bet inhibition induces apoptosis in aggressive b-cell ... · mscv-ires-gfp/nrasq61k was generated...

Small Molecule Therapeutics

BET Inhibition Induces Apoptosis in AggressiveB-Cell Lymphoma via Epigenetic Regulation ofBCL-2 Family MembersSimon J. Hogg1,2, Andrea Newbold1, Stephin J. Vervoort1, Leonie A. Cluse1,Benjamin P. Martin1, Gareth P. Gregory1,2,3, Marcus Lefebure1,2, Eva Vidacs1,Richard W. Tothill1, James E. Bradner4, Jake Shortt1,2,3,5, and Ricky W. Johnstone1,2

Abstract

Targeting BET bromodomain proteins using small moleculesis an emerging anticancer strategy with clinical evaluation of atleast six inhibitors now underway. Although MYC downregula-tion was initially proposed as a key mechanistic property of BETinhibitors, recent evidence suggests that additional antitumoractivities are important. Using the Em-Myc model of B-celllymphoma, we demonstrate that BET inhibition with JQ1 isa potent inducer of p53-independent apoptosis that occurs inthe absence of effects on Myc gene expression. JQ1 skews theexpression of proapoptotic (Bim) and antiapoptotic (BCL-2/BCL-xL) BCL-2 family members to directly engage the mito-chondrial apoptotic pathway. Consistent with this, Bim knock-

out or Bcl-2 overexpression inhibited apoptosis induction byJQ1. We identified lymphomas that were either intrinsicallyresistant to JQ1-mediated death or acquired resistance follow-ing in vivo exposure. Strikingly, in both instances BCL-2 wasstrongly upregulated and was concomitant with activation ofRAS pathways. Em-Myc lymphomas engineered to express acti-vated Nras upregulated BCL-2 and acquired a JQ1 resistancephenotype. These studies provide important information onmechanisms of apoptosis induction and resistance to BET-inhibition, while providing further rationale for the translationof BET inhibitors in aggressive B-cell lymphomas. Mol CancerTher; 15(9); 2030–41. �2016 AACR.

IntroductionThe bromodomain and extra-terminal domain (BET) family

members (BRD2, BRD3, BRD4, and BRDT) comprise a class ofepigenetic reader proteins, which bind acetylated lysine residueson histones to facilitate the recruitment of transcriptional elon-gation complexes (1). BRD4 is associated with almost all activepromoters and most active enhancers in both transformed andnontransformed cells (2). Loading of BRD4 onto "super-enhan-cers" drives oncogenic transcription programs in lymphoma,particularly where immunoglobulin gene switch translocationsare juxtaposed to cMYC (3). Thus, small-molecule BET-inhibitors

have been proposed as aMYC pathway–targeted therapeutic withpreclinical activity demonstrated in multiple myeloma, Burkittlymphoma, acute lymphoblastic lymphoma, diffuse large B-celllymphoma (DLBCL), and acute myelogenous leukemia (4–8).BRD4 may also function as a coactivator of MYC- and/or E2F-regulated genes and inhibition of BRD4 activity can affect theexpression of MYC-target genes independent of decreased MYCexpression (3). BET inhibitors also have activity inmodels ofMLL-rearranged AML where MYC is not the primary oncogenic driverand instead epigenetic modulation of cell-cycle regulators andapoptotic pathways were mechanistically implicated (8–12).Histone-independent roles for BET proteins are also relevant inlymphoma cell survival, as BRD4 chaperones acetylated RELA,augmenting NFkB signaling (13).

As BET inhibitors are now in active clinical development, thereis a pressing need to elucidate mechanisms of antineoplasticactivity to facilitate effective drug combination strategies and helppredict which patients are most likely to derive therapeutic gain.We therefore sought to interrogate determinants of apoptosisinduction by the prototypical thienodiazepine-based BET-inhib-itor, JQ1 (14), using a well-characterized and genetically tractablemurine model of aggressiveMyc-driven lymphoma (15). Consis-tent with previous reports, JQ1 potently induced cytostasis andapoptosis in Em-Myc lymphoma cells at on-target nanomolarconcentrations (16). Unexpectedly, however (and in contrast tohuman Burkitt lymphoma lines), JQ1 did not downregulatetransgenic cMyc transcription or protein in Em-Myc cells. Thus,the Em-Myc model provided a unique system for dissecting BET-inhibitor activity in MYC-driven malignancy where expression ofMYC ismaintainedwhenBRD4 is inhibited.We characterized this

1Gene Regulation Laboratory, Research Division, Peter MacCallumCancer Centre, Melbourne, Victoria, Australia. 2Sir Peter MacCallumDepartment of Oncology, The University of Melbourne, Parkville,Vic-toria, Australia. 3Monash Hematology, Monash Health, Clayton,Victo-ria, Australia. 4Department of Medical Oncology, Dana-Farber CancerInstitute, Boston, Massachusetts. 5School of Clinical Sciences at Mon-ash Health, Monash University, Clayton, Victoria, Australia.

Note: Supplementary data for this article are available at Molecular CancerTherapeutics Online (http://mct.aacrjournals.org/).

Current address for J.E. Bradner: Novartis Institutes for BioMedical Research,Cambridge, Massachusetts.

Corresponding Authors: Ricky Johnstone, Peter MacCallum Cancer Centre,Melbourne, 3000, Victoria, Australia. Phone: 613-8559-7133; Fax: 613-8559-5329; E-mail: [email protected]; and Jake Shortt,[email protected].

doi: 10.1158/1535-7163.MCT-15-0924

�2016 American Association for Cancer Research.

MolecularCancerTherapeutics

Mol Cancer Ther; 15(9) September 20162030

on September 9, 2020. © 2016 American Association for Cancer Research. mct.aacrjournals.org Downloaded from

Published OnlineFirst July 12, 2016; DOI: 10.1158/1535-7163.MCT-15-0924

http://mct.aacrjournals.org/

response as p53-independent and mediated by epigenetic mod-ulation of BCL-2 family proteins to activate the intrinsic mito-chondrial apoptotic pathway. Despite statistically significant pro-longation of survival, including p53-defective lymphomas, pro-gressive disease was observed with subsequent in vivo derivationof JQ1-resistant lymphoma. Mutational activation of RAS, as wellas perturbations of the balance between proapoptotic BIM andantiapoptotic BCL-2 family proteins mediated resistance to JQ1.These data indicate that MYC downregulation is not an absoluterequirement for BET-inhibitor activity, and that lesions antago-nizing the intrinsic apoptotic pathwaymay result in acquisition ofBET-inhibitor resistance in the clinic.

Materials and MethodsCell lines and reagents

Em-Myc lymphomaswere derived, cultured, and transplanted aspreviously described (17). Retroviral transduction of freshly iso-lated Em-Myc lymphomas used murine stem-cell virus-internalribosomal entry site-green fluorescence protein (MSCV-IRES-GFP) vectors according to standard techniques. MSCV-IRES-GFP/Bcl-2 was cloned as previously described (18). MSCV-IRES-GFP/NrasQ61K was generated by subcloning wild-typemurine Nras into the MSCV vector and performing site directedmutagenesis using the Agilent Quikchange II XL kit according tothe manufacturer's instructions. The Ramos cell line was pur-chased from the ATCC. The BL-41 and OPM2 cell lines werepurchased from Leibniz-Institut DSMZ (Braunschweig, Ger-many). All human cell lines were authenticated by the suppliersusing Short Tandem Repeat (STR) profiling, passaged for fewerthan 6 months after resuscitation, maintained at 5% CO2 andcultured in Gibco RPMI1640 supplemented with 10% FCS,penicillin (100 U/mL), and streptomycin (100 mg/mL). Etopo-side and doxorubicin were diluted from clinical pharmacy stock(Peter MacCallum Cancer Centre). (þ)-JQ1 (JQ1), IBET-151,IBET-762, Y803, and RVX-208 were provided by James Bradner(Dana Farber Cancer Institute, Boston, MA). Fedratinib waskindly provided by Sanofi-Aventis (Paris, France). For in vitro use,all small-molecule inhibitors were dissolved inDMSO to generatestock solution with a final concentration of 10 mmol/L.

