Toxicology and Applied Pharmacology 253 (2011) 70–80

Contents lists available at ScienceDirect

Toxicology and Applied Pharmacology

j ourna l homepage: www.e lsev ie r.com/ locate /ytaap

Beneficial effects of carbon monoxide-releasing molecule-2 (CORM-2) on acutedoxorubicin cardiotoxicity in mice: Role of oxidative stress and apoptosis

Hitesh Soni a,b, Gaurav Pandya a, Praful Patel a,1, Aviseka Acharya a, Mukul Jain a, Anita A. Mehta b,⁎a Zydus Research Centre, Sarkhej-Bavla N.H 8A Moraiya, Ahmedabad-382210, Indiab Department of Pharmacology, L.M. College of Pharmacy, Navarangpura, Ahmedabad-380009, India

⁎ Corresponding author at: Department of PharmacolOpp. Gujarat University, Navarangpura, Ahmedabad-38079 26304865.

E-mail address: dranitalmcp@gmail.com (A.A. Meht1 P.P. presently works at Torrent Pharmaceutica

Ahmedabad, India.

0041-008X/$ – see front matter © 2011 Elsevier Inc. Aldoi:10.1016/j.taap.2011.03.013

a b s t r a c t

a r t i c l e i n f o

Article history:Received 1 December 2010Revised 12 March 2011Accepted 18 March 2011Available online 8 April 2011

Keywords:DoxorubicinCarbon monoxideCORM-2CardiotoxicityMice

Doxorubicin (DXR) has been used in variety of humanmalignancies for decades. Despite its efficacy in cancer,clinical usage is limited because of its cardiotoxicity, which has been associated with oxidative stress andapoptosis. Carbon monoxide-releasing molecules (CORMs) have been shown to reduce the oxidative damageand apoptosis. The present study investigated the effects of CORM-2, a fast CO-releaser, against DXR-inducedcardiotoxicity in mice using biochemical, histopathological and gene expression approaches. CORM-2 (3, 10and 30 mg/kg/day) was administered intraperitoneally (i.p.) for 10 days and terminated the study on day 11.DXR (20 mg/kg, i.p.) was injected before 72 h of termination. Mice treated with DXR showed cardiotoxicity asevidenced by elevation of serum creatine kinase (CK) and lactate dehydrogenase (LDH), tissue malondialde-hyde (MDA), caspase-3 and decrease the level of total antioxidant status (TAS) in heart tissues. Pre- and post-treatment with CORM-2 (30 mg/kg, i.p.) elicited significant improvement in CK, LDH, MDA, caspase-3 and TASlevels. Histopathological studies showed that cardiac damagewithDXR has been reversedwith CORM-2+DXRtreatment. Therewas dramatic decrease in hematological count inDXR-treatedmice,whichhas been improvedwith CORM-2. Furthermore, there was also elevation of mRNA expression of heme oxygenase-1, hypoxiainducible factor-1 alpha, vascular endothelial growth factor and decrease in inducible-nitric oxide synthaseexpression upon treatment with CORM-2 that might be linked to cardioprotection. These data suggest thatCORM-2 treatment provides cardioprotection against acute doxorubicin-induced cardiotoxicity in mice andthis effect may be attributed to CORM-2-mediated antioxidant and anti-apoptotic properties.

ogy, L.M. College of Pharmacy,0009, Gujarat, India. Fax: +91

a).l Limited, Research Centre,

l rights reserved.

© 2011 Elsevier Inc. All rights reserved.

Introduction

Heart failure (HF) and cancer are the diseases with a high rate ofmortality. Doxorubicin (DXR), an anthracycline, is one of themost usedantitumor agents. However, DXR is associated with cardiotoxic effectsleading to the cardiomyopathy and HF, which is one of the majorlimitations for itsuse as antineoplastic agent (Singal and Iliskovic, 1998).The mechanism of DXR-induced cardiotoxicity has been linked toelevated reactive oxygen species (ROS) formation, mitochondrialimpairment, apoptosis and DNA damage, nitrosative stress andalterations of calcium metabolism (Takemura and Fujiwara, 2007;Myers et al., 1977). Several approaches to avoid cardiotoxicity of DXRhave been tried but with some degree of success. Co-administrationwith iron-chelating agent dexrazoxane is the only drug approved byUSFDA to reduce DXR-induced cardiotoxicity. However, dexrazoxane

leads to high incidence of myelosuppression therefore its use has beenrestricted to some advanced stages of tumor (Schlame et al., 2000).

Carbon monoxide (CO) has been described as a “silent killer”for mammalians due to its higher affinity for hemoglobin (Hb)(Tenhunen et al., 1968). Mammalian cells express the enzyme hemeoxygenase-1 (HO-1), which is responsible for the catabolism of heme.Endogenously HO-1 has the potential to generate CO, bilirubin andiron (Fe ++) at the time of heme breakdown. CO has beneficialeffects in many patho-physiological conditions, whichmimics the roleof HO-1 (Otterbein et al., 2003a, 2003b). Recently, CO has emerged asa potential therapeutic agent for the treatment of various cardiovas-cular disorders (Otterbein et al., 2003a, 2003b; Fujimoto et al., 2004).More recently, CO-releasing molecules (CORMs) provide betterapproach for the delivery of CO due to their different solubility profileand predictable release kinetics which may allow for controlleddelivery of CO. CORM-2 (Tricarbonyldichlororuthenium (II) dimmer)is basically a metal carbonyl. For most 18-electron metal carbonyls,the mechanism of CO loss is dissociative to give a 16-electronintermediate. This intermediate then enters in a competition betweenthe liberated CO and ligands present in solution to fill the vacant siteon the metal. Depending on the type of solution, the rate of release ofCO will be different. For instance, the half-life of CORM-3 (water

71H. Soni et al. / Toxicology and Applied Pharmacology 253 (2011) 70–80

soluble CO-releaser) in saline is 10.6 h whereas in phosphate bufferedsaline (PBS) is 20.4 min and in human plasma is 3.6 min. These dataconfirm that a series of different reactions takes place between thetransition metal and the various ligands present in the solutions, andthis significantly affects the dissociation of CO from the metal center(Motterlini et al., 2003). It has been reported by us aswell as others thatCO-releaser molecules also proved to be effective against variousvascular and cardiovascular diseases (Soni et al., 2010; Motterlini et al.,2003). Recent evidence indicate that COmay be a strong contributor tothe defensive action attributed to HO-1 and participate more directly inprotecting cells against oxidative and nitrosative stress. The use ofCORMhas been serving as a pharmacological tool to show this new roleof CO. CORM-2 has been shown to reduce the production of ROS andnitric oxide (NO) derived from up-regulation of inducible-nitric oxidesynthase (iNOS) in RAW 264.7 macrophages stimulated with lipopo-lisaccharide (LPS) (Srisook et al., 2006). Both CORM-2 and CORM-3 areable to reduce NO production in different cellular systems such asmicroglial cells and murine macrophages without affecting iNOSexpression (Bani-Hani et al., 2006; Sawle et al., 2005). Recently, Sulimanet al. (2007) studied using mouse model and suggested that DXRdisrupts cardiac mitochondrial biogenesis, which promotes intrinsicapoptosis, while CO/HO promotes mitochondrial biogenesis andopposes apoptosis, prevents fibrosis and cardiomyopathy in DXR-induced cardiotoxicity. There was progressive mitochondrial damageand mitochondrial initiation of apoptosis in DXR-induced cardiomyop-athy, along with the antiapoptotic mitochondrial profile that leads tostimulation of the CO/HO system (Childs et al., 2002; Piantadosi et al.,2006). These observations support the idea that CO would resistintrinsic apoptosis after DXR administration. We tested the hypothesisthat DXR causes oxidative stress-induced cardiotoxicity and CORM-2administration prevents the cardiotoxicity by protecting the heart fromoxidative stress and creating an apoptosis-resistant phenotype.

