BeeSpaceBiology Overview

BeeSpace WorkshopIGB, UIUC • 21 May 2006

BeeSpace Goals

Analyze the relative contributions of Nature and Nurture in

Societal Roles in Honey Bees

Experimentally measure brain gene expression for important societal roles during normal behavior

varying heredity (nature) and environment (nurture)

Interactively annotate gene functions for important gene clusters using concept navigation across biological

literature representing community knowledge

Overview

Understanding Social Behavior

• Honey bees have only 1 million neurons

Yet…• Worker bee exhibits social behavior

• She forages when she is not hungry

but the Hive is• She fights when she is not threatened

but the Hive is

Biology: The Model Organism

Western Honey Bee, Apis mellifera has become a primary model for social behavior

Complex social behavior in controllable “urban” environment

• Normal Behavior – honey bees live in the wild

• Controllable Environment – hives can be modified

Small size manageable with current genomic technology

• Capture bees on-the-fly during normal behavior

• Record gene expression for whole-brain or brain-region

Biological Foundations of BeeSpace

• There is a robust relationship between brain gene expression & social behavior

• Gene expression is the “first phenotype” and can be used to understand nature/nurture

Nature and Nurture

both act on the genome

Heredity Environment

(Whitfield et al, 2002)

HomeComb build, Remove corpses, Hygienic behavior (remove diseased brood)

OffspringBrood care, Attend queen, Personal reproduction (worker)

DefenseGuard, Soldier

FoodForage for nectar, Forage for pollen, Forage for waterForage for resin, Scout, Process food (nectar to honey)Dance communication: sender, Dance communication: receiver

Principal Societal Rolesin the Honey Bee Colony

Nature/Nurture Dissection I

Defense

Roles: Guard and Soldier (Hunt, Hoffmann, Alaux)

Nature: Types of Bees (European, African)

Nurture: Level of Threat (Alarm pheromone; Alaux)

Nature/Nurture Dissection II

Role: Forager (onset age of foraging)

Hereditary factors:European and Africanized Bees (Hunt, Hoffmann)

ligustica and mellifera (Leconte, )

High/Low Pollen Hoarding Lines (Page, )

Nature/Nurture Dissection III

Role: forager (onset age of foraging)

Social factorsPrecocious vs Normal Forager (Newman, Zhang, Ament)

Normal vs Overage Nurse

Typical vs Single-cohort colonyMales (?)

Queens (Corona, Hughes)

Nature/Nurture Dissection IV

Role: Forager (onset age of foraging)

Physiological Manipulations affecting:

cGMP, Manganese, Insulin, Vitellogenin

Juvenile Hormone

TOFA (Fatty Acid inhibitor)(Maleszka, Ament)

Brood Pheromone, Queen Pheromone (Alaux)

Nature/Nurture Dissection V

Dissection of Dance Communication

Species differences, Pts. 1 & 2 (Sarma)

“Distance genes” (Sarma)

“Direction genes” (Brockmann)

Time training (Moore and Naeger)

Scouts (Liang)

Experimental Status

• Genome Complete and Microarray Fabricated (one + year late)

• Bees collected for Experiments– 3/4 last summer; 1/4 this summer

• Experiments complete with EST array• Experiments in progress with full array

• Initial Use of Interactive Annotation on-going• Planning Meta-level Functional Analysis

Goals of Functional Analysis

• Identify genes regulated by heredity and environment… so what?

• Discover candidate genes (gene clusters, molecular pathways) for behavioral regulation… set up for causal experiments– Kr-h1 (Grozinger lab)

– In situ analysis project (Fahrbach lab)

Examplar: Regulation of Brain Kr-h1 Expression by Queen pheromone

Regulates worker behavior:Retinue response

Delay nurse to forager transition**

Inhibit queen rearing

Inhibit ovary development

Christina Grozinger, NC State

Worker responses to queen pheromone

In young bees: Retinue response (Slessor et al, Science 1988) Alter brain gene expression patterns (Grozinger et al PNAS 2003)

In forager bees: No retinue/attraction Still have antennal responses (Pham-Delegue et al 1993)

How is response modulated??

Do foragers respond to QP at all?

• Look at brain gene expression– Kr-h1: downregulated by QP in the brains of

young bees• Place 30 foragers and 30 day-olds in a cage

with a queen for 3 days

Does JH modulate response?

• JH levels much higher in foragers than young bees

• Treat young bees with methoprene (JH analog)

• Methoprene reduces QP’s effects on gene expression

• But Met-treated bees still attracted to QP in retinue

Kr-

h1

re

lativ

e e

xpre

ssio

n le

vels

Grozinger and Robinson JCPA, 2007

Grozinger et al,Naturwissenschaften,

2007

What does Kr-h1 do?