In vitro apoptosis and cell-cycle analysisEm-Myc lymphoma cells (1–2 � 105) were incubated in the

presence of JQ1, or vehicle control (DMSO), for 24 hours beforeflow cytometric analysis of viability [assessed by Annexin-V andpropidium iodide (PI) positivity], and cell-cycle progression,assessed by nuclear DNA content (PI) staining as previouslydescribed (18). Loss of mitochondrial outer membrane potential(MOMP,%Delta Psi loss) was assessed by tetramethylrhodamineethylester (TMRE) staining as previously described (19). Datawere collectedon a FACSCanto IIflowcytometer (BDBiosciences)and analyzed using FlowJo Software, version 10.0.7 (Tree Star).

Western blottingWhole cells lysates from cultured cells or were prepared in ice-

cold immunoprecipitation lysis buffer (0.15 mol/L NaCl, 10mmol/L Tris-Cl, pH 7.4, 5 mmol/L EDTA and 1% Triton X-100) and supplemented with protease and phosphatase inhibi-tors (complete EDTA-free protease and phosSTOP inhibitor cock-tails, Roche Diagnostics). Lysates (20–50 mg) were separated on10% SDS polyacrylamide gels and electroblotted onto Immobi-

lon-P nylonmembranes (Millipore). Membranes were incubatedwith the following primary antibodies.

Hamster anti-Bcl-2 (clone 3F11, BD Biosciences), rabbit anti–Bcl-XL (Sana Cruz Biotechnology Inc.), rabbit anti–Mcl-1 (Rock-land Immunochemicals Inc.), mouse anti-HSP90 (clone AC88,Enzo Life Sciences Inc.), mouse anti–a-tubulin (Merck KGaA),mouse anti–b-actin (clone AC-74, Sigma-Aldrich). Rabbit anti-PARP (clone 46D11), rabbit anti–P-p44/42 MAPK Thr 208/Tyr204 (clone D13.14.4E), rabbit anti-cMyc were purchased fromCell Signaling Technology. All antibodies were incubated over-night at 4�C followed by subsequent incubation with horse-radish peroxidase–conjugated secondary antibodies (DAKO).Immunoreactive bands were visualized by enhanced chemilu-minescence (Amersham). All Western blots were repeated atleast three times.

Quantitative real-time PCRRNA was extracted from cell pellets using the Nucleospin RNA

ExtractionKit (Macherey-Nagel) as per themanufacturer's instruc-tions. cDNA was synthesized according to the manufacturer'sinstructions (Promega). Quantitative PCR analysis of sampleswas performed on the 7900HT Fast Real-Time PCR System(Applied Biosystems) with SYBR-green ROX mix (Agilent).GAPDH and L32 were used as the murine and human controlgenes, respectively. Primer sequences were:Mus musculus Mcl-1 F:GGTGCCTTTGTGGCCAAACACTTA R: ACCCATCCCAGCCTC-TTTGTTTGA, Mus musculus Bcl-2 F: ATGACTGAGTACCT-GAACCGGCAT R: GGGCCATATAGT TCCACAAAGGCA, Musmusculus Bcl-XL F: AAGCGTAGACAAGGAGATGCAGGT R: GCAT-TGTTCCCGTAGAGATCCACA,Mus musculus total MYC F: GGAC-GACGAGACCTTCATCAA R: CCAGCTTCTCTGAGACGAGCTT,Mus musculus endogenous MYC F: CAGCTCCTCCTCGAGTTAGR: TGAGGAAACGACGAGAACAG, Mus musculus transgenic PhiXMYC F: TCGAACAGCTTCGAAACTCTGGTG R: TTAAATCGAA-GTGGACTGCTGGCG, Mus musculus RN3 F: ATTTTGAGCG-CATTGTGTTGAGCR: GGGAGCATCTGGCGACTGTTC,Musmus-culus Bim F: GGATCGGAGACGAGTTCAACGAAA R:TTCAGC-CTCGCGGTAATCAT, Mus musculus GAPDH F: CCTTCATT-GACCTCAACTAC R: GGAAGGCCATGCCAGTGAGC, Homosapiens MYC F: GGACGACGAGACCTTCATCAA R: CCAGCTT-CTCTGAGACGAGCTT, Homo sapiens L32 F: TTCCTGGTCC-ACAATGTCAAG R: TTGTGAGCGATCTCGGCAC.

In vivo analysisThe Peter MacCallum Cancer Centre Animal Ethics Committee

approved all in vivo procedures in this study. C57BL/6 mice werepurchased from the Walter and Eliza Hall Institute (Melbourne,VIC). For transplantation of Em-Myc lymphomas in vivo, cohorts of6- to 8-week-old syngeneic C57BL/6mice were inoculated via tailvein injectionwith 1 to 4�105Em-Myc lymphoma cells. For in vivouse, JQ1 was reconstituted in 1 part DMSO to 9 parts 10% (w/v)Hydroxypropyl-b-cyclodextrin (HPBCD; Cyclodextrin Technolo-gies Development Inc.) in sterile water, or DMSO vehicle control.JQ1 was dosed at 50 mg/kg 5 days per week (5d/2d) via intra-peritoneal injection, commencing 3 days after lymphoma inoc-ulation, for a total of 5-weeks therapy or until treatment failure.For detection of GFP-positive cells, 10 mL whole blood wasincubated in 200 mL red cell lysis buffer (150 mmol/L NH4Cl,10 mmol/L KHCO3, 0.1 mol/L EDTA) and washed twice in ice-cold flow cytometry buffer (2% FCS and 0.02% NaN3 in PBS).Data were collected on a FACSCanto II flow cytometer (BD

JQ1 Mediates Apoptosis without Loss of Myc Expression

www.aacrjournals.org Mol Cancer Ther; 15(9) September 2016 2031




Biosciences) and analyzed using FlowJo Software, version 10.0.7(Tree Star). Full blood count analyses were performed on theCELL-DYN Sapphire Blood Analysis Instrument (AbbottLaboratories).

Whole-exome sequencing and analysisDNA was extracted using the DNeasy Blood and Tissue Kit

(Qiagen). Fragment-sequencing libraries were prepared and thenprocessed for exome capture using SureSelect Mouse All Exonchemistry (Agilent Technologies). Captured libraries weresequenced on Illumina HiSeq 2000 using a paired-end sequenc-ing strategy achieving approximately 100x average read depthover captured bases. Short-read sequence alignment and somaticvariant calling was done as previously described (20). Variantvalidation was performed by Sanger sequencing directly fromgDNA using BigDye terminator chemistry (Life Technologies,Thermo Fisher Scientific) and a custom oligonucleotide primerdesigned 30-prime of the target base. Primer sequence used wasMus musculus Nras R: TGGCAAATACACAGAGGAACC.

Statistical analysisStatistical analysis was performed using GraphPad Prism Soft-

ware, Version 6.0c.

ResultsJQ1 induces p53-independent apoptosis and cytostasis in Em-Myc lymphomas

JQ1 is a potent and selective BET bromodomain inhibitor witha kd of 49 to 190 nmol/L for BET bromodomain family members(14). To determine whether Em-Myc lymphomas were sensitive toBET bromodomain inhibition in vitro, we cultured a series ofindependently-derived lymphomas in increasing concentrationsof JQ1 for 24 hours before assessment of cell viability usingAnnexin-V/PI positivity (Fig. 1A–C). Dose-dependent inductionof cell death was evident in the majority (4/5) of Em-Myc lym-phomas. Importantly, we also identified a primary Em-Myc lym-phoma (#6066) with relative de novo resistance to JQ1 at con-centrations up to 1.5 mmol/L (Fig. 1A).