Materials and methods

Animals. Male BalbC mice weighing 25–30 g were maintained inAAALAC-accredited, climate-controlled facilities and allowed freeaccess to food and water. All studies were carried out in accordancewith the “Guide for the Care and Use of Laboratory Animals”. Theanimals were housed in quiet rooms with 12:12-h light–dark cycle(07:00 am–07:00 pm). Institutional Animal Ethical Committee (IAEC)approved all protocols.

Chemicals. Tricarbonyldichlororuthenium (II) dimmer (CORM-2),Doxorubicin hydrochloride (DXR) and RuCl3 (also termed as inactivecarbon monoxide releasing molecule—iCORM-2) were purchasedfrom Sigma Chemicals, USA. TRIzol reagent was purchased fromInvitrogen (Carlsbad, CA, USA). Proteinase K was purchased fromBangalore Genei, India. All other reagents were purchased from SigmaChemicals, USA. In all experiments, 0.5% dimethyl sulfoxide (DMSO)in saline was used to ensure that effects were due to CO and not due toDMSO solvent. Also to dissociate the effects of CO from the donormolecule, RuCl3 which has the same basic structure as CORM-2 but donot liberate CO was used as a negative control and termed as inactivecarbon monoxide releasing molecule-2 (iCORM-2).

Mice model of DXR-mediated cardiotoxicity and experimental protocol.All animals were acclimatized for a period of 5 days before the start

Table 1Effects of single dose of doxorubicin (5, 10, 15 and 20 mg/kg, i.p.) on CK and mortality afte

Vehicle DXR (5 mg/kg, i.p.) DXR (1

CK (IU/l) 346±42.5 555±78.9 668±Mortality 0 0 0

of the study. Male BalbC mice were randomized into seven groups,each group containing 8+12=20 animals. All treatments weregiven till day 10. CORM-2 or iCORM-2 (RuCl3) was dissolved in 0.5%DMSO and saline was added to make dose volume of 10 ml/kg andadministered from day 1 to day 10. DXR was dissolved in saline andsingle bolus injection of DXR (20 mg/kg, i.p.) was administered onday 8. Dose range and duration of treatment were established afterperforming some pilot experiments (Tables 1 and 2). CORM-2(50 mg/kg, i.p.) for 10 days showed reduction in body weight inanimals, 20% mortality and animals were found to be lethargic. Doseof DXR was established based on pilot experiments that showedsignificant increase in creatine kinase (CK) (Table 1) along withcardiac damage during histopathology of heart (data not shown).Similar dose of DXR was also reported in various literatures (Pacheret al., 2003; Li et al., 2006). Experimental design was described inFig. 1.

Assessment of body weight, heart weight and mortality. Animals wererandomized on the basis of bodyweight on day 0 and bodyweight andheart weight of mice were recorded on day 11 using weighing balance(Mettler Toledo, India). Animals were daily observed for anymortalityand recorded.

Assessment of serum CK and lactate dehydrogenase (LDH) levels. CKlevels in serum sample were detected using diagnostic kits (RandoxLaboratories Ltd, UK) according to supplier's description andexpressed as International Units (IU)/l. LDH levels in sample wereassayed using optimized lactate dehydrogenase procedure accordingto the manufacturer's instructions (Randox Laboratories Ltd, UK). TheLDH levels in the sample were measured by monitoring the rate ofdecrease in absorbance at 565 nm and expressed as IU/l.

Mouse heart tissue homogenization and determination of total protein inhomogenate. Heart samples were quickly excised, washed with PBS,pH 7.4, weighed and homogenized (100 mg heart per ml of PBS). Thesamples were homogenized with a polytron homogenizer. Thehomogenate was centrifuged at 12,000×g. The supernatants wereused for various measurements. Protein concentration in supernatantwas determined using Bradford Colorimetric Protein Determination at595 nm (QuantiChrom Protein Assay Kit, BioAssay Systems, USA).

Assessment of total antioxidant status (TAS) and malondialdehyde(MDA) in mouse heart tissue homogenate. The total antioxidant activityin heart tissue homogenate was measured by ABTS (2,2′-Azino-di-[3-ethylbenzthiazoline sulfonate]) decolorization assay using commer-cially available kit (Randox Laboratories, Boston, MA, USA). The heartMDA levels were detected using diagnostic kits (Bioxytech MDA-586,OxisResearch, USA) as per manufacturer's instruction and expressedas nmol/mg protein.

Hematological analysis in blood samples. Mice were anesthetized andblood samples were collected from retro-orbital route in microce-ntrifuge tubes containing5%ethylenediamine tetraacetate (EDTA) as ananticoagulant. All samples were analyzed for red blood cells (RBC),hemoglobin (Hb), hematocrit (HCT) and reticulocyte count using CellDyn 3700 (Abbott Diagnostics) analyzer. The Cell-Dyn 3700 utilizesmethylene blue staining to measure the percent of the totalreticulocytes.

r 72 h of administration (n=5).

0 mg/kg, i.p.) DXR (15 mg/kg, i.p.) DXR (20 mg/kg, i.p.)

88.5 793±81.3 1327±234.90 1/5

Table 2Effects of different doses of CORM-2 (3, 10, 30, 50 and 100 mg/kg, i.p.) once daily for 10 days on COHb and mortality (n=5).

Vehicle iCORM-2(100 mg/kg, i.p.)

CORM-2(3 mg/kg, i.p.)

CORM-2(10 mg/kg, i.p.)

CORM-2(30 mg/kg, i.p.)

CORM-2(50 mg/kg, i.p.)

CORM-2(100 mg/kg, i.p.)

COHb (%) 0.23±0.56 0.26±0.37 0.46±0.53 0.69±0.68 0.82±0.71 1.72±0.69 2.15±1.13Mortality 0 0 0 0 0 1/5 3/5

72 H. Soni et al. / Toxicology and Applied Pharmacology 253 (2011) 70–80

Histopathology of mouse heart tissue. Mice were euthanized underanesthesia and heart samples were harvested at the end of the study.The specimens were fixed in phosphate-buffered 10% formalin for24 h and then embedded in paraffinwax for light microscope analysis.Five micrometer-thick sections were cut and stained with hematox-ylin and eosin (H&E). Images of representative fields were acquiredunder an Olympus Provis AX-70 microscope (Olympus, Lake Success,NY) equipped with a Spot RT color digital camera (DiagnosticInstruments, Sterling Heights, MI). Examinations were performed ina blinded manner. In histopathological examination, cardiomyocytesexhibiting myocardial coagulative necrosis, vascular dilatation andinfiltration of inflammatory cells were investigated.

DNA extraction and DNA ladder by gel electrophoresis. Genomic DNAfrom heart tissues was extracted as described by Khaw et al (2002). Inbrief, tissue samples were homogenized with 0.1-mol/l PBS, pH 7.4,followed by centrifugation at 500×g for 5 min. Samples were washedwith ice-cold PBS, by centrifugation at 500×g for 5 min. The wash wasrepeated 3 times and 0.3 ml of homogenization buffer (0.1 mol/l NaCl,10 mmol/l TRIS–HCl, pH 8.0, 25 mmol/l EDTA, 0.5% Na dodecyl sulfate,and 0.1 mg proteinase k/ml) was added. Themixturewas incubated at50 °C for 12 to 18 h with gentle shaking. The DNA was extractedwith an equal volume of phenol–chloroform–isoamyl alcohol (1:1:1).The reagents were mixed gently and then centrifuged for 10 min at1700×g at room temperature to separate into different phases. The

Groups

Day 2 Day 3 Day 4 Day 5 Day 6

Groups(1) Vehicle Control (0.5% DMSO, 10 ml/kg, i.p.) + Saline (1

ml/kg, i.p.)

(2) CORM-2 (30 mg/kg, i.p.) + Saline (10 ml/kg, i.p.)

(3) Vehicle Control (0.5% DMSO, 10 ml/kg, i.p.) + DXR (20mg/kg, i.p.)

(4) i CORM-2 (RuCl3, 30 mg/kg, i.p.) + DXR (20 mg/kg, i.p.

(5) CORM-2 (3 mg/kg, i.p.) + DXR (20 mg/kg, i.p.)

(6) CORM-2 (10 mg/kg, i.p.) + DXR (20 mg/kg, i.p.)

