but no changes in ΔΨm)and 24 hours (stage II, after the release of cytochrome c and lossof ΔΨm). Mitochondria from DMSO-treated HCT116 wt andBAXKO/BAK cells were of normal morphology at all timepoints of observation (Fig. 6A, images a and f). However, afterthe addition of MG132, mitochondria were seen to undergo dra-matic changes. At 6 hours of MG132 treatment, most mitochon-dria had normal morphology but some of them appeared in atransition form, similar to the “normal-vesicular” transition de-scribed by Sun et al. (ref. 35; Fig. 6A, images b and g). At 24hours, the majority of the mitochondria in MG132-treated cellsexhibited either very distinctively altered “vesicular” ultrastruc-ture (ref. 35; Fig. 6A, images c and h) or swollen ultrastructure(Fig. 6A, images e and j). In addition, an intermediate form, “ve-sicular-swollen,” was also observed in which one part of a mito-chondrion appeared to be swollen, whereas another part

appeared vesicular (Fig. 6A, images d and i). The above-mentioned mitochondrial changes resembled the recentlydescribed structural transformations of mitochondria duringetoposide-induced apoptosis (35). However, we have observedsuch transformations during MG132-induced apoptosis inde-pendently of the presence of BAK and BAX.

Mitochondrial damage was further determined by flow cyto-metric analysis of total mitochondrial mass. We found that at 24hours of MG132 treatment, a significant subpopulation ofHCT116 cells displayed a reduced mitochondrial mass whereascontrol DMSO-treated cells showed no such alterations(Fig. 6B). MG132-induced loss of total mitochondrial massprogressed over time and, more importantly, the process wasBAX/BAK independent (Fig. 6B). In addition, the mitochon-drial content after exposure to MG132 in HCT116 cells wasassessed in whole-cell extracts by probing for cytochrome c ox-idase subunit IV (CoxIV), an inner mitochondrial membraneprotein in comparison with actin (Fig. 6C). After MG132 treat-ment, CoxIV levels were greatly dimished whereas actin levelswere unaffected. Mitochondrial disappearance was not detect-able in DMSO-treated cells (Fig. 6C).

We also determined the general metabolic activity of mito-chondria by determining the levels of ATP in MG132-treatedcells at different time points. Intracellular ATP levels of controlcells and MG132-treated cells remained comparable at 6, 16,and 24 hours (not shown) but dropped dramatically at 48 hours,indicating almost complete metabolic catastrophe in cells trea-ted with MG132 (Fig. 6D). Sudden loss of ATP level (70-90%)was observed in all tested cell lines, although some differenceswere noticeable between wt and BAXKO/BAK cells, that is,the remaining level of ATP was higher in BAXKO/BAK cellsthan in wt MG132-treated cells, and the remaining ATP levelsin BAXKO or C1 cells were intermediate.

Importantly, analysis of mitochondrial damage by MG132 inBAX/BAK DKO MEFs revealed a similar pattern (Fig. 7).Thus, mitochondria from BAX/BAK DKO MEFs exposed toMG132 underwent similar ultrastructural alterations (Fig. 7A).MG132, but not etoposide, caused loss of total mitochondrialmass in BAX/BAK DKO MEFs (Fig. 7B). In accordance withthe previous results, significant decrease in ATP levels wasobserved in wt and BAX/BAK DKO MEFs treated withMG132 (Fig. 7C). It is also important to note that zVAD-fmk and cyclosporin A failed to prevent alterations in mito-chondrial ultrastructure and mitochondrial degradation inducedby MG132 (Fig. 7).

Thus, taken together, our results indicate that MG132-induced cell death proceeds through a mitochondrial deathprogram and loss of essential mitochondrial functions. Theultrastructural transformation and the ultimate functionaldemise of mitochondria observed here seem to be consistentwith the features associated with mitochondrial apoptosis—fragmentation and disruption of the mitochondrial network,leading to mitochondrial “death” or mitoptosis (13, 16).

Cell Death by Simultaneous Expression of Several BH3-Only Proteins and p53 in the Absence of BAX andReduced BAK Expression

BH3-only proteins, when acting individually, require proa-poptotic BH1-3 proteins to release cytochrome c and induce






FIGURE 5. Mitochondrial association of BH3-only proteins and p53 and effect on MMP. A. Western blot analysis of cytochrome c (Cyt c) and AIF. Thecytosolic and mitochondrial fractions of DMSO- or MG132-treated HCT116 Bax−/− cells 6 h after exposure were probed with the indicated antibodies. B.Western blot analysis of BH3-only proteins and p53. The above fractions were probed with the indicated antibodies. C. Interaction between VDAC and BH3-only proteins. Indicated HCT116 cell lines were treated as in A, and mitochondrial lysates were immunoprecipitated with anti-VDAC antibody and analyzed byimmunoblotting with anti-NOXA or anti-BIM antibodies. D. Effect on ΔΨm. HCT116 Bax−/−Bak #5 cells were treated with DMSO or MG132, and ΔΨm wasmeasured by flow cytometry using the fluorescent dye Rh123 at 6 and 16 h after treatment. E. Effect on ROS. HCT116 Bax−/−Bak #5 or wt cells were treatedwith DMSO or MG132, and generation of ROS was measured by flow cytometry using the fluorescent dye 2′,7′-dichlorodihydrofluorescein diacetate(H2DCFDA) at different times.