Defective p53 signaling mediates resistance to conventionalchemotherapeutics and is associated with poorer outcomes in thelymphoma clinic (21). To elucidate the requirement for p53-competence in JQ1-mediated apoptosis we also tested the sensi-tivity of Em-Myc lymphomas with defective p53 signaling. An Em-Myc lymphoma derived on a p53-null background (#3391) and asecond lymphoma bearing a previously characterized p53 muta-tion (#106; refs. 17, 22) were both as sensitive to JQ1 as a p53wild-type lymphoma (#4242; Fig. 1B), despite relative etoposideand doxorubicin resistance (Fig. 1D). Thus, JQ1 potently inducescell death in Em-Myc lymphomas that are chemoresistant due toloss or dysfunction of p53.

We next sought to confirm whether JQ1-induced cell deathoccurred via the intrinsic apoptotic pathway. In addition tophosphatidylserine exposure (assessed by Annexin-V staining;Fig. 1A–C), JQ1-treatment induced accumulation of sub-diploidDNA on propidium iodide nuclear staining (Fig. 1E) and mito-chondrial outer-membrane permeabilization (Fig. 1F). Further-more, JQ1 treatment potently induced proteolytic cleavage ofPARP as a downstreammarker of caspase activation (Fig. 1G). Toconfirm the phenotype is not limited to the JQ1 pharmacophore,we assessed apoptosis induction by a panel of structurally distinct

bromodomain inhibitors. Specifically, we showed proapoptoticactivity at on-target concentrations by JQ1, IBET-151, IBET-762,RVX-208, andY803 (OTX015/MK-8628) against Em-Myc lympho-ma cells in vitro (Supplementary Fig. S1A).

As these results implicated the intrinsic pathway of apoptosisinduction, we retrovirally expressed Bcl-2 as a means to preventmitochondrial permeabilization in lymphomas with primarysensitivity to JQ1. These Em-Myc MSCV-Bcl-2 lymphomas wererendered highly resistant to JQ1-induced mitochondrial permea-bilization (Fig. 1F) and apoptosis (Fig. 1H) compared with theirisogenic controls. In the absence of apoptosis induction, Em-MycMSCV-Bcl-2 lymphomas underwent G1 cell-cycle arrest (Fig. 1I).Further, we show ectopic retroviral expression of Bcl-2 in thehuman IG-cMYC translocatedmultiplemyeloma cell line, OPM2,abrogates JQ1-induced apoptosis (Supplementary Fig. S1B–S1D). Thus, BET-inhibition mediates apoptosis in human andmouse multiple myeloma and lymphoma cells that can beinhibited by forced expression of Bcl-2.

JQ1-induced apoptosis occurs despite maintained Mycexpression

The Em-Myc model of aggressive B-cell lymphoma/leukemiawas generatedwith a transgene that juxtaposesmurine cMyc to theimmunoglobulin Em-enhancer element to generate a B-cell–restricted tumor (15). Analogous switch translocations of thecMYC locus occur in Burkitt lymphoma, subgroups of diffuselarge B-cell lymphoma and multiple myeloma. Initial descrip-tions of BET-inhibition in IG-cMYC–translocated lymphoidmalignancies reported specific downregulation of cMYC andcMYC-associated transcriptional programs (4). We thereforeanticipated that JQ1's activity in the Em-Myc model would bemediated by transcriptional downregulation of cMyc. Unexpect-edly, no reductions in cMyc transcript were detected followingtreatment with pro-apoptotic concentration of JQ1 (1 mmol/L)over a time course corresponding to apoptosis induction in asensitive lymphoma (Fig. 2A). Furthermore, JQ1 did not down-regulate theMyc-target gene, Rn3 (Fig. 2B; ref. 23). In contrast, thehuman IG-cMYC-translocated Burkitt lymphoma cell lines, BL-41and Ramos, ormultiplemyeloma cell line, OPM2, showed robustsuppression of MYC mRNA levels within 2 hours of drug treat-ment (Fig. 2C). In these human lines, BET-inhibition displacesBRD4 from endogenous immunoglobulin-associated super-enhancers brought into play by the chromosomal translocation(3). Theorchestrated expressionofMyc from theEm-Myc transgenemay not accurately reflect this pathophysiology, providing anexplanation for these divergent observations. To investigatewhether the epigenetic regulation of transgenic Myc expressionin Em-Myc lymphomaswas differentially regulated comparedwithendogenous expression programs, we designed distinct primersets specific for the Em-Myc transgene (by flanking the PhiXbacteriophage region adjacent to transgenicMyc), and the endog-enous Myc loci, respectively. As expected, significantly higherexpression of the Em-Myc transgene–derived Myc transcript com-pared with endogenous Myc transcript was observed, with anaverage ratio of 340:1 (Fig. 2D). Endogenous, but not transgenicMyc transcript was suppressed by JQ1-treatment in Em-Myc lym-phoma cells (Fig. 2E and F). Thus, although JQ1 treatmentcompletely suppressed the expression of endogenous Myc (as isalso seen with human MYC in the context of immunoglobulinswitch translocations), there was no suppression of the Em-Myctransgene. Accordingly, because transgenic Myc expression

Hogg et al.

Mol Cancer Ther; 15(9) September 2016 Molecular Cancer Therapeutics2032




Figure 1.

JQ1 induces p53-independent apoptosis and cytostasis in Em-Myc lymphomas. A, independently derived Em-Myc lymphomas were cultured in vitro for 24 hoursin increasing concentrations of JQ1, or DMSO vehicle, and Annexin-V/PI positivity was assessed by flow cytometry. B, Em-Myc lymphomas derived on ap53-null background (p53 null) or bearing a previously characterized mutant p53 (p53 mut.) were cultured in vitro for 24 hours in increasingconcentrations of JQ1, or DMSO vehicle, and Annexin-V/PI positivity was assessed by flow cytometry. A representative p53 wild-type Em-Myc lymphoma(#4242) was used as a sensitive control. C, a representative FACS plot of p53 wild-type Em-Myc lymphoma #4242 treated with 250 nmol/L JQ1, or DMSO,or 24 hours and stained with Annexin-V (APC) and PI (FL3). D, representative p53 wild-type (WT) Em-Myc lymphomas (#6066) and p53-mutant or -nulllymphomas (#3391 and #106) were cultured in vitro for 24 hours in 80 nmol/L etoposide, 500 nmol/L doxorubicin, or DMSO vehicle and Annexin-V/PIpositivity was assessed by flow cytometry. E, Em-Myc lymphoma #4242 cultured in vitro for 24 hours in increasing concentrations of JQ1, or DMSO vehicle,and nuclear DNA content was assessed by PI staining and flow cytometry. F, Em-Myc lymphomas expressing Bcl-2 (#4242/Bcl-2 and#299/Bcl-2) or emptyvector (#4242.MSCV and#299.MSCV) were cultured in vitro for 24 hours in indicated concentrations of JQ1, or DMSO vehicle, and mitochondrial outermembrane permeabilization (MOMP) was assessed by TMRE staining. �� , P < 0.001 for comparison between Bcl-2 and empty vector at each concentrationof JQ1 (two-way ANOVA). G, representative Em-Myc lymphoma (#4242) was cultured in vitro for 16 hours in indicated concentrations of JQ1, or DMSOvehicle. Cell lysates were then prepared and separated by SDS-PAGE before immunoblotting for poly(ADP-ribose) polymerase (PARP). b-Tubulin wasused as a loading control. H, JQ1-sensitive Em-Myc lymphomas (#4242 and#299) were transduced with murine stem cell virus–expressing Bcl-2 or empty vectorcontrol (MSCV) cultured in vitro for 24 hours in increasing concentrations of JQ1, or DMSO vehicle, and Annexin-V/PI positivity was assessed by flowcytometry. �� , P < 0.01 and �� , P < 0.001 for comparison between Bcl-2 and empty vector at each concentration of JQ1 (two-way ANOVA). I, Em-Myclymphoma #4242 was transduced with murine stem cell virus–expressing Bcl-2 (#4242/Bcl-2) and cultured in vitro for 24 hours in increasing concentrationsof JQ1, or DMSO vehicle, and nuclear DNA content was assessed by PI staining and flow cytometry. For all experiments, error bars indicate � SEM forat least three independent experiments.






dominates in Em-Myc cells, MYC protein expression was notdownregulated before apoptosis induction (Fig. 2G). As previ-ously demonstrated, we confirmed that JQ1 treatment is associ-ated with loss of MYC protein expression in a human MYC-translocated multiple myeloma cell line, OPM2 (SupplementaryFig. S2A). However, BRD4-independent retroviral expression ofMYC in OPM2 cells did not completely suppress the induction ofapoptosis by JQ1 (Supplementary Fig. S2B). Consistent with ourdata in Em-Myc cells, these data suggest that apoptosis inductionby JQ1 is not dependent on loss ofMYC expression. Therefore, the

robust induction of apoptosis in Em-Myc lymphoma differsmech-anistically fromother experimental systemswhere decreasedMYCexpression appears to be important to mediate the biologicaleffects of BET inhibitors (4, 8, 24).