(7) CORM-2 (30 mg/kg, i.p.) + DXR (20 mg/kg, i.p.)

Day 1

Fig. 1. Experime

aqueous phase was removed and a one half volume of 7.5 mol/lammonium acetate, pH 5.3, was added andmixed. Two volumes of icecold 100% ethanol were added to above andmixed until a stringy DNAprecipitate formed. The reaction tube was placed at −70 °C for15 min, and then centrifuged at 100×g for 2 min in a microfuge tube.The supernatant was removed, and 1 ml of 70% cold ethanol wasadded to precipitate the DNA. The DNA pellet was air-dried, dissolvedin TRIS–HCl:EDTA buffer, pH 8.0, and stored at −4 °C until use.

The extracted DNA was quantified by UV spectrophotometricanalysis and 10 μg purified DNA was loaded into 1.8% agarose gel(Electrophoresis grade, GIBCO BRL, Life Technologies) containing0.5 μg/ml of ethidium bromide. The electrophoresis was performed ina BioRad widemini-slab TM cell at 75 V (BioRadModel 200/2.0 powersupply) for about 1 h. DNA ladders, an indicator of tissue apoptoticnucleosomal DNA fragmentation, were visualized under UV lightsource and photographed under ultraviolet transillumination (Kimet al., 2009).

RNA extraction and cDNA synthesis. Heart tissues were dissected andSnap-frozen in liquid nitrogen immediately. Samples were keptfrozen at −70±2 °C till use in gene expression studies. Total RNAwas prepared from heart tissues by the TRIzol reagent (Invitrogen).Quantitation of total RNA was performed using BioPhotometer andthe quality of RNA was ascertained by measuring 260/280 ratio.

Day 7 Day 8 Day 9 Day 10

Single bolus injection of Doxorubicin (DXR) (20 mg/kg, i.p.)

Study Termination

Parameters analyzed on day 11

n=12

0

)

Day 11

Single bolus injection of Doxorubicin (DXR) (20 mg/kg, i.p.)

Study Termination

Parameters analyzed on day 11

n=12

Parameters analyzed on day 11Parameters analyzed on day 11•Body weight•Heart weight•Biochemistry

CKLDHTAS (Heart tissue)MDA (Heart tissue)

•HaematologyRBCHBReticulocyteHaematocrit

•Histopathologyof heart (H & E staining) n=4•DNA isolation from heart for DNA ladder n=4•RNA isolation & gene expression by RT-PCR n=4

HO-1 (Taqmanprobe)iNOS (SYBR green method)HIF-1 alpha (SYBR green method)VEGF (SYBR green method)

n=8

n=12

ntal design.

73H. Soni et al. / Toxicology and Applied Pharmacology 253 (2011) 70–80

The cDNA synthesis was performed using kit (High CapacityReverse Transcription Kit, Applied Biosystem, USA) according tomanufacturer's instruction. Briefly, 1.5 μg of total RNA from eachsamplewas added to amixture of 2.0 μl 10× RT buffer, 0.8 μl 25× dNTPmixture (100 nm), 2.0 μl 10× RT random primers, 1.0 μl RT enzymeand 3.2 μl nuclease-free water. The reaction mixture was heated at25 °C for 10 min followed by 85 °C for 5 s, and finally cooled to 4 °C.

Quantification by real-time RTPCR. Quantitative analysis of specificmRNA expressionwas performed by real-time RTPCR. Resulting cDNAsamples were subjected to PCR amplification using 96-well opticalreaction plates in the ABI prism 7300 system (Applied Biosystems).The 20-μl reaction mixture contained 2 μl forward primer and 2 μlreverse primer, 10 μl 2× SYBR Green Universal Mastermix, 2 μl cDNAsample and 4 μl nuclease-free water. The reverse and forward primersfor HO-1, iNOS, hypoxia inducible factor-1 (HIF-1) alpha and vascularendothelial growth factor (VEGF), used in the current study werechosen from previously published literature and are listed in Table 3(Kopf et al., 2008; Khaleduzzaman et al., 2007, Wagatsuma et al,2005). Assay controls were also incorporated into same plate.Thermocycling conditions were initiated at 95 °C for 10 min, followedby denaturation at 95 °C for 10 s, and annealing at 60 °C for 30 s.Melting curve was performed by the end of each cycle to ascertainreal-time RTPCR process for specific gene transcript.

Real-time RTPCR data analysis. The real-time RTPCR data wereanalyzed using the relative gene expression technique called ΔΔCT,which is described in Applied Biosystems User Bulletin. The data wereexpressed as the fold change in target gene expression normalized tothe endogenous reference gene, beta actin, and relative to theuntreated control samples.

Statistical analysis. Data were presented as mean±standard error ofmean (SEM). Data were analyzed by One-way ANOVA followed byTukey's multiple comparison tests. All analysis was done usingGraphPad Prism software version 4.0. pb0.05 was considered to bestatistically significant.

Results

In the beginning, we designed pilot experiments and found thatDXR in single dose of 20 mg/kg intraperitoneally (i.p.), induced clearsigns of cardiac toxicity after 72 h of DXR injection inmice as indicatedby increase in serum CK levels (Table 1) and found abnormality inheart tissues due to DXR-induced toxicity (data not shown). Animalsin the DXR group appeared sicker, weaker and lethargic compared tocontrol. The mortality was 20% in the DXR group. CORM-2 (50 mg/kg,i.p.) produced 20% mortality in the treatment duration of 10 days(Table 2). Therefore 3, 10 and 30-mg/kg dose of CORM-2 wereconsidered for further study. Therewas also increasing trend for COHblevels in whole blood samples at 50 and 100 mg/kg dose of CORM-2

Table 3Primer sequence used for real-time RTPCR reactions.

Gene Primer sequence

HO-1 F: TTCTGGTATGGGCCTCACTGGR: ACCTCGTGGAGACGCTTTACA

iNOS F: GACGGATAGGCAGAGATTGGR: CACATGCAAGGAAGGGAACT

HIF-1 alpha F: ACAAGTCACCACAGGACAGR: AGGGAGAAAATCAAGTCG

VEGF F: TTACTGCTGTACCTCCACCR: ACAGGACGGCTTGAAGATG

Mouse beta-actin F: TACAGCTTCACCACCACAGCR: TCTCCAGGGAGGAAGAGGAT

but it did not reach to the statistical significance. COHb level in bloodsamples have been analyzed as described earlier (Vera et al., 2005).

Animals were randomized on bodyweight basis before treatment. Onday 11, body weight was significantly decreased in DXR-treated group ascompared to control group (pb0.01) and this differencewas abolished byprior and concurrent treatment with CORM-2+DXR (30 mg/kg, i.p.)(Fig. 2A). Heart weight was also decreased in DXR group (Fig. 2B) ascompared to control group (pb0.01), and significantly increased inCORM-2+DXR-treated group as compared to DXR group (pb0.05). Theelevation of assayed enzymes such as CK (Fig. 3A) and LDH (Fig. 3B) wassignificant in DXR-treated groups as compared to vehicle control group.On the other hand, CORM-2 (30 mg/kg, i.p.)+DXR treatment causedsignificant reduction in CK and LDH levels when compared with theresults obtained from serum of animals that received DXR only. The totalantioxidant activity (TAS) was significantly decreased (pb0.001) in hearttissues of DXR-treated group (Fig. 4A). In CORM-2+DXR-treated group,the total antioxidant activity was significantly increased as compared toDXR-treated group (pb0.01). The product of lipid peroxidationmeasuredas MDA content in heart tissues, was significantly higher in DXR-treated

Fig. 2. Effects of CORM-2 (3, 10 and 30 mg/kg, i.p.) pre- and concurrent treatment onthe changes in (A) body weight and (B) heart weight induced by DXR (20 mg/kg, i.p.,single dose) in BalbC mice. Heart weight was determined on day 11. All values areexpressed as mean±SEM (n=8). (a) indicates pb0.05 vs. vehicle control group and(b) indicates pb0.05 vs. vehicle+DXR-treated group.

