biodiversity of fruit flies (tephritidae: diptera) and ... · biodiversity of fruit flies...
TRANSCRIPT
BIODIVERSITY OF FRUIT FLIES
(TEPHRITIDAE: DIPTERA) AND UTILIZATION
OF GUT BACTERIA IN THEIR MANAGEMENT
THESIS
By
CHANDRA SHEKHAR PRABHAKAR (A-2007-40-01)
Submitted to
CHAUDHARY SARWAN KUMAR
HIMACHAL PRADESH KRISHI VISHVAVIDYALAYA
PALAMPUR – 176 062 (H.P.) INDIA
in
partial fulfilment of the requirements for the degree
of
DOCTOR OF PHILOSOPHY IN AGRICULTURE (DEPARTMENT OF ENTOMOLOGY)
(ENTOMOLOGY)
2011
Dr P.K. Mehta Professor & Head
Department of Entomology, College of Agriculture, CSK Himachal Pradesh Krishi Vishvavidyalaya, Palampur – 176 062 (H.P.) India
CERTIFICATE – I
This is to certify that the thesis entitled “Biodiversity of fruit flies
(Tephritidae: Diptera) and utilization of gut bacteria in their management”
submitted in partial fulfilment of the requirements for the award of the degree of
Doctor of Philosophy (Agriculture) in the discipline of Entomology of CSK
Himachal Pradesh Krishi Vishvavidyalaya, Palampur is a bonafide research work
carried out by Chandra Shekhar Prabhakar (Admission No. A-2007-40-01)
son of Shri Ramdeo Prasad Prabhakar under my supervision and that no part of
this thesis has been submitted for any other degree or diploma.
The assistance and help received during the course of this investigation
have been duly acknowledged.
(Dr P.K. Mehta) Place: Palampur Major Advisor Dated: March, 2011
CERTIFICATE- II
This is to certify that the thesis entitled “Biodiversity of fruit flies
(Tephritidae:Diptera) and utilization of gut bacteria in their management”
submitted by Chandra Shekhar Prabhakar (A-2007-40-01) son of Shri Ramdeo
Prasad Prabhakar to the CSK Himachal Pradesh Krishi Vishvavidyalaya,
Palampur in partial fulfilment of the requirements for the degree of Doctor of
Philosophy (Agriculture) in the discipline of Entomology has been approved
by the Advisory Committee after an oral examination of the student in
collaboration with an External Examiner.
________________________ (Dr P.K. Mehta)
____________________ ( )
Chairperson Advisory Committee
External Examiner
________________________
________________________
(Dr Pankaj Sood) Member
(Dr T.R. Sharma) Member
_______________________
(Dr S.S. Kanwar) Member
(Dr P.N. Sharma) Member
(Dr R.G. Sud) Member-cum-Dean‘s nominee
___________________ Head of the Department
______________________ Dean, Postgraduate Studies
i
ACKNOWLEDGEMENTS
In this highly complex society, no work can be accomplished by a single individual but it needs inspiration and sincere gratitude of intellectuals as well as the grace of that Almighty. With limitless humility, I would like to praise and thank „GOD‟, the merciful, the compassionate, who bestowed me with health, tenacity and enough courage to go through this crucial juncture. I am grateful to “God”, for bestowing me with affectionate parents, whose love, dedication & inspiration encouraged me to undergo higher studies. Their sacrifice, heartiest blessings & firm faith have made this documentation a puny remuneration to translate their and my dreams into reality. With the overwhelming sense of legitimate pride and genuine obligation which gives me exuberant pleasure and privilege to express my eternal gratitude to my learned and revered advisor Dr P. K. Mehta (Professor & Head) Department of Entomology, CSKHPKV, Palampur and Chairman of my Advisory Committee for his excellent and praiseworthy guidance, keen interest, adroit admonition, juvenile encouragement and parental affection during whole course of my study and particularly at times of research and preparation of this manuscript. With a conscientious supervision, he has saved me from the taste of several errors by his frank and unsparing criticism. I shall always remain indebted to him.
It is my sole prerogative to place on record my indebtedness and everlasting gratitude to intelligent and professional dexterity of the members of my Advisory Committee, Dr P. N. Sharma (Professor, Plant Pathology) and Dr Pankaj Sood (Entomologist), who introduced me to the basics of Molecular Biology and its application in the field of Entomology particularly in the field of population genetics and molecular taxonomy and I enjoyed working under their guidance. I cannot afford to forget other members of my advisory committee Dr S. S. Kanwar (Sr. Microbiologist & Head), Dr R. G. Sud (Professor & Dean, COBS) and Dr T. R. Sharma (Professor, Molecular Biology) for their scientific acumen, constructive criticism, valuable suggestions and ever helping attitude steered the completion of this work.
I am especially grateful to Dr M. L. Agarwal (Professor, RAU, Pusa, Bihar), Dr I. M. White (Fruit fly Taxonomist, RNHM, London, UK), Dr R. A. I. Drew (Professor, Griffith University, Queensland, Australia), Dr V. C. Kapoor (Rtd. Professor, PAU, Ludhiana, Punjab) and Dr A. Bakri (University Cadi Ayyad, Marrakech, Morocco) for their help in identification of fruit fly species.
I would also like to thanks Dr B. Singh (Scientist, IHBT (CSIR), Palampur) and Dr Nageshwar Singh (Department of Chemistry and Biochemistry, CSKHPKV, Palampur) and Dr Ajay Kumar (Department of Microbiology, CSKHPKV, Palampur) who helped me in every tricky situation and made my work possible.
I am thankful to the esteemed faculty members of the Department of Entomology; Dr Desh Raj, Dr Nirmala Devi, Dr Y. S. Chandel, Dr D. C. Sharma, Dr R. S. Chandel, Dr A. K.
ii
Sood, Dr P. K. Sharma, Dr K. S. Verma, Dr Surjeet, Dr P. C. Sharma, Dr Sanjay Sharma and Dr Anjna Thakur for their guidance and encouragement.
I would also like to thank Mr. K. Bhandari (Scientist, NCAR, Kathmandu, Nepal) for providing fruit fly samples from Nepal.
Heartfelt thanks are also to the laboratory, field and office staff of the Department of Entomology, Microbiology, Chemistry and Biochemistry, Plant Pathology and CGIRT, COBS for their cordial help extended during the study.
I am thankful to Mr. Manoj Negi, Navell Sir, Ranjan, Abhinav, Sunil, Nikhil, Susheel, Vikas Dharmani, Lovleet, Anil, Lokender, Vishal, Ajay, Moondeep, Sachin, Prashant, Manoj, Shankyan, Naveen, Harish and Rohit who kept me in exalted state during moments of despondency & made this place a home away from home. I can hardly over look the co-operation, timely help and moral support extended by my galaxy of friends especially Dr Amit, Dr Vinod, Dr Vikas, Dr Nardi, Dr Bilal, Dr Ravishankar, Dr Ajit, Dr Vishal, Dr Samuel, Dr Prachi, Dr Naresh, Dr Sangeev, Amit, Kunal, Pankaj, Shailendra, Dinesh, Arvind, Manoj, Vivek, Khursheed, Vineet, Niraj, Brajesh, Lata, Anil, Manu, Yogesh, Zinta, Sandeep, Mukul, Veerendra, Jai, Pradeep, Chandan, Shweta, Rishu, Kinjal, Sawpna, Beena, Kajal, Rubi, Munish, Sumit, Jintu, Ranbir, Ashwani, Prashant, Manglesh, Sharvan, Naveen, Harish, Saurav, Ankit, Kuldeep, Suresh, Subhash, Gaurav, Praveen, Pushpender, Bhanu, Pote, Pawan, Omkar, Mukul, and Savneet who boosted me up in periods of mental stress & strain. Moreover, the services rendered by Mr. Brij and Mr. Santosh are acknowledged who provided me the best support and service during stress hours. I shall remain lifelong indebted and can never forget the constant inspiration, love and affection of my sisters, Anita & Dr Sunita; brother-in-laws, Dr Shyam & Dr Sanoj, and brothers Shashi & Ramnagina who always inspired me to excel in my field. Mr. Ajay Walia deserves special thanks for his untiring efforts in bringing the manuscript to this form. Acknowledgements are inherently endless & incomplete, I am grateful to many friendly & helpful people whos name I could not mention here, due to paucity of space. Lastly, it is worth mentioning the beautiful town Palampur and Shivalik (PG) Hostel for some unforgettable experiences and memories. Needless to say, all omissions and errors are mine.
Place : Palampur Dated : March, 2011
(Chandra Shekhar Prabhakar)
iii
TABLE OF CONTENTS
Chapter Title Page
1. Introduction 1-4
2. Review of Literature 5-26
3. Materials and Methods 27-50
4. Results and Discussion 51-146
5. Summary and Conclusions 147-149
Literature Cited 150-175
Brief Biodata of the Student
iv
LIST OF ABBREVIATIONS USED
Abbreviation Meaning
% : Per cent OC : Degree Celsius
i.d. : Internal diameter
SDW : Sterile distilled water
DNA : Deoxy ribonucleic acid
mtDNA : Mitochondrial DNA
mtCOI : Mitochondrial cytochrome oxidase I
RAPD : Random amplified polymorphic DNA
CTAB : Cetyl trimethylammonium bromide
PYEA : Peptone yeast extract agar
BHIA : Brain heart infusion agar
GCMS : Gas chromatography mass spectrometry
♂ : Male
♀ : Female
ME : Methyl eugenol
CL : Cue lure
et al. : And others
K2P : Kimura2parameter
UPGMA : Unweighted pair group mean algorithm
NJ : Neighbour joining
g : Gram
$ : Dollar
hr /h : Hour
i.e. : That is
kb : Kilo base
M : Molar
m : Meter
mg : Milligram
min : Minute
ml : Millilitre
mm : Millimeter
mM : Millimolar
N : Normal
ng : Nanogram
nm : Nanometer
nmole : Nanomole
OD : Optical density
PCR : Polymerase chain reaction
pmol : Picomole
rRNA : Ribosomal ribonucleic acid
v
rpm/ rev min-1
: Revolution per minute
bp Base pair
sp. : Species
viz. : Namely
µg : Microgram
µl : Microlitre
µM : Micromolar
R2+3 : Radius vein 2 and 3 combined
R4+5 : Radius vein 4and 5 combined
ia : Infra alar
sc : Subcostal cell
dm-cu : Discal medial- cubital crossvein
r-m : Radial-medial crossvein
bc : Basal costal cell
c : Costal cell
M : Media vein
r1 : Cell between R1 and R 2+3
bm : Basal medial cell
ZSI : Zoological Survey of India, (formerly Indian Museum), Kolkata, India
NPC : National Pusa Collection, Indian Agricultural Research Institute, New Delhi, India
ZMUC : Zoologisches Museum, Humboldt Universität, Berlin, Germany
BMNH : The Natural History Museum [British Museum (Natural History)], London, UK
UMO : Hope Entomological Collection, University Museum, Oxford University, Oxford, UK
USNM : National Museum of Natural History, Smithsonian Institution, Washington, DC, USA
DEI : Institute für Pflanzenschutzforschung (formerly Deutsches Entomologisches Institut), Kleinmachnow, Eberswalde, Germany
MCSNM : Museo Civico de Storia Naturale, Milano, Italy
NMW : Naturhistorisches Museum Wien, Postfach 417, Burgring 7, Vienna, Austria
PAN : Polska Akademia Nauk Instytut Zoologiczy, Warsaw, Poland
IZAS : Institute of Zoology, Academia Sinica, Beijing, China
SMN : Staatliches Museum fur Naturkunde, Rosenstein 1, Stuttgart, Baden-Wurttemburg D-7000, Germany
TMB : Természettudományi Muzeum Allattara (Hungarian Natural History Museum), Budapest, Hungary
NCBI : National centre of Biotechnology Information
MEGA : Molecular Evolution Genetic Analysis
vi
LIST OF TABLES
Table no. Title Page
2.1 Summary of a selected number of examples of insect-bacteria interactions
16-17
3.1 Surveyed locations for sample collection 28-29
3.2a Bactrocera cucurbitae (Coquillett) isolates used for molecular characterization
31
3.2b Fruit fly species used for molecular characterization 32-33
3.3 Reagent and concentration of DNA extraction buffer 34
3.4 Base sequences of UEA 7 and UEA 10 primer 34
3.5 GenBank sequences of mtCOI gene of Bactrocera cucurbitae used in phylogenetic analysis
37
3.6 GenBank sequences of mtCOI gene of Bactrocera tau used in phylogenetic analysis
38
3.7 Base sequences of rss gene primers 44
3.8 Bacteria used for multiple sequence alignment 47-48
3.9 Attractancy of promising gut bacteria to fruit fly B. tau (Walker)
48
4.1 Species and infestation index of fruit flies at different locations
52
4.2 Pair wise genetic distance based on mtCOI gene sequences of Bactrocera cucurbitae using the K2P method in MEGA4.1.
98
4.3 Population groups of B. cucurbitae isolates based on their geographical origin
100
4.4 Molecular diversity indices of B. cucurbitae 101
vii
Table no. Title Page
4.5 Distribution and frequency of different mitochondrial haplotypes in populations
103
4.6 Pair wise genetic distance based on mtCOI gene sequences between B. tau isolates of India using the K2P method in MEGA4.1
115
4.7 Pair wise genetic distance based on mtCOI gene sequences between B. tau isolates of India and other countries using the K2P method in MEGA4.1
117
4.8 Estimates of evolutionary divergence over sequence pairs between species using the K2P method in MEGA4.1
123
4.9 Isolation of gut bacteria from different populations of B. tau
128
4.10 Attractancy of bacterial isolates against fruit fly, B. tau (Walker)
130
4.11 Morphological, biochemical and molecular characteristics of promising gut bacteria of B. tau
131
4.12 Pair wise genetic distance based on 16S rDNA sequences of gut bacteria of Bactrocera tau and other bacterial sequences
137
4.13 Attractancy of promising gut bacteria isolates to B. tau (Walker)
141
4.14 Identified Chemicals in promising gut bacterial culture of B. tau
143
4.15 Properties of insect related chemicals identified in GCMS analysis
144
viii
LIST OF FIGURES
Fig. No. Title Page
4.1 Minimum spanning tree (MST) of mitochondrial haplotypes of B. cucurbitae generated by population genetic analysis software Arlequin 3.1
104
4.2 Distribution map of different mitochondrial haplotypes of Bactrocera cucurbitae populations in India
106
4.3 UPGMA tree based on mtCOI gene sequences showing the relationships between thirty three B. cucurbitae isolates of India and rooted at Locusta migratoria.
108
4.4 Phylogenetic tree based on mtCOI gene sequences showing the relationships between fifty six B. cucurbitae isolates of India and other countries, rooted at Locusta migratoria.
110
4.5 Phylogenetic tree based on mtCOI gene sequences showing the relationships between sixteen B. tau isolates of Himachal Pradesh and rooted at Locusta migratoria.
118
4.6 Phylogenetic tree based on mtCOI gene sequences showing the relationships between twenty eight B. tau isolates of India and other countries and rooted at Locusta migratoria.
119
4.7 Phylogenetic tree based on mtCOI gene sequences showing the relationships between eight species of Bactrocera and Dacus spp. of India rooted at Locusta migratoria.
125
4.8 Phylogenetic tree based on 16S rDNA gene sequences showing the relationships between five gut bacterial isolates of Bactrocera tau.
138
ix
LIST OF PLATES
Plate no. Title Page
4.1 Morphographs of Bactrocera correcta (Bezzi) 57
4.2 Morphographs of Bactrocera dorsalis (Hendel) 60
4.3 Morphographs of Bactrocera latifrons (Hendel) 62
4.4 Morphographs of Bactrocera nigrofemoralis White & Tsuruta
64
4.5 Morphographs of Bactrocera paraverbascifoliae Drew & Raghu
66
4.6 Morphographs of Bactrocera zonata (Saunders) 68
4.7 Morphographs of Bactrocera diversa (Coquillett) 71
4.8 Morphographs of Bactrocera trilineata (Hardy) 73
4.9 Morphographs of Bactrocera cucurbitae (Coquillett) 75
4.10 Morphographs of Bactrocera scutellaris (Coquillett) 78
4.11 Morphographs of Bactrocera tau (Walker) 80
4.12 Morphographs of Dacus longicornis Wiedemann 83
4.13 Morphographs of Dacus sphaeroidalis (Bezzi) 85
4.14 Morphographs of Dacus (Callantra) sp. 87
4.15 Morphographs of Cyrtostola limbata (Hendel) 89
4.16 Morphographs of Pliomelaena udhampurensis Agarwal & Kapoor
91
4.17 Morphographs of Dioxyna sororcula (Wiedemann) 93
4.18 mtCOI gene PCR product of Bactrocera cucurbitae isolates amplified by using gene specific markers
99
4.19 Minimum spanning network of the 14 mitochondrial haplotypes, observed in a set of 33 individuals from all 5 Bactrocera cucurbitae populations
105
4.20 mtCOI gene PCR product of Bactrocera tau isolates amplified by using gene specific markers
113
4.21 mtCOI gene PCR product of fruit fly species isolates amplified by using gene specific markers
121
4.22 16S rRNA gene PCR product of gut bacterial isolates of B. tau (Walker) amplified by using gene specific markers
133
4.23 Promising gut bacteria of Bactrocera tau 134
4.24 GCMS chromatogram of promising gut bacteria of Bactrocera tau
145
x
Department of Entomology, COA CSK Himachal Pradesh Krishi Vishvavidyalaya
Palampur – 176 062 (HP) Title of thesis : Biodiversity of fruit flies (Tephritidae: Diptera) and
utilization of gut bacteria in their management Name of the student : Chandra Shekhar Prabhakar Admission number : A-2007-40-01 Major discipline : Entomology Minor discipline : (i) Biochemistry (ii) Agricultural Biotechnology Date of thesis submission : 14
th March, 2011
Total pages of the thesis : 175 Major Advisor : Dr P.K. Mehta
ABSTRACT Present investigations on biodiversity of fruit flies and their associated gut bacteria were
undertaken to resolve the fruit flies spectrum prevalent in Himachal Pradesh and their molecular characterization along with associated gut bacteria. The results revealed that Bactrocera cucurbitae and Bactrocera tau are the major and serious pests of cucurbits causing 65.88 per cent fruit infestation in Himachal Pradesh. Out of 17 species of tephritid fruit flies recorded from 5 genera, 14 species were already present in Himachal Pradesh. Bactrocera latifrons (Hendel), B. nigrofemoralis White & Tsuruta, Dacus longicornis Wiedemann, Dacus sp., Cyrtostola limbata (Hendel) from subfamily Dacinae and Pliomelaena udhampurensis Agarwal & Kapoor from subfamily Tephritinae were recorded for the first time from Himachal Pradesh. Pest status and distribution of B. latifrons needs to be investigated in Himachal Pradesh as this species has been reported as pest in south India. Eight species of fruit flies (61 isolates) were molecularly characterized with mtCOI gene and were submitted to GenBank, NCBI with accession number HQ378195-HQ378245 and HQ446513-HQ446522. mtCOI gene/s of B. nigrofemoralis, D. longicornis and D. sphaeroidalis are totally new to GenBank, NCBI. mtCOI gene analysis of B. cucurbitae showed exceedingly low genetic diversity amongst B. cucurbitae populations and one single haplotype (H1) was found to be predominant in Indian subcontinent. On the basis of mtCOI gene sequence analysis of B. tau isolates from Himachal Pradesh, the observed genetic diversity is low and quite similar to B. tau sp A (Thailand). Eight species of fruit flies were clearly differentiated on the basis of mtCOI gene sequences which were grouped together as per earlier classification. This validates the utility of mtCOI gene as a tool for fruit fly detection, species characterization and phylogenetic studies. Out of 63 bacteria isolated from the gut of B. tau on two culture media viz. BHIA and PYEA, 30 bacteria were screened as attractant for fruit fly. Five most attractive bacterial isolates were characterized on the basis of morphological, biochemical and 16S rRNA gene sequence characteristics. These were Delftia acidovorans, Pseudomonas putida, Flavobacterium sp., Defluvibacter sp. and Ochrobactrum sp. Their 16S rRNA gene sequences were submitted to GenBank, NCBI and accession numbers HQ446523 to HQ446527 was awarded to them. Attractancy of different bacterial isolates was in the range of 6.17 to 11.17 and 5.67 to 8.17 adults/ 30min for female and male, respectively. P. putida was found to be the most attractive bacteria to fruit fly followed by D. acidovorans. All bacterial isolates were, however, found statistically superior over sugar (negative control) and inferior to protein hydrolyzate (positive control). Twenty two volatile chemicals were identified on the basis of GCMS analysis of five bacterial isolates. Of which only three chemicals viz. Z-(9)-tricosene (House fly), cedrol (Cryptomeria bark borer) and chryophllene oxide (Compoletis sonorensis) are known to be associated with insect chemical communication behaviour.
____________________ ____________ (Chandra Shekhar Prabhakar) Student Date:
(Dr P.K. Mehta) Major Advisor
Date: ___________________
Head of the Department
xi
Department of Entomology, COA CSK Himachal Pradesh Krishi Vishvavidyalaya
Palampur – 176 062 (HP) Title of thesis : Biodiversity of fruit flies (Tephritidae: Diptera) and
utilization of gut bacteria in their management Name of the student : Chandra Shekhar Prabhakar Admission number : A-2007-40-01 Major discipline : Entomology Minor discipline : (i) Biochemistry (ii) Agricultural Biotechnology Date of thesis submission : 14
th March, 2011
Total pages of the thesis : 175 Major Advisor : Dr P.K. Mehta
ABSTRACT Present investigations on biodiversity of fruit flies and their associated gut bacteria were undertaken
to resolve the fruit flies spectrum prevalent in Himachal Pradesh and their molecular characterization along with associated gut bacteria. The results revealed that Bactrocera cucurbitae and Bactrocera tau are the major and serious pests of cucurbits causing 65.88 per cent fruit infestation in Himachal Pradesh. Out of 17 species of tephritid fruit flies recorded from 5 genera, 14 species were present in Himachal Pradesh. Bactrocera latifrons (Hendel), B. nigrofemoralis White & Tsuruta, Dacus longicornis Wiedemann, Dacus sp., Cyrtostola limbata (Hendel) from subfamily Dacinae and Pliomelaena udhampurensis Agarwal & Kapoor from subfamily Tephritinae were recorded for the first time from Himachal Pradesh. Pest status and distribution of B. latifrons needs to be investigated in the Himachal Pradesh as this species has been reported as pest in south India. Eight species of fruit flies (61 isolates) were molecularly characterized with mtCOI gene and were submitted to GenBank, NCBI with accession number HQ378195-HQ378245 and HQ446513-HQ446522. mtCOI gene/s of B. nigrofemoralis, D. longicornis and D. sphaeroidalis are totally new to GenBank, NCBI. mtCOI gene analysis of B. cucurbitae showed exceedingly low genetic diversity amongst B. cucurbitae populations and one single haplotype (H1) was found to be predominant in Indian subcontinent. On the basis of mtCOI gene sequence analysis of B. tau isolates from Himachal Pradesh, the observed genetic diversity is low and quite similar to B. tau sp A (Thailand). Eight species of fruit flies were clearly differentiated on the basis of mtCOI gene sequences which were grouped together as per earlier classification. This validates the utility of mtCOI gene as a tool for fruit fly detection, species characterization and phylogenetic studies. Out of 63 bacteria isolated from the gut of B. tau on two culture media viz. BHIA and PYEA, 30 bacteria were screened as attractant for fruit fly. Five most attractive bacterial isolates were characterized on the basis of morphological, biochemical and 16S rRNA gene sequence characteristics. These were Delftia acidovorans, Pseudomonas putida, Flavobacterium sp., Defluvibacter sp. and Ochrobactrum sp. Their 16S rRNA gene sequences were submitted to GenBank, NCBI and accession numbers HQ446523 to HQ446527 were awarded to them. Attractancy of different bacterial isolates was in the range of 6.17 to 11.17 and 5.67 to 8.17 adults/ 30min for female and male, respectively. P. putida was found to be the most attractive bacteria to fruit fly followed by D. acidovorans. All bacterial isolates were, however, found statistically superior over sugar (negative control) and inferior to protein hydrolyzate (positive control). Twenty two volatile chemicals were identified on the basis of GCMS analysis of five bacterial isolates. Of which only three chemicals viz. Z-(9)-tricosene (House fly), cedrol (Cryptomeria bark borer) and chryophllene oxide (Compoletis sonorensis) are known to be associated with insect chemical communication behaviour.