JQ1 directly modulates the ratio of proapoptotic andprosurvival BCL-2 family members

BCL-2 family members have previously been identified asbona fide BET protein–regulated genes and important mediatorsof the bromodomain inhibitor–induced apoptotic response in

Figure 2.

JQ1-induced cytostasis and apoptosis is independent from changes in Myc gene expression. A, total Myc and (B) RN3 mRNA expression in representativeEm-Myc lymphoma (#4242) was assessed following 2, 8, and 24 hours treatment in vitro with 1 mmol/L JQ1, or DMSO vehicle, using qRT-PCR. Transcript levelsare expressed as fold change compared with DMSO. C, total Myc mRNA expression in representative human IG-MYC translocated Burkitt lymphoma celllines (BL-41 and Ramos) and the OPM2 myeloma cell line was assessed following 2 hours treatment in vitro with 1 mmol/L JQ1, or DMSO vehicle, using qRT-PCR.Transcript levels are expressed as fold change compared with DMSO. D, apoptosis-protected Em-Myc lymphoma cells (#4242/Bcl-2) were cultured in vitroand Myc mRNA transcript derived from the Em-Myc transgene or the endogenous Myc locus was assessed, using qRT-PCR. Myc mRNA expression from (E) theendogenous Myc locus and (F) the Em-Myc transgene in apoptosis protected Em-Myc lymphoma cells (#4242/Bcl-2) following 2 and 8 hours treatment in vitrowith 1 mmol/L JQ1, or DMSO vehicle, using qRT-PCR. Transcript levels are expressed as fold change compared with DMSO. For all experiments, error barsindicate�SEM for at least three independent experiments. In all experiments � ,P<0.05; �� ,P<0.001; n.s., not significant, for indicated comparisons (Student t-test).G, Em-Myc lymphoma (#4242) cells were treated for indicated time points with 0.5 mmol/L JQ1. Cell lysates were then prepared and separated by SDS-PAGE beforeimmunoblotting for Myc. b-Actin was used as a loading control.

Hogg et al.





models of MLL-rearranged AML (9). Having demonstratedactivation of the intrinsic apoptotic pathway by JQ1 despitesustained Myc expression, we next assessed the capacity fordirect modulation of BCL-2 family members. Short exposuresto proapoptotic JQ1 concentrations significantly reduced Bcl-2and Bcl-XL mRNA with no effect on Mcl-1 mRNA levels (Fig.3A–C). Prosurvival BCL-2 proteins sequester proapoptoticBH3-only proteins, including BIM, thereby preventing BAX/BAK activation and induction of MOMP (25). In the context ofmalignant peripheral nerve-sheath tumors, genetic knockdownof BRD4 and treatment with JQ1 both potently induce theexpression of proapoptotic BIM (26). Moreover, BIM is regu-lated independently of p53 to augment apoptosis inMyc-drivenlymphomagenesis (27). Concurrent to Bcl-2 and Bcl-XL sup-pression, JQ1 treatment rapidly increased Bim transcription(Fig. 3D). To elucidate the functional importance of Bim inthe apoptotic response to JQ1, we treated two Em-Myc lympho-mas derived on a Bim-null background (#24 and #20). Thesedemonstrated high-level JQ1 resistance (up to 2 mmol/L) com-pared with a representative Bim wild-type control (#4242; Fig.3E). These Bim-deficient lymphomas do not have a generalantiapoptotic phenotype as they remain equally sensitive toetoposide, doxorubicin and non–BET-targeted therapeutics

[including PI3K inhibitor (ref. 17) and cyclin-dependent kinase(CDK) inhibitors (ref. 28); Fig. 3F]. Taken together with theresults presented in Fig. 1, these data indicate that JQ1-medi-ated apoptosis induction occurs due to a shift in the balance ofBCL-2 family proteins, favoring mitochondrial permeabiliza-tion via a relative excess of Bim to Bcl-2 and Bcl-XLtranscription.

JQ1 prolongs the survival of mice bearing Em-Myc lymphomaHaving demonstrated a capacity to induce p53-independent

apoptosis in vitro, we next assessed the efficacy of JQ1 in vivo. Inmice bearing established lymphoma with palpable lymphade-nopathy, a single 50 mg/kg dose of JQ1 induced a statisticallysignificant reduction in spleen weight and increased cell deathin explanted lymph nodes (Fig. 4A and B). Prolonged JQ1treatment delayed the outgrowth of lymphomas, as evidencedby reduced numbers of cells in leukemic phase (Fig. 4C) andimproved median survival (18 d vs. 34 d, P < 0.0001; 26 d vs.52 d, P < 0.0001 for #4242 and #299, respectively, Fig. 4D andE). Similar results were achieved in mice bearing etoposide-resistant lymphoma derived on a p53-null background (Fig.4F, 20 d vs. 33 d, P < 0.001). To substantiate our in vitroobservations that JQ1 mediates its activity via engaging theintrinsic apoptotic pathway, we next assessed its efficacy in the

Figure 3.

JQ1 directly modulates the ratio ofproapoptotic and prosurvival BCL-2family members. Bcl-2 (A), Bcl-xL (B),and Mcl-1 mRNA (C) expressions wereassessed by qRT-PCR in Em-Myclymphoma cells (#4242) followingin vitro culture, for 2, 6, and 12 hoursin the presence of JQ1 at indicatedconcentrations, or DMSO vehicle.Transcript levels are expressed as foldchange compared with DMSO-treated#4242. D, representative Em-Myclymphoma (#4242) cells were culturedin vitro for 2, 4, and 6 hourswith 1mmol/LJQ1, or DMSO vehicle, and Bim mRNAlevels were assessed by qRT-PCR.Transcript levels are expressed asfold change compared with DMSO. E,Em-Myc lymphomas derived on aBim-null background (#24 and #20) andrepresentative Bim wild-type Em-Myclymphoma (#4242) were culturedin vitro for 24 hours in increasingconcentrations of JQ1, or DMSO vehicle,and Annexin-V/PI positivity wasassessed by flow cytometry. F,representative p53 wild-type Em-Myclymphoma (#6066) and Em-Myclymphomas derived on a Bim-nullbackground (#24 and #20) werecultured in vitro for 24 hours in80 nmol/L etoposide, 500 nmol/Ldoxorubicin, or DMSO vehicle andAnnexin-V/PI positivity was assessedby flow cytometry. � , P < 0.05;�� , P < 0.01; �� , P < 0.001; n.s.,not significant.






context of Bcl-2 overexpression in vivo. Retroviral expression ofBcl-2 significantly abrogated the survival advantage conveyedby JQ1 (Fig. 4G; prolongation of median survival 4d #4242MSCV-Bcl-2, P < 0.001, vs. 16d for #4242 MSCV). ProlongedJQ1 treatment was well-tolerated in vivo and no significantchanges in body weight were observed (SupplementaryFig. S3A). Moreover, there was minimal hematological toxicitywith no significant changes in hemoglobin or neutrophils,although modest thrombocytopenia was observed (Supple-mentary Fig. S3B–S3D).