74 H. Soni et al. / Toxicology and Applied Pharmacology 253 (2011) 70–80

group (6.11±0.76 mmol/mg protein, pb0.001) as compared to controlgroup (1.13±0.13). Pre- and concomitant administration of CORM-2 (10and 30 mg/kg, i.p.) produced a significant decrease in MDA (2.91±0.31and 1.75±0.20 mmol/mg protein respectively, pb0.001) as compared toDXR alone group (Fig. 4B). DXR (20 mg/kg, i.p.) treatment elicitedsignificant decrease in RBC, Hb, HCT and % reticulocyte count. Pre- andpost-treatment with CORM-2 (30 mg/kg, i.p.) for 10 days producedsignificant (pb0.001) increase in RBC, Hb, HCT and % reticulocyte count(Fig. 5A, B, C and D) as compared to DXR treatment alone. Sections ofmouse heart stained with H&E were examined by light microscopy(Fig. 6). Heart sections from control and CORM-2 (30 mg/kg, i.p.)+DXR-treated mice were indistinguishable by histology and appeared normalmorphologically. The DXR heart was characterized by loss of myofibrilsand vascular dilatation, a hallmark of necrosis. However, myocardialnecrosis was still evident at concentration of 3 and 10 mg/kg CORM-2,which suggests that theseheartswerenot completely protected. CORM-

Fig. 3. Effects of CORM-2 (3, 10 and 30 mg/kg, i.p.) pre- and concurrent treatment onthe changes in (A) serum CK and (B) serum LDH-induced by DXR (20 mg/kg, i.p., singledose) in BalbC mice. CK and LDH levels were determined on day 11. All values areexpressed as mean±SEM (n=8). (a) indicates pb0.05 vs. vehicle control group and(b) indicates pb0.05 vs. vehicle+DXR-treated group.

Fig. 4. Effects of CORM-2 (3, 10 and 30 mg/kg, i.p.) pre- and concurrent treatment onthe changes in (A) TAS and (B) MDA from heart tissue induced by DXR (20 mg/kg, i.p.,single dose) in BalbC mice. Values were determined on day 11. All values are expressedas mean±SEM (n=8). (a) indicates pb0.05 vs. vehicle control group and (b) indicatespb0.05 vs. vehicle+DXR-treated group.

2 protects the heart by mitigating the loss of mitochondrial DNA andreducing oxidative stress, which attenuates cardiac apoptosis andnecrosis and maintains normal heart function. DXR-treated heartsamples showed clear laddering pattern. However, CORM-2 (3 and10mg/kg, i.p.)+DXR-treated hearts had reduced amount of DNAladdering, whereas CORM-2 (30 mg/kg, i.p.)+DXR-treated heartsamples showedno ladderingpattern, indicatingantiapoptotic propertyof CORM-2 at higher dose (Fig. 7). As shown in Fig. 8, DXR treatmentinduced marked elevation in the caspase-3 activity in the myocardialtissue (2.50±0.11 fold, pb0.001) compared with vehicle control mice.CORM-2 (30 mg/kg, i.p.) pretreatment prevented the DXR-inducedincrease in caspase-3 activity (1.5±0.12).

HO-1 expression in heart tissuewas significantly suppressed byDXR(20 mg/kg, i.p.) treatment. CORM-2 (10 and 30 mg/kg, i.p.)+DXRproduced significant fold increase (2.65±0.21, pb0.001 and

Fig. 5. Effects of CORM-2 (3, 10 and 30 mg/kg, i.p.) pre- and concurrent treatment on the changes in (A) RBC count, (B) Hb level, (C) HCT and (D) % Reticulocyte count-induced byDXR (20 mg/kg, i.p., single dose) in BalbCmice. All parameters determined on day 11. All values are expressed asmean±SEM (n=12). (a) indicates pb0.05 vs. vehicle control groupand (b) indicates pb0.05 vs. vehicle+DXR-treated group.

75H. Soni et al. / Toxicology and Applied Pharmacology 253 (2011) 70–80

3.36±0.30, pb0.001 respectively) in HO-1 mRNA expression ascompared to DXR group (0.30±0.04). Induction of HO-1 in the heartmay provide potential cardioprotective action (Fig. 9). The expressionlevel of iNOS mRNA was significantly increased in DXR-treated mousehearts (Fig. 10). This suggests that iNOS gene expression is selectivelyinduced by DXR after 72 h of DXR treatment in mouse heart. Treatmentwith CORM-2 (30 mg/kg, i.p.) significantly attenuated DXR-inducedincrease in the iNOS mRNA expression (Fig. 10). The mRNA expressionof the hypoxia-induced transcription factor, HIF-1-alpha was markedlyincreased in CORM-2+DXR group compared to DXR group (Fig. 11).The mRNA expression of the angiogenic factor, VEGF in heart was notsignificantly affected by DXR treatment but interestingly, CORM-2(30 mg/kg, i.p.)+DXR (20 mg/kg, i.p.) group elicited significantincrease in the mRNA expression of VEGF as compared to DXR-treatedgroup which might reflect a protective response to counteractimpairment of angiogenesis by DXR (Fig. 12).

Discussion

A number of studies using HO-1 transgenic mice are supportive ofHO-1-mediated cardioprotection. Cardiac specific overexpression ofhuman HO-1 protected against cardiac I/R injury in the transgenicmice (Yet et al., 2001), as well as improved functional recovery afterreperfusion, and limited cardiomyocyte apoptosis (Vulapalli et al.,

2002). These studies have implicated HO-1 as a critical defenseagainst cardiac tissue injury. Physiological CO can also promote andrestore the critical capacity for energy production in cardiac cells. Theprogressive mitochondrial damage and mitochondrial initiation ofapoptosis in DXR-induced cardiomyopathy, along with the antiapop-toticmitochondrial profile that accompanies stimulation of the CO/HOsystem, support the idea that COwould oppose intrinsic apoptosis andnecrosis after DXR administration (Childs et al., 2002; Piantadosi et al.,2006). It is reported that CO accumulation in cells triggers mitochon-drial heme release, upregulating HO-1 and generating endogenousCO, which, sustains mitochondrial biogenesis, and protect the heart(Cronje et al., 2004). It has been reported that CO derived from CORM-3 exerts a direct positive inotropic effect on normal rat hearts and thatboth cGMP and Na+/H+ exchanger were involved in this effect(Musameh et al., 2006). Recently, Musameh et al. (2010) alsoreported that CORM-3 produced a positive inotropic effect in DXR-induced cardiomyopathy in rat hearts and this effect is likely to be dueto the CO liberated by CORM-3 which suggests that CORM may yieldan interesting alternative inotropic therapy to the other drugs, whichare currently in use. To study the potential protective properties of COagainst the cardiotoxic effects of DXR, we used a mouse model, asdescribed previously (Pacher et al., 2003; Li et al., 2006). Theunderlying mechanism of DXR-induced cardiotoxicity is unclear butnumerous reports suggested that DXR causes cardiomyocyte apoptosis

Fig. 6. H&E stained representative sections of heart tissue showing changes in myocardium from various group. (A) and (B) show normal appearance of myocardium of BalbC mice treatedwith Vehicle Control (0.5% DMSO, 10 ml/kg, i.p.)+Saline (10 ml/kg, i.p.) and CORM-2 (30 mg/kg, i.p.)+Saline (10 ml/kg, i.p.) respectively (A and B, 400×). (C) and (D) representmorphological alterations in myocardium of mice treated with Vehicle Control (0.5% DMSO, 10 ml/kg, i.p.)+DXR (20 mg/kg). It represents loss of striation, myocardial necrosis withinflammatory cellular infiltration andfibrosis (C) and vacuolar changes (thin arrow) inmyocardium (D) (C andD, 400×). (E) and (F) represent cardiacmuscle ofmice treatedwith iCORM-2(RuCl3, 30 mg/kg, i.p.)+DXR (20mg/kg, i.p.) and CORM-2 (3 mg/kg, i.p.)+DXR (20 mg/kg, i.p.) respectively and shows similar findings as (C and D) (E and F, 400×). (G) and (H) representcardiac tissue of mice received CORM-2 (10 mg/kg, i.p.)+DXR (20 mg/kg, i.p.) and CORM-2 (30 mg/kg, i.p.)+DXR (20 mg/kg, i.p.) respectively. (G) showsminimal cellular infiltration andsingle cell necrosis than DXR treated mice while H represents findings similar to vehicle control groups (B) (G and H, 400×).