cell death (29, 36) in MEFs or only BAX in HCT116 cells (23).Our results indicate that MG132-induced cell death occurs in aBAX/BAK–independent manner, but in the presence of over-expression of multiple BH3-only proteins and p53. Therefore,

we hypothesized that simultaneous expression of several BH3-only proteins and p53 would result in death of cells deficient inBAX and BAK. Hence, we asked whether coexpression of sev-eral BH3-only proteins and p53 could induce cell death in

FIGURE 6. Analysis of mitochondrial ultrastructure and functions induced by MG132 in HCT116 cells. A. Representative electron microscopic images ofmitochondria from HCT116 wt and Bax−/−Bak #5 cells treated with MG132 or DMSO. B. The effect on mitochondrial mass was determined by staining withnonyl-acridine orange at different times after treatment with MG132 or DMSO and analyzed by flow cytometry. C. Analysis of mitochondrial and cytoskeletalmarkers. The total cell lysates from treated cells were analyzed by immunoblotting using anti-CoxIV and anti-actin antibodies. D. ATP levels in MG132-treatedcells relative to control DMSO-treated cells at 48 h. Columns, mean; bars, SD.






HCT116 cells. For this purpose, we used a clonogenic survivalassay of HCT116 cells with different backgrounds for BAX andBAK expression. Cotransfection of various BH3-only membersand p53 resulted in significant reduction in colony formationcompared with cells that were transfected with individual ex-pression constructs (Fig. 8A). As expected, multiple BH3-onlyproteins and p53 induced cell death in wt HCT116 as well as inBax−/− and #5 cell lines, although to a lesser extent than in wt.To ascertain expression of various proteins coded by the trans-fected constructs in surviving colonies, the cells from pooledcolonies were expanded and analyzed by Western blotting. In-terestingly, cells derived from wt HCT116 cells did not expressany of the transfected genes (Fig. 8B), showing efficient cellkilling by various proapoptotic proteins. Cells survived after

transfection and selection of BAXKO/BAK HCT116 cells ex-pressing BIK, BIM-S, MCL-1S, and PUMA, but not NOXA oradditional p53 (Fig. 8B). These results suggest that whereas en-gagement of these proteins is required for efficient cell-deathactivity in cells lacking BAX and reduced BAK, NOXA andp53 are probably the most critical proteins for this process.Thus, expression of several BH3-only proteins without p53 re-sulted in significant cell death in wt but not in BAXKO/BAKHCT116 cells (Fig. 8C).

Summarizing, these experiments established proof-of-principlethat several BH3-only proteins and p53, when expressedsimultaneously, can instigate apoptosis in the absence ofBAX and with significantly reduced BAK in HCT116 cells.Thus, in addition to the well-established and accepted role of

FIGURE 7. Analysis of mitochondrial ultrastructure and functions in-duced by MG132 in BAX/BAK DKO MEFs. A. Representative electron mi-croscopic images of mitochondria from BAX/BAK DKO MEFs treated withDMSO or MG132 alone or in combination with zVAD-fmk (zVAD) or cy-closporin A (CsA). B. Mitochondrial mass was determined by staining withnonyl-acridine orange 72 h after treatment with DMSO or MG132 alone orin combination with zVAD-fmk or cyclosporin A and then analyzed by flowcytometry. C. ATP levels in wt or BAX/BAK DKO MEFs treated withMG132 and/or zVAD-fmk and/or cyclosporin A relative to control DMSO-treated cells at 48 h. Columns, mean; bars, SD.






FIGURE 8. Effect of coexpression of BH3-only proteins and p53 on cell death in HCT 116 cells. A. Colony survival assay. Indicated HCT116 cell lineswere either mock transfected or transfected with empty vector or vectors expressing various proteins together or individually. Cells were then selected withG418 for 14 d, stained with crystal violet, and photographed. B. Western blot analysis of BH3-only proteins and p53 in surviving cells. The transfected cellswere expanded after G418 selection and analyzed by Western blotting. C. Colony survival assay. Indicated HCT116 cell lines were either mock transfected ortransfected with empty vector or vectors expressing indicated proteins. Cells were then selected with G418 for 14 d, stained with crystal violet, and photo-graphed. D. Model for the MG132-induced cell death in HCT 116 cells. Exposure to proteasome inhibitors results in fast and dramatic up-regulation of BH3-only proteins and p53 through inhibition of degradation and activation of transcription by different transcription factors (TFs). Proapoptotic proteins accumulateat the mitochondria and induce structural and functional mitochondrial demise—mitoptosis and, consequently, cell death. Additional death signaling pathways(e.g., caspase-dependent as well as caspase-independent cell death pathways) are also activated.