____________________ ____________ (Chandra Shekhar Prabhakar) Student Date:
(Dr P.K. Mehta) Major Advisor
Date: ___________________
Head of the Department
Dean, Postgraduate Studies
1
1
1. INTRODUCTION
Fruit flies (Diptera: Tephritidae) are one of the most fascinating and
diversified group of insects often referred to as ‗peacock flies‘ due to their habit of
strutting and vibrating wings, and rank among the world‘s most serious pests of
horticultural crops (Kapoor 1993; Agarwal and Sueyoshi 2005; Satarkar et al.
2009).
The family Tephritidae of order Diptera consists of over 4,448 species or
subspecies of fruit flies, classified in 481 genera (Agarwal and Sueyoshi 2005) of
which 800 species belong to Dacinae fruit flies (Fletcher 1987; Drew 1989a).
They have global distribution, covering tropical, subtropical and temperate
regions and occupy habitats ranging from rainforests to open savannah except in
Arctic and Antarctic regions (Kapoor et al. 1980; Drew 1989a; 1989b; Norrbom et
al. 1998; Michaux and White 1999).
In India, fruit flies have been identified as one of the ten most serious
problems of agriculture because of their polyphagous nature and cause a huge
economic loss to fruits and vegetables which varies from 2.5 -100 per cent
depending upon the crop and season (Verghese et al. 2004; Dhillon et al. 2005).
Of the 243 species of fruit flies recorded from India (Agarwal and Sueyoshi
2005), nine species viz. melon fly, Bactrocera cucurbitae (Coquillett); oriental fruit
fly, Bactrocera dorsalis (Hendel); peach fruit fly, Bactrocera zonata (Saunders);
pumpkin fly, Bactrocera tau (Walker); guava fruit fly, Bactrocera correcta (Bezzi);
lesser pumpkin fly, Dacus ciliatus (Loew); ber fly, Carpomyia vesuviana (Costa)
and seed fly, Acanthiophilus helianthi (Rossi) are major economically important
species which cause a loss of Rs 7000 crore per annum (Sardana et al. 2005).
Owing to their enormous damage potential and faster acclimatization and
adaptability, many fruit fly species have been recommended for domestic and
international quarantine to restrict their entry into new habitats. Some alien
species viz. Bactrocera minax (Enderlein), Bactrocera latifrons (Hendel) and
Bactrocera oleae (Gmelin) have also been reported to cause damage in Bhutan,
South India, and Jammu & Kashmir, respectively (Sardana et al. 2005).
2
2
Among various tephritids, B. cucurbitae, B. tau and D. ciliatus are the most
important and serious pests of cucurbits in India causing significant reduction in
qualitative and quantitative yield of crops (Srinivasan and Narayanaswamy 1961;
Prabhakar et al. 2007; 2009a) which is estimated to the tune of Rs 4,705 crore
per annum (Sardana et al. 2005).
In Himachal Pradesh, B. tau, B. cucurbitae and B. scutellaris (Bezzi) were
reported on many vegetable crops (Narayanan and Batra 1960; Gupta et al.
1992; Sood and Nath 1999; Prabhakar et al. 2007; 2009a). Bactrocera tau, in
particular was rated as the most serious pest of cucurbits in Himachal Pradesh
(Gupta et al. 1992; Sood and Nath 1999; Prabhakar et al. 2009a).
The fruit flies are the most difficult pests to control as they attain peak
activity with the onset of rains; as a result, the residual insecticides applied for
their control get washed away. Even no effective bioagent is known which can
keep the population of fruit flies under check. Moreover, most of the available
insecticides fail to target the eggs as well as the developing maggots in fruits and
tender vegetables. Even the repeated application of insecticides may pose
serious health hazards to the consumers.
Symbiotic association with bacteria among tephritid fruit flies is known
since 1909, when it was first observed in the olive fly, B. oleae (Gmelin) by Petri
(1909). At present, a number of bacteria have been found to be symbiotically
associated with fruit flies which play an important role in physiology of insect
especially with reference to protein hydrolyzation (Murphy et al.1988; Behar et al.
2005), degradation of xenobiotics (Bousch and Matsumara 1967) and as
attractants to fruit flies (Lauzon et al. 1998; 2000).
The control of fruit flies by the symbionts is not a new idea as it was first
conceived in Florida in 1930 to control Mediterranean fruit fly, Ceratitis capitata
(Wiedemann) by foliar application of copper carbonate, which reduced symbiont
population (Baker et al. 1944). The role of symbionts associated with different
stages of fruit flies is only partially understood and even today it is not been fully
explained. A comprehensive understanding of the fruit fly biology in an ecological
pretext with associated bacteria as an important component of the system is of
utmost importance for envisaging this multitrophic interaction.
3
3
Himachal Pradesh is a north- western Himalayan state of India comprising
massive variety of inimitable flora and fauna in diverse agroclimatic zones like
sub-tropical, sub- temperate, temperate and cold desert. The changing climate
scenario, land utilization pattern, cropping system approach and increasing
international trade and tourism have, however, made it vulnerable to biological
invasion by alien species. This is leading to weaken ecosystem stability, affecting
farmer‘s livelihoods & consumer confidence, and at the end, loss of resident
species. Therefore fruit flies are indeed the excellent candidates for studies on
biodiversity, adaptability in changing climate and invasion to new areas because
of their capability to fly to long distances, polyphagous in nature and vast host
range, homoplasmy in taxonomic characters, high reproductive potential, wide
range of distribution due to their high adaptability and great economic importance
as a pest.
Among different DNA markers, two sets of markers i.e multilocus
microsatellite loci and mitochondrial DNA sequences have been used extensively
to study the recent history of insect populations, including population structure,
phylogeography and invasion biology (Roderick 1996; 2004; Sunnucks 2000).
Microsatellites, being nuclear, co-dominant loci, with high levels of variability, are
particularly informative in the study of recent population phenomena such as
biological invasions. In contrast, the unique properties of nucleotide sequence
polymorphism of mitochondrial DNA (mtDNA) can provide high resolution
information on the evolutionary relations between taxonomically bound families
as mitochondrial genes evolve approximately 10 times faster than single-copy
nuclear DNA (Brown et al. 1979). Therefore, mtDNA sequence is a useful
molecular marker (Brown and Simpson 1981; Barton and Jones 1983; Aquadro
et al. 1984; Palumbi and Cipriano 1998). Also mitochondrial cytochrome oxidase
I (mtCOI) gene is reasonably well conserved, and has been sequenced in
various invertebrate taxas (Brown 1985; Bermingham and Lessios 1993; Brower
1994a; Hu et al. 2008). Nevertheless, mtCOI sequences are at the base of the
barcoding identification system (Hebert et al. 2003; Hajibabaei et al. 2006) that,
4
4
besides being a valuable tool for species identification and discovery, have also
been proposed as a powerful methodology in biosecurity and invasive species
identification (Armstrong and Ball 2005).
Therefore, the present investigation was planned to generate information
on biodiversity, geographical distribution and genetic relationship among fruit fly
species with mitochondrial cytochrome oxidase I (mtCOI) gene sequencing, and
also to explore their gut associated bacteria. It is imperative to know about the
species which are trying to invade new areas especially from quarantine
purpose. This study would be helpful in understanding the true distribution of fruit
fly species in the region and their gut associated bacteria which may be useful in
devising alternative eco-friendly management strategies for this devastating pest.
Therefore the present study was undertaken with the following objectives:
i) Molecular characterization of fruit fly species infesting cucurbits in
Himachal Pradesh,
ii) isolation, identification and characterization of predominant fruit fly gut
bacteria, and
iii) to evaluate the role of predominant gut bacteria in management of fruit
fly.
5
5
2. REVIEW OF LITERATURE
The literature pertaining to the survey, economic importance,
biodiversity, associated gut bacteria of fruit flies and role of gut bacteria in fruit
flies management have been reviewed under the following heads:
2.1 Geographical distribution and economic importance
2.2 General status of tephritid taxonomy
2.3 Biodiversity of fruit flies
2.4 Molecular characterization of fruit flies
2.5 Gut bacterial diversity in fruit flies
2.6 Molecular characterization of gut bacteria
2.7 Bacterial odours as attractants for fruit flies
2.8 Role of bacteria in the IPM of fruit flies
2.1 Geographical distribution and economic importance
The family Tephritidae is one of the largest families of Diptera (Drew
1989a), comprising of predominantly medium sized, pictured-winged and highly
ornamented flies often referred to as ‗peacock flies‘ due to their habit of strutting
and vibrating their wings (Kapoor 1993; Agarwal and Sueyoshi 2005; Satarkar et
al. 2009; De Meyer et al. 2010). The tephritid flies are commonly known as ―fruit
flies‖ because a number of species infest a wide variety of fruits, vegetables,
flower heads, seeds, leaves and other plant parts (White and Elson-Harris 1992;
Agarwal and Sueyoshi 2005).
They are found in nearly all habitats with suitable plant life. Their
distribution is cosmopolitan covering tropical, subtropical and temperate regions
and they occupy habitats ranging from rainforests to open savannah except in
Arctic and Antarctic regions (Kapoor et al. 1980; Drew 1989a; 1989b; McPheron
6
6
and Steck 1996; Norrbom et al. 1998; Michaux and White 1999; Agarwal and
Sueyoshi 2005; De Meyer et al. 2010). These flies are widespread over the entire
world and richly predominant in the tropical and subtropical areas.
They occupy a predominantly important place in the list of enemies of
plants and among the world‘s most notorious agricultural pests, both because of
their widespread presence and broad larval host range, the enormous direct and
indirect damage by the major species of the fruit fly complex and thus have a
grave effect on agricultural economy (Michaux and White 1999; Agarwal and
Sueyoshi 2005; Satarkar et al. 2009; De Meyer et al. 2010).
Several tephritids are critically important as fruit crop pests (Thompson
1998). About 35% of fruit fly species attack soft fruits, including many
commercially important ones (White and Elson-Harris 1992). Economic impacts
can be enormous, and control or eradication requires substantial budgets. Dowell
and Wange (1986) had rightly stated that establishment of major fruit fly threats
to the Californian fruit industry would cause crop losses of US $ 910 million
yearly, and an eradication program would cost US $ 290 million. Annual losses in
the eastern Mediterranean (Israel, Palestinian Territories, Jordan) linked to fruit
fly infestations are estimated at US $ 192 million (Enkerlin and Mumford 1997). In
India, fruit flies caused annual estimated losses to the tune of $ 855.40 million
(Sardana et al. 2005; Prabhakar et al. 2009a). Indirect losses resulting from
quarantine restrictions imposed by importing countries to prevent entry and
establishment of unwanted fruit fly species, however would exaggerate this figure
enormously. Most economically important fruit fly pests belong to four genera:
Anastrepha Schiner (New World Tropics), Bactrocera Macquart, Ceratitis
MacLeay and Dacus Fabricius (Old World Tropics) (De Meyer et al. 2010).
Among fruit flies, Bactrocera species in particular are native to tropical
Asia, Australia and South Pacific regions, with a few species being found in
African and warm temperate areas of Europe and Asia. These are mainly
polyphagous pests, having widespread distribution, wide climatic adaptation, high
reproductive potential, high mobility and cause losses in fruit and vegetable crops
(Muraji and Nakahara 2002).
7
7
In India, fruit flies have been identified as one of the ten most serious
problems of agriculture as a whole and nine species in particular viz. melon fly,
B. cucurbitae; oriental fruit fly, B. dorsalis; peach fruit fly, B. zonata; pumpkin fly,
B. tau; guava fruit fly, B. correcta; lesser pumpkin fly, Dacus ciliatus; ber fly,
Carpomyia vesuviana and seed fly, Acanthiophilus helianthi are major and
economically important (Sardana et al. 2005). Among these the melon fly,
Bactrocera cucurbitae is a polyphagous fruit fly that attacks more than 125 plant
species, mostly belonging to the Cucurbitaceae and Solanaceae (Dhillon et al.
2005; Pinero et al. 2006), and include some species of significant agricultural
interest. The first report on the melon fly was published by Bezzi (1913), who
listed 39 insect species from India and considered India as its native region.
Besides India, today the melon fly is distributed throughout the Pakistan, Nepal,
China, New Guinea, Philippines, Mariana and Hawaii Islands, and throughout
most of Southeast Asia (Hu et al. 2008). The species has also been reported
from Egypt, Kenya and Tanzania (Weems and Heppner 2001) where it is a
recent invader.
Two important pest species, Bactrocera tryoni (Froggatt) and Ceratitis
capitata (Wiedemann) have not yet been reported from India. However, Munro
(1938) recorded the later from Pusa, Bihar in 1907 and 1908, when he reared
them on peach. Kapoor et al. (1980) related this as a case of accidental
introduction which could not establish in India. Three more fruit fly species, B.
caryeae (Kapoor), B. caudate (Fabricius) and Rhagoletis cingulata (Loew) are
waiting to enter India or have doubtful presence (Sardana et al. 2005).
In Himachal Pradesh, B. zonata and B. dorsalis as pests of stone fruits,
guava and mango (Bhalla and Pawar 1977); B. cucurbitae and B. tau on
cucurbits (Sood and Nath 1999; Prabhakar et al. 2009a) are the most serious
pests. B. tau in particular has been reported on many fruit and vegetable crops
by Narayanan and Batra (1960) in India, Yang et al. (1994a; 1994b) in China and
Huque (2006) in Bangladesh. This species was reported as a serious pest of
8
8
cucurbitaceous vegetables (Bhalla and Pawar 1977; Gupta et al. 1992; Sood and
Nath 1999; Prabhakar et al. 2007; Prabhakar et al. 2009a) and also of
solanaceous vegetables in Himachal Pradesh and plains of Punjab (Kapoor and
Agarwal 1983). Recently, B. scutellaris (Bezzi) was reported as pest of many
cucurbit crops in Himachal Pradesh (Sunandita and Gupta 2007; Prabhakar et al.
2007; Prabhakar et al. 2009a).
2.2 General status of tephritid taxonomy
Tephritid taxonomic research was pioneered by forefathers of biology,
Linnaeus and Fabricius. Tephritid taxonomy has a long history (over-two
centuries) with some 4,500 species having been described since mid-1700s
(Drew and Romig 2000), distributed throughout the temperate, subtropical and
tropical areas of the world.
The Dacinae fruit flies, one of the major subfamilies of the Tephritidae, are
economically important group of Diptera. Drew (1989a) estimated that there are
at least 800 species distributed in Africa (200), the Asian region (300) and
throughout the South Pacific (300). This group is mainly found in subtropical and
tropical areas. The rate of discovery of new species indicates that there may be
up to a thousand species in total. Economically important species of fruit flies
belong to the genera; Anastrepha, Rhagoletis, Bactrocera and Ceratitis. The
Dacinae fruit flies have traditionally been divided into two main genera;
Bactrocera and Dacus. Other major pest tephritids of the genera Anastrepha,
Rhagoletis and Ceratitis belong to the subfamilies Trypentinae and Ceratinae.
Based on previous studies, the Dacus genus which includes a large
number of fruit fly species is now renamed as Bactrocera (Drew 1989a).
Bactrocera as a genus is one of the largest within family Tephritidae with about
500 described species arranged in 28 subgenera (Drew 1989a; Drew and
Hancock 2000) whose members extend throughout Asia, Oceanic region and
Australia. There are very few recorded species in Africa and only B. oleae is
found in North Africa and Southern Europe.
9
9
In Indian subcontinent, the knowledge of family Tephritidae has been
based largely upon the monumental monograph of Bezzi published in 1913
(Kapoor et al. 1980). During 1960s to 1990s, lots of work has been carried out on
taxonomy of tephritid fruit flies in India by Kapoor and his associates. In 2005,
Agarwal and Sueyoshi published catalogue of Indian fruit flies, listing 243 species
in 79 genera. This is a grand gift to the most neglected group of insects in India
(Anonymous 2010).
2.3 Biodiversity of fruit flies
The Tephritidae (i.e. the ―true fruit fly‖) is a medium sized insect family with
about 4,448 recognized species or subspecies of fruit flies, classified in 481
genera (Agarwal and Sueyoshi 2005). It has a worldwide distribution with a
considerable number of pest species and some beneficial members which are
used as biocontrol agents (Zwolfer 1987; White 1987; Sardana et al. 2005).
Zaka-ur-Rab (1984) listed 60 genera and 138 species of tephritids in the
Indian subcontinent, out of which 56 genera and 102 species belong to sub
families other than Dacinae. However, Sardana et al. (2005) enlisted 207 species
of fruit flies under 71 genera, 13 tribes and 4 subfamilies from India which infest a
wide range of vegetable and fruit crops. Agarwal and Sueyoshi (2005) published
catalogue of Indian fruit flies, listing 243 species in 79 genera, which have been
arranged in 4 subfamilies and 18 tribes. Of the 4,448 recognized species or
subspecies of fruit flies of family Tephritidae known so far, only 243 species of
fruit flies have so far been reported from India , where as it is generally accepted
that from 8-12 per cent of the world species of acalyptrate dipterans are
represented in India. This indicates that more than 400 species of tephritid flies
are estimated to occur in India and many of them are yet to be discovered from
the biodiversity rich habitats of India (Anonymous 2010).
In Himachal Pradesh, 41 species distributed in 27 genera, 3 subfamilies
and 10 tribes were listed in catalogue of Indian fruit flies by Agarwal and
Sueyoshi (2005). List of tephritid fruit flies species reported from Himachal
Pradesh is as follows :
10
10
Subfamily Tribe Genus Species
DACINAE 1. DACINI I Bactrocera Macquart 1. correcta (Bezzi) 2. dorsalis (Hendel) 3. zonata (Saunders) 4. diversa (Coquillett) 5. cucurbitae (Coquillett) 6. scutellaris (Bezzi) 7. tau (Walker)
II Dacus Fabricius 8. discophorus (Hering) 9. ciliatus Loew
TRYPETINAE 2. ADRAMINI III Adrama Walker 10. apicalis Shiraki 11. austeni Hendel
IV Meracanthomyia Hendel 12. kotiensis Kapoor V Pelmatops Enderlein 13. ichneumoneus
(Westwood) 3. CARPOMYINI VI Carpomya Costa 14. vesuviana Costa 4. TRYPETINI VII Anomoia Walker 15. immsi (Bezzi) VIII Acidiella Hendel 16. rioxaeformis (Bezzi) IX Cornutrypeta Han &
Wang 17. melanonotum (Brunetti)
X Stemonocera Rondani
18. cervicornis (Brunetti) 19. discalis (Brunetti)
TEPHRITINAE 5. NOEETINI XI Ensina Robineau-Desvoidy
20. sonchi (Linnaeus)
6. PLIOMELAENINI XII Elaphromyia Bigot 21. pterocallaeformis (Bezzi)
XIII Pliomelaena Bezzi
22. quadrimaculata Agarwal & Kapoor
23. zonogastra (Bezzi) 7. SCHISTOPTERINI XIV Rhabdochaeta Meijere 24. pulchella Meijere 8. TEPHRELLINI XV Metasphenisca Hendel 25. reinhardi (Wiedemann) XVI Oxyaciura Hendel 26. monochaeta (Bezzi)
27. xanthotricha (Bezzi) XVII Sphaeniscus Becker 28. atilius (Walker) 9. TEPHRITINI
XVIII Campiglossa Rondani 29. absinthii (Fabricius)
30. cribellata Bezzi 31. lyncea (Bezzi)
XIX Dioxyna Frey 32. sororcula (Wiedemann) XX Scedella Munro 33. spiloptera (Bezzi) XXI Spathulina Rondani 34. acroleuca (Schiner) XXII Sphenella Robineau-
Desvoidy 35. sinensis Schiner
XXIII Acanthiophilus Becker
36. helianthi (Rossi)
XXIV Actinoptera Rondani 37. carignaniensis Kapoor & Grewal
38. formosana Shiraki XXV Trupanea Schrank
39. pteralis Agarwal, Grewal,
Kapoor, Gupta & Sharma 10. TERELLIINI XXVI Chaetostomella
Hendel 40. completa (Kapoor, Malla
& Ghosh) XXVII Terellia Robineau-
Desvoidy 41. Sarolensis (Agarwal &
Kapoor)
11
11
2.4 Molecular characterization of fruit flies
Homoplasmy in morphology, great economic importance, adaptation to
varied climatic conditions, a wide host range and little work on the genetic
relationship among the members of tephritid fruit flies make these flies an
excellent candidate for the study of species diversity and evolutionary processes.
Genetic markers and sequences from the mitochondrial genome in
particular, have proven to be very informative in the study of species diversity
and evolutionary processes (Shi et al. 2005; Xie et al. 2006). This is due to some
of its peculiarities, such as strictly maternal inheritance, absence of
recombination, a relatively high mutation rate and last but not least, the
availability of efficient PCR primers (Simon et al. 1994) and a wealth of
comparative data (Boykin et al. 2006; Mun et al. 2003; Shi et al. 2005; Nardi et
al. 2003; 2005; Jamnongluk et al. 2003; Reyes and Ochando 2004; Xie et al.
2006). Mitochondrial cytochrome oxidase subunit I (COI) sequences were shown
to be appropriate for intra-specific analysis because of the high degree of
polymorphism observed.
Additionally, COI sequences are at the base of the barcoding identification
system (Hebert et al. 2003; Hajibabaei et al. 2006) that, besides being a valuable
tool for species identification and discovery, has been proposed as a powerful
methodology in biosecurity and invasive species identification (Armstrong and
Ball 2005). Currently, this tool has been applied in pest monitoring and
quarantine (Armstrong and Ball 2005; Ratnasingham and Hebert 2007) and its
usefulness has been confirmed in several hexapod orders: Coleoptera (Lobl and
Leschen 2005), Diptera (Scheffer et al. 2006), Ephemeroptera (Ball et al. 2005),
Hemiptera (Foottit et al. 2008; Lee et al. 2011), Hymenoptera (Smith et al. 2008)
and Lepidoptera (Hajibabaei et al. 2006). Species identification is achieved by
comparing the sequence of an unknown sample to a reference database through
similarity methods such as BLAST (Altschul et al. 1990). The reliability of
identification depends on the extent of taxonomical coverage of the group of
12
12
interest and an understanding of the degree of variation within species (Lee et al.
2011). A case study on tephritid fruit flies (Armstrong and Ball 2005) reported
high rates of success, but also mentioned some difficulties with the identification
of a few species (e.g. B. dorsalis, B. cucurbitae, A. fraterculus), where the
occurrence of cryptic species, inadequate sampling of all genetic subgroups, and
high levels of geographic differentiation might complicate identification. However,
broader ad hoc surveys of the phylogeography and geographic variability in
species might provide valuable additions to the barcoding dataset and its
applicability in difficult groups. Modern control strategies, such as the use of
semiochemicals, sterile insect techniques, and foreseeable genetic tools, are
strictly species/strain specific, and thus require a deep knowledge of the
taxonomy and population structure of the target. This necessity becomes even
more sensible when dealing with insect groups characterized by the presence of
sibling species, such as mosquitoes and tephritid fruit flies (Hu et al. 2008).