76 H. Soni et al. / Toxicology and Applied Pharmacology 253 (2011) 70–80

Fig. 7. Representative DNA ladder. Effect of CORM-2 (3, 10 and 30 mg/kg, i.p.) pre- andconcurrent treatment on the qualitative analysis of apoptosis using DNA ladder(hallmark of apoptosis) induced by DXR (20 mg/kg, i.p., single dose) in genomic DNAisolated from the heart of BalbC mice. DNA extracted from heart tissues then subjectedfor DNA laddering by gel electrophoresis. Lane 1: low range molecular weight marker(1000 bp—MBI, Fermentas), Lane 2: DNA from heart tissue of vehicle control group,Lane 3: CORM-2 (30 mpk, i.p.) treated group, Lane 4: iCORM-2+DXR group, Lane 5:CORM-2 (3 mpk, i.p.)+DXR treated group, Lane 6: CORM-2 (10 mpk, i.p.)+DXR, Lane7: CORM-2 (30 mpk, i.p.)+DXR.

Fig. 9. Effects of CORM-2 (3, 10 and 30 mg/kg, i.p.) pre- and concurrent treatment onthe relative fold changes in HO-1 mRNA expression induced by DXR (20 mg/kg, i.p.,single dose) in heart of BalbC mice. Values are normalized using mouse beta actin asinternal reference standard. All values are expressed as mean±SEM (n=4). (a)indicates pb0.05 vs. vehicle control group and (b) indicates pb0.05 vs. vehicle+DXR-treated group.

77H. Soni et al. / Toxicology and Applied Pharmacology 253 (2011) 70–80

(Delpyet al., 1999; Sawyer et al., 1999) andalsodamage fromROS is likelyto be the primal cause for DXR-mediated cardiotoxicity (denHartog et al.,2004). In the present study we demonstrated that DXR led to acutecardiac toxicity and chronic treatment with CORM-2 (fast CO releaser)followed by DXR treatment improve compromised heart function.Further, we show that CORM-2 exert beneficial cardioprotective effectagainst DXR-induced cardiotoxicity in vivo by reducing oxidative stressand apoptosis. However, data from our pilot experiments suggests thatthere is very thin line between therapeutic efficacy and toxic effects of

Fig. 8. Effects of CORM-2 (3, 10 and 30 mg/kg, i.p.) on DXR-induced caspase-3activation analyzed by colorimetric assay from heart tissue. (a) indicates pb0.05 vs.vehicle control group and (b) indicates pb0.05 vs. vehicle+DXR-treated group.

CORM-2 which indicates that therapeutic index of this molecule isnarrow.However, therewas no significant increase in the COHb at higherdose of CORM-2 as evident from our pilot study. Therefore, toxicity/mortality at higher dose of CORM-2 may be related to some other targetbut not the COHb and this issue needs much intense investigation in thefuture.

The results from our study showed that CORM-2 protects themyocardium, which was evident from dose dependently decreased

Fig. 10. Effects of CORM-2 (3, 10 and 30 mg/kg, i.p.) pre- and concurrent treatment onthe relative fold changes in iNOS mRNA expression induced by DXR (20 mg/kg, i.p.,single dose) in heart of BalbC mice. Values are normalized using mouse beta-actin asinternal reference standard. All values are expressed as mean±SEM (n=4). (a)indicates pb0.05 vs. vehicle control group and (b) indicates pb0.05 vs. vehicle+DXR-treated group.

Fig. 11. Effects of CORM-2 (3,10 and 30 mg/kg, i.p.) pre- and concurrent treatment onthe relative fold changes in HIF-1 alpha mRNA expression induced by DXR (20 mg/kg, i.p., single dose) in heart of BalbC mice. Values are normalized using mouse beta-actin asinternal reference standard. All values are expressed as mean±SEM (n=4). (a)indicates pb0.05 vs. vehicle control group and (b) indicates pb0.05 vs. vehicle+DXR-treated group.

78 H. Soni et al. / Toxicology and Applied Pharmacology 253 (2011) 70–80

serum CK and LDH in CORM-2+DXR-treated groups as compared toDXR alone. To more directly explore whether the protective effects ofCORM-2 against DXR-induced cardiotoxicity were related to actions ofCORM-2 on stress responsive enzymes, we measured TAS and MDAlevels in heart tissue. We found that there was significant increase inantioxidant status and significant decrease in MDA content in CORM-2+DXR-treated hearts as compared to DXR alone. Importantly, theprotection against DXR-related injury by higher dose of CORM-2 inour studies might be related to CORM-2 exposure before DXRadministration.

Fig. 12. Effects of CORM-2 (3,10 and 30 mg/kg, i.p.) pre- and concurrent treatment on therelative fold changes in VEGF mRNA expression induced by DXR (20 mg/kg, i.p., singledose) in heart of BalbC mice. Values are normalized using mouse beta-actin as internalreference standard. All values are expressed as mean±SEM (n=4). (a) indicates pb0.05vs. vehicle control group and (b) indicates pb0.05 vs. vehicle+DXR-treated group.

Enhancement of erythropoietic activity occurs when an organismis subjected to higher altitudes or to atmospheres containing CO orwhen injected with androgens or cobalt. Higher erythropoieticactivity under these conditions is essentially a response to a feedbackmechanism of the kidney that monitors tissue pO2 which ultimatelyincrease in RBC production in the bone marrow. This response can bequantified by measurement of the HCT over a period of time. Vincent(1980) has indicated that 2000-ppm CO elicits an increase in HCT,starting on the fifth day of treatment and continuing until 16treatment days. Similarly, Rochetaing et al. (2001) have also reportedthat adaptation of rats to subchronic CO exposure (600 ppm for2 weeks) significantly increased heart weight (0.782±0.030 g incontrol group and 1.063±0.034 g in CO 600 ppm group) and the HCTvalues (43.4±0.9% in control group and 67.9±0.5% in CO 600 ppmgroup). Report from Albright et al. (2005) indicated that DXR-treatedmice showed a dramatic decrease in reticulocytes (short-livedprecursors of RBC). Therefore, we performed the analysis ofhematological parameters such as RBC, Hb, HCT and reticulocytecount in blood obtained before excising mouse hearts. CORM-2+DXRhave been shown to produce a significant increase of the RBC, Hb andHCT. Likewise, there was higher percentage of reticulocytes in CORM-2+DXR group as compared to DXR group.

The mechanism for DXR-induced apoptosis is unclear, but DXRalso strongly increased ROS, a known trigger of apoptosis. Mitochon-drial dysfunction can lead to the release of mitochondrial cytochromec into the cytoplasm. Cytochrome c may then form a complex calledthe apoptosome that activates caspase-3 (cysteine-dependent, aspar-tate-specific proteases-3), a key cell death protease (Jang et al., 2004).DXR treatment-induced alterations in cardiac morphology that werealso associated with elevated caspase-3 activity and DNA laddering,supporting cardiomyocyte apoptosis as seen in our in vivo studies.These effects of DXR were largely reversed by CORM-2 treatment atthe dose of 30 mg/kg when CORM-2 was added before DXR.Conversely, CORM-2 had no effect in absence of DXR could resultdue to b1 min half life of CORM-2 (Motterlini and Otterbein, 2010).