Disease progression and secondary JQ1 resistance is associatedwith Bcl-2 upregulation and RAS pathway activation

There has been much recent interest into mechanisms ofacquired resistance to BET inhibition, which has proven diffi-cult to engineer in vitro (29, 30). We observed universal treat-ment-failure despite ongoing dosing in mice bearing #4242lymphoma that was initially sensitive to JQ1 (Fig. 4D). Re-challenge of previously treated Em-Myc#4242 lymphomas(annotated JQ1R) with JQ1 demonstrated sustained drug resis-tance ex vivo compared with matched JQ1 na€�ve control(JQ1S; Fig. 5A). Re-transplantation of JQ1R and re-treatmentwith JQ1 in vivo according to the same schedule used for

parental lymphoma resulted in far inferior survival outcomes(Fig. 5B, prolongation of median survival 6d #4242 JQ1R, P <0.0001, vs. 16d for #4242 MSCV).

We used global RNA sequencing (RNA-seq) to investigatecompensatory transcriptional pathways being activated in JQ1-resistant cells (Supplementary Methods). These analyses iden-tified 108 genes that we were significantly up- or downregulatedin JQ1R cells, including Bcl-2 (Fig. 5C–E). As we hypothesizedaberrant regulation of the intrinsic apoptotic pathway–medi-ated resistance to JQ1, we compared differentially regulatedgenes (JQ1R vs. JQ1S, FDR < 0.05 and logFC > 1) to genesknown to regulate the intrinsic mitochondrial apoptotic path-way (Fig. 4F). This analysis demonstrated Bcl-2 as the onlyapoptosis-related gene differentially expressed that we havesubsequently validated using RT-PCR and immunoblot (Fig.5G and H). Bim induction was observed in JQ1S and JQ1R celllines following 16 hours of exposure to JQ1 at both the mRNAand protein level (Supplementary Fig. S4A–S4B); however,excess Bcl-2 likely buffers the increased Bim in JQ1R cells toprevent BAX/BAK activation and apoptosis induction. Gene setenrichment analyses (GSEA) was used to identify transcription-al programs differentially expressed in JQ1-resistant cells wherea KRAS expression signature was strongly correlated with

Figure 4.

JQ1 prolongs the survival of mice bearingEm-Myc lymphoma. Cohorts of C57Bl/6recipient mice (n¼ 4 per treatment group)were injected intravenously Em-Myclymphoma #4242 and allowed to developadvanced lymphadenopathy before asingle dose of JQ1 (50 mg/kg), or DMSOvehicle. Sixteen hours after treatment,spleen weights were recorded (A) andapoptosis in homogenized peripherallymph nodeswas assessed (B) byAnnexin-V/PI positivity using flow cytometry.Cohorts of C57Bl/6 recipient mice wereinjected intravenously Em-Myc lymphoma#4242 cells 3 days before commencementof JQ1 treatment (50 mg/kg/d) or DMSOvehicle. � ,P < 0.05; �� ,P <0.01 for indicatedcomparisons (Student t-test). C, thepercentage of GFP-expressing Em-Myclymphoma #4242 cells in the peripheralbloodwas assessed by flowcytometry as asurrogate marker of disease progression.��, P < 0.001 for day 17 comparisonbetween JQ1-treated and DMSO-treatedmice (Student t-test). Error bars indicate�SEM. Kaplan–Meier survival curvesrepresenting cohorts of C57BL/6mice (n¼10 per treatment group) transplanted withp53 competent Em-Myc lymphomas(D)#4242 or (E)#299 and treated daily withJQ1 or DMSO vehicle. F, Kaplan–Meiersurvival curves representing cohorts ofC57BL/6 mice transplanted with p53-nullEm-Myc lymphoma #3391 (n ¼ 6 pertreatmentgroup)andtreateddailywithJQ1or DMSO vehicle. G, Kaplan–Meier survivalcurve representing cohorts of C57BL/6mice (n ¼ 10 per treatment group)transplanted with Bcl-2–overexpressingEm-Myc lymphoma #4242/Bcl-2 andtreated daily with JQ1 or DMSO vehicle.

Hogg et al.





JQ1R cells (Fig. 5I). Therefore, despite initial significant(including p53 independent) disease responsiveness, sustainedJQ1 exposure leads to the emergence of resistant clones asso-

ciated with alterations in BCL-2 protein expression. This corre-lates with abrogation of in vivo activity by forced retroviralexpression of BCL-2.

Figure 5.

Disease progression and secondary JQ1resistance is associated with Bcl-2upregulation and RAS pathwayactivation. A, Em-Myc lymphoma JQ1Rwith acquired resistance to JQ1 washarvested from C57BL/6 mice bearing#4242 relapsing after JQ1 treatment(from Fig. 4D). Em-Myc lymphomasfrom JQ1-treated mice (JQ1R) and aDMSO vehicle–treated mouse (JQ1S)were cultured in vitro for 24 hours inincreasing concentrations of JQ1, orDMSO vehicle, and Annexin-V/PIpositivity was assessed by flowcytometry. B, Kaplan-Meier survivalcurves representing cohorts of C57BL/6 mice transplanted with JQ1-resistantEm-Myc lymphoma JQ1R (n ¼ 10 pertreatment group) and treated dailywithJQ1 or DMSO vehicle. RNA-seq analysisof JQ1R and JQ1S cells (C) volcano plotillustrating FC (log base 2) comparedwith a P value (�log base 10) betweenJQ1S and JQ1R (genes with a log 2 of FC>1 are shown in red). D, heat map ofdifferentially expressed genes in JQ1Sand JQ1R cells. Scale bars represent logfold change of each gene relative to theaverage gene expression across the 4samples. E, IGV screenshot of RNA-seqreadsmapped to the BCL2 locus in JQ1Sand JQ1R cells. F, Bcl-2 is the onlysignificantly (FDR < 0.05, logFC > 1)changed gene involved in apoptosis(AmiGO 2 term "intrinsic apoptosissignaling pathway"). The levels of Bcl-2,Bcl-XL, and Mcl-1 were shown at theprotein and mRNA levels by (G)immunoblot and (H) qRT-PCR,respectively. I, GSEA enrichment scoreplot of KRAS targets using significantlygenes differentially regulated in ourRNA-seq dataset.






RAS-pathway activation conveys primary resistance to JQ1Our initial experiments identified a lymphoma (#6066) with

de novo resistance to JQ1-induced apoptosis (#6066, Fig. 1A). Asseen with #4242 MSCV-Bcl2 lymphoma (Fig. 1I), a secondarycytostatic response was observed in the #6066 lymphoma thatwas resistant to apoptosis (Fig. 6A). However, the reducedapoptosis in the #6066 lymphoma was not explained by blunt-ing of the transcriptional upregulation of Bim following JQ1treatment (Fig. 6B). Overall survival in JQ1-treated mice bear-ing this lymphoma was poor (median survival 10d vs. 17d, P ¼0.0004, Fig. 6C) compared with prior experiments with lym-phomas demonstrating in vitro sensitivity (Fig. 4B and C).Consistent with p53-dependent mechanisms of apoptosisinduction by chemotherapy, the #6066 lymphoma has wild-type p53 expression and is sensitive to etoposide and doxoru-bicin in vitro (Fig. 1D). Interestingly, we also observed cross-resistance to the dual JAK-2/BET inhibitor (31), Fedratinib(Supplementary Fig. S5A). To elucidate this mechanism ofselective resistance to JQ1, we performed whole-exomesequencing of #6066 and identified somatic variants by com-parison with Em-Myc germline DNA. Notably, #6066 bears ahot-spot mutation of Nras (Q61K), evoking constitutive RASpathway activation (Fig. 6D). As RAS pathway activation con-veys resistance to apoptosis mediated via BCL-2 (32), wehypothesized that Nras activation mediated resistance to JQ1.To test this in an isogenic setting, the JQ1-sensitive, Nras wild-type lymphoma (#4242) was transduced with empty vector(MSCV-GFP) or MSCV-NrasQ61K resulting in constitutive RASpathway activation as evidenced by phosphorylation of MAPK(Fig. 6E). Like #6066 (bearing a spontaneous Nras mutation),4242 MSCV-NrasQ61K showed relative resistance to the apo-ptotic effects of JQ1 (Fig. 6F). Similarly, OPM2 cells transducedwith MSCV-NrasQ61K display increased phosphorylation ofMAPK and are more resistant to JQ1-induced apoptosis com-pared with the empty vector control (Supplementary Fig. S5B–S5C). Having demonstrated enrichment of a KRAS gene signa-ture and upregulation of Bcl-2 in JQ1R cells, we hypothesizedthat RAS activation in lymphoma cells may regulate the expres-sion of BCL-2 to convey resistance to JQ1. We show RAS-activation correlated with BCL-2 upregulation as evidenced byWestern blot (Fig. 6G) and reduced sensitivity to BH3-mimetictreatment (Fig. 6H). Thus, constitutive RAS pathway activationmediates resistance to the apoptotic effects of BET-inhibitionconcurrent with upregulation of BCL-2.