Recently, Zhang et al. (2010) studied 689 bp nucleotide sequences of the
mitochondrial cytochrome oxidase I gene of thirty-five individuals representing 7
Bactrocera species found in the Chongqing region in China and GenBank
submitted sequences for another 20 Bactrocera species and 2 tephritid species,
Anastrepha ludens and Ceratitis capitata, which were used as outgroups for the
phylogenetic analysis. They reported Bactrocera (Tetradacus) minax and
Bactrocera (Zeugodacus) diaphora sequences for the first time, and the
subgenus Bactrocera (Tetradacus), represented by B. (T.) minax and B. (T.)
tsuneonis, was included for the first time in an analysis of the genus Bactrocera
phylogeny. Zhang et al. (2010) observed that nucleotide diversity within
subgenus ranged from 9.1 to 19.0% among the subgenera, and the net
divergence among subgenera ranged from 4.6 to 12.7%. Phylogenetic analysis
based on maximum parsimony method supported that subgenus Bactrocera
(Bactrocera) and Bactrocera (Zeugodacus) are paraphyletic. The subgenus
Zeugodacus, Bactrocera (Zeugodacus) caudate, Bactrocera (Zeugodacus)
diaphora, and Bactrocera (Zeugodacus) scutellata are closely related to
13
13
Bactrocera (Zeugodacus) tau and Bactrocera (Zeugodacus) cucurbitae. These
results indicated that subgenus Austrodacus and Zeugodacus, which attack
cucurbit plants, are closely related to species of the subgenus Afrodacus,
Bactrocera, and Gymnodacus, which attack plants of numerous families. Earlier
phylogenetic relationships among 24 Bactrocera species belonging to 9
subgenera were studied by Smith et al. (2003) with DNA sequence of portions of
the mitochondrial 16S rRNA, cytochrome oxidase II, tRNALys, and tRNAAsp
genes suggested (1) the genus Bactrocera is monophyletic, (2) the subgenus
Zeugodacus is paraphyletic, (3) the subgenus Daculus is a sister group to
subgenus Bactrocera and (4) the subgenus Bactrocera is monophyletic.
Asokan et al. (2007) reported the mtCOI based identification of three fruit
flies, B. dorsalis, B. correcta and B. zonata where molecular identification has
corroborated the morphological identification. A single fragement of
approximately 500 bp was amplified for B. dorsalis, B. correcta and B. zonata.
Sequencing results showed that the total nucleotide length obtained was 440
bases, for all the three species of fruit flies. Alignment of the above sequences in
Bioedit revealed that there was 92% similarity between B. dorsalis and B.
correcta and also between B. correcta and B. zonata. The number of nucleotides
that were different between B. dorsalis and B. correcta and between B. correcta
and B. zonata was 32 and 28, respectively. Highest variation (11%) was
observed between B. dorsalis and B. zonata, where there was difference in 45
nucleotides.
Bactrocera cucurbitae populations sampled throughout Southern China,
Thailand and the Philippines by Hu et al. (2008) observed that these populations
were genetically very similar, and most likely constitute a single phyletic unit with
no sign of cryptic species or historical separation on the basis of the
mitochondrial cytochrome oxidase I gene analysis. They also observed that a
single haplotype predominates throughout this region. However, interspecific
distances with outgroups ranged from 0.051 between B. cucurbitae and B. tau to
0.167 between B. cucurbitae and B. dorsalis.
14
14
Shi et al. (2005) conducted an analysis of population genetic structure of
B. dorsalis from China using mitochondrial cytochrome oxidase (COI) gene
sequences. They observed twentyeight haplotypes among 37 individuals with up
to 13 mutations and genetic distances reached 2.2% between haplotypes. They
also observed many haplotypes were missing in the sampled populations in the
haplotype network. However, 43 haplotypes were observed in the six Bactrocera
dorsalis populations (71 individuals) with up to 12 mutations from China using
(COI) gene sequences by Liu et al. (2007).
B. tau is a major cucurbit pest, morphologically members of the B. tau
complex show differences in the three yellow stripes on the thorax, along with
size and shape of dark bands on the dorsal abdomen. However, some species of
the B. tau complex could not be easily distinguished morphologically. Mitotic
karyotype and electrophoresis analyses of the B. tau complex have been
demonstrated to be useful tools for separation of these closely related species,
although the methods are somewhat tedious and time consuming (Baimai et al.
2000b).
Analysis of mitotic karyotypes of the larvae belonging to the same species
of adult fruit flies morphologically identified as B. tau s.s. and B. tau-like species
has revealed seven distinct chromosomal forms which are most likely to
represent seven closely related species within the B. tau complex. All members
of the B. tau complex in this study exhibited mitotic karyotype 2n=12, conforming
to the other species groups of the genus Bactrocera as previously described
(Baimai et al. 1995; 1999; 2000a).
Jamnongluk et al. (2003) compared sequences of the mitochondrial
cytochrome oxidase I gene of eight species of the Bactrocera tau complex from
Thailand using Bactrocera dorsalis, Bactrocera pyrifoliae, Ceratitis capitata,
Anopheles gambiae, and Locusta migratoria as outgroups.. The sequence
divergence between species in the B. tau complex ranged from 0.06 to 28%, and
up to 29% between the complex and its tephritid outgroups, B. dorsalis and C.
capitata.
15
15
2.5 Gut bacterial diversity in fruit flies
Insects represent one of the largest reservoirs of bacterial diversity on
Earth and about 15% of all insects harbour diverse communities of bacteria
(Brooks 1963; Buchner 1965; Douglas 1989; 1998; Stouthamer et al. 1999;
Moran et al. 2005; 2008; Wernegreen 2002; Prabhakar et al. 2009b). The insect
–bacterial association has co-evolved for more than 250 million years and have
resulted in manifold interactions between insects and bacteria, ranging from
pathogenicity to highly sophisticated symbiotic relationships (Smith and
Szathmary 1995; Werren and O‘Neill 1997; Douglas and Beard 1997;
Wernegreen 2002; Oliver et al. 2003; 2005 ) and may be extracellular or
intracellular and may play a role in the nutrition, the physiology or the
reproduction of the insect host (Dale and Moran 2006). One of the most striking
interactions is that bacteria have extended the nutritional range of insects by
supplying nutrients as endosymbionts (Douglas et al. 2001) and by accessing
otherwise indigestible substrates, such as lingo- cellulose-derived organic matter
from soils, with the help of gut bacteria (Brune 1998). Considering the extent of
the dependence between the insect and the symbiont and the age of the
association, symbionts can be classified in two groups; the obligate primary (P)
endosymbionts, which have a long evolutionary history with their hosts and they
are required for host survival and fertility, and the facultative secondary (S)
symbionts, which have established a more recent association with the host and
they have retained their ability to return to a free-living condition (Moya et al.,
2008). Petri (1909; 1910) described one of the first bacterial symbiotic
associations in an insect species, the olive fly, Bactrocera (Dacus) oleae
(Kounatidis et al. 2009, Prabhakar et al. 2009b).
Vast range of gut bacteria have been isolated and identified from different
orders of insects. Descriptions of new symbionts identified in insects are frequent
in the literature. In the present review, a summary of association between
bacteria and insects except fruit flies are presented in Table 2.1.
16
Table 2.1: Summary of a selected number of examples of insect-bacteria interactions
Insect order, common name and species name
Bacterial species (group) Type of interaction References
Orthoptera Desert locusts Schistocerca gregaria (Forskal)
Pantoea agglomerans (γ-proteobacteria)
Symbiont Dillon and Charnley 1995; Dillon et al. 2000
Thysanoptera Western flower thrips Frankliniella occidentalis (Pergande)
Pantoea agglomerans (γ-proteobacteria)
Symbiont de Vries et al. 2001a; de Vries et al. 2001b
Callembola Folsomia candida Willem
Alcaligenes facecalis
Symbiont Thimm et al.1998
Anoplura Human body louse Pediculus humanus Linnaeus
Rickettsia prowazekii
(α-proteobacteria) Obligate intracellular
Andersson et al. 1998
Hemiptera Sharpshooters Homalodisca coagulata (Say) Stinkbugs Megacopta punctatissima (Montandon) Blood sucking bug Rhodnius prolixus (Stal) Sap-sucking insects, Aphids Acyrthosiphon pisum (Harris) Schizaphis graminum Rondani Baizongia pistaciae (Linnaeus) Cinaria cedri Borner Aphids Acyrthosiphon pisum (Harris) Sap-sucking insects, Psyllids Pachypsylla venusta (Osten-Sacken) Sap-sucking insects, Whiteflies Bemisia tabaci (Gennedius) Sap-sucking insects, Mealybugs Planococcus citri (Risso)
Baumannia cicadellinicola (γ-proteobacteria) Sulcia muelleri (Bacteroidetes) Ishikawaella capsulate (γ-proteobacteria) Rhodococcus rhodnii Buchnera aphidicola Bap Buchnera BSg Buchnera BBp Buchnera aphidicola BCc (γ-proteobacteria) Hamiltonella defensa (γ-proteobacteria) Carsonella ruddii (γ-proteobacteria) Portiera aleyrodidarum (γ-proteobacteria) Tremblaya princeps (β-proteobacteria)
P-endosymbiont Extracellular symbiont Gut symbiont P-endosymbiont S-symbiont Endosymbiont P-endosymbiont Endosymbiont
Wu et al. 2006 Hosokawa et al. 2005; Hosokawa et al. 2006 Douglas 2006 Shigenobu et al. 2000 Tamas et al. 2002 van Ham et al. 2003 Perez-Brocal et al. 2006 Oliver et al. 2003; Grenier et al. 2006 Thao et al. 2004; Baumann et al. 2002
17
Insect order, common name and species name
Bacterial species (group) Type of interaction References
Neuroptera Antlion Myrmeleon bore Tjeder
Enterobacter aerogenes Bacillus cereus Bacillus sphaericus Morganella morganii Serratia marcescens Klebsiella spp
Temporal association Nishiwaki et al. 2004; Nishiwaki et al. 2007; Yoshida et al. 2001
Coleoptera Rice weevil Sitophilus oryzae (Linnaeus)
SOPE P-endosymbiont (γ-proteobacteria)
P-endosymbiont
Heddi et al. 1998
Lepidoptera Tobacco horn worm Manduca sexta (Linnaeus)
Burkholderia sp., Ralstonia sp., Cupriavidus sp., Enterococcus gallinarum, Enterococcus casseliflavus, Enterococcus saccharolyticus, Citrobacter sedlakii, Caulobacter sp., Pseudomonas spp., Enterobacter cloacae, Enterobacter aphidicola, Enterobacter aerogenes, Sphingomonas sp., Flavobacterium hydatis, Flavobacterium spp., Delftia acidovorans, Bacillus licheniformis
Gut symbiont Brinkmann et al. 2008
Hymenoptera Carpenter ant Camponotus floridanus (Buckley) Camponotus pennsylvanicus (De Geer) Honey bee Apis mellifera Linnaeus
Blochmannia floridanus
(γ-proteobacteria) Blochmannia pennsylvanicus (γ-proteobacteria) Brevibacillus formosus Stenotrophomonas maltophilia Brevibacillus brevis Bacillus fusiformis Acinetobacter calcoaceticus Bacillus spp.
Endosymbiont Symbiont
Gil et al. 2003; Zientz et al. 2006; Degnan et al. 2005 Evans and Armstrong 2006
18
18
Many studies on the dacinae fruit flies have provided valuable data on the
role of microorganisms in host plant relationships and fruit fly biology (Drew et al.
1983; Courtice and Drew 1984; Drew 1987; Drew and Lloyd 1987; Jang and
Nishijima 1990). The role of extra cellular bacteria associated with the alimentary
tract of dipteran larvae and/ or adults is only partially understood at present. Most
specific studies on the relationship of bacteria and fruit flies relate back to the
early work of Petri (1910) in which the association of organism Bacillus
(Pseudomonas) savastanoi Smith (the known cause of olive knot disease) with
Bactrocera oleae (Gmelin) was reported. He also described another bacterium
Ascobacterium luteum in association with Bactrocera savastanoi.
Stammer (1929) isolated bacteria from 37 species of tephritidae and
further described the bacterial transfer system through each stage of the life
cycle of B. oleae; but the bacteria associated were not identified. Yamvrias et al.
(1970) could not isolate either P. savastanoi or A. luteum from eggs and
oesophageal bulbs of field collected B. oleae adults as earlier reported by Petri
(1910). Girolami (1973) defined two different types of symbiosis in tephritidae;
one with bacteria in adult oesophageal bulb and other with bacteria in the blind
sacs at the anterior end of the larval midgut. The release of compact masses of
bacteria from the oesophageal bulb into the midgut has been described; however
identity of the microorganisms was not reported (Girolami 1983).
Pseudomonas (Phytomonas) melophthora was found to be associated
with all stages of Rhagoletis pomonella (Walsh), oviposition punctures, larval
burrows and exit holes in apple fruits (Allen and Riker 1932; Allen et al. 1934;
Baerwald and Boush 1968). Contrary to this, Rossiter et al. (1983) identified
bacteria associated with R. pomonella as Klebsiella oxytoca and Enterobacter
cloacae, and reported that the bacteria are necessary for normal development in
most tephritid species. The bacterium associated with B. cucurbitae adults and
larval stages, was identified as Pseudomonas pseudomalaii (Gupta et al. 1982a;
1982b; Gupta and Pant 1983).
19
19
Tsiropoulos (1976) found 15 morphologically different bacteria associated
with the walnut husk fly, R. completa (Cresson), but only the Pseudomonas spp.
and Xanthomonas spp. were found associated with all stages of the fly. Howard
et al. (1985) also characterized the oesophageal bulb inhabitants of six
Rhagoletis spp. and discovered a diverse microbial flora, although K. oxytoca
predominated in every species of fly. Twenty different strains of bacteria from
laboratory reared B. dorsalis and 23 strains from wild adults, characterized as
members of family Enterobacteriaceae have been reported (Jang and Nishijima
1990). Most common bacteria associated with Bactrocera flies were Citrobacter
freundii, E. agglomerans, E. cloacae, K. oxytoca and Kluyvera spp. (Lloyd et al.
1986; Jang and Nishijima 1990). These bacteria were collectively referred as
―Fruit fly type‖ bacteria. Studies suggested that the flies were colonized by the
bacteria which were fed and that the dinitrogen fixing activity associated with the
flies was localized within these colonizing bacteria (Murphy et al. 1994). In
tephritidae, specific bacteria belonging to Enterobacteriaceae (Erwinia herbicola,
E. cloacae and K. oxytoca) are believed to mediate interactions between the
adult fruit flies and the larval host plant. The general pattern of results suggested
that female flies coming to oviposit on fruiting hosts were spreading
Enterobacteriaceae (Raghu et al. 2002). Eighteen different bacterial species
belonging to the family Enterobacteriaceae, Pseudomonadaceae, Vibrionaceae,
Micrococcaceae, Deinococcaceae, Bacillaceae and the genus Listeria,
Enterobacter, Providencia, Serratia and Staphyloccocus spp. were most
frequently isolated from the gut of Mexican fruit fly, Anastrepha ludens (Loew).
Some isolates were resistant to penicillin and ampicillin probably having
ecological significance with respect to intra- and inter-specific competition within
host cadavers (Kuzina et al. 2001). Sood and Nath (2002) studied bacterial
association in two species of fruit flies, B. tau and B. cucurbitae in Himachal
Pradesh (India) and isolated 11 types of bacteria associated with Bactrocera spp.
out of which five were common to both the species viz., Pseudomonas putida,
Erwinia herbicola (Pantoea agglomerans), Cedacea davisae, Arthrobacter spp.
20
20
and Xanthomonas maltophilia (Stenotrophomonas maltophilia). Jamnongluk et
al. (2002) reported endosymbiotic bacteria of the genus Wolbachia (widespread
among arthropods) from tephritid fruit flies. Belcari et al. (2003) isolated nine
species of bacteria from the oesophageal bulb of the olive fruit fly (B. oleae) and
eight species from the phylloplane of the host plant. Only three species viz.
Agrobacterium radiobacter, Pseudomonas putida and Serratia marcescens were
isolated from both. A range of bacteria belonging to different genera viz.
Acetobacter, Agrobacterium, Arthrobacter, Listeria, Enterobacter, Pantoea,
Pectobacterium, Klebsiella, Citrobacter, Erwinia, Bacillus, Lactobacillus,
Kluyvera, Micrococcus, Pseudomonas, Staphylococcus, Streptococcus, Proteus,
Providencia, Hafnia, Serratia and Xanthomonas have been isolated and
characterized from the fruit fly gut. (Lloyd et al. 1986; Drew and Lloyd 1987; Jang
and Nishijima 1990; Lauzon et al. 1998; 2000; Zinder and Dworkin 2000; Bergey
et al. 2001; Kuzina et al. 2001; Marchini et al. 2002; Sood and Nath 2002; Belcari
et al. 2003; Behar et al. 2005; 2008; 2009; Capuzzo et al. 2005; Sacchetti et al.
2008; Kounatidis et al. 2009; Prabhakar et al. 2009b). However, tephritid gut
bacteria mostly belong to family Enterobacteriaceae and two species viz.
Klebsiella and Enterobacter are the predominant ones (Drew and Lloyd 1987;
Zinder and Dworkin 2000, Behar et al. 2005; Prabhakar et al. 2009b). Recently,
Crotti et al. (2010) reported that microbe-insect symbiosis had established acetic
acid bacteria (AAB) as symbionts of several insects of the orders Diptera
including fruit fly Bactrocera oleae, Hymenoptera, Hemiptera, and Homoptera.
An increasing number of reports of associations of bacteria with insects in
general and fruit flies in particular cannot be considered just environmental
microorganisms but are indeed symbionts of the host body, where they occupy a
specific favourable niche. But, still there is a paucity of information on this aspect
and research in this particular area with modern molecular tools is essential in
order to strengthen knowledge on fruit fly ecology and clarification of the
function(s) exerted by the bacteria in and for their hosts will be a major step
toward understanding the bacterium-fruit fly association.
21
21
2.6 Molecular characterization of gut bacteria
Molecular approaches for the detection and characterization of microbes
have resulted in dramatic change in our understanding of microbial diversity. It is
now recognized that approximately 99 per cent of the microbes in the
environment can not be cultivated (Amann et al. 1995). However, nucleic acid
based approaches for the characterization of microbes have provided new
informations inspite of their own limitations (Head et al. 1998). Nucleic acid
sequence approaches, particularly those using 16S rRNA genes, are enabling
the identification of the microbial community of insects (Brauman et al. 2001;
Toth et al. 2001)
RAPD-PCR analysis has been used to compare the strains of bacteria
between insects and within the generations. Some bacteria in the thrips persisted
for two years through 50 generations and were therefore indigenous bacteria,
whereas transient bacteria ingested with food did not pass to the next
generations (de Vries et al. 2001a; 2001b).
Profiling the insect gut microbiota is now feasible using methods based on
the 16S rRNA gene. Molecular and cultural techniques were used to examine the
Sitophylus oryzae Linn. principal endosymboites (SOPE) and were compared
with proteobacteria (Heddi et al. 1998) and found that SOPE belongs to
Enterobacteriaceae family and share 95.0 and 94.1 per cent sequence homology
with Escherichia coli and Salmonella paratyphi, respectively. The closest
symbiotic bacteria to SOPE are the primary endosymbiotes of S. zeamais
Motsch (97.8 per cent) and closest free living bacteria to SOPE is Erwinia
herbicola (96.00 per cent) (Heddi et al. 1998). In another study, Bauer et al.
(2000) showed significant genetic diversity in enumerated lactic acid bacteria
using ERIC-PCR (enterobacterial repetitive intergenic consensus).
For the first time, five distinct strains of Wolbachia in Bactrocera ascita
based on wsp (Wolbachia specific primers) gene sequence were reported by
Jamnongluk et al. (2002). It was also stated that four of the five Wolbachia
22
22
strains were in the same group as those found in other tephritid fruit flies,
suggesting possible horizontal transmission of Wolbachia from other fruit flies
into B. ascita.
Waleron et al. (2002) studied the genotypic characteristics of Erwinia
based on PCR-RFLP analysis (polymerase chain reaction- restriction fragment
length polymorphism) of the recA gene fragment. The results indicated that PCR-
RFLP analysis of recA gene fragment is a useful tool for identification of species
and subspecies of Erwinia. Whereas. Sood and Prabhakar (2009) studied
genotypic characteristics of gut bacteria of fruit fly, Bactrocera tau with RAPD
and PCR-RFLP using recA gene and rrs gene and reported PCR–RFLP profile of
three symbionts was more authentic than RAPD–REP–PCR profile as PCR–
RFLP profile was based on the specific bacterial gene than profile generated
through RAPD–REP–PCR where, amplification of DNA can occur anywhere in
the genome. The PCR–RFLP profile of three symbionts of fruit fly was also
supported by the antibiotic sensitivity pattern of different symbionts of fruit flies.
PCR amplification and nucleotide sequencing of the entire 16S rRNA gene
of symbiotic bacteria of the olive fruit fly (B. oleae) consistently yielded a single
sequence that displayed marked similarity with enterobacterial lineages, with
closest matches (97%) to Erwinia persicina and E. rhapontici. The symbiont's
identity was also distinct from Pseudomonas savastanoi. A novel species was
proposed, by virtue of its unique properties, under the designation ‗Candidatus
Erwinia dacicola‘ (Capuzzo et al. 2005). However, Kounatidis et al. (2009)
investigated the association between Acetobacter tropicalis and B. oleae with
cultivation-dependent and -independent techniques. Using an A. tropicalis
specific PCR assay, the symbiont was detected in all insects tested originating
from laboratory stocks or field collected from different locations in Greece. This
acetic acid bacterium was successfully established in cell-free medium, and
typing analyses, carried out on a collection of isolates, revealed that different A.
tropicalis strains are present in fly populations. Three symbionts were
23
23
characterized from fruit fly Bactrocera tau, with traditional microbiological
techniques as well as modern PCR based tools with 16S rDNA (rrs gene)
sequence analysis by Prabhakar et al. (2009b). They observed two bacteria from
family Enterobacteriaceae i.e. Klebsiella oxytoca and Pantoea agglomerans and
one bacterium from family Staphylococcaceae namely Staphylococcus sp.
2.7 Bacterial odours as attractants for fruit flies
The attractancy of protein solutions containing bacteria to fruit flies was
first reported by Gow (1954), when B. dorsalis in Hawaii responded strongly to
solutions containing a Proteus species. Cultures of fruit fly type bacteria growing
on peptone yeast extract agar (Drew et al. 1983) and hydrolyzed protein
solutions inoculated with these bacteria are strong attractants for Bactocera
species (Drew and Fay 1988). When plates inoculated with these bacteria were
exposed on the host trees, wild flies were attracted to and fed on bacteria.
The attractant emitted by hydrolyzed protein solution, with and without
bacteria are not known, although various protein bait formulations have been
used in fruit fly control programmes for many years (Bose et al. 1978). Drew and
Fay (1988), on the other hand, deduced that ammonia was only a weak
attractant and that certain bacterial metabolites were the primary attractants.
Drew (1987) proposed that bacterial volatiles such as 2-butanone were important
attractants in dacinae and served as a feeding attractant to females and a sex
attractant to mature males.
Evidence from field studies supported the theory that bacterial odours
enhance host attractancy. An extended field study of a wild fly population in a
peach tree in Queensland indicated that the host tree become more attractive to
flies after a short period of occupation by a small population of flies (Drew and
Lloyd 1987). Jang and Nishijima (1990), in a laboratory experiment, studied the
attractancy of bacteria and PIB-7 (Protein hydrolyzate) and observed significantly
higher response of flies (B. tryoni) to the bacteria in the absence of PIB-7, but
relatively lower response of flies to bacteria alone when PIB-7 was also a
treatment.
24
24
Certain components of bacterial odours serve as either feeding or
ovipositional stimulants (Drew and Lloyd 1987). Under laboratory conditions, flies
frequently returned to the same spot, regurgitate and reingest several times
(Lloyd 1988). This behaviour involved some form of host marking system and
bacterial odours were reported to be evolved. Robacker and Flath (1995)
identified ammonia, trimethylamine, isoamylamine, 2-methyl-butylamine, 2, 5-
dimethylpyrazine and acetic acid from the culture of Staphylococcus aureus. In
contrary to this, Lee et al. (1995) identified 3-methyl-1-butanol, phenethyl alcohol,
2, 5-dimethylpyrazine, 2-methyl-1-propanol and 3-(methylthio)-1-propanol as
volatile components from bacteria, K. pneumoniae. All the chemicals attracted
Mexican fruit flies. However, the attractiveness of E. agglomerans isolated from
apple maggot and Mexican fruit fly towards Mexican fruit fly did not vary
significantly despite the variation in volatiles produced by them (Robacker et al.