CO is known to stimulate mitochondrial heme release, whichincreases HO-1 expression and endogenous CO generation (Cronjeet al., 2004). CORM-2 or the CO it releases could induce the expressionofHO-1. Indeed, an earlier study by Sawle et al. (2005) demonstrated theability of CORM-2 (50 and 100 μM) to induce HO-1 protein expressionand activity in murine RAW264.7 macrophages. Although CORM-2treatmentmay activatemultiple signalingpathways,we focusedonHO-1 because of its profound antiapoptotic actions via regulating many keyproteins involved in cell survival. We found that CORM-2 treatmentsignificantly increased HO-1 mRNA expression in DXR-treated mousehearts. Therefore, our results support the conclusion that CORM-2protect against DXR-induced cardiotoxicity by activatingHO-1 signalingcascade, leading to reduced cardiomyocyte apoptosis. Increased iNOSexpression and nitrotyrosine formationhave been observed 5 days aftera single dose of DXR in mice cardiomyocyte (Mihm et al., 2002). Whilethe basal production of NO via constitutive NOS isoforms in cardio-myocytes modulates ventricular contractility and blood flow distribu-tion (Varin et al., 1999), higher NO production via iNOS, is associatedwith severe cardiac lesions such as dilated cardiomyopathy andcongestive heart failure (Haywood et al., 1996). High concentrationsof NOparticipate in cardiomyocyte oxidative damage, apoptosis, and/ornecrosis through peroxynitrite formation (Adams et al., 1999). DXRpromotes the synthesis of NO and ROS, such as the superoxide anion.The reaction of NO and superoxide anion leads to the synthesis ofperoxynitrite which is a potent cellular oxidant that contributessignificantly to DXR-induced cardiac dysfunction (Weinstein et al.,2000). Megías et al. (2007) reported that a 30-min preincubation ofA549 cells with CORM-2 followed by incubation with a combination ofinterleukin (IL)-1b, tissue necrosis factor (TNF)-α and interferon (IFN)-γ reduces the expression of iNOS, IL-6, IL-8 and matrix metalloprotei-nase (MMP)-7 via modulation of the transcription factors NF-kB,

79H. Soni et al. / Toxicology and Applied Pharmacology 253 (2011) 70–80

activator protein-1 and CCAT/enhancer-binding protein. Several otherstudies have reported inhibition of iNOS expression by either CO orCORM-2 itself (Yang et al., 2004, Srisook et al., 2006). Nevertheless, thisissue certainly requires further investigation. Using mRNA expressionanalysis of iNOS inmouseheart tissues,we found significantly increasedmRNA levels of iNOS in cardiac tissue after DXR treatment whencompared with the control group and this has also been reported byothers (Andreadou et al., 2007; Liu et al., 2006). In our study we haveobserved that there was significant increase in iNOS expression by DXRtreatment and treatment with CORM-2 abrogated this effect, which isalso correlated with our histopathological findings.

One of the primary pathways for sensing and responding to low O2

concentrations is the hypoxia-inducible factor (HIF) pathway. HIF is aheterodimer of a constitutively expressed and stable HIF beta subunit(HIF-1beta, HIF-2 beta, or HIF-3 beta) with a labile HIF alpha subunit(HIF-1 alpha, HIF-2 alpha or HIF-3 alpha) (Kaelin, 2005). Among thegenes that are regulated by HIF-1 alpha is HO-1 (Lee et al., 1997). Thekinetics of HO-1 catalysis under hypoxic conditions appears to favorgeneration of CO over NO (Rengasamy and Johns, 1996). The signalingpathways stimulated subsequent toHO-1 expression or by CO exposurehave been examined extensively (Brouard et al., 2000; Otterbein et al.,2000). Cardioprotective effects of HIF-1α subunit were recently shownto be dependent on HO-1 activity (Czibik et al., 2009). Up-regulation ofHIF-1α expressionbyCOhasbeendemonstrated earlier inmacrophagesin vitro and in transplanted kidneys in vivo. In addition, CO protectedagainst I/R-injury in lungs and kidneys through activation andstabilization of HIF-1α (Chin et al., 2007). In our study, we found thatthere was no change in HIF-1 alpha expression in DXR-treated mouseheart but interestingly, there was increase in HIF-1 alpha expression inCORM-2+DXR-treated hearts, which indicate that increased HIF-1alpha may counteract the cardiotoxic effect of DXR or there might becrosstalk between HO-1 expression and HIF-1 alpha. We also believethat CORM-2, under some stimulus may cause HIF-1 alpha stabilizationand leading to erythropoiesis and may be angiogenesis. We observedthat there was increase in the hematological count and based onliterature evidence we hypothesized that it may be due to hypoxia-induced increase in endogenous EPO release by CORM-2 treatment.Westenbrink et al. (2007) demonstrated that EPO treatment markedlyincreases expression of VEGF in themyocardium. It is interesting to notethat HO-1 induction is implicated in VEGF-induced angiogenesis(Bussolati et al., 2004). Recently, a study by Deshane et al. (2007) alsodemonstrated that stromal cell-derived factor-1 (SDF-1) promotedangiogenesis and the function of endothelial progenitor cells (EPC)through a mechanism dependent on HO-1 expression. Although themolecular mechanisms underlying the induction of VEGF and SDF-1 byHO-1 or vice versa remain unclear, it is envisioned that HO-1 and theangiogenic factors can activate a positive-feedback circuit to amplifyneovascularization in adult tissues. It has also been demonstrated thatHO-1 promotes neovascularization in ischemic heart by coinduction ofVEGF and SDF-1 (Lin et al., 2008). Therefore, we have also analyzed themRNA levels of VEGF, a key angiogenic cytokine, in mouse heart. Weobserved that therewasno significant change inmRNA levels of VEGF inDXR-treated group. Interestingly, therewas significant change inmousehearts treated with CORM-2+DXR group similar to HIF-1 alpha. Theseresults also suggest that theremight be counter regulatory response dueto DXR treatment or it may be HO-1-mediated increase in VEGF aspreviously reported by Lin et al. (2008).

In summary, CORM-2 protects the heart by antioxidant andantiapoptotic mechanisms. There was also elevation of antioxidantenzyme HO-1 and decrease in iNOS expression that may otherwisecause oxidative damage to the heart due to increase in ROS.Furthermore, CORM-2 also increases the O2 carrying capacity byincreasing RBC and likewise increase in Hb, HCT and reticulocytecount. This effect may be attributed to increase in the mRNA levels ofHIF-1 alpha. There was also increase in VEGF expression and mayprotect the heart. Result of our study is offering CO-releaser as

therapeutic approach for the prevention of DXR-induced cardiotoxi-city and its probable mechanism. Research in this area has been slowdue to regulatory and safety concerns associated with human trials.An ongoing phase II trial has addressed the safety of inhaled COduring renal transplantation (Clinicaltrials.gov #NCT00531856). CO-releasing molecules may provide an additional therapeutic approach.Whether pharmacologic administration of CORM will provide a safeand effective modality for the treatment of human disease requiresfurther research directed at understanding the pharmacokinetics andtoxicology in humans.

Conflict of interest statement

The authors declare no conflict of interest.

Acknowledgments

Authors thank management of Zydus Research Centre for allsupport.

References

Adams, V., Jiang, H., Yu, J., Möbius-Winkler, S., Fiehn, E., Linke, A., Weigl, C., Schuler, G.,Hambrecht, R., 1999. Apoptosis in skeletal myocytes of patients with chronic heartfailure is associated with exercise intolerance. J. Am. Coll. Cardiol. 33, 959–965.

Albright, C.F., Graciani, N., Han, W., Yue, E., Stein, R., Lai, Z., Diamond, M., Dowling, R.,Grimminger, L., Zhang, S.Y., Behrens, D., Musselman, A., Bruckner, R., Zhang, M.,Jiang, X., Hu, D., Higley, A., Dimeo, S., Rafalski, M., Mandlekar, S., Car, B.,Yeleswaram, S., Stern, A., Copeland, R.A., Combs, A., Seitz, S.P., Trainor, G.L., Taub,R., Huang, P., Oliff, A., 2005. Matrix metalloproteinase-activated doxorubicinprodrugs inhibit HT1080 xenograft growth better than doxorubicin with lesstoxicity. Mol. Cancer Ther. 4, 751–760.

Andreadou, I., Sigala, F., Iliodromitis, E.K., Papaefthimiou, M., Sigalas, C., Aligiannis, N.,Savvari, P., Gorgoulis, V., Papalabros, E., Kremastinos, D.T., 2007. Acute doxorubicincardiotoxicity is successfully treated with the phytochemical oleuropein throughsuppression of oxidative and nitrosative stress. J. Mol. Cell. Cardiol. 42, 549–558.