DiscussionInitial descriptions of targeted BET inhibition evoked much

interest, due in part to the opportunity of indirect targeting ofthe previously "undruggable" oncogene, cMYC (4). MYC acti-vation is relevant across the full spectrum of human cancers, andis of particular relevance to aggressive B-cell malignancy. In thatcontext, the presence of an isolated MYC translocation is nec-essary for the diagnosis of Burkitt lymphoma, with excellentoutcomes expected in patients fit for intensive chemoimmu-notherapy (33). Conversely, MYC translocations convey poorrisk in multiple myeloma (34). Despite intense clinical research,the prognostic significance of both MYC translocation and/orMYC overexpression at the protein level remains controversial inDLBCL. It is increasingly evident that it is not MYC overexpres-sion per se that determines DLBCL outcomes, rather its co-

occurrence with co-operating lesions (35). Of note, MYC plusBCL2 protein expression in the context of activated B-cell (ABC)subtype disease ("double expressors") or germinal center B-cellDLBCL with switch translocations of both MYC and BCL2("double hit" lymphomas; DHL), correlates with much worseoutcomes (36, 37).

Our mechanistic data using genetically defined Em-Myc lym-phomas confirms other reports of a preclinical efficacy signal forBET inhibitors in the context ofMYCdysregulation (4–6).We alsonow show that engagement of the intrinsic apoptotic pathway byp53-independent mechanisms is a critical determinant of BETinhibitor activity in the lymphoma setting. Our results highlightan important caveat in the extrapolationofmechanistic data usingepigenetically active drugs from transgenic animals to humantumors. Specifically, the epigenetic regulation of cMyc (and retro-virally expressed Bcl-2) is divergent between Em-Myc lymphomasand human IG-cMYC translocated disease. Of particular interest isthat despite complete insensitivity of transgenic cMyc to BET-inhibitor-mediated transcriptional downregulation, the majorityof lymphomas remain exquisitely sensitive to JQ1-evoked apo-ptosis. These data are consistent with the reported co-activatorfunction of BRD4 toMYC target gene expression (3), althoughourinitial analysis of Myc-target genes showed little or no change inexpression following JQ1 treatment. We also show that theepigenetic regulation of endogenously expressed BCL-2 familyproteins mediates the apoptotic response to BET-inhibition, prin-cipally due to a shift in the ratio of Bim to Bcl-2 and Bcl-XLtranscription. A previous study in MLL-rearranged AML demon-strated that BRD4 bound to a locus containing the transcriptionalstart site of the Bcl-2 gene and BET inhibitor treatment resulted indecreased binding of BRD4, CDK9, and Pol II within this regionand loss of phospho-Pol II and H3K4me3 transcriptional activa-tionmarks, concomitant with decreased Bcl-2 expression (9). Ourdata support the notion that Bcl-2 is a critical target gene of BRD4in tumors where Myc is the primer driver oncoprotein or insituations such as MLL-AF9-driven leukemia where MYC activityis an important secondary event (9). The functional and clinicalsignificance of our observations are further supported by thefinding that the antiapoptotic phenotype of constitutive RASexpression mediates primary resistance to JQ1, and that lympho-mas progressing on JQ1 therapy variably upregulate BCL-2 familyproteins.

Understanding mechanisms of BET-inhibitor activity willassist in the translation of clinical compounds to lymphomatrials. Through this study and others (3), it is apparent thattranscriptional downregulation of MYC is not a pre-requisite toBET-inhibitor efficacy in all tumor contexts. Though perturba-tions of the mitochondrial apoptotic pathway mediate sensi-tivity to BET-inhibition, it does not follow that the presence ofBCL-2 overexpression will always be a necessary predictor ofBET-inhibitor responses. Where BCL-2 lies downstream ofNFkB activation, for example, in ABC-subtype DLBCL, BRD4antagonismmay downregulate BCL2 transcription downstreamof RELA (38). Likewise, translocated BCL-2 expressed on BRD4-loaded superenhancers may be directly targeted by BET-inhi-bitors in DHL (39). Conversely, MCL-1–dependent lympho-mas, or those where BCL-2 is stabilized by RAS pathwayactivation are likely to resist BET-inhibitor induced apoptosis.Moreover, it is apparent that there are other mechanisms ofBET-inhibitor resistance in different tumor contexts. Two recentstudies reported concordant data supporting a role of activated

Hogg et al.





Figure 6.

RAS-pathway activation conveys primary resistance to JQ1. A, Em-Myc lymphoma #6066 cells were cultured in vitro for 24 hours in increasingconcentrations of JQ1, or DMSO vehicle, and nuclear DNA content was assessed by PI staining and flow cytometry. B, Em-Myc lymphoma #6066 cells werecultured in vitro for 6 hours with 1 mmol/L JQ1, or DMSO vehicle and Bim mRNA levels were assessed by qRT-PCR. Transcript levels are expressed asfold change compared with DMSO. � , P < 0.05 for the indicated comparisons (Student t-test). C, Kaplan–Meier survival curve representing cohorts ofC57BL/6 mice (n ¼ 10 per treatment group) transplanted with Em-Myc lymphoma #6066 and treated daily with JQ1 or DMSO vehicle. D, Sangersequencing chromatogram of Em-Myc lymphoma #6066 for NRAS confirms C-to-A point mutation at nucleotide 181 that corresponds to a Q61K missensemutation. E, Em-Myc lymphoma (#4242) cells were transduced with murine stem cell virus–expressing NRAS Q61K (4242/NRAS) or empty vectorcontrol (4242/MSCV). Cell lysates were prepared from Em-Myc lymphomas #4242/MSCV and #4242/NRAS and separated by SDS-PAGE beforeimmunoblotting for phosphorylated p44/42 MAPK (pERK1/2) expression. F, Em-Myc lymphomas #4242/MSCV and #4242/NRAS were cultured in vitro for24 hours in increasing concentrations of JQ1, or DMSO vehicle, and Annexin-V/PI positivity was assessed by flow cytometry. ��P < 0.01; �� , P < 0.001 forindicated comparisons between 4242/NRAS and 4242/MSCV (2-way ANOVA). G, Cell lysates were prepared from Em-Myc lymphomas #4242/MSCV,#4242/NRAS, and #6066 and separated by SDS-PAGE before immunoblotting for Bcl-2. H, Em-Myc lymphomas #4242/MSCV and #4242/NRAS werecultured in vitro for 24 hours in increasing concentrations of BH3-mimetic ABT-199, or DMSO vehicle, and Annexin-V/PI positivity was assessed byflow cytometry.






Wnt signaling in mediating resistance to BET inhibitor in MLL-rearranged AML (29, 30), whereas another study demonstratedthat in triple-negative breast cancer, resistance to JQ1 wasconferred by constitutive hyperphosphorylation of BRD4through decreased activity of PP2A (40).