2004). It was concluded that combinations of attractive chemicals sometimes are
not attractive. Sood et al. (2010) studied washed and fermented bacterial
preparation of two predominant B. tau symbionts, Klebsiella oxytoca and
Pantoea agglomerans (reported in earlier publication Prabhakar et al. 2009b) for
their attractancy to two fruit fly species (B. cucurbitae and B. tau) under
laboratory conditions. Pantoea agglomerans (washed bacterial preparation) in
combination with sugar attracted maximum number of B. cucurbitae, while
protein hydrolyzate in combination with sugar attracted maximum number of B.
tau. All the combinations of washed bacteria proved superior to control (sugar
alone) in terms of attractancy for both species. As fermented bacterial
preparation, Klebsiella oxytoca in combination with jaggary attracted maximum
fruit flies of both the species when applied on potted cucumber plants (Sood et
al. 2010).
The response of fruit flies to their type bacteria suggests that a system of
bacterial attraction for fruit flies probably exists in nature and may play a vital role
in fruit fly behaviour.
25
25
2.8 Role of bacteria in the IPM of fruit flies
Control of fruit flies by manipulating its symbiotes has been proposed long
back in 1929-30. Foliar application of copper carbonate was recommended for
killing the symbiotic bacteria and later on this preparation was improved by
adding sugar (Baker et al. 1944; Fytizas and Tzanakakis 1966a; 1966b). The use
of antibiotics like streptomycin has also been proposed which rapidly kill
symbiotes and the resultant larvae die soon after hatching from the eggs.
Recontamination of the adults with microorganisms can certainly occur but the
progeny of recontaminated parents have a considerably reduced rate of survival.
The antibiotics, oxytetracyclin and sulphanilamide administrated to the
larvae of the gourd fruit fly, B. cucurbitae, destroyed the symbiotic
microorganisms in the mycetocytes of the mid gut region. The depopulated
mycetocytes were with prominent vacuoles, and the treated larvae had reduced
survival rates (Chinnarajan et al. 1972). However, all these approaches could not
be commercialized because of low efficacy of copper carbonate and residual
hazards of streptomycin and other antibiotic treatments. Sood and Nath (1998)
evaluated some insecticide attractant solutions containing bacteria in yellow traps
for mass trapping of fruit flies. Jaggery trap attracted maximum number of flies
followed by ethyl methyl ketone + ammonium acetate + sugar, ethyl methyl
ketone + sugar, Erwinia herbicola + sugar. Copper could play an important role
as symbioticide, in destroying the fruit fly associated bacteria and thus helpful in
managing first and second instar larvae of olive fruit fly (Belcari and Bobbio
1999). Application of fruit fly symbionts under field conditions at Palampur
(Himachal Pradesh) during 2006-07 as foliar application and as bait in
combination with insecticide, K. oxytoca resulted in significant reduction in fruit fly
infestation (65.46 %) over untreated control (79.56 %) (Sood et al. 2010). The
attractancy of gut bacterial symbionts to fruit fly species in spite of low field
efficacy indicate that symbiotic bacteria could be exploited for its surveillance and
management (Sood et al. 2010). Endosymbiotic bacteria of the genus Wolbachia
26
26
induce cytoplasmic incompatibility, thelytokous parthenogenesis, male-killing or
feminization in their hosts, thus may be useful in IPM (Jamnongluk et al. 2002).
The symbiotic bacteria modified with toxin genes can be used in the
management of fruit flies (Sood and Nath 2005). Symbiont biology receives
increasing attention because insect symbionts can potentially be used to control
vector borne diseases or suppress insect pests (Crotti et al. 2010).
27
27
3. MATERIALS AND METHODS
The research work of the present investigation entitled ―Biodiversity
of fruit flies (Tephritidae: Diptera) and utilization of gut bacteria in their
management” was carried out in the Departments of Entomology,
Microbiology and Plant Pathology (Molecular Plant Pathology laboratory),
CSK Himachal Pradesh Krishi Vishvavidyalaya, and Division of Natural Plant
Products, Institute of Himalayan Bioresource Technology (IHBT), Palampur
(H.P.), during 2008 to 2010. Geographically, the experimental site is situated
at 32o6‘ N latitude and 76o3‘ E longitude and at an elevation of 1290.8 m
above mean sea level in North Western Himalayas.
The details of materials used and methods employed during the
present investigations are described in this chapter.
3.1 Survey and identification of fruit flies infesting cucurbits
An extensive survey was undertaken to know the prevalence and
diversity of fruit fly species in Himachal Pradesh and other states of India
(Table 3.1) with the help of insect collecting net, fruit fly para-pheromones
and collection of infested fruit and flower samples comprising minimum of ten
fruit fly infested fruits during the peak activity of fruit flies in the area. The
fruit fly infested samples from each location were kept in separate rearing
cages (20 x 15 x 18 cm3) under laboratory conditions at Palampur. The
emerging fruit fly adults were identified on the basis of morphological
descriptions given by Kapoor et al. (1980), Agarwal and Kapoor (1988),
White and Elson-Harris (1992), Hardy and Drew (1996), Drew et al. (1998),
Hancock and Drew (1999), and Drew and Raghu (2002). Identified fruit flies were
kept in separate vials and stored under refrigerator at -20oC for DNA extraction.
28
Table 3.1: Surveyed locations for sample collection
Sr. No.
State (s) District (s) Place (s) Latitude* DM
Longitude* DM
Elevation* m (amsl)
Sample collected/ Method
India
1 Himachal
Pradesh
Bilaspur Chandpur 31o21‘ N 76o47‘ E 1020 Infested fruits
2 Ghumarwin 31o25‘ N 76o43‘ E 625 Infested fruits
3 Nihari 31o25‘ N 76o39‘ E 681 Trapping
4 Chamba Banikhet 32o33‘ N 75o57‘ E 1538 Infested fruits
5 Hamirpur Bhota 31o37‘ N 76o33‘ E 889 Infested fruits
6 Nadaun 31o46‘ N 76o20‘ E 460 Infested fruits
7 Kangra Indora 32o7‘ N 75o40‘ E 329 Infested fruits
8 Jawalamukhi 31o53‘ N 76o17‘ E 470 Infested fruits
9 Kangra 32o4‘ N 76o16‘ E 792 Infested fruits
10 Palampur 32o6‘ N 76o32‘ E 1290 Infested fruits and
flowers, trapping, with
insect collection net
11 Shahpur 32o13‘ N 76o11‘ E 912 Infested fruits
12 Paragpur 31o48‘ N 76o14‘ E 606 Trapping
13 Kullu Naggar 32o5‘ N 77o9‘ E 2067 Infested fruits
14 Mandi Barot 32o02‘ N 76o50‘ E 2690 Infested fruits and
flowers
15 Mandi 31o42‘ N 76o55‘ E 806 Infested fruits
29
Sr. No.
State (s) District (s) Place (s) Latitude* DM
Longitude* DM
Elevation* m (amsl)
Sample collected/ Method
16 Nagwain 31o49‘ N 77o10‘ E 1116 Infested fruits
17 Sundernagar 31o31‘ N 76o54‘ E 1120 Infested fruits
18 Solan Nauni 30o56‘ N 77o2‘ E 1546 Infested fruits
19 Saproon 30o56‘ N 77o31‘ E 2386 Infested fruits
20 Una Haroli 31o33‘ N 75o59‘ E 593 Infested fruits
21 Haryana Karnal Karnal 29o41‘ N 76o59‘ E 71 Infested fruits
22 Karnataka Bengaluru Bengaluru 12o58‘ N 77o38‘ E 280 Trapping
23 Delhi Delhi IARI 28o37‘ N 77o9‘ E 229 Infested fruits
24 Bihar Patna Patna 25o37‘ N 85o12‘ E 60 Infested fruits
25 Nalanda Bihar Sharif 25o11‘ N 85o31‘ E 65 Infested fruits
26 Samstipur RAU, Pusa 25o58‘ N 85o40‘ E 58 Trapping
27 Uttar Pradesh Ghaziabad Ghaziabad 28o46‘ N 77o30‘ E 217 Infested fruits
28 Maharashtra Solapur Solapur 17o40‘ N 75o55‘ E 460 Infested fruits
Nepal
29 Dhankuta 26o58‘ N 87o20‘ E 1445 Trapping
*Lat_lon (DM) and elevation in meter (above mean sea level) were provided by CGIRT, CSKHPKV, Palampur,
Himachal Pradesh-176 062
30
30
3.2 Raising of parental stock cultures
A parental stock culture of fruit flies in the laboratory was raised from
field collected infested fruits of cucumber at room temperature in specially
designed rearing cages (38 x 38 x 45 cm3). A polyethylene sheet was fitted
over the base of the cage and filled with mixture of sterile fine sand and saw
dust upto 5 cm height for pupation. The adults were provided with their
natural host as well as a mixture of dry glucose and protein hydrolyzate
(Protinex® Dumex Sciences, New Delhi) in the ratio of 1:1 in a Petri plate
which was replaced at weekly intervals. Flies were also provided with water
soaked cotton in a 50 ml beaker ad libitum. To prevent access of predatory
ants to the cages, these were placed on water filled plastic plates in which
water was changed daily.
3.3 Molecular characterization of fruit flies
3.3.1 DNA extraction
Total genomic DNA of each isolate was extracted following the
procedure of Sharma et al. (2005) with minor modifications. Details of
different isolates of fruit flies used for molecular characterization are
presented in Tables 3.2a and 3.2b. For extracting total genomic DNA, the
individual fruit fly was immersed in liquid nitrogen container for one min. and
ground to fine powder using micro pestle. To each tube 700 μl of CTAB
extraction buffer (Table 3.3) was added. All tubes were incubated at 65oC for
1h in a water bath (YORK Scientific Industries, Delhi).
To each tube equal volume (700 μl) of chloroform: isoamyl alcohol
(24:1) was added. The contents were mixed thoroughly and tubes were spun
at 10,000 rpm for 12 min. in high speed refrigerated centrifuge (REMI India)
at 4oC. Aqueous phase was transferred to new tubes and 450 μl prechilled
isopropanol was added and kept at -20oC for 20-30 min. to precipitate the
DNA. Tubes were then spun at 10,000 rpm for 12 min. and supernatant was
decanted. The DNA pellet was washed thrice with 70 per cent ethanol, dried
31
Table 3.2a: Bactrocera cucurbitae (Coquillett) isolates used for molecular characterization
Sr. No. Isolate
number
Host/ Trap Host scientific name/ lure name Location District
1 P101 Bitter gourd Momordica charantia Linnaeus Nadaun Hamirpur
2 P102 Cucumber Cucumis sativus Linnaeus Bhota Hamirpur
3 P103 Cucumber Cucumis sativus Linnaeus Sundernagar Mandi
4 P104 Cucumber Cucumis sativus Linnaeus Mandi Mandi
5 P106 Cucumber Cucumis sativus Linnaeus Patna Patna (Bihar)
6 P107 Bottle gourd Lagenaria siceraria (Molina) Bihar Sharif Nalanda (Bihar)
7 P108 Bottle gourd Lagenaria siceraria (Molina) Ghaziabad Ghaziabad (U.P)
8 P109 Bottle gourd Lagenaria siceraria (Molina) IARI Delhi
9 P110 Cucumber Cucumis sativus Linnaeus Ghumarwin Bilaspur
10 P111 Cucumber Cucumis sativus Linnaeus Solapur Solapur (MH)
11 P112 Bitter gourd Momordica charantia Linnaeus Indora Kangra
12 P113 Bottle gourd Lagenaria siceraria (Molina) Indora Kangra
13 P114 Bitter gourd Momordica charantia Linnaeus Nagwain Mandi
14 P115 Cucumber Cucumis sativus Linnaeus Jawalamukhi Kangra
15 P117 Cucumber Cucumis sativus Linnaeus Haroli Una
16 P119 Cucumber Cucumis sativus Linnaeus Karnal Karnal (Haryana)
17 P120 Trap Cue lure Bengaluru Bengaluru (Karnataka)
18 P121 Trap Cue lure RAU Pusa Samastipur (Bihar)
19 P122 Trap Cue lure Nihari Bilaspur
20 P123 Trap Cue lure Dhankuta Dhankuta (Nepal)
32
Table 3.2b: Fruit fly species used for molecular characterization
Sr. No. Isolate(s)
number
Fruit fly species name
Host plant/ trap Host scientific name/ lure name Location District
1 P1 Bactrocera tau (Walker)
Bottle gourd Lagenaria siceraria (Molina) Nadaun Hamirpur
2 P2 Bactrocera tau (Walker)
Bitter gourd Momordica charantia Linnaeus Nadaun Hamirpur
3 P4 Bactrocera tau (Walker)
Cucumber Cucumis sativus Linnaeus Palampur Kangra
4 P5 Bactrocera tau (Walker)
Summer squash Cucurbita pepo Linnaeus Nauni Solan
5 P7 Bactrocera tau (Walker)
Cucumber Cucumis sativus Linnaeus Banikhet Chamba
6 P8 Bactrocera tau (Walker)
Cucumber Cucumis sativus Linnaeus Nadaun Hamirpur
7 P9 Bactrocera tau (Walker)
Cucumber Cucumis sativus Linnaeus Mandi Mandi
8 P10 Bactrocera tau (Walker)
Cucumber Cucumis sativus Linnaeus Ghumarwin Bilaspur
9 P11 Bactrocera tau (Walker)
Bitter gourd Momordica charantia Linnaeus Nagwain Mandi
10 P12 Bactrocera tau (Walker)
Bitter gourd Momordica charantia Linnaeus Palampur Kangra
11 P13 Bactrocera tau (Walker)
Pumpkin Cucurbita maxima Duchesne Barot Mandi
12 P14 Bactrocera tau (Walker)
Cucumber Cucumis sativus Linnaeus Jawalamukhi Kangra
13 P15 Bactrocera tau (Walker)
Bitter gourd Momordica charantia Linnaeus Jawalamukhi Kangra
33
14 P16 Bactrocera tau (Walker)
Cucumber Cucumis sativus Linnaeus Chandpur Bilaspur
15 P18 Bactrocera tau (Walker)
Bitter gourd Momordica charantia Linnaeus Shahpur Kangra
16 P20 Bactrocera tau (Walker)
Trap Cue lure Nihari Bilaspur
17 P302 Bactrocera scutellaris (Bezzi)
Trap Cue lure Palampur Kangra
18 P401 Bactrocera zonata (Saunders)
Trap Methyl eugenol Palampur Kangra
19 P501 Bactrocera dorsalis (Hendel)
Litchi Litchi chinensis Sonnerat Palampur Kangra
20 P502 Bactrocera dorsalis (Hendel)
Mango Mangifera indica Linnaeus Palampur Kangra
21 P503 Bactrocera dorsalis (Hendel)
Trap Methyl eugenol Palampur Kangra
22 P504 Bactrocera dorsalis (Hendel)
Guava Psidium guajava Linnaeus Palampur Kangra
23 P508 Bactrocera dorsalis (Hendel)
Trap Methyl eugenol Paragpur Kangra
24 P601 Bactrocera nigrofemoralis White & Tsuruta
Trap Cue lure Palampur Kangra
25 P701 Dacus longicornis Wiedemann
Trap Cue lure Palampur Kangra
26 P1601 Dacus sphaeroidalis (Bezzi)
Trap Cue lure Palampur Kangra
27 P1602 Dacus sphaeroidalis (Bezzi)
Trap Cue lure Palampur Kangra
34
34
and dissolved in 100 μl of Tris EDTA (10mM Tris HCl and 1mM EDTA pH
8.0). RNAase @ 10 μl/ ml (MBI Fermentas) was added and emulsion was
incubated for half an hour at 37oC. The amount of DNA was quantified by
recording the absorbance at 260 nm wavelength using UV/VIS
spectrophotometer (Bio Rad, SmartSpec 3000). DNA was stored at -20oC for
further use.
Table 3.3 : Reagent and concentration of DNA extraction buffer
Reagent Stock concentration
Working concentration
Working solution (100 ml)
Tris HCl (pH- 8.0), 100 mM
1 M 100 mM 10 ml
NaCl 1.4 M 5 M 1.4 M 28 ml
EDTA (pH- 8.0) 0.5 M 20 mM 4 ml
CTAB (2%) 2 g
PVP (1 %) 1 g
Water (RNAase and DNAase free)
55 ml
Total 100 ml
3.3.2 Primers used
A 700 bp long fragment of mitochondrial cytochrome oxidase subunit I
gene (mtCOI gene) was amplified using the forward primer UEA 7 and
reverse primer UEA 10, developed by Lunt et al. (1996). The base
sequences of primers (Table 3.4) were custom synthesized (Life
Technologies (India) Pvt. Ltd.).
Table 3.4: Base sequences of UEA 7 and UEA 10 primer
Name of the Primer Sequence (5‘ to 3‘)
UEA 7 (Forward) 5‘ TACAGTTGGAATAGACGTTGATAC 3‘
UEA 10 (Reverse) 5‘ TCCAATGCACTAATCTGCCATATTA 3‘
35
35
3.3.3 PCR amplification
The PCR amplification was carried out in 0.2ml PCR tubes with 20 μl
reaction volume consisting following reaction mixture:
Reaction Mixture Quantity (µl)
Buffer 10 X 2.0
MgCl2 (25 mM) 2.0
dNTPs mix (10 mM each)
(Fermentas)
0.5
Taq DNA polymerase (5U/µl),
(Life Technologies (India) Pvt. Ltd)
0.2
Primer forward (10 µM) 20 pmol 1.0
Primer reverse (10 µM) 20 pmol 1.0
Water (SDW) 11.3
DNA (20ng) 2.0
Total Volume 20.0
Reaction mixture was vortexed and centrifuged in a microfuge
(Bangalore Genei, India). Amplifications were performed using thermal cycler
(GeneAmp PCR system 9700, Applied Biosystems, USA) with following
temperature transitions:
Steps Temperature (oC) Time (minute)
1. Initial denaturation 94 3.00
2. Denaturation 94 1.00
3. Annealing 50 1.00
4. Elongation 72 1.00
36
36
The thermal cycler was programmed for 35 cycles with one cycle of
initial denaturation and steps 2-4 were repeated 35 times and a final
extension at 72oC for 30 min. using fastest ramp time between the
temperature transitions.
3.3.4 Agarose gel electrophoresis of PCR product
The PCR products were resolved by electrophoresis using 3 per cent
agarose gel in 0.5X Tris borate EDTA buffer. DNA ladders of 100 bp and
Lambda DNA / EcoR I – Hind III double digest were used as markers. The
gels were run at 80V for 2 h using Bangalore Genei power pac system,
stained with ethidium bromide (0.5 μg / ml) for 10 min after electrophoresis,
viewed and images were captured using Alphalmager 2200 (Alpha Infotech
Corporation, San Leandro, CA) gel documentation system.
3.3.5 Sequencing and Data Analysis
PCR products of mtCOI gene of different fruit fly isolates obtained
through amplification with specific primer were freeze dried (CHRIST ALPHA
I-2LD) and sent for custom sequencing using same upstream and
downstream primers to Xcelris labs limited, Ahmadabad, India.
3.3.6 Nucleotide sequence analysis of B. cucurbitae isolates
The sequences of different fruit fly isolates were blasted using on-line
NCBI Blastn program http://www.ncbi.nih.gov/blast (Altschul et al. 1997) and
twenty three sequences of mtCOI of B. cucurbitae isolates available in the
GenBank Nucleotide Database, NCBI were selected for sequence
comparison (Table 3.5). The selected sequences along with thirty three
submitted sequences were aligned by ClustalW program
(http://www.ebi.ac.uk/clustalw/) (Higgins et al. 1994).
Analysis of genetic and phylogenetic relationships was performed using
MEGA 4.1 Software (Tamura et al. 2007). Genetic distances among every
isolate of B. cucurbitae and outgroups were calculated based on the pairwise
matrix of sequence divergences using the Kimura two-parameter method
37
37
(Kimura 1980). The UPGMA (Sneath and Sokal 1973) or/and
distance/neighbor-joining (Saitou and Nei 1987) method was/ were used for
phylogeny reconstruction. Confidence levels (Felsenstein 1985) for UPGMA an
NJ tree were assessed by bootstrap (500 replications). Population structure and
minimum spanning tree (MST) among B. cucurbitae haplotypes was constructed
using Arlequin 3.1 (Excoffier et al. 2005) and program TREEVIEW (Page 1996)
was used to draw the minimum spanning tree (MST). A minimum spanning
network was constructed using TCS1.21 (Clement et al. 2000)
Table 3.5: GenBank sequences of mtCOI gene of Bactrocera cucurbitae used in phylogenetic analysis
Sr. No. Country name GenBank accession number
1 China EU599634
2 China EU048559
3 China EU048560
4 China EU048563
5 China EU048561
6 China EU048564
7 China EU048565
8 China EU048566
9 China EU048567
10 China AY398758
11 Japan AY530900
12 Japan AB192449
13 Malaysia FJ903497
14 Sri Lanka AB192451
15 Thailand AF423110
16 Thailand AB192452
17 USA AY945039
18 USA AY945040
19 USA AY945041
20 USA AY945052
21 USA AY945051
22 USA AY945050
23 USA AY945049
38
38
3.3.7 Nucleotide sequence analysis of B. tau isolates
The detailed procedures of nucleotide sequence analysis are given in
the section 3.3.6.
Analysis of genetic and phylogenetic relationships was performed using
MEGA 4.1 Software (Tamura et al. 2007). Genetic distances among every
isolates of B. tau and outgroups were calculated based on the pairwise matrix of
sequence divergences using the Kimura two-parameter method (Kimura 1980).
The UPGMA (Sneath and Sokal 1973) method was used for phylogeny
reconstruction. Confidence levels (Felsenstein 1985) for UPGMA tree were
assessed by bootstrap (500 replications).
Table 3.6: GenBank sequences of mtCOI gene of Bactrocera tau used in phylogenetic analysis
Sr. No. Country name GenBank accession number
1 China AY398753
2 China EU048569
3 Japan AY530901
4 Malaysia FJ903496
5 Thailand AF400067
6 Thailand AY151138
7 Thailand AF400073
8 Thailand AF400072
9 Thailand AF400071
10 Thailand AF400070
11 Thailand AF400069
12 Thailand AF400068
39
39
3.3.8 Nucleotide sequence analysis of other fruit flies species
The same procedures were employed for the analysis of all fruit fly
sequences as described in the section 3.3.6. Analysis of genetic and
phylogenetic relationships was performed using MEGA 4.1 Software (Tamura
et al. 2007). Genetic distances among every isolates of fruit flies and outgroups
were calculated based on the pairwise matrix of sequence divergences using the
Kimura two parameter method (Kimura 1980). The UPGMA (Sneath and Sokal
1973) method was used for phylogeny reconstruction. Confidence levels
(Felsenstein 1985) for UPGMA tree were assessed by bootstrap (500
replications).
3.4 Isolation and characterization of gut bacteria from B. tau
Brain heart infusion agar (BHIA) (Hi-media) and peptone yeast extract
agar (PYEA) were used for isolating bacteria from gut of B. tau. Peptone
yeast extract broth (PYEB) and peptone yeast extract agar (PYEA) were
then used throughout the experiment for culturing bacteria outside the host
tissues.
PYEB: Peptone-10 g, Yeast extract- 5 g, NaCl- 5 g, Distilled Water-
1000 ml, pH- 7.2
PYEA: Peptone-10 g, Yeast extract- 5 g, NaCl- 5 g, Agar- 15 g,
Distilled Water - 1000 ml, pH- 7.2
3.4.1 Isolation of bacteria from fruit fly gut
The adult flies after surface sterilization with alcohol (70%) for 30 sec.
followed by sodium hypochloride (0.25%) for one min. and then washed
three times with sterilized distilled water (SDW), were dissected open with
the help of sterilized needles, forceps and scissors. Gut of the fruit fly was
removed under aseptic conditions (in the laminar flow).
40
40
The gut of individual fly was rinsed with alcohol (70%) for 30 sec.
followed by sodium hypochloride (0.25%) for one min. and then washed
three times with sterilized distilled water (SDW). A loopful content from each
was streaked separately on PYEA and BHIA plates. The plates were
incubated at 30oC for 48-72 h and were examined for bacterial growth. The
whole set of experiment was repeated three times at weekly intervals, using
randomly trapped flies from the stock culture.