BH3-only proteins and p53 as initiators of mammalian apo-ptosis program, we propose that these proteins might also actas effectors of the apoptotic cascade modulating MMP aswell as other mitochondrial functions essential for cell sur-vival independently of BAX and, probably, BAK.

DiscussionInitially, a major rationale for the therapeutic use of the pro-

teasome inhibitor bortezomib was its ability to inhibit nuclearfactor-κB activation (37-39). Later, the use of these agents wasadvanced on their ability to induce apoptotic cell death (4, 40).Additionally, nonapoptotic mechanisms were also suggested,and it was further suggested that BAX might be the switch be-tween apoptotic nonapoptotic death (41). Our results clearlyshow that MG132 induces apoptosis independently of bothBAX and BAK. More strikingly, our data implicate severalBH3-only proteins, BIK, BIM, NOXA, PUMA, andMCL-1S, and p53 as initiators and mediators of cell death byMG132. Several observations support a major role for theseproteins in directly triggering mitochondrial proapoptotic ac-tion of MG132 in the absence of BAX and BAK: (a)MG132 induces dramatic up-regulation in the level of ex-pression of these proteins very early after exposure; (b) onlyproteasome inhibitors that provoke an increase in the expres-sion of BH3-only proteins and p53 cause cell death; (c)down-regulation of expression of BH3-only proteins and p53,but not BH1-3 proteins, by cycloheximide leads to the reduc-tion of MG132-dependent cell death; (d) specific reduction ofexpression BIK, BIM, NOXA, PUMA, and p53 by siRNAs re-sults in reduction in MG132-induced cell death; (e) BH3-onlyproteins and p53 rapidly accumulate at the mitochondria, re-sulting in (f) MMP and (g) pronounced changes in mitochon-drial ultrastructure. We also show that the initial mitochondrialalterations induced by proteasome inhibitors progress over timeand result in structural and functional death of mitochondria.These impairments have detrimental effects on cell metabolismand lead to cell death. A mitochondrial death program or“mitoptosis” has been described in various experimental sys-tems (14, 16) and was hypothesized to take place in cells under-going apoptosis (13).

Only limited data about the mechanism of mitoptosis areavailable at present. Our results show that mitoptosis is an es-sential pathway of MG132-induced apoptosis regardless of thepresence BAX and BAK. Moreover, experiments with zVAD-fmk reveal that mitoptosis may proceed in the absence of cas-pase activation. During cell death by proteasome inhibitors,mitoptosis is initiated by multiple BH3-only proteins andp53. The precise role of p53 in apoptosis by MG132 is not clearat present. Our data show that p53−/− HCT116 cells are as sen-sitive to proteasome inhibitors as their wt counterparts. Itshould be noted that p53−/− and wt cells express BAX, and ac-tivation of even a single BH3-only protein by MG132 would beenough for apoptosis to proceed. In the absence of BAX andBAK, however, p53 is an important member of proapoptoticteam. As shown recently, mitochondrial p53 is able to disruptthe integrity of both outer and inner mitochondrial membranesin vivo, functionally resembling a “super” BH3-only protein(42). Furthermore, the predominant form of p53 at the mitochon-

dria is a dimer or a higher-order oligomer (43). This interestingobservation led us to speculate that, similar to oligomerization ofBAX and BAK, this might contribute to the pore-forming activ-ity of p53 besides its interaction with BCL-2-family proteins atmitochondrial membrane. Therefore, mitochondrial p53 mightfunctionally substitute for BAX and BAK. It is not clear howBH3-only proteins and p53 cause changes in mitochondrial ul-trastructure and ultimately mitoptosis. Previous publicationshave suggested that changes in ultrastructure occur and lead tomitochondrial fragmentation and then mitoptosis (14). It wasalso shown that mediators involved in mitochondrial fission(44) and fusion (45) may regulate mitochondrial fragmentationduring apoptosis due to an increase in fission, decrease of fusion,or both. A recent study in C. elegans showed that EGL-1 (wormBH3-only protein) induced mitochondrial fragmentation thatwas dependent on CED-9 and mediated by dynamin-relatedprotein DRP1, which is one of the mediators of mitochondrialfission (46). In mammalian cells, activation of DRP1 and itsrecruitment to the mitochondria can be induced by the releaseof Ca2+ from endoplasmic reticulum stores and subsequentuptake by mitochondria. Interestingly, the BH3-only proteinBIK was shown to activate this pathway (47). In addition,BH3-only proteins and p53 may also promote mitochondrialfragmentation through direct binding to antiapoptotic BCL-2-family proteins and thus inhibition of mitochondrial fusion.Support for this mechanism came from recent studies withCED-9 and EGL-1 proteins, which showed that expression ofCED-9 (as well as BCL-xL) in mammalian cells promoted mito-chondrial fusion, and that EGL-1 antagonized this function bybinding to CED-9 (48). The possibility that mammalian BH3-only proteins and p53 may inhibit the fusion-promoting activityof BCL-xL and result in mitochondrial fragmentation remains tobe investigated. Several studies have also shown that followingMMP, other intermembarane space proteins in addition to cyto-chrome c, such as DDP/TIMM8a (15) and OPA1 (45), werereleased, resulting in mitochondrial fission and inhibition offusion, respectively. Thus, it seems that by causing MMP,BH3-only proteins and p53may also promote the release of theseproteins leading to mitochondrial fragmentation and subsequentelimination during apoptosis by the proteasome inhibitors.