Bani-Hani, M.G., Greenstein, D., Mann, B.E., Green, C.J., Motterlini, R., 2006. Modulationof thrombin-induced neuroinflammation in BV-2 microglia by carbon monoxide-releasing molecule 3. J. Pharmacol. Exp. Ther. 318, 1315–1322.

Brouard, S., Otterbein, L.E., Anrather, J., Tobiasch, E., Bach, F.H., Choi, A.M., Soares, M.P.,2000. Carbon monoxide generated by heme oxygenase 1 suppresses endothelialcell apoptosis. J. Exp. Med. 192, 1015–1026.

Bussolati, B., Ahmed, A., Pemberton, H., Landis, R.C., Di Carlo, F., Haskard, D.O., Mason, J.C.,2004. Bifunctional role for VEGF-induced heme oxygenase-1 in vivo: induction ofangiogenesis and inhibition of leukocytic infiltration. Blood 103, 761–766.

Childs, A.C., Phaneuf, S.L., Dirks, A.J., Phillips, T., Leeuwenburgh, C., 2002. Doxorubicintreatment in vivo causes cytochrome C release and cardiomyocyte apoptosis, aswell as increased mitochondrial efficiency, superoxide dismutase activity, and Bcl-2:Bax ratio. Cancer Res. 62, 4592–4598.

Chin, B.Y., Jiang, G., Wegiel, B., Wang, H.J., Macdonald, T., Zhang, X.C., Gallo, D.,Cszimadia, E., Bach, F.H., Lee, P.J., Otterbein, L.E., 2007. Hypoxia-inducible factor 1alpha stabilization by carbon monoxide results in cytoprotective preconditioning.Proc. Natl Acad. Sci. U.S.A. 104, 5109–5114.

Cronje, F.J., Carraway, M.S., Freiberger, J.J., Suliman, H.B., Piantadosi, C.A., 2004. Carbonmonoxide actuates O(2)-limited heme degradation in the rat brain. Free Radic. Biol.Med. 37, 1802–1812.

Czibik, G., Sagave, J., Martinov, V., Ishaq, B., Sohl, M., Sefland, I., Carlsen, H., Farnebo, F.,Blomhoff, R., Valen, G., 2009. Cardioprotection by hypoxia-inducible factor 1 alphatransfection in skeletal muscle is dependent on haem oxygenase activity in mice.Cardiovasc. Res. 82, 107–114.

Delpy, E., Hatem, S.N., Andrieu, N., de Vaumas, C., Henaff, M., Rucker-Martin, C.,Jaffrezou, J.P., Laurent, G., Levade, T., Mercadier, J.J., 1999. Doxorubicin induces slowceramide accumulation and late apoptosis in cultured adult rat ventricularmyocytes. Cardiovasc. Res. 43, 398–407.

den Hartog, G.J., Haenen, G.R., Boven, E., Wan der Vijgh,, W.J., Bast, A., 2004. Lecithinizedcopper, zinc-superoxide dismutase as a protector against doxorubicin-inducedcardiotoxicity in mice. Toxicol. Appl. Pharmacol. 194, 180–188.

Deshane, J., Chen, S., Caballero, S., Grochot-Przeczek, A., Was, H., Li Calzi, S., Lach, R.,Hock, T.D., Chen, B., Hill-Kapturczak, N., Siegal, G.P., Dulak, J., Jozkowicz, A., Grant,M.B., Agarwal, A., 2007. Stromal cell-derived factor promotes angiogenesis via aheme oxygenase-1dependent mechanism. J. Exp. Med. 204, 605–618.

Fujimoto, H., Ohno,M., Ayabe, S., Kobayashi, H., Ishizaka, N., Kimura, H., Yoshida, K., Nagai, R.,2004. Carbon monoxide protects against cardiac ischemia-reperfusion injury in vivo viaMAPK and Akt-eNOS pathways. Arterioscler. Thromb. Vasc. Biol. 24, 1848–1853.

Haywood,G.A., Tsao, P.S., von der Leyen, H.E.,Mann,M.J., Keeling, P.J., Trindade, P.T., Lewis,N.P., Byrne, C.D., Rickenbacher, P.R., Bishopric, N.H., Cooke, J.P., McKenna,W.J., Fowler,M.B., 1996. Expression of inducible nitric oxide synthase in human heart failure.Circulation 15, 1087–1094.

80 H. Soni et al. / Toxicology and Applied Pharmacology 253 (2011) 70–80

Jang, Y.M., Kendaiah, S., Drew, B., Phillips, T., Selman, C., Julian, D., Leeuwenburgh, C.,2004. Doxorubicin treatment in vivo activates caspase-12 mediated cardiacapoptosis in both male and female rats. FEBS Lett. 577, 483–490.

Kaelin Jr., W.G., 2005. Proline hydroxylation and gene expression. Annu. Rev. Biochem.74, 115–128.

Khaleduzzaman, M., Francis, J., Corbin, M.E., McIlwain, E., Boudreaux, M., Du, M.,Morgan, T.W., Peterson, K.E., 2007. Infection of cardiomyocytes and induction of leftventricle dysfunction by neurovirulent polytropic murine retrovirus. J. Virol. 81,12307–12315.

Khaw, B.A., Silva, J.D., Petrov, A., Hartner, W., 2002. Indium 111 antimyosin and Tc-99mglucaric acid for noninvasive identification of oncotic and apoptotic myocardialnecrosis. J. Nucl. Cardiol. 9, 471–481.

Kim, J.W., Jin, Y.C., Kim, Y.M., Rhie, S., Kim, H.J., Seo, H.G., Lee, J.H., Ha, Y.L., Chang, K.C.,2009. Daidzein administration in vivo reduces myocardial injury in a rat ischemia/reperfusion model by inhibiting NF-kappaB activation. Life Sci. 84, 227–234.

Kopf, P.G., Huwe, J.K., Walker, M.K., 2008. Hypertension, cardiac hypertrophy, andimpaired vascular relaxation induced by 2,3,7,8-tetrachlorodibenzo-p-dioxin areassociated with increased superoxide. Cardiovasc. Toxicol. 8, 181–193.

Lee, P.J., Jiang, B.H., Chin, B.Y., Iyer, N.V., Alam, J., Semenza, G.L., Choi, A.M., 1997.Hypoxia-inducible factor-1 mediates transcriptional activation of the hemeoxygenase-1. J. Biol. Chem. 272, 5375–5381.

Li, K., Sung, R.Y., Huang,W.Z., Yang, M., Pong, N.H., Lee, S.M., Chan, W.Y., Zhao, H., To, M.Y.,Fok, T.F., Li, C.K., Wong, Y.O., Ng, P.C., 2006. Thrombopoietin protects against in vitroand in vivo cardiotoxicity induced by doxorubicin. Circulation 113, 2211–2220.

Lin, H.H., Chen, Y.H., Chang, P.F., Lee, Y.T., Yet, S.F., Chau, L.Y., 2008. Heme oxygenase-1promotes neovascularization in ischemic heart by co-induction of VEGF and SDF-1.J. Mol. Cell. Cardiol. 45, 44–55.

Liu, B., Li, H., Qu, H., Sun, B., 2006. Nitric oxide synthase expressions in ADR-inducedcardiomyopathy in rats. J. Biochem. Mol. Biol. 39, 759–765.

Megías, J., Busserolles, J., Alcarez, M.J., 2007. The carbon monoxidereleasing moleculeCORM-2 inhibits the inflammatory response induced by cytokines in Caco-2 cells.Br. J. Pharmacol. 150, 977–986.

Mihm,M.J., Yu, F.,Weinstein, D.M., Reiser, P.J., Baner, J.A., 2002. Intracellular distribution ofperoxynitrite during doxorubicin cardiomyopathy: evidence for selective impairmentof myofibrillar creatine kinase. Br. J. Pharmacol. 135, 581–588.

Motterlini, R., Mann, B.E., Johnson, T.R., Clark, J.E., Foresti, R., Green, C.J., 2003.Bioactivity and pharmacological actions of carbon monoxide-releasing molecules.Curr. Pharm. Des. 9, 2525–2539.