3.4.2 Screening of gut bacterial isolate for fruit fly attractancy
Thirty gut bacterial isolates were used to study the attractiveness to B.
tau. Pure culture (72 hrs old) of different bacterial isolates was grown on
PYE broth medium. The bacterial isolates were taken in separate Petri plates
and kept inside the cage (45 x 45 x 55 cm3) with un-inoculated PYE broth as
control. Twenty five pairs of 5 days old fruit flies were released in the cage
and flies visiting each treatment were recorded for 30 min. The experiment
was repeated six times for B. tau and data obtained were analyzed
statistically. On the basis of screening, five most promising gut bacteria of B.
tau were selected for their characterization, attractiveness to fruit flies and
GCMS analysis for identification of volatile chemicals.
3.4.3 Identification of bacterial isolates
The pure cultures of five promising gut bacteria viz. PIB, P3A, P10A,
B4A and B10B of B. tau were maintained on PYEA slants and PYEA plates
at refrigerated temperature (4-8oC).
Morphological, cultural, biochemical and molecular characteristics
were studied and an attempt was made to identify the bacterial isolates
following the techniques given in the manual of Kanwar et al. (1997) and
these results were compared with Bergey's Manual of Determinative
Bacteriology (Holt et al. 2000).
For studying the morphological, cultural and biochemical
characteristics, 48 h old culture of the test bacterium on PYEA was
employed. All tests were carried out in duplicate along with a control set.
41
41
3.4.3.1 Morphological characterization
Cell shape and Gram‘s reaction were studied, following the standard
procedures and staining reagents as described by Kanwar et al. (1997).
Colony morphology, growth pattern and pigment production were studied by
following the standard procedures. The cultures were grown on PYEA plates
to observe the colony morphology.
Motility: Motility was studied by hanging drop technique. A small drop of
liquid bacterial culture was placed in the center of a cover slip (No. 1) with
the help of an inoculating needle. A concavity slide with a central depression
was used for this technique. Vaseline was applied around the depression of
the slide and it was inverted over the drop of culture by keeping the drop in
the centre of depression (well). The slide was turned quickly the right side up
so that the hanging drop was suspended in the well. The motility was
observed by focusing the edge of the drop under the microscope.
3.4.3.2 Biochemical characterization
Catalase activity: A loopful of 24 h old bacterial culture was placed on a
clean glass slide. A drop of 20 per cent hydrogen peroxide was added over
it, mixed with an inoculating needle and observed for production of gas
bubbles which indicated positive catalase activity.
Oxidase test (Kovacs 1956): For the oxidase test, a 24 h old culture of the
test bacterium was rubbed with a sterilized glass rod on a filter paper,
impregnated with freshly prepared 1 per cent (w/v) aqueous tetramethyl-p-
phenylene diamine dihydrochloride solution. The test was oxidase positive if
a purple colour developed within 10-60 sec. and negative if no colour
developed within 60 sec.
Carbohydrate metabolism test: Five ml peptone water (double strength)
with 1 to 2 drops of phenol red indicator was added to test tubes with
Durham‘s fermentation tube in each test tube. The tubes were autoclaved at
121oC for 15 min. Five ml of 2 per cent sterilized sugar solution was then
added to make the final concentration of 1 per cent in the medium. All the
42
42
test tubes were inoculated with loopful of 24 h old culture of test bacterium.
After 24 h, observations were taken for fermentation and gas production.
Change in medium colour from light red to yellow and gas bubbles in
Durham tubes indicated positive reaction for fermentation and gas
production, respectively.
Medium: Peptone water (Hi-Media)
Sugar used for test: D-Glucose
Utilization of citrate (Simmons 1926): Simmon‘s citrate agar medium was
prepared, dispensed in test tubes, autoclaved at 121oC for 20 min. and
slants were prepared. After inoculation with the test bacterium, the slants
were incubated at 37oC for 24 h and observations were recorded. Growth
and conversion of original green colour to blue colour indicated citrate
utilization.
Citrate medium: Simmon‘s citrate media (Hi-Media)
Indole test: Five ml medium in test tubes was inoculated with pure culture of
bacterial isolates and incubated at 37oC for 24 h. Kovac‘s reagent (0.2 to 0.3
ml) was added and shaken vigorously. The tubes were kept standing for
about 10 min. and observed. Red colour in the alcohol surface layer
indicated a positive indole test whereas, the original colour indicated
negative test.
Medium: Peptone water (Hi-Media)
Methyl red (MR) test (Clark and Lubs 1915): Five ml each of the MR-VP
(Voges-Proskauer) broth was dispensed into test tubes and sterilized in
autoclave at 121oC for 20 min. The tubes were inoculated with the test
bacterium and incubated at 37oC for 24 h. After incubation, 5-6 drops of
methyl-red reagent were added to each tube and shaken well. Formation of
bright red colour indicated positive reaction.
43
43
Media: MR-VP broth media (Hi-Media)
Methyl red reagent: 25 mg of methyl red was dissolved in 75 ml of 95%
ethanol + 50 ml of distilled water.
Voges-Proskauer (VP) test: MR-VP broth was inoculated with the test
bacterium and incubated at 37oC for 24 h. After incubation, 0.6 ml of 5 per
cent -naphthol (in 95% ethanol) and 0.2 ml of 40 per cent aqueous solution
of KOH were added to 1 ml of broth culture and shaken well. Observations
were recorded after 5 min. Development of red colour indicated positive VP-
test.
Triple Sugar Iron (TSI) test: Commercially available TSI medium (Hi-Media)
was dispensed into test tubes and sterilized in autoclave at 121oC for 20
min. and slants were prepared. TSI slants were inoculated by the test
bacteria and incubated at 37oC for 24 h.
3.4.3.3 Molecular characterization of bacterial isolates
Molecular characterization of five promising gut bacteria viz. PIB, P3A,
P10A, B4A and B10B associated with B. tau was done by sequencing 16S
rRNA gene.
3.4.3.3.1 Extraction of genomic DNA
Total genomic DNA of each isolate was extracted following the
procedure of Prabhakar et al. (2009b) with minor modifications. For
extracting total genomic DNA, the individual bacterial isolate was grown in
peptone yeast extract broth (PYEB) for 72 h at 37oC. Each bacterial culture
was transferred to 1.5 ml eppendorf tube and spun at 10,000 rpm for 12 min.
The supernatant was discarded and eppendorf tubes containing bacterial
pellets were immersed in liquid nitrogen container for one min. and the pellet
was ground to fine powder using micro pestle. Rest of the procedure for DNA
extraction was same as given in section 3.3.1.
44
44
3.4.3.3.2 Primer used
16S rRNA (rss) gene amplification was done using universal bacteria
specific primers. The base sequences of primers (Table 3.7) were custom
synthesized (Life Technologies India, Pvt. Ltd.).
Table 3.7: Base sequences of rss gene primers
Name of the Primer Sequence (5‘ to 3‘)
rrs gene F
R
5‘ AGA GTT TGA TCA TGG CTC AG 3‘
5‘ TAC CTT GTT ACG ACT TCA CC 3‘
3.4.3.3.3 PCR amplification for rrs gene
The PCR amplification was carried out in 0.2ml PCR tubes with 25 μl
reaction volume consisting of following reaction mixture:
Reaction Mixture Quantity(µl)
Buffer 10 X 2.5
MgCl2 (25 mM) 1.5
dNTPs mix (10 mM each) 2.0
Taq DNA polymerase (5U/µl),
(Life Technologies India, Pvt. Ltd)
0.2
Primer forward (10 µM) 20 pmol 0.8
Primer reverse (10 µM) 20 pmol 0.8
Water (SDW) 15.2
DNA (20ng) 2.0
Total Volume 25.0
45
45
Reaction mixture was vortexed and centrifuged in a microfuge
(Bangalore Genei, India). Amplifications were performed using thermal cycler
(GeneAmp PCR system 9700, Applied Biosystems, USA) with following
temperature transitions:
Steps Temperature (oC) Time (minute)
1. Initial denaturation 94 5.00
2. Denaturation 94 0.75
3. Annealing 53 0.75
4. Elongation 72 0.50
The thermal cycler was programmed for 35 cycles with one cycle of
initial denaturation and steps 2-4 were repeated 35 times and a final
extension at 72oC for 5 min. using fastest ramp time between the
temperature transitions.
3.4.3.3.4 Agarose gel electrophoresis of PCR product
The digested PCR products were resolved by electrophoresis using
1.2 per cent agarose gel in 0.5X Tris borate EDTA buffer. DNA ladders of
100 bp and Lambda DNA / EcoR I – Hind III double digest were used as
markers. The gels were run at 80V for 2 h using Bangalore Genei power pac
system, stained with ethidium bromide (0.5 μg / ml) for 10 min after
electrophoresis, viewed and images were captured using Alphalmager 2200
gel documentation system.
3.4.3.3.5 Sequencing and Data Analysis
PCR products of rrs gene of five gut bacteria obtained through
amplification with specific primer (section 3.6.3.1) were freeze dried
(CHRIST ALPHA I-2LD) and sent for custom sequencing using same
upstream and downstream primers (Life Technologies India Pvt. Ltd.).
46
46
3.4.3.3.6 Nucleotide sequence analysis
The sequences of different bacterial isolates were blasted using on-
line NCBI Blastn program http://www.ncbi.nih.gov/blast. For the purpose
fourty two sequences of 16S rRNA of different bacteria of high sequence
similarity were selected for sequence comparison from GenBank Nucleotide
Database, NCBI. The pair wise genetic distance between five bacterial
isolates associated with B. tau and other selected bacterial sequences was
determined (Table 3.8).
The evolutionary history was inferred using the UPGMA method
(Sneath and Sokal 1973). The percentage of replicated trees in which the
associated taxa clustered together in the bootstrap test (500 replicates) with
the Maximum Composite Likelihood method to compute evolutionary
distances (Tamura et al. 2004) and in the units of the number of base
substitutions per site. All positions containing gaps and missing data were
eliminated from the dataset (Complete deletion option). There were a total of
298 positions in the final dataset. Phylogenetic analysis was conducted in
MEGA 4.1 Software programme (Tamura et al. 2007).
3.5 Gut bacteria as attractants to fruit flies
Five promising bacterial isolates constantly associated with fruit flies
were evaluated for their attractiveness to fruit flies (B. tau) in presence of
protein hydrolyzate (positive control) and sugar (negative control) under
laboratory conditions. Pure culture (72 hrs old) of each bacterial isolate was
grown in PYE broth was taken in Petri plate and kept inside the cage (45 x
45 x 55 cm3). Twenty five pairs (5 days old) of fruit flies were released in the
cage and flies visiting each treatment were recorded for 30 min. The
experiment was repeated six times for B. tau and data obtained were
analyzed statistically (Table 3.9).
47
47
Table 3.8: Bacteria used for multiple sequence alignment
Sr. No. GenBank accession no.
Name of Bacteria Country
1 HQ113205 Delftia acidovorans Canada
2 FR682935 Delftia sp. Belgium
3 AF538930 Delftia acidovorans Belgium
4 AF149849 Delftia acidovorans Germany
5 FJ688376 Delftia sp. France
6 AM910363 Uncultured Delftia acidovorans Germany
7 EF692532 Delftia sp. Uruguav
8 GQ466172 Delftia acidovorans Turkey
9 AB517709 Myroides odoratus Japan
10 GU350455 Myroides sp. China
11 M58777 Myroides odoratus -
12 D14019 Flavobacterium odoratum Japan
13 GQ857652 Myroides sp. Korea
14 AJ854059 Myroides odoratimimus Germany
15 AM910365 Uncultured Flavobacterium Germany
16 FJ965845 Flavobacterium sp. India
17 EF125185 Ochrobactrum guangzhouense China
18 FJ581024 Pseudochrobactrum sp. India
19 EF071943 Brucellaceae bacterium China
20 DQ334872 Ochrobactrum sp. China
21 AM403218 Ochrobactrum sp. Germany
22 AM041247 Ochrobactrum oryzae India
23 EU543575 Ochrobactrum sp. China
24 AJ920029 Ochrobactrum shiyianus China
25 HM468098 Pseudochrobactrum sp. China
26 GQ249219 Phyllobacteriaceae bacterium China
27 AM884147 Phyllobacteriaceae bacterium Germany
28 FJ542910 Uncultured Defluvibacter sp. USA
29 EU870446 Defluvibacter lusatiensis China
48
48
30 AM884144 Phyllobacteriaceae bacterium Germany
31 FJ982919 Defluvibacter lusatiensis Spain
32 AM884148 Phyllobacteriaceae bacterium Germany
33 HM152635 Uncultured Pseudomonas sp. France
34 AM910358 Uncultured Pseudomonas sp. Germany
35 EU372964 Pseudomonas sp. China
36 FJ472861 Pseudomonas putida China
37 FJ472858 Pseudomonas putida China
38 AM913888 Pseudomonas sp. Germany
39 AM930519 Pseudomonas putida China
40 DQ387441 Pseudomonas putida Korea
41 AY741156 Pseudomonas putida Korea
42 HM805109 Pseudomonas geniculata India
Table 3.9: Attractancy of promising gut bacteria to fruit fly B. tau (Walker)
Treatment Composition
T1 Deftia acidovorans (2 ml)
T2 Pseudomonas putida (2 ml)
T3 Flavobacterium sp. (2 ml)
T4 Defluvibacter sp. (2 ml)
T5 Ochrobacter sp. (2 ml)
T6 (Negative control) Control (Sugar, 2 ml 10%)
T7 (Positive control) Control (ProteinX ®, 2 ml 10%)
49
49
3.6 Volatile chemical compound identification of gut bacteria through Gas Chromatography Mass Spectrometry (GCMS)
Bacterial Preparations: The bacterial cultures were grown in peptone yeast
extract broth (2 ml) for 72 hr at 30°C in GC-MS headspace tube (15 ml) with one
un-inoculated control for qualitative analysis by GC-MS.
Chemical Identifications: GC-MS (70 eV) data were measured in MS-QP-
2010 series (SHIMADZU CORPORATION, Tokyo, Japan) equipped with MS,
AOC-20i auto sampler and BD-5 capillary column (SGC International,
Ringwood, Australia) of 30 m length, 0.25 mm i.d. with film thickness 0.25
µm (Poly ethylene glycol) and helium as a carrier gas. The injector
temperature was 250oC with split ratio 1:50. Injection of volatiles for GC-MS
analysis was by thermal desorption at 250°C in a split injector. The injector was
operated in the split mode and the purge valve was opened after 1 min. Linear
velocity of helium carrier gas was 40.80 cm/ sec. The GC column oven
temperature was programmed to hold at 40oC for 4 min and then increased
up to 220oC at increments of 4oC/ min and finally holding at 220oC for 15
min. Column flow rate was set at 1.28 ml/ min. Ion source temperature was
200oC and the interface temperature was set at 250oC. The MS was scanned
at 70 eV over 40-600 a.m.u. at 2 scans/ sec.
GC-MS identifications were based on computer matching of unknown spectra
with those in the Wiley 138K Mass Spectral Database (John Wiley & Sons, New
York).
Calculation of Retention Index (I)
GCMS data were temperature programmed and then the Kovats index was
calculated by the equation
50
50
Where;
I = Kovats retention index,
n = the number of carbon atoms in the smaller alkane,
N = the number of carbon atoms in the larger alkane,
z = the difference of the number of carbon atoms in the smaller and larger
alkane,
tr = the retention time.
51
51
4. RESULTS AND DISCUSSION
The results achieved in the present study are described and discussed
under the following heads:
4.1 Survey and diversity of fruit flies
After an extensive survey of commercial cucurbits growing areas of
Himachal Pradesh during 2009-2010 across eight districts viz. Bilaspur, Chamba,
Hamirpur, Kangra, Kullu, Mandi, Solan and Una, the data were compiled to draw
inferences as under.
4.1.1 Fruit flies infestation in cucurbits
The fruit flies infestation was encountered (ranging from 44.44 to 80.00
per cent) mostly in lower and middle altitude areas of Himachal Pradesh (Table
4.1). The state average fruit flies infestation was 65.88 per cent, highest being in
Kangra at Palampur (80.00%) and lowest in Chamba at Banikhet (44.44%).
In district Bilaspur, fruit flies infestation at different locations varied from
55.55 to 60.00 per cent with maximum infestation at Ghumarwin (60.00 %)
followed by Chandpur (55.55 %). In Chamba, only one location was surveyed i.e.
Banikhet and the fruit fly infestation was 44.44 per cent.
The fruit flies infestation ranged between 50-60 per cent in district
Hamirpur, while it varied from 60-80 per cent at different locations in district
Kangra.
In district Mandi, Solan, Kullu and Una, the fruit flies infestation varied
from 66.66 to 77.00 per cent, 70.00 to 77.77 per cent, 77.77 per cent, (at
Naggar) and 66.66 per cent (at Haroli), respectively.
The variations of fruit flies infestation in cucurbits at different locations
might be due to the variations in the local environmental conditions and relative
susceptibility of the crop varieties. For example, highest fruit flies infestation was
recorded at Palampur (80.00%) in Kangra district, where Sood et al. (2010) also
52
Table 4.1: Species and infestation index of fruit flies at different locations
Sr. No.
State(s) District(s) Place(s) Species recorded Host collected Per cent infestation*
India 1 Himachal
Pradesh Bilaspur Chandpur Bactrocera tau Cucumber 55.55
2 Ghumarwin B. cucurbitae, B. tau, Cucumber 60.00 3 Nihari B. cucurbitae, B. tau, B. scutellaris - - 4 Chamba Banikhet B. tau Cucumber 44.44 5 Hamirpur Bhota B. cucurbitae Cucumber 50.00 6 Nadaun B. cucurbitae, B. tau Bitter gourd , Bottle gourd,
Cucumber 60.00
7 Kangra Indora B. cucurbitae Bitter gourd , Bottle gourd 60.00
8 Jawalamukhi B. cucurbitae, B. tau Cucumber 70.00 9 Kangra B. cucurbitae, B. tau, B. scutellaris Cucumber 60.00 10 Palampur B. cucurbitae, B. tau, B. scutellaris, B. nigrofemoralis, B. latifrons, B.
diversa, B.dorsalis, B. zonata, Dacus longicornis, D. sphaeroidalis, Dacus sp., Cyrtostola limbata, Pliomelaena udhampurensis, Dioxyna sororcula
Bitter gourd , Bottle gourd, Cucumber, Summer squash, Pumpkin
80.00
11 Shahpur B. cucurbitae, B. tau Bitter gourd 70.00
12 Paragpur B. dorsalis, B. zonata - - 13 Kullu Naggar B. tau Cucumber 77.77 14 Mandi Barot B. tau, B. scutellaris Pumpkin 66.66 15 Mandi B. cucurbitae, B. tau Cucumber 70.00 16 Nagwain B. cucurbitae, B. tau Bitter gourd 77.00
17 Sundernagar B. cucurbitae, B. tau, Cucumber, Bitter gourd 70.00
18 Solan Nauni B. tau, Summer squash 70.00 19 Saproon B. cucurbitae Cucumber 77.77 20 Una Haroli B. cucurbitae Cucumber 66.66 Mean 65.88 21 Haryana Karnal Karnal B. cucurbitae Cucumber 77.77
22 Karnataka Bengaluru Bengaluru B. cucurbitae, B. paraverbascifoliae, B. trilineata, B. correcta, B. dorsalis,
- -
23 Delhi Delhi IARI B. cucurbitae Bottle gourd - 24 Bihar Patna Patna B. cucurbitae Cucumber 77.77 25 Nalanda Bihar Sharif B. cucurbitae Bottle gourd 70.00 26 Samstipur RAU Pusa B. cucurbitae, B. tau, B. dorsalis, B. zonata - - 27 Uttar Pradesh Ghaziabad Ghaziabad B. cucurbitae Bottle gourd -
28 Maharashtra Solapur Solapur B. cucurbitae Cucumber -
Nepal
29 Dhankuta B. cucurbitae, B. tau - -
*Visual infestation rating
53
53
reported 79.56 per cent fruit damage by fruit flies in cucumber var. Pusa Sanyog
(susceptible to fruit flies). High fruit flies activity in Himachal Pradesh might have
been facilitated by congenial climatic conditions like high rain fall (1251.90 mm
annual rainfall) and humidity, with majority rains being received during active
cucurbits growing season (May-Sept). This is also supported by faulty insect-pest
control practices adopted by the farmers, as they are not using IPM (Integrated
Pest Management) approach like field sanitation, MAT (Male Annihilation
Technique) and BAT (Bait Application Technique) techniques as observed during
the survey. On the other hand, most of the agricultural land have bushy hedges
and is surrounded by forest and pastures consisting of many wild cucurbits which
could facilitate the fruit flies to rest and pick the resources during and after
insecticide application. High fruit flies infestation in cucurbits recorded during
present study in the Himachal Pradesh is also in the accordance with Gupta et al.
(1992) who had observed 60.00-80.00 per cent fruit flies infestation on different
cucurbits in Himachal Pradesh.
Outside Himachal Pradesh, six Indian states namely Bihar, Delhi,
Haryana, Karnataka, Maharashtra and Uttar Pradesh were surveyed for fruit flies.
The infestations were, however recorded at three places outside Himachal
Pradesh namely Karnal (77.77%) in Haryana and Patna (77.77%) & Bihar Sharif
(70.00%) in Bihar. High fruit infestation in cucurbits due to fruit flies at Karnal
(Haryana), might be due to the micro climatic conditions like irrigated farming
system (canal irrigation) followed by warm climate during crop season supported
by low to moderate rainfall (617 mm annual rainfall) facilitating the rapid fruit fly
growth and development. Whereas, at Patna and Bihar Sharif (Bihar) which are
located in the east of the Indo-Gangetic plain, the holy river Ganga flow round the
year making local climate warm and humid with onset of monsoon (during
cucurbits season), in the vicinity of Tropics of Cancer helped rapid expansion of
fruit flies and consequently heavy fruit damage. Heavy losses observed in
cucurbits by fruit flies in Indo-Gangetic plain are in line with the earlier reports of
30 to 100 per cent fruit infestation in different cucurbits by fruit flies (Dhillon et al.
2005).
54
54
Higher infestation rate (fruit damage) of fruit flies in Himachal Pradesh as
well as in other states of India on the crops necessitates large scale adoption of
integrated pest management programme with wide-area management
programme as an essential component of IPM for fruit fly management with firm
cohesion between farmers- government agriculture departments and educational
& research institutions like SAUs (State Agricultural Universities).
4.1.2 Fruit flies species associated with cucurbits in Himachal Pradesh
In the infested cucurbit samples collected from different locations, two
species viz. Bactrocera tau and B. cucurbitae were the predominant infesting all
the cucurbits at majority locations surveyed. B. cucurbitae and B. tau were
observed as the most damaging fruit fly species on different cucurbits at
Ghumarwin (Bilaspur), Nadaun (Hamirpur), Jawalamukhi, Kangra, Palampur &
Shahpur (Kangra) and Mandi, Nagwain & Sundernagar (Mandi) in Himachal
Pradesh (Table 4.1). However, cucurbit samples collected from Chandpur
(Bilaspur), Banikhet (Chamba), Naggar (Kullu) and Nauni (Solan) indicated
infestation of B. tau only, whereas samples from Bhota (Hamirpur), Indora
(Kangra), Saproon (Solan) and Haroli (Una) indicated infestation of B. cucurbitae
only.
B. scutellaris was the lone species reared from the infested samples of
flowers and tender fruits collected from three locations during survey namely,
Kangra & Palampur in district Kangra and Barot in district Mandi.
During the course of survey, B. tau and B. cucurbitae were recorded as
the predominant species infesting cucurbits in Himachal Pradesh. However, B.
cucurbitae was earlier considered to be the major fruit fly species infesting
cucurbits in the state, has now been observed confined mostly to the low hills of
the State.
The species has earlier been reported to be the major species infesting
cucurbits (Kapoor et al. 1980; Gupta et al. 1992) in Himachal Pradesh. However,
Sood and Nath (1999) and Prabhakar et al. (2009a) reported B. tau as a major
55
55
fruit fly species infesting cucurbits in the State. B. tau has also been reported
from north-eastern region of India (Borah and Dutta 1996), China (Yang et al.