Various mechanisms for the apoptosis-induced release ofproapoptotic proteins from the mitochondrial intermembranespace may exist (32). In a more well-known MEFs model,the BH3-only proteins have been proposed to initiate this pro-cess through activation of multidomain proapoptotic BAXand BAK (29) either through direct binding or through inter-action with the antiapoptotic BCL-2-family members (49, 50).Cells from BAX/BAK DKO mice fail to undergo MMP inresponse to a wide range of apoptotic signals, including indi-vidual BH3-only proteins (29, 36). Our results show thatMG132 induces MMP independently from BAX and BAK,most likely through activation of multiple BH3-only proteinsand p53 simultaneously. We found that two BH3-only pro-teins, BIM and NOXA, bound to VDAC, and this interactionmay promote MMP. However, the results with mitochondrialpermeability transition pore inhibitor, cyclosporin A, arguethat this is the only mechanism in MG132-induced MMP be-cause cyclosporin A was ineffective against MG132-inducedMMP. We propose that direct insertion of multiple BH3-only






proteins into the outer mitochondrial membrane (in the ab-sence of interaction with other BCL-2-family proteins) mayalso induce MMP. A precedent for this scenario was sug-gested by a recent report that mutants of BIM-S competentfor mitochondrial insertion but not for interaction withBCL-2-family members induced MMP and cell death (51).

Taken together, we suggest that proteasomal inhibition byMG132 in epithelial cancer cells activates factors involved inthe intrinsic apoptotic pathway, including p53 and the BH3-on-ly proteins BIK, BIM, MCL-1S, NOXA, and PUMA. Subse-quent cell death occurs through mitoptosis, the irreversibledeterioration of mitochondrial ultrastructure, and final organelledemolition leading to the metabolic collapse (Fig. 8D). Concur-rently, MMP and the release of intermembrane space proteins(such as cytochrome c, AIF, etc.) into the cytosol might causecell death through overlapping caspase-dependent and caspase-independent pathways.

Materials and MethodsCells and Plasmids

HCT116 wt, Bax−/−, and p53−/− cell lines were gifts from Dr.B. Vogelstein. C-33A and LoVo cell lines were obtained fromAmerican Type Culture Collection. SV40-transformed wt andbak−/−,bax−/− DKO MEFs were gifts from Dr. S. Korsmeyer.Plasmids used in this s tudy were pcDNA3HABIK,pcDNA3p53, pcDNA3N-HAhNOXA, pcDNA3FTBbc3, pE-FEEBIM-S, and pcDNA3MCL-1L. pcDNA3MCL-1S plasmidwas constructed from pMIG-MCL-1 (a gift from E. Cheng) byintroducing a deletion, Δ690-937, using the QuikChange XLSite-Directed Mutagenesis Kit (Stratagene) and recloning intopcDNA3 vector.

Proteasome Inhibitors and AntibodiesThe following inhibitors obtained from Calbiochem were

used: AdaAhX3L3VS, ALLN, epoxomicin synthetic [Ac(Me)-IITL-EX], Hdm2 E3 ligase inhibitor, clasto-lactastatin-β-lactone, α-methylmuralide, MG132 (Z-LLL-CHO), MG262[Z-LLL-B(OH)2], and proteasome inhibitor I [Z-IE(OtBu)AL-CHO]. The antibodies were obtained from the following com-mercial sources: A1, actin, BAD, BIK, and PUMA from SantaCruz Biotechnology; BCL-2, BCL-w, cytochrome c, BID, andBIM from Pharmingen; BCL-xL from Chemicon International;MCL-1 and caspase-3 from Stressgen; BAK, BAX, and E2F-1from Upstate; HRK from MBL International; p53 from Onco-gene; CoxIV from Molecular Probes; and NOXA, VDAC, andPARP from Calbiochem.

Cell Viability and Apoptosis AssaysCell viability was determined using CellTiter 96 AQueous

One Solution Cell Proliferation Assay (Promega). Cell deathwas calculated as percent decrease of absorbance in proteasomeinhibitor–treated cells compared with vehicle-treated cells. Thedata represent the mean ± SD from eight microwells from eachof at least two independent experiments. The percentage of ap-optotic cells was determined by Annexin V-allophycocyanin(Pharmingen) staining and by flow cytometric analysis. Theviability stain 7-amino-actinomycin D (Pharmingen) was alsoincluded in the assay and used as an indicator of membranestructural integrity. DNA fragmentation assay was done as

described (52). Colony survival assay was carried out by trans-fection of HCT116 cells with vectors expressing BIK, BIM-S,NOXA, PUMA, p53, and MCL-1S using FuGene transfectionreagent (Roche); cells were then selected for 14 d with G418,stained with crystal violet, and photographed.