Motterlini, R., Otterbein, L.E., 2010. The therapeutic potential of carbon monoxide. Nat.Rev. Drug Discov. 9, 728–743.

Musameh, M.D., Fuller, B.J., Mann, B.E., Green, C.J., Motterlini, R., 2006. Positive inotropiceffects of carbon monoxide-releasing molecules (CO-RMs) in the isolated perfusedrat heart. Br. J. Pharmacol. 149, 1104–1112.

Musameh, M.D., Green, C.J., Mann, B.E., Motterlini, R., Fuller, B.J., 2010. CO liberatedfrom a carbon monoxide-releasing molecule exerts a positive inotropic effect indoxorubicin-induced cardiomyopathy. J. Cardiovasc. Pharmacol. 55, 168–175.

Myers, C.E.,McGuire,W.P., Liss, R.H., Ifrim, I., Grotzinger, K., Young, R.C., 1977. Adriamycin: therole of lipid peroxidation in cardiac toxicity and tumor response. Science 197, 165–167.

Otterbein, L.E., Bach, F.H., Alam, J., Soares, M., Tao Lu, H., Wysk, M., Davis, R.J., Flavell, R.A.,Choi, A.M., 2000. Carbon monoxide has anti-inflammatory effects involving themitogen-activated protein kinase pathway. Nat. Med. 6, 422–428.

Otterbein, L.E., Soares, M.P., Yamashita, K., Bach, F.H., 2003a. Heme oxygenase-1:unleashing the protective properties of heme. Trends Immunol. 24, 449–455.

Otterbein, L.E., Zuckerbraun, B.S., Haga, M., Liu, F., Song, R., Usheva, A., Stachulak, C.,Bodyak, N., Neil Smith, R., Czismadia, E., Tyagi, S., Akamatsu, Y., Flavell, R.J., Billiar,T.R., Tzeng, E., Bach, F.H., Choi, A.M.K., Soares, M.P., 2003b. Carbon monoxidesuppresses arteriosclerotic lesions associated with chronic graft rejection andwith balloon injury. Nat. Med. 9, 183–190.

Pacher, P., Liaudet, L., Bai, P., Mabley, J.G., Kaminski, P.M., Virág, L., Deb, A., Szabó, E.,Ungvári, Z., Wolin, M.S., Groves, J.T., Szabó, C., 2003. Potent metalloporphyrinperoxynitrite decomposition catalyst protects against the development ofdoxorubicin-induced cardiac dysfunction. Circulation 107, 896–904.

Piantadosi, C.A., Carraway, M.S., Suliman, H.B., 2006. Carbon monoxide, oxidative stress,andmitochondrial permeability pore transition. Free Radic. Biol. Med. 40, 1332–1339.

Rengasamy, A., Johns, R.A., 1996. Determination of Km for oxygen of nitric oxidesynthase isoforms. J. Pharmacol. Exp. Ther. 276, 30–33.

Rochetaing, A., Barbé, C., Kreher, P., 2001. Acute ischemic preconditioning and highsubchronic CO exposure independently increase myocardial tolerance to ischemia.Inhal. Toxicol. 13, 1015–1032.

Sawle, P., Foresti, R., Mann, B.E., Johnson, T.R., Green, C.J., Motterlini, R., 2005. Carbonmonoxide-releasing molecules (CO-RMs) attenuate the inflammatory responseelicited by lipopolysaccharide in RAW264.7 murine macrophages. Br. J. Pharmacol.145, 800–810.

Sawyer, D.B., Fukazawa, R., Arstall, M.A., Kelly, R.A., 1999. Daunorubicin-induced apoptosisin rat cardiac myocytes is inhibited by dexrazoxane. Circ. Res. 84, 257–265.

Schlame, M., Rua, D., Greenberg, M.L., 2000. The biosynthesis and functional role ofcardiolipin. Prog. Lipid Res. 39, 257–288.

Singal, P.K., Iliskovic, N., 1998. Doxorubicin-induced cardiomyopathy. N. Engl. J. Med.339, 900–905.

Soni, H., Patel, P., Rath, A.C., Jain, M., Mehta, A.A., 2010. Cardioprotective effect withcarbon monoxide releasing molecule-2 (CORM-2) in isolated perfused rat heart:role of coronary endothelium and underlying mechanism. Vascul. Pharmacol. 53,68–76.

Srisook, K., Han, S.S., Choi, H.S., Li, M.H., Ueda, H., Kim, C., Cha, Y.N., 2006. CO fromenhanced HO activity or from CORM-2 inhibits both O2- and NO production anddownregulates HO-1 expression in LPSstimulated macrophages. Biochem. Phar-macol. 71, 307–318.

Suliman, H.B., Carraway, M.S., Ali, A.S., Reynolds, C.M., Welty-Wolf, K.E., Piantadosi, C.A.,2007. The CO/HO system reverses inhibition of mitochondrial biogenesis andprevents murine doxorubicin cardiomyopathy. J. Clin. Invest. 117, 3730–3741.

Takemura, G., Fujiwara, H., 2007. Doxorubicin-induced cardiomyopathy from thecardiotoxic mechanisms to management. Prog. Cardiovasc. Dis. 49, 330–352.

Tenhunen, R., Marver, H.S., Schmid, R., 1968. The enzymatic conversion of heme tobilirubin by microsomal heme oxygenase. Proc. Natl Acad. Sci. U.S.A. 61, 748–755.

Varin, R., Mulder, P., Richard, V., Tamion, F., Devaux, C., Henry, J.P., Lallemand, F.,Lerebours, G., Thuillez, C., 1999. Exercise improves flow-mediated vasodilation ofskeletal muscle arteries in rats with chronic heart failure: role of nitric oxide,prostanoids and oxidant stress. Circulation 99, 2951–2957.

Vera, T., Henegar, J.R., Drummond, H.A., Rimoldi, J.M., Stec, D.E., 2005. Protective effectof carbon monoxide-releasing compounds in ischemia-induced acute renal failure.J. Am. Soc. Nephrol. 16, 950–958.

Vincent, S.L., 1980. The effect of carbonmonoxide exposure on erythropoietic activity inthe Sprague–Dawley rat. Bios 51, 90–96.

Vulapalli, S.R., Chen, Z., Chua, B.H., Wang, T., Liang, C.S., 2002. Cardioselectiveoverexpression of HO-1 prevents I/R-induced cardiac dysfunction and apoptosis.Am. J. Physiol. Heart Circ. Physiol. 283, H688–H694.

Wagatsuma, A., Tamaki, H., Ogita, F., 2005. Expression of vascular endothelial growthfactor and its receptors in heart tissue following short-term swimming training. Int.J. Sport Health Sci. 3, 91–99.

Weinstein, D.M., Mihm, M.J., Bauer, A., 2000. Cardiac peroxynitrite formation and leftventricular dysfunction following doxorubicin treatment inmice. J. Pharmacol. Exp.Ther. 294, 396–401.

Westenbrink, B.D., Lipsic, E., van der Meer, P., van der Harst, P., Oeseburg, H., DuMarchie Sarvaas, G.J., Koster, J., Voors, A.A., van Veldhuisen, D.J., van Gilst, W.H.,Schoemaker, R.G., 2007. Erythropoietin improves cardiac function throughendothelial progenitor cell and vascular endothelial growth factor mediatedneovascularization. Eur. Heart J. 28, 2018–2027.

Yang, N.C., Lu, L.H., Kao, Y.H., Chau, L.Y., 2004. Heme oxygenase-1 attenuatesinterleukin-1beta-induced nitric oxide synthase expression in vascular smoothmuscle cells. J. Biomed. Sci. 11, 799–809.

Yet, S.F., Tian, R., Layne, M.D., Wang, Z.Y., Maemura, K., Solovyeva, M., Ith, B., Melo, L.G.,Zhang, L., Ingwall, J.S., Dzau, V.J., Lee, M.E., Perrella, M.A., 2001. Cardiac-specificexpression of heme oxygenase-1 protects against ischemia and reperfusion injuryin transgenic mice. Circ. Res. 89, 168–173.