1994) and Bangladesh (Huque 2006). The reports pertaining to cucurbit
infestation by B. tau from across the places indicate a wider geographical
distribution of the species. During recent past, B. scutellaris has also been
reported as one of the most destructive fruit fly species infesting tender fruits and
growing vegetative parts from Himachal Pradesh, damaging not only the fruits
but also retarding the plant vigour and growth (Prabhakar et al. 2007, Sunandita
and Gupta 2007, Prabhakar et al. 2009a). The reports of different workers on
infestation of cucurbits by fruit flies in the state substantially support the present
findings, that cucurbits are not damaged by a single fruit fly species but by a
complex of species viz. B. cucurbitae, B. tau and B. scutellaris.
Cucurbit samples collected from different Indian states outside Himachal
Pradesh showed infestation of B. cucurbitae only (Table 4.1). Earlier, Agarwal
and Sueyoshi (2005) had reported that B. cucurbitae is widely distributed in India.
Stonehouse et al. (2007) also reported activity of B. cucurbitae from five states
of India viz. Gujarat, Karnataka, Kerala, Uttar Pradesh and Orissa. Whereas,
Agarwal (1984; 1987) reared this species from infested cucurbit samples
collected from Bihar, Punjab and Uttar Pradesh.
4.1.3 Diversity of fruit flies in pheromone traps
Pheromone traps were installed at three locations viz. Nihari (Bilaspur),
Palampur (Kangra) and Paragpur (Kangra) to assess the diversity of fruit flies
associated with cucurbits. Five species of fruit flies from Nihari (Bilaspur) and ten
species of fruit flies from Palampur (Kangra) were collected. Whereas, only two
species were collected from traps installed at Paragpur (Kangra).
Traps installed at two locations outside Himachal Pradesh at Bangaluru
(Karnataka) and Samstipur (Bihar) revealed presence of five species at
Bengaluru and four species at Samstipur (Table 4.1). Samples of fruit flies from
Dhankuta (Nepal) sent by scientist working in Nepal Council of Agricultural
Research revealed presence of two species (B. cucurbitae and B. tau) in the
region.
56
56
The usefulness of male lures in population monitoring and taxonomic
surveys have also been highlighted by White and Hancock (1997), Drew and
Hancock (2000), White (2000) and Smith et al. (2003).
4. 2 Identification of fruit flies species
Different species of fruit flies attacking cucurbits, damage the crop either
individually or collectively, so an attempt was made to identify the associated
species using morphological characteristics. The literature pertaining to
identification has been given in section 3.1.
4.2.1 Morphological characteristics of fruit fly species identified
Subfamily : DACINAE
Tribe : DACINI
I. Genus Bactrocera Macquart
Subgenus Bactrocera Macquart
1. Bactrocera (Bactrocera) correcta (Bezzi)
(Plate 4.1)
Material examined:
Karnataka: Bengaluru district: 3♂♂, Bengaluru, 5.i.2010, ME.
Description:
Face fulvous with transverse, elongate black spots almost meeting in centre.
Scutum predominantly black with lateral yellow stripes. Scutellum yellow with a
narrow black basal band and two scutellar setae. The wings are mostly clear with
a narrow costal band confluent with R2+3 ending at the apex of this vein and a
small fuscous spot around apex of R4+5. Abdomen oval, tergum I black, tergum II
red-brown with a narrow transverse black band that does not reach lateral
margins. Abdominal terga III-V red brown with a black T pattern, a pair of oval
red-brown shining spots on tergum V. Male with a pectin on tergum III.
57
57
Adult Male Wing
Scutum Scutellum & Abdomen
Face Head
Legs Spur
Plate 4.1: Morphographs of Bactrocera correcta (Bezzi)
58
58
Note: It is similar to B. zonata but is distinguished by the facial spots being united
or almost united, to form a black transverse band and scutum predominantly
black.
Attractant: Methyl eugenol
Host: Not recorded
Chaetodacus correctus: Bezzi, 1916. Bull. Entomol. Res., 7: 107. Syntype ♂, ♀.
India (Bihar: Pusa; Tamil Nadu: Coimbatore, Chennai: Guindy, Hagari) (ZSI).
Bactrocera zonata: Bezzi, 1913. Mem. Indian Mus., 3: 94. [Misidentification].
Strumeta paratuberculatus: Philip, 1948. Indian J. Entomol., 10(1): 31. Holotype
♂. Myanmar (Aingyi) (ZSI).
Dacus (Strumeta) correctus: Narayanan and Batra, 1960. Fruit Flies and Their
Control, I.C.A.R., New Delhi, 33.
Dacus (Strumeta) dutti: Kapoor, 1971. Oriental Insects, 5(4): 480. Holotype ♂.
India (Maharashtra: Pune) (NPC).
Dacus (Bactrocera) bangaloriensis: Agarwal & Kapoor, 1983. J. Entomol. Res.,
7(2): 169. Holotype ♂. India (Karnataka: Bangalore) (NPC).
Bactrocera (Bactrocera) correcta: Kapoor, 1993. Indian Fruit Flies. Oxford & IBH
Publ., New Delhi: 73.
Bactrocera (Bactrocera) correcta: Drew & Raghu, 2002. Raffles Bull. Zool., 50(2):
335.
Bactrocera (Bactrocera) correcta: Agarwal & Sueyoshi, 2005. Oriental Insects,
39: 376.
2. Bactrocera (Bactrocera) dorsalis (Hendel)
(Plate 4.2)
Material examined:
Himachal Pradesh: Kangra district: 3♂♂, 5♀♀, Palampur, 9.vii.2009, ex Litchi
chinensis; 11♂♂, 7♀♀, Palampur, 13.vi.2009, ex Mangifera indica; 8♂♂,
59
59
Palampur, 13.vi.2009, ME; 9♂♂, 5♀♀, Palampur, 15.ix.2009, ex Psidium
guajava; 9♂♂, Paragpur, 19.vii.2010; Karnataka: Bengaluru district: 4♂♂,
Bengaluru, 29.xii.2009, ME; Bihar: Samastipur district: 9♂♂, RAU Pusa,
26.ii.2010, ME.
Description:
Face fulvous with a pair of medium-sized circular black spots. Scutum
predominantly black but may have red-brown areas of varying sizes and shapes.
Two broad lateral postsutural vittae, parallel sided and ending behind ia. setae,
medial postsutural vittae absent. Scutellum entirely yellow coloured with a narrow
basal black band and two apical setae. Wing with a distinct brown costal band
ending just beyond the end of vein R4+5, crossveins r-m and dm-cu not covered
by any markings; narrow pale fuscous cubital streak present. Generally, the
abdomen with two horizontal black stripes and a longitudinal median stripe
extending from the base of the segment III to the apex of the abdomen. These
markings may form a T-shaped pattern, but the pattern varies considerably. Legs
mostly fulvous with fore tibiae pale fuscous and hind tibiae fuscous.
Attractant: Methyl eugenol
Host: ex fruit Mango, ex fruit Litchi, ex fruit Guava
Musca ferruginea: Fabricius, 1794. Entomol. Syst., 4: 342. Preoccupied by
Musca ferruginea Scopoli, 1763. Entomol. Carn., 340. ? Type. ? Sex. ―India
Orientali‖ (e. India) (?ZMUC).
Dacus ferrugineus: Fabricius, 1805. Syst. Antliat., p. 274.
Dacus dorsalis: Hendel, 1912. Suppl. Entomol., 1: 18. Lectotype ♀. Taiwan
(Koshun) (BMNH).
Bactrocera ferruginea: Bezzi, 1913. Mem. Indian Mus., 3: 95.
Chaetodacus ferrugineus dorsalis: Bezzi, 1916. Bull. Entomol. Res., 7: 104.
Dacus (Strumeta) dorsalis: Hardy & Adachi, 1956. Bull. Bernice P. Bishop Mus.,
14(1): 7.
60
60
Adult Male Wing
Scutum Scutellum & Abdomen
Face Head
Legs Lateral view
Plate 4.2: Morphographs of Bactrocera dorsalis (Hendel)
61
61
Dacus (Bactrocera) dorsalis: Hardy, 1977. Cat. Diptera Oriental Reg., 3: 49.
Bactrocera (Bactrocera) dorsalis: White & Elson-Harris, 1992. Fruit Flies of
Economic Significance, C.A.B. International Publ., p. 187.
Bactrocera (Bactrocera) dorsalis: Drew & Raghu, 2002. Raffles Bull. Zool., 50(2):
336.
Bactrocera (Bactrocera) dorsalis: Agarwal & Sueyoshi, 2005. Oriental Insects,
39: 376-377.
3. Bactrocera (Bactrocera) latifrons (Hendel)
(Plate 4.3)
Material examined:
Himachal Pradesh: Kangra district: 1♂, 1♀, Palampur, 12.vii.2010.
Description:
Face with two dark spots. Scutum predominantly black with two lateral
postsutural yellow vittae. Scutellum entirely pale yellow with two scutellar setae.
Wing with a complete costal band expanded into an apical spot at apex, cubital
streak present. Abdomen oval, orange-brown to fuscous, tergum III with a basal
transverse dark band and sometimes with a medial stripe down terga III-V. Male
with pecten on tergum III.
Attractant: Not known
Host: On bitter gourd
Remarks: New record from Himachal Pradesh
Dacus amoyensis: Froggatt, 1909. In Official report on fruit fly and other pests in
various countries 1907-1908. Report on parasitic and injurious insects. N.S.W.,
Dept. Agric., Sydney, p. 99. ? Type ♀. China (Fujian: Amoy) (UMO). (Nomen
nudum, attributed to Bigot).
62
62
Adult Female Wing
Scutum Scutellum & Abdomen
Face Head
Legs and Lateral view
Plate 4.3: Morphographs of Bactrocera latifrons (Hendel)
63
63
Chaetodacus latifrons: Hendel, 1915. Annls. Hist. Nat. Mus. Natl. Hung., 13: 425.
Lectotype ♂. Taiwan (Tainan). [Precedent name over Dacus parvulus Hendel,
1912. Bull. Zool. Nomencl., 54(1): 68 (1997)] (BMNH).
Dacus (Strumeta) latifrons: Hardy & Adachi, 1954. Pacif. Sci., 8(2). 171.
Dacus (Strumeta) parvulus: Hardy, 1973. Pac. Insects Monogr., 31: 49.
Dacus (Bactrocera) latifrons: Hardy, 1977. Cat. Diptera Oriental Reg., 3: 50.
Bactrocera (Bactrocera) latifrons: White & Elson-Harris, 1992. Fruit Flies of
Economic Significance, C.A.B. International Publ., p. 208.
Bactrocera (Bactrocera) parvula: Kapoor, 1993. Indian Fruit Flies. Oxford & IBH
Publ. Co., New Delhi: 76.
Bactrocera (Bactrocera) latifrons: Agarwal & Sueyoshi, 2005. Oriental Insects,
39: 377.
4. Bactrocera (Bactrocera) nigrofemoralis White & Tsuruta
(Plate 4.4)
Material examined:
Himachal Pradesh: Kangra district: 9♂♂, Palampur, 13.vi.2009, CL.
Description:
Head dark red-brown to fuscous, fulvous laterally and face shining black. Scutum
shining black without pale markings. Two narrow lateral yellow postsutural vittae,
narrowing posteriorly to end well before infra alar setae. Scutellum yellow except
for a moderately broad black basal band with two scutellar setae. Femora mostly
shining black, mid femora entirely shining black, hind femora with basal 2/3
fulvous and apical 1/3 shining black, mid tibiae each with an apical black spur.
Wings colourless except fuscous cell sc, narrow fuscous costal band confluent
with R2+3 and remaining narrow to end just beyond extremity of R4+5. A narrow
fuscous cubital streak. Abdomen oval, terga I and II black except for a narrow
red-brown band along inter-segmental line and a broad transverse fulvous to red
64
64
Adult Male Wing
Scutum Scutellum
Abdomen Face
Legs Lateral view
Plate 4.4: Morphographs of Bactrocera nigrofemoralis White & Tsuruta
65
65
brown band across posterior 1/2 of tergum II and narrowing to lateral margins;
terga III-V red-brown except for a broad black band across anterior margin of
tergum III. A pair of oval black shining spots on tergum. Male with pecten on
tergum III.
Attractant: Cue lure
Host: Not recorded
Remarks: New record from Himachal Pradesh as well as north India
Bactrocera (Bactrocera) nigrofemoralis: White & Tsuruta, 2001. Entomological
Sci., 4: 79. Holotype ♂. India (Karnataka: nr. Medikeri, Talakaveri, 1100m)
(BMNH).
Bactrocera (Bactrocera) nigrofemoralis: Drew & Raghu, 2002. Raffles Bull. Zool.,
50(2): 339.
Bactrocera (Bactrocera) nigrofemoralis: Agarwal & Sueyoshi, 2005. Oriental
Insects, 39: 378.
5. Bactrocera (Bactrocera) paraverbascifoliae Drew & Raghu
(Plate 4.5)
Material examined:
Karnataka: Bengaluru district: 3♂♂, Bengaluru, 30.xii.2009, ME.
Description:
Face fulvous with medium sized circular to oval black spots. Scutum black with
red-brown to dark red-brown below and behind lateral postsutural vittae. Two
parallel sided lateral postsutural vittae of medium width. Scutellum yellow except
narrow black basal band with two scutellar setae. wings colourless except for
dark fuscous cell sc with a narrow fuscous to dark fuscous costal band confluent
with R2+3 and gradually widening to end between extremities of R4+5 & M and a
narrow fuscous cubital streak. Legs fulvous except a small area of dark fuscous
66
66
Adult Male Wing
Scutum Scutellum
Abdomen Face
Legs and Lateral view
Plate 4.5: Morphographs of Bactrocera paraverbascifoliae Drew & Raghu
67
67
on base of fore tibiae, fuscous on base of mid tibiae and hind tibiae dark fuscous
basally to fuscous apically. Mid tibiae each with an apical black spur. Abdomen
oval, tergum I fuscous anterocentrally, tergum II red-brown except for a narrow
transverse black anteriorly which ends laterally just before the dark fuscous
lateral margins, terga III- V orange-brown except for a distinct black 'T' pattern. A
pair of oval red- brown shining spots on tergum V. Male with pecten on tergum
III.
Attractant: Methyl eugenol
Host: Not recorded
Remarks: Not present in Himachal Pradesh
Bactrocera (Bactrocera) paraverbascifoliae: Drew & Raghu, 2002. Raffles Bull.
Zool., 50(2): 341. Holotype ♂. India (Kerala: New Amarambalam Forest)
(BMNH).
Bactrocera (Bactrocera) paraverbascifoliae: Agarwal & Sueyoshi, 2005. Oriental
Insects, 39: 379.
6. Bactrocera (Bactrocera) zonata (Saunders)
(Plate 4.6)
Material examined:
Himachal Pradesh: Kangra district: 6♂♂ Palampur, 13.vi.2009, ME; 8♂♂,
Pragpur, 19.vii.2010, ME; Bilaspur district: 4♂♂, Nihari, 15.v.2010, ME; Bihar:
Samastipur district: 5♂♂, RAU Pusa, 26.ii.2010, ME.
Description:
Face fulvous with two medium sized oval black spots. Scutum red-brown with a
pale fuscous pattern posteriorly with lateral yellow or orange postsutural stripes,
scutellum entirely pale yellow coloured except for a narrow dark red-brown basal
band and with two scutellar setae. Wing lacks a complete costal band (reduced
to an isolated apical spot), cubital streak absent but with a very small pale
68
68
Adult Male Wing
Scutum Scutellum
Abdomen Face
Head Lateral view with Legs
Plate 4.6: Morphographs of Bactrocera zonata (Saunders)
69
69
fuscous tint in the cell cup. Legs fulvous with apices of femora red-brown and
hind tibiae pale fuscous to fuscous, mid tibiae each with an apical black spur. On
abdomen there is usually a pair of dark marks on tergum III and no medial dark
line except on tergum V. Male abdomen with pecten.
Attractant: Methyl eugenol
Host: Not recorded
Note: B. zonata is a general red-brown species having a wing pattern which is
similar to that of B. correcta i.e. an incomplete costal band with a fuscous spot
around apex of R4+5. B. correcta is different in having a black scutum and black
"T" pattern on abdominal terga III-V.
Dasyneura zonatus: Saunders 1842. Trans. Entomol. Soc. London, 3: 61. ?Type.
?Sex. India (Bengal) (?UMO).
Bactrocera maculigera: Doleschall, 1858. Natuurk. Tijdschr. Ned.-Indië, 17: 122.
?Type ♂. Indonesia (Moluccas: Ambon) (ZMHU).
Rivellia persicae: Bigot, 1890. Indian Mus. Notes, 1:192. Syntype ♂, ♀. India
(Jharkhand: Chota Nagpur: Ranchi) (?ZSI).
Dacus ferrugineus var. mangiferae: Cotes, 1893. Indian Mus. Notes, 3(1):17.
Lectotype ♀. India (Bihar: Tirhut region) (?ZSI).
Chaetodacus zonatus: Bezzi, 1916. Bull. Entomol. Res., 7: 105.
Dacus (Strumeta) zonatus: Hardy, 1973. Pac. Insects Monogr., 31: 54.
Dacus (Bactrocera) zonatus: Hardy, 1977. Cat. Diptera Oriental Reg., 3: 53.
Bactrocera (Bactrocera) zonata: White & Elson-Harris, 1992. Fruit Flies of
Economic Significance, C.A.B. International Publ., p. 239.
Bactrocera (Bactrocera) zonata: Drew & Raghu, 2002. Raffles Bull. Zool., 50(2):
347.
Bactrocera (Bactrocera) zonata: Agarwal & Sueyoshi, 2005. Oriental Insects, 39:
379.
70
70
Subgenus Hemigymnodacus Hardy
7. Bactrocera (Hemigymnodacus) diversa (Coquillett)
(Plate 4.7)
Material examined:
Himachal Pradesh: Kangra district: 1♂, 2♀, Palampur (Sagur), 17.vi.2010, ME.
Description:
Face of male entirely pale yellow without black spots while face of female with a
transverse black line above mouth. Scutum black with broad parallel sided lateral
yellow vittae and a narrow medial postsutural vittae. Scutellum yellow with a
narrow black basal band and 2 or 4 scutellar setae. Wing with a narrow dark
costal band confluent with R2+3 and widening across apex of wing, dark cubital
streak present. Abdominal terga III-V red-brown with a black T pattern. Male
without pectin.
Attractant: Methyl eugenol
Host: Not recorded
Dacus diversus : Coquillett, 1904. Proc. Entomol. Soc. Wash., 6: 139. Syntype
♂, ♀. Sri Lanka (Colombo), India (Karnataka: Bangalore) (USNM).
Bactrocera diversa: Bezzi, 1913. Mem. Indian Mus., 3: 94.
Chaetodacus diversus: Bezzi, 1916. Bull. Entomol. Res., 7: 108.
Dacus quadrifidus: Hendel, 1928. Entomol. Mitt., 17(5): 343. Holotype ♂. Sri
Lanka (DEI).
Dacus (Gymnodacus) diversus: Hardy, 1954. Proc. Entomol. Soc. Wash., 56(1):
18.
Dacus (Melanodacus) citronellae: Kapoor & Katiyar, 1969. Bull. Entomol., 10(2):
123. Holotype ♂. India (Bihar: Pusa) (NPC).
Dacus (Hemigymnodacus) diversus: Hardy, 1973. Pac. Insects Monogr., 31: 19.
71
71
Adult Male Wing
Scutum Scutellum
Abdomen (Female) Face
Head Lateral view with Legs
Plate 4.7: Morphographs of Bactrocera diversa (Coquillett)
72
72
Bactrocera (Hemigymnodacus) diversa: White & Elson-Harris, 1992. Fruit Flies of
Economic Significance, C.A.B. International Publ., p. 244.
Bactrocera (Hemigymnodacus) diversa: Agarwal & Sueyoshi, 2005. Oriental
Insects, 39: 381.
Subgenus Javadacus Hardy
8. Bactrocera (Javadacus) trilineata (Hardy)
(Plate 4.8)
Material examined:
Karnataka: Bengaluru district: 3♂♂, Bengaluru, 2.i.2010, ME.
Description:
Face entirely fulvous without black marking. Scutum black with broad parallel
sided lateral yellow vittae and a narrow medial postsutural vittae, anterior supra
alar seate absent. Scutellum yellow with a narrow black basal band and 2
scutellar setae.
Wings with complete costal band not overlapping R4+5 and expanding slightly at
wing apex. Legs fulvous with apices of femora red-brown. Abdominal terga I and
II black except for a narrow red-brown band along intersegmental line and a
broad transverse fulvous to red brown band across posterior 1/2 of tergum II and
narrowing to lateral margins. Terga III-IV entirely black except fulvous at postero-
submedially part of terga IV, terga V entirely fuscous to light brown.
Attractant: Methyl eugenol
Host: Not recorded
Dacus (Afrodacus) trilineatus: Hardy, 1955. J. Kans. Entomol. Soc., 28(1): 12.
Holotype ♂. India (Karnataka: Bangalore: Sarakki village) (BMNH).
73
73
Adult Male Wing
Scutum Scutellum
Abdomen Head
Legs Lateral view
Plate 4.8: Morphographs of Bactrocera trilineata (Hardy)
74
74
Bactrocera (Afrodacus) trilineata: Kapoor, 1993. Indian Fruit Flies. Oxford & IBH
Publ. Co., New Delhi: 73.
Bactrocera (Javadacus) trilineata: White & Elson-Harris, 1992. Fruit Flies of
Economic Significance, C.A.B. International Publ., p. 277.
Bactrocera (Javadacus) diversa: Agarwal & Sueyoshi, 2005. Oriental Insects, 39:
382.
Subgenus Zeugodacus Hendel
9. Bactrocera (Zeugodacus) cucurbitae (Coquillett)
(Plate 4.9)
Material examined:
Himachal Pradesh: Bilaspur district: 2♂, 1♀, Ghumarwin, 7.viii.2009, ex
Cucumis sativus; 8♂, Nihari, 15.v.2010, CL; Hamirpur district : 2♂, 2♀, Bhota,
29.v.2009, ex Cucumis sativus; 1♂, 2♀, Nadaun, 25.v.2009, ex Momordica
charantia; Kangra district: 4♂, 2♀, Indora, 9.viii.2009, ex Lagenaria siceraria, ex
Momordica charantia; 2♂, 2♀, Jawalamukhi, 19.viii.209, ex Cucumis sativus; 5♂,
1♀, Kangra, 26.vi.2009, ex Cucumis sativus; 4♂, Palampur, 26.vi.2009, CL; 5♂,
3♀, Shahpur, 3.ix.2009, ex Momordica charantia; Mandi district: 2♂, 1♀, Mandi,
2.vi.2009, ex Cucumis sativus; 2♂, 2♀, Nagwain, 10.viii.2009, ex Momordica
charantia; 2♂, 1♀, Sundernagar, 2.vi.2009, ex Cucumis sativus; Solan district:
3♂, 2♀, Saproon, 3.vii.2009, ex Cucumis sativus; Una district: 1♂, 2♀, Haroli,
2.ix.2009, ex Cucumis sativus; Haryana: Karnal district: 4♂, 2♀, Karnal,
16.x.2009, ex Cucumis sativus; Karnataka: Bengaluru district: Bengaluru,
27.xii.2009, CL; Delhi: Delhi: IARI, 19.vii.2009, ex Lagenaria siceraria; Bihar:
Patna district: 4♂, 5♀, Patna, 15.vii.2009, ex Cucumis sativus; Nalanda district:
3♂, 2♀, Bihar Sharif, 15.vii.2009, ex Lagenaria siceraria; Samstipur district: 6♂,
RAU Pusa, 25.ii.2010, CL; Uttar Pradesh: Ghaziabad district: 4♂, 2♀,
Ghaziabad, 19.vii.2009, ex Lagenaria siceraria; Maharashtra: Solapur district:
5♂, 2♀, Solapur, 9.vii.2009, ex Cucumis sativus; Nepal: 3♂, Dhankuta,
5.vii.2010, CL.