Analysis of ΔΨm, Mitochondrial Mass, Caspase Activity,and Cellular ATP Levels

Mitochondrial dysfunction was assessed using the cationiclipophilic green fluorochrome Rh123 (Invitrogen), as previouslydescribed (53). Disruption ofΔΨm was measured by flow cyto-metric analysis of cells incubated with Rh123 (0.5μg/mL) for 30min. The mitochondrial mass was determined by flowcytometric analysis using 10-N-nonyl acridine orange (Molecu-lar Probes) as described (54). The activity of caspase-3/caspase-7was measured using Caspase-Glo 3/7 kit from Promega. ATPlevels were analyzed using the ATP Bioluminescence assay(Promega).

Subcellular Fractionation, Western Blot Analysis, andImmunoprecipitation

Cells (5 × 106 per dish) were plated in 100-mm-diameterdishes and, on the next day, treated with DMSO or MG132for 6 h, and the mitochondrial and cytosolic fractions were iso-lated as described earlier (52). After proteasome inhibitor treat-ment, the cell extracts were prepared; immunoprecipitation andimmunoblotting were carried out as previously described (52).

RT-PCR AnalysismRNA was isolated from HCT116 wt and p53−/− cells

treated with MG132 or DMSO using the QuickPrep micromRNA Purification Kit (Amersham Biosciences). cDNAwas synthesized using Protoscript II RT-PCR Kit and oli-go-dT primers (New England Biolabs) following the manu-facturer's instructions. PCR amplification was done using Taqpolymerase (New England Biolabs) as recommended by themanufacturer. The following primers were used: Gapdh,TGAAGGTCGGAGTCAACGGATTTGGT (forward) andCATGTGGGCCATGAGGTCCACCAC (reverse); Bik ,CTCAGGGCCCCGCGCCTGGCCCAGCTC (forward) andCGCCGGGGCCTCACTTGAGCAGCAGGT (reverse); Bim,ATGAGAAGATCCTCCCTGCT (forward) and AATG-CATTCTCCACACCAGG ( reve r s e ) ; Mcl - 1 , GAG-G A G G A G G A G G A C G A G T T ( f o r w a r d ) a n dACATTCCTGATGCCACCTTC (reverse); Noxa , GA-GATGCCTGGGAAGAAGGCGCGCAAG (forward) andAAAGTGGTTTTATAATGTTCTCTCATC (reverse); p53,CCTCACCATCATCACACTGG (forward) and CCT-CATTCAGCTCTCGGAAC (reverse); and Puma , CA-G A C T G T G A AT C C T G T G C T ( f o r w a r d ) a n dACAGTATCTTACAGGCTGGG (reverse). The specificity ofPCR amplification of each primer pair was confirmed by analyz-ing the PCR products by gel electrophoresis. Each primer pairwas also tested with a logarithmic dilution of a cDNA mix togenerate a linear curve. The PCR products were then amplifiedin the linear range, separated by 6% PAGE gel electrophoresis,and visualized by Vistra Green (Amersham Biosciences). Theimages of the stained bands were obtained using Storm 860 sys-tem (Amersham Biosciences) and quantified using ImageQuantsoftware.






Luciferase Reporter AssayLuciferase reporter plasmids p53-Luc (Stratagene) or pGL2-

E2F/luc (a gift from S. Chellappan), as well as the respectivenegative control plasmids (pCis-CK and pGL2-E2Fmut/luc),and pRL-TK (Promega) were cotransfected into HCT116 wtor p53−/− cells. Twenty-four hours after transfection, cells weretreated with MG132 or vehicle (DMSO) and, 6 h later, assayedfor luciferase activity using the Dual Luciferase Reporter AssaySystem (Promega).

Ubiquitin Pull-Down AssayUbiquitinated proteins were isolated using UbiQapture-Q

Kit (Biomol) according to the manufacturer's instructions.HCT116 cells were plated at 5 × 106 per dish in 100-mm dishesand, on the next day, treated with DMSO or MG132 for 16 h.Ubiquitinated proteins were isolated from the total cell lysateswith 150 μL UbiQapture-Q matrix by rotating samples for 3h at 4°C. After washing four times, captured proteins were elut-ed with 2× SDS-PAGE loading buffer and analyzed by Westernblotting using specific antibodies.

Stable and Transient Protein KnockdownHCT116 Bax−/− cells were transfected with a vector expres-

sing BAK-specific shRNA (pRS-shBAK, OriGene) and select-ed with puromycin (1 μg/mL; Invitrogen). Puromycin-resistantclones were isolated and expanded. Clones with significantdown-regulation of BAK were identified by Western blotting.Transient depletion of BH3-only proteins and p53 was carriedout by transfection of siRNAs (Qiagen) targeted against variousproteins—BIK (Hs_BIK_4), BIM (Hs_BCL2L11_5), NOXA(Hs_PMAIP1_1 ) , PUMA (Hs_BBC3_2) , and p53(Hs_TP53_9). The siRNAs were transfected into HCT116 wtcells with HiPerFect transfection reagent (Qiagen). After 24 h,cells were treated with 1 μmol/L MG132 or DMSO for 24 h andanalyzed for protein expression, caspase-3 activation, and cellviability.