Despite initial disease control, Em-Myc lymphomas progresswithin a short time-period on single-agent JQ1 therapy. Treat-ment failure is due at least in part to cell-autonomousmechanisms of resistance to BET inhibitor–evoked apoptosis,as explanted lymphomas exhibited in vitro resistance to JQ1.Moreover, re-transplant of these lymphomas to JQ1-na€�vemice resulted in attenuated therapeutic responses in vivo. Wetherefore predict that single-agent BET-inhibitor treatmentoutcomes will be limited by rapid emergence of resistantdisease in patients. The risk of BET-inhibitor resistance couldbe mitigated by treatment in low disease-burden states (e.g.,post-remission induction), or more likely by the rationalincorporation of drug combination therapy. Preliminary pre-clinical data suggest BET inhibitors may be effective in com-bination with BH3-mimetics directly engaging the mitochon-drial pathway, shown in the context of DHL, or drugs miti-gating prosurvival signaling downstream of RAS (e.g., PI3K orMEK), shown in the context of T-cell acute lymphocyticleukemia (41, 42).

Taken together, this study details the apoptotic proteins andpathways engaged by JQ1 to induce death of lymphoma cells, andprovides clear evidence that induction of apoptosis is critical forthe therapeutic effects of JQ1. Importantly, the molecular andbiological responses to JQ1occurred independently ofMycdown-regulation and were not reliant on an intact p53 pathway. Wedemonstrate that increased expression of BCL-2 through activa-tion of Nras or following initial exposure to JQ1 is sufficient toinduce drug resistance. These studies provide important informa-tion regarding the mechanisms of action of, and mechanisms ofresistance to JQ1 that are important for further clinical develop-ment of BET protein inhibitors.

Disclosure of Potential Conflicts of InterestJ.E. Bradner is President, NIBR at Novartis. No potential conflicts of interest

were disclosed by the other authors.

Authors' ContributionsConception and design: S.J. Hogg, A. Newbold, B.P. Martin, J. Shortt,R.W. JohnstoneDevelopment of methodology: S.J. Hogg, A. Newbold, B.P. Martin, M. Lefe-bure, J.E. Bradner, J. ShorttAcquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): S.J. Hogg, A. Newbold, S.J. Vervoort, L.A. Cluse,G.P. Gregory, M. Lefebure, E. Vidacs, R.W. TothillAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): S.J. Hogg, A. Newbold, S.J. Vervoort, B.P. Martin,G.P. Gregory, M. Lefebure, R.W. Tothill, J.E. Bradner, J. ShorttWriting, review, and/or revision of the manuscript: S.J. Hogg, A. Newbold,B.P. Martin, G.P. Gregory, R.W. Tothill, J. Shortt, R.W. JohnstoneAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): A. Newbold, B.P. Martin, E. VidacsStudy supervision: J. Shortt, R.W. Johnstone

AcknowledgmentsWe thank members of the Gene Regulation laboratory and Prof Mark

Dawson (Peter MacCallum Cancer Centre) for helpful comments, advice, andsuggestions.

Grant SupportThis work was supported by funding from the Leukemia Foundation of

Australia (to S.J. Hogg, A. Newbold, G.P. Gregory, andM. Lefebure), the CancerTherapeutics CRC (to S.J. Hogg and G.P. Gregory), the Royal AustralasianCollege of Physicians (toG.P. Gregory), and the Arrow BoneMarrowTransplantFoundation (toM. Lefebure). J. Shortt is supported by funding from the Eva andLes Erdi/ Snowdome Foundation Victorian Cancer Agency Fellowship, and theCancer Council Victoria. R.W. Johnstone is a senior principal research fellow(APP1077867) of the National Health and Medical Research Council ofAustralia (NHMRC) and is supported by an NHMRC program grant(APP454569), the Cancer Council Victoria and the Victorian Cancer Agency.

Received November 15, 2015; revised June 6, 2016; accepted June 22, 2016;published OnlineFirst July 12, 2016.

References1. Yang Z,HeN, ZhouQ. Brd4 recruits P-TEFb to chromosomes at latemitosis

to promote G1 gene expression and cell-cycle progression. Mol Cell Biol2008;28:967–76.

2. Lov�en J, Hoke HA, Lin CY, Lau A, Orlando DA, Vakoc CR, et al. Selectiveinhibition of tumor oncogenes by disruption of super-enhancers. Cell2013;153:320–34.

3. Chapuy B, McKeown MR, Lin CY, Monti S, Roemer MG, Qi J, et al.Discovery and characterizationof super-enhancer-associated dependenciesin diffuse large B cell lymphoma. Cancer Cell 2013;24:777–90.

4. Delmore JE, Issa GC, Lemieux ME, Rahl PB, Shi J, Jacobs HM, et al. BETbromodomain inhibition as a therapeutic strategy to target c-Myc. Cell2011;146:904–17.

5. Mertz JA, Conery AR, Bryant BM, Sandy P, Balasubramanian S, Mele DA,et al. Targeting MYC dependence in cancer by inhibiting BET bromodo-mains. Proc Natl Acad Sci U S A 2011;108:16669–74.

6. Ott CJ, Kopp N, Bird L, Paranal RM, Qi J, Bowman T, et al. BET bromo-domain inhibition targets both c-Myc and IL7R in high-risk acute lym-phoblastic leukemia. Blood 2012;120:2843–52.

7. Trabucco SE, Gerstein RM, Evens AM, Bradner JE, Shultz LD, Greiner DL,et al. Inhibition of bromodomain proteins for the treatment of humandiffuse large B-cell lymphoma. Clin Cancer Res 2015;21:113–22.

8. Zuber J, Shi J, Wang E, Rappaport AR, Herrmann H, Sison EA, et al. RNAiscreen identifies Brd4 as a therapeutic target in acute myeloid leukaemia.Nature 2011;478:524–8.

9. DawsonMA, Prinjha RK, Dittmann A, Giotopoulos G, Bantscheff M, ChanW-I, et al. Inhibition of BET recruitment to chromatin as an effectivetreatment for MLL-fusion leukaemia. Nature 2011;478:529–33.

10. WyceA,GanjiG, SmithemanKN,ChungC-w, Korenchuk S, Bai Y, et al. BETinhibition silences expression ofMYCN andBCL2 and induces cytotoxicityin neuroblastoma tumor models. PLoS ONE 2013;8:e72967.

11. Sun B, Shah B, Fiskus W, Qi J, Rajapakshe K, Coarfa C, et al. Synergisticactivity of BET protein antagonist-based combinations in mantle celllymphoma cells sensitive or resistant to ibrutinib. Blood 2015;126:1565–74.

12. Fiskus W, Sharma S, Qi J, Shah B, Devaraj SG, Leveque C, et al. BET proteinantagonist JQ1 is synergistically lethal with FLT3 tyrosine kinase inhibitor(TKI) and overcomes resistance to FLT3-TKI in AML cells expressing FLT-ITD. Mol Cancer Ther 2014;13:2315–27.

13. Huang B, Yang X-D, Zhou M-M, Ozato K, Chen L-F. Brd4 coactivatestranscriptional activation of NF-kB via specific binding to acetylated RelA.Mol Cell Biol 2009;29:1375–87.

14. Filippakopoulos P, Qi J, Picaud S, Shen Y, Smith WB, Fedorov O, et al.Selective inhibition of BET bromodomains. Nature 2010;468:1067–73.

15. Adams J, Harris A, Pinkert C, Corcoran L, Alexander W, Cory S, et al. The c-myc oncogene driven by immunoglobulin enhancers induces lymphoidmalignancy in transgenic mice. Nature 1984;318:533–8.

16. Bhadury J, Nilsson LM, Muralidharan SV, Green LC, Li Z, Gesner EM, et al.BET and HDAC inhibitors induce similar genes and biological effects and

Hogg et al.





synergize to kill inMyc-inducedmurine lymphoma. Proc Natl Acad Sci U SA 2014;111:E2721–E30.

17. Shortt J, Martin BP, Newbold A, Hannan KM, Devlin JR, Baker AJ, et al.Combined inhibition of PI3K-related DNA damage response kinases andmTORC1 induces apoptosis in MYC-driven B-cell lymphomas. Blood2013;121:2964–74.

18. Lindemann R, Newbold A, Whitecross K, Cluse L, Frew A, Ellis L, et al.Analysis of the apoptotic and therapeutic activities of histone deacetylaseinhibitors by using amousemodel of B cell lymphoma. Proc Natl Acad SciU S A 2007;104:8071–6.