75
75
Adult Female Wing
Scutum Scutellum
Abdomen Face
Head Legs and Lateral view
Plate 4.9: Morphographs of Bactrocera cucurbitae (Coquillett)
76
76
Description:
Face fulvous with a pair of medium sized elongate oval black spots. Scutum
entirely red-brown or fuscous to dark fuscous markings with both lateral and
medial yellow stripes. Scutellum yellow with a narrow dark fuscous basal band,
one pair scutellar setae and rarely two pairs. Wing with complete costal band,
which is expanded into a spot at apex, crossvein dm-cu and r-m covered by
infuscate area, broad fuscous cubital streak present. Legs with femora fulvous
except for apical dark patterns which are red-brown on fore femora and fuscous
to dark fuscous on mid and hind femora, fore tibiae fuscous, mid tibiae fulvous
with fuscous basally, hind tibiae dark fuscous, all tarsi fulvous. On abdomen
transverse band across tergum III, medial longitudinal stripe on terga III-V. Male
with a row of setae (the pecten) on tergum III.
Attractant: Cue lure
Host: Cucurbits
Dacus cucurbitae: Coquillett, 1899. Entomol. News, 10: 129. Lectotype ♀. Hawaii
(Honolulu) (USNM).
Dasyneura caudata: Walker, 1849. List Dipt. Ins. Coll. Brit. Mus., 4: 1073.
(Misidentification).
Bactrocera cucurbitae: Bezzi, 1913. Mem. Indian Mus., 3: 96.
Chaetodacus cucurbitae: Bezzi, 1916. Bull. Entomol. Res., 7: 109.
Dacus (Strumeta) cucurbitae: Swezey, 1946. Bull. B. P. Bishop Mus., 10: 199.
Dacus (Zeugodacus) cucurbitae: Drew, 1973. Queensl. Dep. Indus., Div. Plant
Indus. Bull., 652, p. 23.
Zeugodacus cucurbitae: Munro, 1984. Entomol. Mem. S. Afr. Dep. Agr., 61: 18.
Bactrocera (Zeugodacus) cucurbitae: Drew, 1989. Mem. Queensl. Mus., 26: 212.
Bactrocera (Zeugodacus) cucurbitae: Drew & Raghu, 2002. Raffles Bull. Zool.,
50(2): 348-349.
Bactrocera (Zeugodacus) cucurbitae: Agarwal & Sueyoshi, 2005. Oriental
Insects, 39: 385.
77
77
10. Bactrocera (Zeugodacus) scutellaris (Bezzi)
(Plate 4.10)
Material examined:
Himachal Pradesh: Bilaspur district: 5♂, Nihari, 15.v.2010, CL; Kangra district:
4♂, 2♀, Kangra, 26.vi.2009, ex Cucumis sativus; 8♂, Palampur 13.vi.2009, CL;
Mandi district: 2 ♂, 2♀, Barot, 12.viii.2009, ex Cucurbita maxima.
Description:
Face fulvous with a pair of transverse oval black spots pointed towards centre.
Scutum shining black with narrow lateral and median postsutural yellow vittae.
Scutellum yellow with a distinct black apical spot and two pairs of scutellar setae.
Wings with a narrow dark fuscous complete costal band which is extremely
narrow beyond apex of vein R2+3 and expanding into a distinct apical spot
around apex of R4+5, cubital streak dark and broad. Abdominal terga III-V mostly
dark fuscous to black. Male with pecten on tergum III.
Attractant: Cue lure
Host: Cucurbits
Dacus ornatypes: Froggatt, 1909. In Official report on fruit fly and other pests in
various countries 1907-1908. Report on parasitic and injurious insects. N.S.W.,
Dept. Agric., Sydney, p. 99. ?Type ♂. India (UMO). (Nomen nudum, attributed to
Bigot).
Bactrocera scutellaris: Bezzi, 1913. Mem. Indian Mus., 3: 98. Syntype ♂, ♀. India
(Meghalaya: Shillong; W. Bengal: Siliguri, Kurseong; Uttaranchal: Kumaon:
Bhowali) (ZSI).
Chaetodacus scutellaris: Bezzi, 1916. Bull. Entomol. Res., 7: 113.
Dacus (Paradacus) pusaensis: Kapoor & Katiyar, 1970. The Entomologist, 103:
252. Holotype ♂. India (Bihar: Pusa) (NPC).
78
78
Adult Male Wing
Scutum Scutellum
Abdomen Face
Head Legs and Lateral view
Plate 4.10: Morphographs of Bactrocera scutellaris (Coquillett)
79
79
Dacus (Zeugodacus) scutellaris: Hardy, 1973. Pac. Insects Monogr., 31: 68.
Bactrocera (Zeugodacus) scutellaris: White and Elson-Harris, 1992. Fruit Flies of
Economic Significance, C.A.B. International Publ., p. 278.
Bactrocera (Paradacus) pusaensis: Kapoor, 1993. Indian Fruit Flies. Oxford &
IBH Publ. Co., New Delhi: 79.
Bactrocera (Zeugodacus) scutellaris: Agarwal & Sueyoshi, 2005. Oriental
Insects, 39: 386.
Bactrocera (Zeugodacus) scutellaris: Prabhakar et. al., 2007. Pest Manage.
Econ. Zool, 15(2): 181-185.
11. Bactrocera (Zeugodacus) tau (Walker)
(Plate 4.11)
Material examined:
Himachal Pradesh: Bilaspur district: 2♂, 4♀, Chandpur, 29.viii.2009, ex Cucumis
sativus; 3♂, 3♀, Ghumarwin, 7.viii.2009, ex Cucumis sativus; 5♂, Nihari,
15.v.2010, CL; Chamba district: 2♂, 3♀, Banikhet, 5.viii.2009, ex Cucumis
sativus; 1♂, 2♀, Hamirpur district: 1♂, 2♀, Nadaun, 25.v.2009, ex Lagenaria
siceraria, ex Momordica charantia, ex Cucumis sativus; Kangra district: 4♂, 5♀,
Jawalamukhi, 19.viii.209, ex Cucumis sativus, ex Momordica charantia; 3♂,2♀,
Kangra, 26.vi.2009, ex Cucumis sativus; 5♂, 9♀, Palampur, 26.vi.2009, ex
Cucumis sativus; 12.viii.2009, ex Momordica charantia; 2♂, 2♀, Shahpur,
3.ix.2009, ex Momordica charantia; Kullu district: 1♂, 1♀, Naggar, 22.viii.2009, ex
Cucumis sativus; Mandi: district: 2 ♂, 2♀, Barot, 12.viii.2009, ex Cucurbita
maxima; 2♂, 2♀, Nagwain, 10.viii.2009, ex Momordica charantia; 2♂, 3♀,
Sundernagar, 2.vi.2009, ex Cucumis sativus; Solan district: 1♂, 1♀, Nauni,
2.vii.2009, ex Cucurbita pepo; Bihar: Samastipur: 5♂, RAU Pusa, 26.ii.2010, CL;
Nepal: 4♂, Dhankuta, 5.vii.2010, CL.
80
80
Adult Male Wing
Scutum Scutellum
Abdomen Face
Head Legs and Lateral view
Plate 4.11: Morphographs of Bactrocera tau (Walker)
81
81
Description:
Face fulvous with medium sized black oval spots. Scutum black with large red-
brown areas located centrally and anterocentrally, lateral and median postsutural
yellow vittae present. Scutellum entirely yellow with four setae. Wings with a
narrow dark fuscous complete costal band overlapping vein R2+3 and expanding
into a distinct apical spot at wing apex, cubital streak dark and broad. Abdominal
terga III-V fulvous with a black T pattern. Male with pecten on tergum III.
Attractant: Cue lure
Host: Cucurbits
Dasyneura tau: Walker, 1849. List Dipt. Ins. Coll. Brit. Mus., 4: 1074. Syntype ♂.
China (Fujian: Foochow) (BMNH).
Dacus pictus: Froggatt, 1909. In Official report on fruit fly and other pests in
various countries 1907-1908. Report on parasitic and injurious insects. N.S.W.,
Dept. Agric., Sydney, p. 99. ?Type ♀. Sri Lanka (UMO). (Nomen nudum,
attributed to Bigot).
Bactrocera caudata: Bezzi, 1913. Mem. Indian Mus., 3: 97. India, Nepal
(Kathmandu), Myanmar. (Misidentification).
Chaetodacus hageni: Bezzi, 1916. Bull. Entomol. Res., 7: 109.
Zeugodacus bezzianus: Hering, 1941. Arb. Morphol. Taxon. Entomol., 8(1): 26.
Holotype ♀. China (Sichuan: Mou-Pin) (BMNH).
Dacus (Zeugodacus) tau: Hardy, 1959. Bull. Brit. Mus. (Nat. Hist.) Entomol., 8(5):
233.
Bactrocera (Zeugodacus) tau: White and Elson-Harris, 1992. Fruit Flies of
Economic Significance, C.A.B. International Publ., p. 271.
Bactrocera (Zeugodacus) tau: Agarwal & Sueyoshi, 2005. Oriental Insects, 39:
386-387.
Bactrocera (Zeugodacus) tau: Prabhakar et. al., 2009. J. Insect Sci., 22(3): 300-
308.
82
82
II Genus Dacus Fabricius
Subgenus Callantra Walker
12. Dacus (Callantra) longicornis Wiedemann
(Plate 4.12)
Material examined:
Himachal Pradesh: Kangra district: 7♂, Palampur, 2.vi.2009, CL.
Description:
Face fulvous with a pair of oval black spots. Scutum dark red-brown without
distinct black patterns, lateral and medial postsutural vittae absent. Scutellum
yellow with broad red-brown basal band and two scutellar setae. Wing with cells
bc and c fuscous, a broad dark fuscous complete costal band overlapping vein
R4+5 for its entire length. Legs with fore femora dark red-brown to fuscous, mid
femora dark red-brown to fuscous except basal ¼ fulvous, hind femora dark
fuscous, fore and mid tibiae dark red–brown to fuscous, hind tibiae dark fuscous.
Abdomen elongate-oval, strongly petiolate, abdominal terga III-V dark fuscous to
black, large orange brown spots posterocentrally on terga IV and V with oval
shining spots on tergum V. Male with pecten on tergum III.
Attractant: Cue lure
Host: Not recorded
Remarks: New record from Himachal Pradesh as well as north western
Himalayas
Dacus longicornis: Wiedemann, 1830. Aussereuropäische Zweiflügelige
Insekten., 2: 524. Lectotype ♀. Indonesia (Java) (ZMUC).
Callantra smieroides: Walker, 1860. J. Proc. Linn. Soc. London, Zool., 4: 154.
Lectotype ♂. Indonesia (Sulawesi: Makassar) (BMNH).
83
83
Adult Male Wing
Scutum Scutellum and Abdomen
Last abdominal segment Face
Head Legs and Lateral view
Plate 4.12: Morphographs of Dacus longicornis Wiedemann
84
84
Callantra smicroides: Bezzi, 1913. Mem. Indian Mus., 3: 84. (Emend. C.
smieroides Walker).
Mellesis destillatoria: Bezzi, 1916. Bull. Entomol. Res., 7: 118. Holotype ♀.
Myanmar (Kachin: Bhamo) (MCSNM).
Mellesis bioculata: Bezzi, 1919. Philipp. J. Sci., 15(5): 437. Lectotype ♂.
Philippines (Luzon: Mt. Makiling) (BAKER, presently in MCSNM).
Dacus (Callantra) smieroides: Malloch, 1939. Proc. Linn. Soc. N. S. W., 64: 411.
Callantra eumenoides: Perkins, 1937. Proc. R. Soc. Queensl., 48(9): 54.
Callantra eumenoides: Hardy, 1973. Pac. Insects Monogr., 31: 11.
Callantra longicornis: Hardy, 1977. Cat. Diptera Oriental Reg., 3: 45.
Dacus (Callantra) variegatus: Liang et al., 1993. J. Aust. Entomol. Soc., 32: 139.
Dacus (Callantra) eumenoides: Kapoor, 1993. Indian Fruit Flies. Oxford & IBH
Publ., New Delhi: 83.
Dacus (Callantra) longicornis: Drew et al., 1998. Inverterbr. Taxon., 12: 604.
Dacus (Callantra) longicornis: Agarwal & Sueyoshi, 2005. Oriental Insects, 39:
388.
13. Dacus (Callantra) sphaeroidalis (Bezzi)
(Plate 4.13)
Material examined:
Himachal Pradesh: Kangra district: 2♂, 1♂, Palampur, 17.vi.2010, 2.vii.2010, CL.
Description:
Face red brown with two large elongated black spots. Scutum red brown without
dark markings. Scutellum yellow with a narrow black basal band and 2 scutellar
setae. Wings with a pale fuscous tint across membrane except for fuscous cell
85
85
Adult Male Wing
Scutum Scutellum
Abdomen Face
Head Legs and Lateral view
Plate 4.13: Morphographs of Dacus sphaeroidalis (Bezzi)
86
86
sc, broad fuscous costal band confluent with R4+5 and expanding apically in to a
large round dark spot which overlaps M; pale fuscous anal streak present. Legs
with fore and mid femora red-brown, hind femora fulvous except red-brown
around apical 1/3, fore and mid tibiae red-brown, hind tibiae red-brown basally.
Abdomen elongate-oval, petiolate but not as strongly as in D. longicornis.
Abdominal terga III-V red-brown except for a narrow transverse black band
across anterior margin of tergum III, a pair of oval fuscous to dark fuscous
shining spots on tergum V. Male with pecten on tergum III.
Attractant: Cue lure
Host: Not recorded
Mellesis sphaeroidalis: Bezzi, 1916. Bull. Entomol. Res., 7: 115. Holotype ♂.
India (Uttaranchal: Dehra Dun) (BMNH).
Callantra sphaeroidalis: Hardy, 1973. Pac. Insects Monogr., 31: 11.
Callantra discophora: Agarwal, 1987. Biol. Bull. India, 9(2): 135.
[Misidentification].
Dacus (Callantra) sphaeroidalis: Liang et al., 1993. J. Aust. Entomol. Soc., 32:
139.
Dacus (Callantra) sphaeroidalis: Agarwal & Sueyoshi, 2005. Oriental Insects, 39:
389.
14. Dacus (Callantra) sp.
(Plate 4.14)
Material examined:
Himachal Pradesh: Kangra district: 1♂, Palampur, 2.vii.2010, CL.
Description:
Face pale brown with a transverse black line above mouth. Scutum red brown
with a narrow black line at centre. Scutellum yellow without a narrow black basal
87
87
Adult Male Wing
Scutum Scutellum
Abdomen Face
Head Legs and Lateral view
Plate 4.14: Morphographs of Dacus (Callantra) sp.
88
88
band and two scutellar setae. Wings with a pale fuscous tint across membrane
except for fuscous cell sc, broad fuscous costal band confluent with R4+5 and
expanding apically into a large round dark spot which overlaps M, pale fuscous
anal streak present. Legs with fore femora red-brown, mid and hind femora
fulvous except red-brown around apical 1/3; fore, mid and hind tibiae red-brown.
Abdomen elongate-oval and petiolate. Abdominal terga I-II pale brown with black
or dark brown at middle, terga III-V red-brown except for a narrow transverse
black band across anterior margin of tergum III.
Attractant: Cue lure
Host: Not recorded
Remarks: New record from Himachal Pradesh
Tribe: GASTROZONINI
III Genus Cyrtostola Hancock & Drew
15. Cyrtostola limbata (Hendel)
(Plate 4.15)
Material examined:
Himachal Pradesh: Kangra district: 1♀, Palampur, 10.viii.2010.
Description:
Scutum with four longitudinal black vittae placed submedially and sublaterally.
Scutellum with a large apical black spot with four scutellar setae. Wing with
fulvous basal area, including most of cell sc (which is brown basally) and narrow
transverse and marginal brown bands, across r-m crossvein reaching costa well
distal of cell sc, that across dm-cu crossvein converging with and weakly joined
to the subapical band over apex of vein M. Abdomen with transverse black bands
anteriorly on terga III-V.
89
89
Adult Female Wing
Scutum & Scutellum Abdomen
Face Head
Legs and Lateral view
Plate 4.15: Morphographs of Cyrtostola limbata (Hendel)
90
90
Attractant: Unknown
Host: Not recorded
Remarks: New record from Himachal Pradesh
Taeniostola limbata Hendel, 1915, Ann. Hist. Nat. Mus. Natl. Hung., 13: 435.
Holotype ♂. Taiwan (Taihorinsho) (DEI).
Cyrtostola limbata: Hancock & Drew, 1999. J. Nat. Hist., 33(5): 699.
Cyrtostola limbata: Agarwal & Sueyoshi, 2005. Oriental Insects, 39: 394.
Subfamily TEPHRITINAE
Tribe PLIOMELAENINI
IV Genus Pliomelaena Bezzi
16 Pliomelaena udhampurensis Agarwal & Kapoor
(Plate 4.16)
Material examined:
Himachal Pradesh: Kangra district: 1♀, Palampur, 18.viii.2009.
Description:
Small sized, blackish-brown species. Head with width more than height. Thorax
black with yellow dust and small yellow pubescence. scutellum wider than long,
rounded at apical end, black, with yellow dust, lateral margins of scutellum
yellow. Four scutellar bristles, all equal in size. Wings hyaline at base, marking
dark brown, costal spine two, both cross veins straight, wing marking light in
axillary lobe. Legs yellow, fore tibiae with long yellowish-white bristles. Abdomen
black-brown with few small yellow pubescence on abdomen.
Attractant: Unknown
Host: On cucurbits
91
91
Adult Male Wing
Scutum Scutellum
Abdomen Face
Legs Lateral view
Plate 4.16: Morphographs of Pliomelaena udhampurensis Agarwal & Kapoor
92
92
Remarks: New record from Himachal Pradesh
Pliomelaena udhampurensis: Agarwal & Kapoor, 1988. J. Entomol. Res., 12(2):
119. Holotype ♂. India (Jammu and Kashmir: Udhampur) (NPC).
Pliomelaena udhampurensis: Agarwal & Sueyoshi, 2005. Oriental Insects, 39:
418.
Tribe TEPHRITINI
V Genus Dioxyna Frey
17. Dioxyna sororcula (Wiedemann)
(Plate 4.17)
Material examined:
Himachal Pradesh: Kangra district: 1♀, Palampur, 6.vii.2010.
Description:
A small species with head longer than height. Body black in ground colour and
covered with dense yellow-grey dust and scale-like setae. Two pairs of frontal
and orbital setae; proboscis slender, elongate and geniculate. Two scutellar
setae. Wing markings as 3 large hyaline spots filling cell r1, 4-5 hyaline round
spots in cell bm.
Attractant: Unknown
Host: On cucurbits
Trypeta sororcula: Wiedemann, 1830. Aussereuropäische Zweiflügelige
Insekten., 2: 509. ?Type ♂. Canary Is. (Teneriffe) (NMW, Holotype probably lost).
Leptomyza variipennis: Wulp, 1897. Természetr. Füz., 20: 143. Holotype ♂. Sri
Lanka (Kandy) (?TMB).
Ensina bisetosa: Enderlein, 1911. Zool. Jahrb. Abt. Syst. Geogr. Biol. Tiere, 31:
455. Lectotype ♂. Taiwan (Takao) (PAN).
93
93
Adult Male Wing
Scutum Head
Face Legs & Lateral view
Plate 4.17: Morphographs of Dioxyna sororcula (Wiedemann)
94
94
Oxyna sororcula: Bezzi, 1913. Mem. Indian Mus., 3: 159.
Ensina sororcula: Hendel, 1915. Ann. Hist. Nat. Mus. Natl. Hung., 13: 465.
Paroxyna sororcula f. madeirensis: Lindner, 1928. Konowia, 7: 30. Syntype ♂.
Madeira (nr. Funchal) (SMN).
Paroxyna seguyi: Zia, 1939. Sinensia, 10(1-6): 12. Lectotype ♂. China (Guangxi:
Yangso [Yangshuo]) (IZAS).
Dioxyna sororcula: Frey, 1954. Commentat. Biol. Soc. Sci. Fenn. (1944), 8(10):
62.
Stylia sororcula: Hardy & Adachi, 1956. Bull. Bernice P. Bishop. Mus., 14(1): 21.
Dioxyna sororcula: Hardy & Drew, 1996. Inverterbr. Taxon., 10: 241.
Dioxyna sororcula: Agarwal & Sueyoshi, 2005. Oriental Insects, 39: 418.
4.2.2 Simple keys to known species of Bactrocera and Dacus of Himachal Pradesh
1. Abdomen oval or elongate …………………….......................... 2
.................................................................................. (Genus Bactrocera)
- Abdomen petiolate and elongate .......................................................... 11
........................................................................................... (Genus Dacus)
2 (1). Lateral and medial postsutural yellow vittae present .............................. 3
- Lateral postsutural yellow vittae present, medial postsutural yellow vittae
absent ..................................................................................................... 6
3 (2). Scutum black .......................................................................................... 4
- Scutum mostly red brown ....................................................................... 5
4 (3). Scutellum yellow without an apical black spot ..........................................
............................... Bactrocera (Hemigymnodacus) diversa (Coquillett)
- Scutellum yellow with an apical black spot ...............................................
............................................... Bactrocera (Zeugodacus) scutellaris (Bezzi)
95
95
5 (3). Wings with cubital streak and costal band with a distinct large spot in wing
apex ............................................ Bactrocera (Zeugodacus) tau (Walker)
- Wings with infuscation on dm-cu crossveins in addition to cubital streak
and costal band with a distinct large spot in wing apex ........................
.................................. Bactrocera (Zeugodacus) cucurbitae (Coquillett)
6 (2). Scutum base colour red brown ................................................................ 7
- Scutum base colour black ....................................................................... 8
7 (6). Wings with costal band but either discontinuous or with an extremely
narrow section distal to apex R2+3 before expanding into a spot in wing
apex ................................... Bactrocera (Bactrocera) zonata (Saunders)
8(6) Wings with costal band but either discontinuous or with an extremely
narrow section distal to apex R2+3 before expanding into a spot in wing
apex ...................................... Bactrocera (Bactrocera) correcta (Bezzi)*
- Wings with continuous costal band confluent with R2+3 ........................... 9
9 (8). All femora with dark black marking .................................................
....................... Bactrocera (Bactrocera) nigrofemoralis White & Tsuruta
- All femora entirely fulvous ................................................................... 10
10 (9) Costal band confluent with R2+3 not expanding into a distinct spot in wing
apex .................................... Bactrocera (Bactrocera) dorsalis (Hendel)
- Costal band confluent with R2+3 expanding into a small spot in wing apex
............................................ Bactrocera (Bactrocera) latifrons (Hendel)
11 (1). Scutum red brown with postsutural medial yellow vittae, lateral postsutural
yellow vittae absent ………………................................................…………
………………………………..… Dacus (Callantra) discophorus (Hering)*
- Scutum red brown without postsutural lateral and medial yellow vittae
………………………………………………………………………………... 12
96
96
12(11). Costal band narrow, confluent with vein R2+3 except at apex ………....
…………………………………………… Dacus (Didacus) ciliatus Loew*
- Costal band broad, usually confluent or overlapping vein R4+5 ………... 13
13 (12). Costal band broad, usually confluent or overlapping vein R4+5 not
expanding into a large spot in wing apex ...................................................
………………………………. Dacus (Callantra) longicornis Wiedemann
- Costal band broad, usually confluent or overlapping vein R4+5 expanding
into a large spot in wing apex, reaching and crossing vein M ……………
…………………………………... Dacus (Callantra) sphaeroidalis (Bezzi)
* Not recorded in the present study from Himachal Pradesh
4.3 Molecular characterization of fruit fly species prevalent in India
Homoplasmy in morphology, economic importance, adaptation to varied
climatic conditions, a wide host range and little work on the genetic relationship
among the members of tephritid fruit flies make them an excellent candidate for
the study of species diversity and evolutionary processes.
Among different DNA markers, mitochondrial cytochrome oxidase I
(mtCOI) gene is reasonably well conserved and evolving approximately 10 times
faster than single-copy nuclear DNA (Brown et al. 1979 Brown 1985).
Nevertheless, mtCOI sequences are at the base of the barcoding identification
system (Hebert et al. 2003; Hajibabaei et al. 2006) that, besides being a valuable
tool for species identification and discovery, has been proposed as a powerful
methodology in biosecurity and invasive species identification (Armstrong and
Ball 2005).