Transmission Electron MicroscopyCells were harvested by trypsinization and washed once in

PBS, then the cell pellets were fixed with 2.5% glutaraldehydein 0.1 mol/L sodium cacodylate buffer (pH 7.25) containing 2%sucrose and 2 mmol/L calcium chloride for 24 h at 4°C. Thefollowing steps up to polymerization were at room temperature.Cell pellets were washed in 0.1 mol/L sodium cacodylate buffercontaining 5% sucrose and postfixed in 1% osmium tetroxidein 0.1 mol/L sodium cacodylate buffer containing 2% sucrosefor 24 h. The pellets were washed twice in distilled water,dehydrated through graded ethanols to 100%, rinsed twice inpropylene oxide, and infiltrated with a 1:1 mixture of Polybedresin (Polysciences, Inc.) and propylene oxide in capped micro-centrifuge tubes for 24 h. The cell pellets were then incubatedin fresh Polybed resin for 6 h, transferred to BEEM capsulesfilled with fresh resin, and polymerized overnight at 75°C.Thick (0.25 μm) sections were heat-attached to glass micro-scope slides, stained with toluidine blue, coverslipped inPermount mounting medium (Fisher Scientific), and photo-graphed using a Zeiss research light microscope equipped withan Olympus digital camera. Ultrathin sections (0.05 μm) werecut with a diamond knife using a Reichert Ultracut E ultrami-crotome, collected on 200-mesh copper grids, post-stained with

uranyl acetate and lead citrate, and viewed and photographedwith a JEOL 100CX transmission electron microscope.

Disclosure of Potential Conflicts of InterestNo potential conflicts of interest were disclosed.

AcknowledgmentsWe thank Drs. S. Chellappan (H. Lee Moffitt Cancer Center and Research Insti-tute, Tampa, FL), E. Cheng (Washington University, St. Louis, MO), the lateS. Korsmeyer (Dana-Farber Cancer Institute, Boston, MA), B. Vogelstein (JohnsUniversity, Baltimore, MD), David Huang (Water and Eliza Hall Institute ofMedical Research, Melbourne, Australia), and E. White (Rutgers University,Piscataway, NJ) for the generous gifts of plasmids and cell lines, and Joy Eslickand Sherri Koehm for flow cytometry analysis.

References1. Adams J. The proteasome: a suitable antineoplastic target. Nat Rev Cancer2004;4:349–60.

2. Nencioni A, Grunebach F, Patrone F, Ballestrero A, Brossart P. Proteasomeinhibitors: antitumor effects and beyond. Leukemia 2007;21:30–6.

3. Lopes UG, Erhardt P, Yao R, Cooper GM. p53-dependent induction of apo-ptosis by proteasome inhibitors. J Biol Chem 1997;272:12893–6.

4. Chauhan D, Catley L, Li G, et al. A novel orally active proteasome inhibitorinduces apoptosis in multiple myeloma cells with mechanisms distinct from bor-tezomib. Cancer Cell 2005;8:407–19.

5. Nawrocki ST, Carew JS, Dunner K, Jr., et al. Bortezomib inhibits PKR-likeendoplasmic reticulum (ER) kinase and induces apoptosis via ER stress in humanpancreatic cancer cells. Cancer Res 2005;65:11510–9.

6. Concannon CG, Koehler BF, Reimertz C, et al. Apoptosis induced by protea-some inhibition in cancer cells: predominant role of the p53/PUMA pathway.Oncogene 2007;26:1681–92.

7. Youle RJ, Strasser A. The BCL-2 protein family: opposing activities that me-diate cell death. Nat Rev Mol Cell Biol 2008;9:47–59.

8. Chipuk JE, Green DR. How do BCL-2 proteins induce mitochondrial outermembrane permeabilization? Trends Cell Biol 2008;18:157–64.

9. Zhu H, Zhang L, Dong F, et al. Bik/NBK accumulation correlates withapoptosis-induction by bortezomib (PS-341, Velcade) and other proteasomeinhibitors. Oncogene 2005;24:4993–9.

10. Qin JZ, Ziffra J, Stennett L, et al. Proteasome inhibitors trigger NOXA-mediated apoptosis in melanoma and myeloma cells. Cancer Res 2005;65:6282–93.

11. Fernandez Y, Verhaegen M, Miller TP, et al. Differential regulation of noxa innormal melanocytes and melanoma cells by proteasome inhibition: therapeuticimplications. Cancer Res 2005;65:6294–304.

12. Green DR, Reed JC.Mitochondria and apoptosis. Science 1998;281:1309–12.

13. Skulachev VP. Programmed death phenomena: from organelle to organism.Ann N Y Acad Sci 2002;959:214–37.

14. Skulachev VP, Bakeeva LE, Chernyak BV, et al. Thread-grain transition ofmitochondrial reticulum as a step of mitoptosis and apoptosis. Mol Cell Biochem2004;256–7:341–58.