• Downregulated by QP (2x) (Grozinger et al 2003)

• High in foragers compared to nurses (4x)(Grozinger and Robinson 2007)

• QP regulates transition to foraging… so Kr-h1 involved in foraging?

• What aspect of foraging? (Fussnecker and Grozinger in prep)

– Preparation for flight

– Neuroanatomical changes

– Phototaxis

Function of Kr-h1?

But what does Kr-h1 actually DO???

Study effects on neuron structure in Drosophila (Tzumin Lee, UMass)

Use MARCM to study single neurons

WT LOF GOF

Shi, Lin, Grinberg, Grozinger, Robinson, Lee. Dev Neurobio. in press

Associated with permanent brain changes?

• MB expand in foragers

• When foragers revert to nursing behavior, MB stay the same size (Fahrbach et al 2003)

• Is Kr-h1 associated with flight behavior, or “permanent” brain changes?

• Kr-h1 expression correlates with permanent change in brain

(Fussnecker and Grozinger, in prep)

Effect of cGMP on Kr-h1 expression?

(Fussnecker and Grozinger, in prep)

Background: cGMP treatment causes premature onset of positive

phototaxis (Ben-Shahar et al 2003)

Regulated directly/indirectly by cGMP?

• cGMP response element(Hum et al 2004)

N = ATCG; R = A, G; K = G/T; Y = T/C

(Fussnecker and Grozinger, in prep)

ConsensusApisDrosophilaAedesTribolium

AaAtRKaNTTCaAcAKTY AAATAGTCTTCCAAAGTAAAACATTCTTCAAAATTCAAATGTTTTTCCAAATTGAAATATTTTTCTAAATTT

Comparative studies… Bumble beesHoney bee• Kr-h1 associated with foraging…

– QP regulates transition from nursing to foraging– Foragers less responsive to QP

• Kr-h1 & foraging or Kr-h1 & QP?

Bumble bee• Nurse vs. forager –

determined by size• Queen presence regulates dominance

status (reproduction)• In collaboration with Guy Bloch… Z. Huang

Comparative studies… Bumble bees

• Partially sequenced Bt_Kr-h1 and Bt_PKG – the foraging gene;

increased expression in honey bee forager brain

(Fan, Patch, Bloch and Grozinger,prelim results)

Associated with flight?

• Drones become competent to take mating flights when they are approx 5-7 days old

• Compare drones of different ages, with and without flight experience

• Kr-h1 expression matches likelihood of flight; not affected by experience

Z. Huang, MSU

(Fussnecker and Grozinger, in prep)

Cellular localization of gene expression using in situ hybridization

• information in the brain flows through chains of connected neurons (circuits)

• different populations of neurons express distinctive complements of proteins (gene products)

• in situ hybridization localizes mRNAs encoding specific proteins to individual neurons

• this allows gene expression to be studied in the context of the neural circuits that produce behavior

BeeSpace in situ hybridization projectsFahrbach Lab

• Goal: create “brain maps” for genes identified in microarray studies as associated with bee behavior using in situ hybridization– leverages more than a century of neuroanatomical studies BUT– requires develop of efficient approaches– current bottlenecks: frozen sections (10 μm), color reaction to reveal

digoxigenin-labeled probes– proposed solutions: Vibratome sections (100 μm), fluorescent probes

• Test set: 36 neuropeptide-encoding genes identified in the bee genome by a UIUC team using bioinformatics and proteomics (Hummon et al. 2006 Science paper)– set is “right size” for a test of new methods– peptides are expressed abundantly in very small populations of

neurons (often fewer than 10, out of approximately 1 million total neurons in the bee brain), so identification is unambiguous

– data produced will be of interest to insect neurobiologists independent of methods advances

Progress report

• Rodrigo Velarde (Ph.D., Entomology, UIUC, May 2007) has recently joined Fahrbach laboratory at Wake Forest University

• Velarde’s previous experience in the Robinson laboratory included use of in situ hybridization to map the feeding-related neuropeptide NPF

• as a postdoctoral researcher, Velarde will coordinate all BeeSpace in situ hybridization projects

Goals of Functional Analysis

• Array studies as papers?• Identify genes regulated by heredity and environment… so

what?

Ghostbusters Paradigm (descriptive, then analytical)

MAPK (Whitfield lab, Jason Ebaugh)• Discover candidate genes (gene clusters, gene pathways)

for behavioral regulation… set up for causal experiments

Kr-h1 (Grozinger lab)