19. Essmann F, Engels IH, Totzke G, Schulze-Osthoff K, J€anicke RU. Apoptosisresistance of MCF-7 breast carcinoma cells to ionizing radiation is inde-pendent of p53 and cell-cycle control but caused by the lack of caspase-3and a caffeine-inhibitable event. Cancer Res 2004;64:7065–72.

20. Li J, Doyle MA, Saeed I, Wong SQ, Mar V, Goode DL, et al. Bioinformaticspipelines for targeted resequencing and whole-exome sequencing ofhuman and mouse genomes: a virtual appliance approach for instantdeployment. PLoS ONE 2014;9:e95217.

21. Ichikawa A, Kinoshita T, Watanabe T, Kato H, Nagai H, Tsushita K, et al.Mutations of the p53 gene as a prognostic factor in aggressive B-celllymphoma. New Engl J Med 1997;337:529–34.

22. Wiegmans AP, Alsop AE, Bots M, Cluse LA, Williams SP, Banks K-M, et al.Deciphering the molecular events necessary for synergistic tumor cellapoptosis mediated by the histone deacetylase inhibitor vorinostat andthe BH3 mimetic ABT-737. Cancer Res 2011;71:3603–15.

23. Poortinga G, Wall M, Sanij E, Siwicki K, Ellul J, Brown D, et al. c-MYCcoordinately regulates ribosomal gene chromatin remodeling and Pol Iavailability during granulocyte differentiation. Nucleic Acids Res 2011;39:3267–81.

24. Tolani B, Gopalakrishnan R, Punj V, Matta H, Chaudhary P. Targeting Mycin KSHV-associated primary effusion lymphoma with BET bromodomaininhibitors. Oncogene 2014;33:2928–37.

25. Youle RJ, Strasser A. The BCL-2 protein family: opposing activities thatmediate cell death. Nat Rev Mol Cell Biol 2008;9:47–59.

26. Patel AJ, Liao C-P, Chen Z, Liu C, Wang Y, Le LQ. BET bromodomaininhibition triggers apoptosis ofNF1-associatedmalignant peripheral nervesheath tumors through bim induction. Cell Reports 2014;6:81–92.

27. Hemann MT, Bric A, Teruya-Feldstein J, Herbst A, Nilsson JA, Cordon-Cardo C, et al. Evasion of the p53 tumour surveillance network by tumour-derived MYC mutants. Nature 2005;436:807–11.

28. Gregory GP, Hogg SJ, Kats LM, Vidacs E, Baker AJ, Gilan O, et al. CDK9inhibition by dinaciclib potently suppresses Mcl-1 to induce durableapoptotic responses in aggressive MYC-driven B-cell lymphoma in vivo.Leukemia 2015;29:1437–41.

29. Fong C, Gilan O, Lam E, Rubin A, Ftouni S, Tyler D, et al. BET inhibitorresistance emerges from leukaemia stem cells. Nature 2015;525:538–42.

30. Rathert P, Roth M, Neumann T, Muerdter F, Roe J-S, Muhar M, et al.Transcriptional plasticity promotes primary and acquired resistance to BETinhibition. Nature 2015;525:543–7.

31. Ciceri P, M€uller S, O'Mahony A, Fedorov O, Filippakopoulos P, Hunt JP,et al. Dual kinase-bromodomain inhibitors for rationally designed poly-pharmacology. Nat Chem Biol 2014;10:305–12.

32. Shortt J, Johnstone RW. Oncogenes in cell survival and cell death. ColdSpring Harbor Perspect Biol 2012;4:a009829.

33. Mead G, Sydes M, Walewski J, Grigg A, Hatton C, Norbert P, et al. Aninternational evaluation of CODOX-M and CODOX-M alternating withIVAC in adult Burkitt's lymphoma: results of United Kingdom LymphomaGroup LY06 study. Ann Oncol 2002;13:1264–74.

34. Chng W, Huang G, Chung T, Ng S, Gonzalez-Paz N, Troska-Price T, et al.Clinical and biological implications of MYC activation: a common differ-ence between MGUS and newly diagnosed multiple myeloma. Leukemia2011;25:1026–35.

35. Testoni M, Kwee I, Greiner TC, MontesMoreno S, Vose J, Chan WC, et al.Gains of MYC locus and outcome in patients with diffuse large Bcelllymphoma treated with RCHOP. Br J Haematol 2011;155:274–7.

36. JohnsonNA, SlackGW, Savage KJ, Connors JM, Ben-Neriah S, Rogic S, et al.Concurrent expression of MYC and BCL2 in diffuse large B-cell lymphomatreated with rituximab plus cyclophosphamide, doxorubicin, vincristine,and prednisone. J Clin Oncol 2012;30:3452–9.

37. HuS, Xu-Monette ZY, TzankovA,Green T,WuL, BalasubramanyamA, et al.MYC/BCL2 protein coexpression contributes to the inferior survival ofactivated B-cell subtype of diffuse large B-cell lymphoma anddemonstrateshigh-risk gene expression signatures: a report from the internationalDLBCLRituximab-CHOP consortium program. Blood 2013;121:4021–31.

38. Ceribelli M, Kelly PN, Shaffer AL, Wright GW, Xiao W, Yang Y, et al.Blockade of oncogenic IkB kinase activity in diffuse large B-cell lymphomaby bromodomain and extraterminal domain protein inhibitors. Proc NatlAcad Sci U S A 2014;111:11365–70.

39. Emadali A, Rousseaux S, BruderCosta J, RomeC,Duley S,Hamaidia S, et al.Identification of a novel BET bromodomain inhibitorsensitive, gene reg-ulatory circuit that controls rituximab response and tumour growth inaggressive lymphoid cancers. EMBO Mol Med 2013;5:1180–95.

40. Shu S, Lin CY, He HH, Witwicki RM, Tabassum DP, Roberts JM, et al.Response and resistance to BET bromodomain inhibitors in tripe-negativebreast cancer. Nature 2016;529:413–17.

41. Johnson-Farley N, Veliz J, Bhagavathi S, Bertino JR. ABT-199, a BH3mimetic that specifically targets Bcl-2, enhances the antitumor activity ofchemotherapy, bortezomib and JQ1 in "double hit" lymphoma cells. LeukLymphoma 2015;56:2146–52.

42. Tan Y, Sementino E, Pei J, Kadariya Y, Ito TK, Testa JR. Co-targeting of Aktand Myc inhibits viability of lymphoma cells from Lck-Dlx5 mice. CancerBiol Ther 2015;16:580–8.






2016;15:2030-2041. Published OnlineFirst July 12, 2016.Mol Cancer Ther Simon J. Hogg, Andrea Newbold, Stephin J. Vervoort, et al. via Epigenetic Regulation of BCL-2 Family MembersBET Inhibition Induces Apoptosis in Aggressive B-Cell Lymphoma

Updated version

10.1158/1535-7163.MCT-15-0924doi:

Access the most recent version of this article at:

Material

Supplementary

http://mct.aacrjournals.org/content/suppl/2016/07/12/1535-7163.MCT-15-0924.DC1

Access the most recent supplemental material at:

Cited articles

http://mct.aacrjournals.org/content/15/9/2030.full#ref-list-1

This article cites 42 articles, 16 of which you can access for free at:

Citing articles

http://mct.aacrjournals.org/content/15/9/2030.full#related-urls

This article has been cited by 8 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://mct.aacrjournals.org/content/15/9/2030To request permission to re-use all or part of this article, use this link



http://mct.aacrjournals.org/lookup/doi/10.1158/1535-7163.MCT-15-0924

http://mct.aacrjournals.org/content/suppl/2016/07/12/1535-7163.MCT-15-0924.DC1

http://mct.aacrjournals.org/content/15/9/2030.full#ref-list-1

http://mct.aacrjournals.org/content/15/9/2030.full#related-urls

http://mct.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://mct.aacrjournals.org/content/15/9/2030


bet inhibition induces apoptosis in aggressive b-cell ... · mscv-ires-gfp/nrasq61k was generated...

Documents