15. Arnoult D, Rismanchi N, Grodet A, et al. Bax/Bak-dependent release ofDDP/TIMM8a promotes Drp1-mediated mitochondrial fission and mitoptosisduring programmed cell death. Curr Biol 2005;15:2112–8.

16. Tinari A, Garofalo T, Sorice M, Esposti MD, Malorni W. Mitoptosis: differ-ent pathways for mitochondrial execution. Autophagy 2007;3:282–4.

17. Zhang L, Yu J, Park BH, Kinzler KW, Vogelstein B. Role of BAX in theapoptotic response to anticancer agents. Science 2000;290:989–92.

18. Bunz F, Dutriaux A, Lengauer C, et al. Requirement for p53 and p21 to sus-tain G2 arrest after DNA damage. Science 1998;282:1497–501.

19. Kisselev AF, Goldberg AL. Proteasome inhibitors: from research tools todrug candidates. Chem Biol 2001;8:739–58.

20. MacLaren AP, Chapman RS,Wyllie AH,Watson CJ. p53-dependent apoptosisinduced by proteasome inhibition in mammary epithelial cells. Cell Death Differ2001;8:210–8.

21. Bunz F, Hwang PM, Torrance C, et al. Disruption of p53 in human cancercells alters the responses to therapeutic agents. J Clin Invest 1999;104:263–9.

22. LeBlanc H, Lawrence D, Varfolomeev E, et al. Tumor-cell resistance to death






receptor-induced apoptosis through mutational inactivation of the proapoptoticBcl-2 homolog Bax. Nat Med 2002;8:274–81.

23. Theodorakis P, Lomonosova E, Chinnadurai G. Critical requirement of BAXfor manifestation of apoptosis induced by multiple stimuli in human epithelialcancer cells. Cancer Res 2002;62:3373–6.

24. Bingle CD, Craig RW, Swales BM, Singleton V, Zhou P, Whyte MK. Exonskipping in Mcl-1 results in a bcl-2 homology domain 3 only gene product thatpromotes cell death. J Biol Chem 2000;275:22136–46.

25. Bae J, Leo CP, Hsu SY, Hsueh AJ. MCL-1S, a splicing variant of the anti-apoptotic BCL-2 family member MCL-1, encodes a proapoptotic protein posses-sing only the BH3 domain. J Biol Chem 2000;275:25255–61.

26. Chipuk JE, Green DR. Dissecting p53-dependent apoptosis. Cell Death Dif-fer 2006;13:994–1002.

27. Mathai JP, Germain M, Marcellus RC, Shore GC. Induction and endoplasmicreticulum location of BIK/NBK in response to apoptotic signaling by E1A andp53. Oncogene 2002;21:2534–44.

28. Hershko T, Ginsberg D. Up-regulation of Bcl-2 homology 3 (BH3)-only pro-teins by E2F1 mediates apoptosis. J Biol Chem 2004;279:8627–34.

29. Wei MC, Zong WX, Cheng EH, et al. Proapoptotic BAX and BAK: a requi-site gateway to mitochondrial dysfunction and death. Science 2001;292:727–30.

30. Adams JM, Cory S. The Bcl-2 apoptotic switch in cancer development andtherapy. Oncogene 2007;26:1324–37.

31. Johnson DE. Noncaspase proteases in apoptosis. Leukemia 2000;14:1695–703.

32. Green DR, Kroemer G. The pathophysiology of mitochondrial cell death.Science 2004;305:626–9.

33. Scorrano L, Ashiya M, Buttle K, et al. A distinct pathway remodels mitochon-drial cristae and mobilizes cytochrome c during apoptosis. Dev Cell 2002;2:55–67.

34. Sugiyama T, Shimizu S, Matsuoka Y, Yoneda Y, Tsujimoto Y. Activation ofmitochondrial voltage-dependent anion channel by a pro-apoptotic BH3-only pro-tein Bim. Oncogene 2002;21:4944–56.

35. Sun MG, Williams J, Munoz-Pinedo C, et al. Correlated three-dimensionallight and electron microscopy reveals transformation of mitochondria duringapoptosis. Nat Cell Biol 2007;9:1057–65.

36. Zong WX, Lindsten T, Ross AJ, MacGregor GR, Thompson CB. BH3-onlyproteins that bind pro-survival Bcl-2 family members fail to induce apoptosis inthe absence of Bax and Bak. Genes Dev 2001;15:1481–6.

37. Russo SM, Tepper JE, Baldwin AS, Jr., et al. Enhancement of radiosensitiv-ity by proteasome inhibition: implications for a role of NF-κB. Int J Radiat OncolBiol Phys 2001;50:183–93.

38. Adams J. Preclinical and clinical evaluation of proteasome inhibitor PS-341for the treatment of cancer. Curr Opin Chem Biol 2002;6:493–500.

39. Hideshima T, Chauhan D, Richardson P, et al. NF-κB as a therapeutic targetin multiple myeloma. J Biol Chem 2002;277:16639–47.

40. Mitsiades N, Mitsiades CS, Poulaki V, et al. Molecular sequelae of protea-some inhibition in human multiple myeloma cells. Proc Natl Acad Sci U S A2002;99:14374–9.

41. Ding WX, Ni HM, Yin XM. Absence of Bax switched MG132-inducedapoptosis to non-apoptotic cell death that could be suppressed by transcriptionalor translational inhibition. Apoptosis 2007;12:2233–44.

42. Wolff S, Erster S, Palacios G, Moll UM. p53′s mitochondrial translocationand MOMP action is independent of Puma and Bax and severely disrupts mito-chondrial membrane integrity. Cell Res 2008;18:733–44.

43. Pietsch EC, Perchiniak E, Canutescu AA, Wang G, Dunbrack RL, MurphyME. Oligomerization of BAK by p53 utilizes conserved residues of the p53 DNAbinding domain. J Biol Chem 2008;283:21294–304.

44. Frank S, Gaume B, Bergmann-Leitner ES, et al. The role of dynamin-relatedprotein 1, a mediator of mitochondrial fission, in apoptosis. Dev Cell 2001;1:515–25.

45. Arnoult D, Grodet A, Lee YJ, Estaquier J, Blackstone C. Release of OPA1during apoptosis participates in the rapid and complete release of cytochrome cand subsequent mitochondrial fragmentation. J Biol Chem 2005;280:35742–50.

46. Jagasia R, Grote P, Westermann B, Conradt B. DRP-1-mediated mitochon-drial fragmentation during EGL-1-induced cell death in C. elegans. Nature 2005;433:754–60.

47. Germain M, Mathai JP, McBride HM, Shore GC. Endoplasmic reticulumBIK initiates DRP1-regulated remodelling of mitochondrial cristae duringapoptosis. EMBO J 2005;24:1546–56.

48. Delivani P, Adrain C, Taylor RC, Duriez PJ, Martin SJ. Role for CED-9 andEgl-1 as regulators of mitochondrial fission and fusion dynamics. Mol Cell 2006;21:761–73.

49. Letai A, Bassik MC, Walensky LD, Sorcinelli MD, Weiler S, Korsmeyer SJ.Distinct BH3 domains either sensitize or activate mitochondrial apoptosis, serv-ing as prototype cancer therapeutics. Cancer Cell 2002;2:183–92.

50. Kim H, Rafiuddin-Shah M, Tu HC, et al. Hierarchical regulation ofmitochondrion-dependent apoptosis by BCL-2 subfamilies. Nat Cell Biol 2006;8:1348–58.

51. Weber A, Paschen SA, Heger K, et al. BimS-induced apoptosis requiresmitochondrial localization but not interaction with anti-apoptotic Bcl-2 proteins.J Cell Biol 2007;177:625–36.

52. Lomonosova E, Subramanian T, Chinnadurai G. Mitochondrial localizationof p53 during adenovirus infection and regulation of its activity by E1-19K.Oncogene 2005;24:6796–808.

53. Liu H, Ma Y, Pagliari LJ, et al. TNF-α-induced apoptosis of macrophagesfollowing inhibition of NF-κB: a central role for disruption of mitochondria.J Immunol 2004;172:1907–15.

54. Colell A, Ricci JE, Tait S, et al. GAPDH and autophagy preserve survivalafter apoptotic cytochrome c release in the absence of caspase activation. Cell2007;129:983–97.






2009;7:1268-1284. Published OnlineFirst August 20, 2009.Mol Cancer Res Elena Lomonosova, Jan Ryerse and G. Chinnadurai by Proteasome Inhibition?

Independent Mitoptosis during Cell Death Induced−BAX/BAK

Updated version

10.1158/1541-7786.MCR-08-0183doi:

Access the most recent version of this article at:

Material

Supplementary

http://mcr.aacrjournals.org/content/suppl/2009/08/11/1541-7786.MCR-08-0183.DC1

Access the most recent supplemental material at:

Cited articles

http://mcr.aacrjournals.org/content/7/8/1268.full#ref-list-1

This article cites 54 articles, 20 of which you can access for free at:

Citing articles

http://mcr.aacrjournals.org/content/7/8/1268.full#related-urls

This article has been cited by 5 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

Rightslink site. (CCC)Click on "Request Permissions" which will take you to the Copyright Clearance Center's

.http://mcr.aacrjournals.org/content/7/8/1268To request permission to re-use all or part of this article, use this link



http://mcr.aacrjournals.org/lookup/doi/10.1158/1541-7786.MCR-08-0183

http://mcr.aacrjournals.org/content/suppl/2009/08/11/1541-7786.MCR-08-0183.DC1

http://mcr.aacrjournals.org/content/7/8/1268.full#ref-list-1

http://mcr.aacrjournals.org/content/7/8/1268.full#related-urls

http://mcr.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mcr.aacrjournals.org/content/7/8/1268


bax/bak independentmitoptosisduringcelldeath ... · abolished (17).bax-deficient human colon...

Documents