Therefore in the present study, mitochondrial cytochrome oxidase (mtCOI)
gene sequences were exploited for characterization of fruit fly and their isolates
collected from different regions of India.
97
97
4.3.1 Mitochondrial cytochrome oxidase (mtCOI) gene analysis of Bactrocera cucurbitae
PCR analyses of mtCOI region of 33 B. cucurbitae individuals collected
from 20 locations with universal primer pair (UEA7 and UEA10) amplified a ~650
bp amplicons, characteristics of this region (Plate 4.18). Sequencing of PCR
product using custom services revealed that various sequences of test isolates
consisted of 611 bp in all isolates.
4.3.1.1 Sequences submission and blast analysis
The obtained sequences were first blast search against the B. cucurbitae
sequences available online in the NCBI GenBank using BLASTN programme
and confirm their identity as B. cucurbitae. Comparative analysis and sequences
of the test and reference isolates from GenBank revealed that identity of all
isolates was in confirmation with that of the morphological characteristics, thus
establishing their taxonomic status. All the sequences were submitted to
GenBank database (NCBI) vide accession numbers HQ378195 to HQ378227.
4.3.1.2 Multiple alignments of test isolates of B. cucurbitae
All the sequences of 33 isolates were compared by multiple alignments
using ClustalW programme in Molecular Evolutionary Genetics Analysis (MEGA)
software version 4.1. Multiple alignments of 33 sequences of B. cucurbitae
revealed 15 variable positions in various sequences and 4 indels. Variable sites
were characterized by 11 singletons and 4 parsimonious informative, giving an
overall 2.45 per cent sequence variation of total length (611 bp)
4.3.1.3 Pair-wise genetic distance between B. cucurbitae isolates
The data pertaining to genetic distance between sequences (below
diagonal) and standard error (above diagonal) is presented in Table 4.2. The pair
wise genetic distance between the isolates ranged from 0.000 to 0.009, thereby
indicating very low genetic variation between the B. cucurbitae isolates used in
98
Table 4.2: Pair wise genetic distance based on mtCOI gene sequences of Bactrocera cucurbitae using the K2P
method in MEGA4.1.
Sr. No. B. cucurbitae isolates Pair wise genetic distance
B. cucurbitae isolates
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34
1 HQ378195 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.003 0.000 0.002 0.000 0.003 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
2 HQ378196 0.002 0.003 0.002 0.002 0.002 0.002 0.002 0.002 0.003 0.003 0.002 0.003 0.002 0.002 0.003 0.003 0.002 0.002 0.002 0.002 0.002 0.003 0.002 0.003 0.002 0.002 0.002 0.003 0.002 0.002 0.002 0.002 0.010
3 HQ378197 0.004 0.005 0.002 0.002 0.002 0.002 0.002 0.002 0.003 0.004 0.002 0.003 0.002 0.004 0.003 0.003 0.002 0.002 0.002 0.002 0.002 0.003 0.002 0.004 0.002 0.002 0.002 0.004 0.002 0.002 0.003 0.002 0.010
4 HQ378198 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.002 0.003 0.000 0.002 0.000 0.003 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
5 HQ378199 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.002 0.003 0.000 0.002 0.000 0.003 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
6 HQ378200 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.002 0.003 0.000 0.002 0.000 0.003 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
7 HQ378201 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.002 0.003 0.000 0.002 0.000 0.003 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
8 HQ378202 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.002 0.003 0.000 0.002 0.000 0.003 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
9 HQ378203 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.002 0.003 0.000 0.002 0.000 0.003 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
10 HQ378204 0.002 0.004 0.005 0.002 0.002 0.002 0.002 0.002 0.002 0.003 0.002 0.000 0.002 0.002 0.000 0.003 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.003 0.002 0.002 0.002 0.003 0.002 0.002 0.002 0.002 0.009
11 HQ378205 0.005 0.004 0.009 0.005 0.005 0.005 0.005 0.005 0.005 0.004 0.003 0.003 0.003 0.002 0.003 0.003 0.003 0.003 0.003 0.003 0.003 0.004 0.003 0.003 0.003 0.003 0.003 0.004 0.003 0.003 0.004 0.003 0.009
12 HQ378206 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.005 0.002 0.000 0.003 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
13 HQ378207 0.002 0.004 0.005 0.002 0.002 0.002 0.002 0.002 0.002 0.000 0.004 0.002 0.002 0.002 0.000 0.003 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.003 0.002 0.002 0.002 0.003 0.002 0.002 0.002 0.002 0.009
14 HQ378208 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.005 0.000 0.002 0.003 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
15 HQ378209 0.004 0.002 0.007 0.004 0.004 0.004 0.004 0.004 0.004 0.002 0.002 0.004 0.002 0.004 0.002 0.003 0.003 0.003 0.003 0.003 0.003 0.003 0.003 0.004 0.003 0.003 0.003 0.003 0.003 0.003 0.003 0.003 0.009
16 HQ378210 0.002 0.004 0.005 0.002 0.002 0.002 0.002 0.002 0.002 0.000 0.004 0.002 0.000 0.002 0.002 0.003 0.002 0.002 0.002 0.002 0.002 0.002 0.002 0.003 0.002 0.002 0.002 0.003 0.002 0.002 0.002 0.002 0.009
17 HQ378211 0.002 0.004 0.005 0.002 0.002 0.002 0.002 0.002 0.002 0.004 0.004 0.002 0.004 0.002 0.005 0.004 0.002 0.002 0.002 0.002 0.002 0.003 0.002 0.002 0.002 0.002 0.002 0.003 0.002 0.002 0.003 0.002 0.009
18 HQ378212 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.005 0.000 0.002 0.000 0.004 0.002 0.002 0.000 0.000 0.000 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
19 HQ378213 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.005 0.000 0.002 0.000 0.004 0.002 0.002 0.000 0.000 0.000 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
20 HQ378214 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.005 0.000 0.002 0.000 0.004 0.002 0.002 0.000 0.000 0.000 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
21 HQ378215 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.005 0.000 0.002 0.000 0.004 0.002 0.002 0.000 0.000 0.000 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
22 HQ378216 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.005 0.000 0.002 0.000 0.004 0.002 0.002 0.000 0.000 0.000 0.000 0.002 0.000 0.003 0.000 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
23 HQ378217 0.002 0.004 0.005 0.002 0.002 0.002 0.002 0.002 0.002 0.004 0.007 0.002 0.004 0.002 0.005 0.004 0.004 0.002 0.002 0.002 0.002 0.002 0.002 0.003 0.002 0.002 0.002 0.003 0.002 0.002 0.002 0.002 0.010
24 HQ378218 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.005 0.000 0.002 0.000 0.004 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.003 0.000 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
25 HQ378219 0.004 0.005 0.007 0.004 0.004 0.004 0.004 0.004 0.004 0.005 0.005 0.004 0.005 0.004 0.007 0.005 0.002 0.004 0.004 0.004 0.004 0.004 0.005 0.004 0.003 0.003 0.003 0.004 0.003 0.003 0.003 0.003 0.010
26 HQ378220 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.005 0.000 0.002 0.000 0.004 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.004 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
27 HQ378221 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.005 0.000 0.002 0.000 0.004 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.004 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
28 HQ378222 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.005 0.000 0.002 0.000 0.004 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.004 0.000 0.000 0.002 0.000 0.000 0.002 0.000 0.010
29 HQ378223 0.004 0.005 0.007 0.004 0.004 0.004 0.004 0.004 0.004 0.005 0.009 0.004 0.005 0.004 0.007 0.005 0.005 0.004 0.004 0.004 0.004 0.004 0.005 0.004 0.007 0.004 0.004 0.004 0.002 0.002 0.003 0.002 0.010
30 HQ378224 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.005 0.000 0.002 0.000 0.004 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.004 0.000 0.000 0.000 0.004 0.000 0.002 0.000 0.010
31 HQ378225 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.005 0.000 0.002 0.000 0.004 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.004 0.000 0.000 0.000 0.004 0.000 0.002 0.000 0.010
32 HQ378226 0.002 0.004 0.005 0.002 0.002 0.002 0.002 0.002 0.002 0.004 0.007 0.002 0.004 0.002 0.005 0.004 0.004 0.002 0.002 0.002 0.002 0.002 0.004 0.002 0.005 0.002 0.002 0.002 0.005 0.002 0.002 0.002 0.009
33 HQ378227 0.000 0.002 0.004 0.000 0.000 0.000 0.000 0.000 0.000 0.002 0.005 0.000 0.002 0.000 0.004 0.002 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.000 0.004 0.000 0.000 0.000 0.004 0.000 0.000 0.002 0.010
34 HQ378228 B. tau 0.051 0.053 0.055 0.051 0.051 0.051 0.051 0.051 0.051 0.049 0.049 0.051 0.049 0.051 0.051 0.049 0.049 0.051 0.051 0.051 0.051 0.051 0.053 0.051 0.051 0.051 0.051 0.051 0.055 0.051 0.051 0.049 0.051
35 GU122437 L. migratoria
0.859 0.866 0.872 0.859 0.859 0.859 0.859 0.859 0.859 0.866 0.873 0.859 0.866 0.859 0.873 0.866 0.859 0.859 0.859 0.859 0.859 0.859 0.865 0.859 0.866 0.859 0.859 0.859 0.859 0.859 0.859 0.859 0.859 0.858
All results are based on the pairwise analysis of 35 sequences. Below diagonal and above diagonal values are number of base substitution per site and standard error estimate(s) respectively, and were obtained by a bootstrap procedure (500 replicates).
99
99
Plate 4.18: mtCOI gene PCR product of Bactrocera cucurbitae isolates
amplified by using gene specific markers.(Lane 1 and 35, DNA
ladder 100bp; lane 2 to 34 showing mtCOI gene amplification
of Bactrocera cucurbitae isolate P101, P102, P103, P104, P106,
P106A, P106B, P106C, P107, P108, P109, P110, P111, P111A,
P111B, P111C, P111D, P112, P113, P114, P115, P117, P119A,
P119B, P119C, P119D, P119E, P119F, P120, P121, P122, P123
and P123A)
100
10
0
this study. Whereas, genetic distance with outgroup members ranged from 0.049
to 0.051 (B. cucurbitae/ B. tau) and 0.859 to 0.873 (B. cucurbitae/ L. migratoria)
base substitution per site. Hu et al. (2008) reported 0.000-0.002 (base
substitution per site) pairwise genetic distance between different B. cucurbitae
isolates collected from China and south east Asia. The observed variations in
pair wise genetic distance among B. cucurbitae suggested that B. cucurbitae
populations present in Indian subcontinent have little more variation than those
present in China and south east Asia.
4.3.1.4 Estimation of population genetic structure of B. cucurbitae from Indian subcontinent
For population genetic structure determination, haplotype numbers,
haplotypes distribution, haplotype frequency, polymorphic sites and nucleotide
diversity were assessed using ARLEQUIN 3.1.
To estimate population genetic structure of B. cucurbitae in Indian
subcontinent mtCOI gene sequences of all the 33 isolates were divided into 5
groups on the basis geographical origin (Table 4.3). The first group contained B.
Table 4.3: Population groups of B. cucurbitae isolates based on their
geographical origin
Sr. No.
B. cucurbitae population
groups
Geographical origin of isolates
Number of individuals
genotyped (n)
Sequences accession number
1 North west India Himachal Pradesh 11
HQ378195, HQ378196, HQ378197, HQ378198, HQ378206, HQ378212, HQ378213, HQ378214, HQ378215, HQ378216, HQ378225
2 East India Bihar 6 HQ378199, HQ378200, HQ378201, HQ378202, HQ378203, HQ378224
3 South India
Maharashtra and Karnataka
6
HQ378207, HQ378208, HQ378209, HQ378210, HQ378211, HQ378223
4 North India
Delhi, Haryana, Uttar Pradesh
8 HQ378204, HQ378205, HQ378217, HQ378218, HQ378219, HQ378220, HQ378221, HQ378222
5 Nepal
Nepal 2
HQ378226, HQ378227
101
10
1
cucurbitae isolates of Himachal Pradesh named as ―North West India‖, the
second group contained isolates from Bihar and referred as ―East India‖, the third
group constituted of isolates from Maharashtra and Karnataka designated as
―South India‖, the fourth group named North India had isolates from Haryana,
Delhi and Uttar Pradesh and fifth group contained isolates from Nepal kept in
―Nepal‖ population.
Among 11 isolates of B. cucurbitae from ―North West India‖ population,
sequence analysis exhibited 7 variable positions characterized by 3 substitutions
(2 transitions and 1 transversion) and 4 indels (Table 4.4). In ―East India‖
population of B. cucurbitae, no variable site was observed whereas, 16 variable
sites (4 transitions, 2 transversions, 6 substitutions and 10 indels) were observed
in ―South India‖ population of B. cucurbitae. However, in ―North India‖ population,
only 5 variable sites with 4 transitions and 1 transversion (5 substitutions) with no
indels were observed. B. cucurbitae population from Nepal contained only two
sequences with 1 transition, 1 substitution and 1 indels. Within and between the
population groups, haplotypes diversity was determined on the basis of
sequence variations.
Table 4.4: Molecular diversity indices of B. cucurbitae
Statistics North-West India
East India
South India
North India
Nepal
Sample Size 11 6 6 8 2
No. of transitions 2 0 4 4 1
No. of transversions 1 0 2 1 0
No. of substitutions 3 0 6 5 1
No. of indels 4 0 10 0 1
No. of transitions sites
2 0 4 4 1
No. of transversions sites
2 0 4 4 1
No. of substitutions sites
3 0 7 5 1
No. of indel sites 4 0 10 0 1
102
10
2
Overall 14 sequence variants (haplotypes) were identified in the five B.
cucurbitae populations (Table 4.5) and most of the haplotypes differ by two or
three mutations only with the exception of Bengaluru isolate of ―South India‖
population that showed 12 mutations (Fig 4.1 and Plate 4.19). Haplotype ―H1‖ is
the predominant haplotype among different groups except ―South India‖ with an
overall frequency of 0.52 (52% of the individuals of B. cucurbitae belong to
haplotype ―H1‖) followed by haplotype ―H6‖ having overall frequency of 0.09 (9%)
and shared two groups namely ―South India‖ and ―North India‖. Other haplotypes
are localized in their geographical group (Fig 4.2).
Literature pertaining to B. cucurbitae population genetic structure is scanty
and during literature searches only one published study was encountered.
Recently, Hu et al. (2008) published population genetic structure of B. cucurbitae
from China and south-east Asia using 64 individuals from eight geographically
distinct populations excluding Indian population. They reported 8 haplotypes
(12.50%) from 64 individuals. Whereas, 14 haplotypes (42.42%) were observed
in 33 individuals distributed over populations in the present study. This suggests
that the haplotypes diversity is more among B. cucurbitae population present in
Indian subcontinent than that of China and south-east Asia. The present findings
are also supported by the results of Virgilio et al. (2010), who studied
phylogeography and genetic structure of 25 populations of B. cucurbitae
collected from different countries by using 13 microsatellite loci and suggested
that B. cucurbitae populations are more diverse in central Asia (India, Pakistan
and Bangladesh) than any other populations of the world. They also suggested
that the central Asia is the most possible centre of origin of B. cucurbitae. The
present finding on haplotype diversity in B. cucurbitae population in Indian
subcontinent also propounds the possible origin of B. cucurbitae from central
Asia and more precisely in India. However, sole predominance of H1 haplotypes
prevalent in Indian subcontinent supported that the fruit flies might have travelled
long distances through single or multiple sources. Two systems of dispersal
could be possible for the B. cucurbitae in Indian subcontinent, i) this fly might be
10
3
Table 4.5: Distribution and frequency of different mitochondrial haplotypes in populations
Population groups Mitochondrial haplotypes n*
H1 H2 H3 H4 H5 H6 H7 H8 H9 H10 H11 H12 H13 H14
North-West India 6 1 1 2 1 11
East India 6 6
South India 2 1 1 1 1 6
North India 4 1 1 1 1 8
Nepal 1 1 2
Overall Frequency 0.52 0.03 0.03 0.06 0.03 0.09 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03
*n indicates the number of individuals genotyped
104
10
4
Fig 4.1: Minimum spanning tree (MST) of mitochondrial haplotypes of B.
cucurbitae generated by population genetic analysis software
Arlequin 3.1
105
10
5
Plate 4.19: Minimum spanning network of the 14 mitochondrial
haplotypes, observed in a set of 33 individuals from all 5
Bactrocera cucurbitae populations. Sampling region of each
haplotype is colour coded as: North west India, green; East
India, yellow; South India, light blue, North India, blue and
Nepal, brown. One, two and three step haplotypes are shown.
106
10
6
Fig 4.2: Distribution map of different mitochondrial haplotypes of Bactrocera cucurbitae populations in India
107
10
7
flying or traveling with the temperature gradients from north to south with the start
of winter season in the northern regions, where winter temperature fall below 0OC
and at the same time, temperature is favourable round the year in south India
and vice-versa with the northward rise in temperature from south-middle-north
India. This statement is supported by the collection of B. cucurbitae from
Bengaluru (South India) during Dec-Jan, 2009-10 when no activity of this fly was
observed in Himachal Pradesh (North West India). ii) This fly could easily be
transported along with their host fruit to any place in India, as no regulation has
been enacted against transportation and trade of host fruit and planting materials
for fruit fly in India i. e. no domestic quarantine regulations have been enforced in
India against fruit fly. Besides above two systems of dispersal, large scale tourist
movement as well as personal commutation by vast majority of population also
facilitates the dispersal of fruit flies with in India.
However in India, the first system of dispersal may not be working solely,
as the highest dispersal capability of the fly is reported to be as high as 2 km per
2 weeks (Peck et al. 2005). Their observations pertain to the terrain topography
consisting of hills and plains, without big rivers and high mountains, whereas in
Indian subcontinent, the north-western and north-eastern Himalayan terrain
consists of big rivers and high mountains, whereas, east and west Indo-Gangetic
plains and middle & south Indian terrain harbour big rivers. Therefore the second
system of the fly dispersal could be of major significance in the Indian
subcontinent.
4.3.1.5 Phylogenetic analysis of B. cucurbitae isolates from Indian subcontinent based on mtCOI gene
The optimal phylogenetic tree is presented in Fig. 4.3 had branch length of
1.06502390 base substitutions per site. The bootstrap value for each branch is
given in the tree.
It is clear from the Fig. 4.3 that all the B. cucurbitae isolates were
clustered in a single clade with no significant variations. Comparing B. cucurbitae
mtCOI sequences with outgroups revealed that interspecific pair wise distances
108
10
8
Fig 4.3: UPGMA tree based on mtCOI gene sequences showing the relationships between thirty three B. cucurbitae isolates of India and rooted at Locusta migratoria. Number above the branches are bootstrap values calculated by UPGMA (500 replicates). Phylogenetic analyses were conducted in software MEGA4.1.
1
HQ378203 B. cucurbitae Nalanda India HQ378212 B. cucurbitae Indora India HQ378213 B. cucurbitae Indora India HQ378224 B. cucurbitae RAU Pusa India HQ378195 B. cucurbitae Nadaun India HQ378222 B. cucurbitae Karnal India HQ378202 B. cucurbitae Patna India HQ378206 B. cucurbitae Ghumarwin India HQ378215 B. cucurbitae Jawalamukhi India HQ378227 B. cucurbitae Dhankuta Nepal HQ378200 B. cucurbitae Patna India HQ378208 B. cucurbitae Solapur India HQ378216 B. cucurbitae Haroli India HQ378198 B. cucurbitae Mandi India HQ378214 B. cucurbitae Nagwain India HQ378218 B. cucurbitae Karnal India HQ378225 B. cucurbitae Nihari India HQ378220 B. cucurbitae Karnal India HQ378199 B. cucurbitae Patna India HQ378201 B. cucurbitae Patna India HQ378221 B. cucurbitae Karnal India HQ378196 B. cucurbitae Bhota India HQ378226 B. cucurbitae Dhankuta Nepal HQ378217 B. cucurbitae Karnal India HQ378209 B. cucurbitae Solapur India HQ378210 B. cucurbitae Solapur India HQ378204 B. cucurbitae Ghaziabad India HQ378207 B. cucurbitae Solapur India HQ378211 B. cucurbitae Solapur India HQ378219 B. cucurbitae Karnal India HQ378197 B. cucurbitae Sundernagar India HQ378223 B. cucurbitae Bengaluru India HQ378205 B. cucurbitae Delhi India HQ378228 B.tau GU122437 Locusta migratoria
43
10
35
23
7
10
0
2
100
0.0 0.1 0.2 0.3 0.4 0.5
109
10
9
ranged from 0.051 (between B. cucurbitae and B. tau) to 0.873 (between B.
cucurbitae and L. migratoria). In the phylogenetic tree shown in Fig. 4.3, B. tau
occupied a position closer to B. cucurbitae with high confidence values. This
finding suggested that the B. cucurbitae populations in Indian subcontinent is
homogeneous and also deny the presence of any cryptic species complex as
suggested in other tephritid fruit flies like B. tau (Jamnongluk et al. 2003) and B.
dorsalis (Baimai et al. 1995; 1999; 2000a).
4.3.1.6 Phylogenetic analysis of B. cucurbitae populations across the world available in GenBank (NCBI) based on mtCOI gene
All the sequences of 33 isolates of B. cucurbitae from Indian subcontinent
and 23 global mtCOI sequences of B. cucurbitae available in NCBI GenBank
were compared by multiple sequence alignments using ClustalW programme in
MEGA software version 4.1. The identity and accession number of GenBank
sequences is given in Table 3.5.
Pair wise genetic distance between 56 isolates of B. cucurbitae based
upon substitutions per site was obtained by bootstraps procedure (500
replicates) using K2P method in MEGA 4.1 to elucidate the relationship among
them. The pair wise genetic distance between the isolates varied from 0.000 to
0.010 (1%).
The phylogenetic tree is presented in Fig. 4.4. The evolutionary distances
were compared using K2P and were in units of base substitution per site. The
optimal tree had branch length of 1.198492 base substitutions per site. The same
tree topology was obtained when the phylogenetic analysis was carried out with
NJ method. The bootstrap values calculated by UPGMA and NJ method with 500
replicates are given above and below the branches in the phylogenetic tree.
It is clear from tree presented in Fig. 4.4 that all the global isolates
including Indian were clustered in a single clade with no significant
variation among isolates irrespective of their origin or geographical distributions.
110
11
0
Fig 4.4: Phylogenetic tree based on mtCOI gene sequences showing the relationships
between fifty six B. cucurbitae isolates of India and other countries, rooted at Locusta migratoria. Numbers above and below the branches are bootstrap values calculated by UPGMA (500 replicates) and neighbour-joining method (500 replicates), respectively. Phylogenetic analyses were conducted in software MEGA4.1.
1
HQ378195 B. cucurbitae Nadaun India
AB192449 B. cucurbitae Japan
EU048563 B. cucurbitae China
HQ378212 B. cucurbitae Indora India
HQ378216 B. cucurbitae Haroli India
HQ378206 B. cucurbitae Ghumarwin India
FJ903497 B. cucurbitae Malaysia
HQ378213 B. cucurbitae Indora India
HQ378208 B. cucurbitae Solapur India
HQ378214 B. cucurbitae Nagwain India
HQ378200 B. cucurbitae Patna India
AY945049 B. cucurbitae USA
AB192451 B. cucurbitae Sri Lanka
AY945052 B. cucurbitae USA
HQ378199 B. cucurbitae Patna India
HQ378221 B. cucurbitae Karnal India
EU048567 B. cucurbitae China
EU048566 B. cucurbitae China
HQ378203 B. cucurbitae Nalanda India
AY945039 B. cucurbitae UAS
HQ378220 B. cucurbitae Karnal India
EU048559 B. cucurbitae China
AY945051 B. cucurbitae USA
HQ378201 B. cucurbitae Patna India
AY945040 B. cucurbitae USA
HQ378227 B. cucurbitae Dhankuta Nepal
HQ378202 B. cucurbitae Patna India
AY530900 B. cucurbitae Japan
EU048561 B. cucurbitae China
AY945050 B. cucurbitae USA
HQ378215 B. cucurbitae Jawalamukhi India
HQ378218 B. cucurbitae Karnal India
HQ378224 B. cucurbitae RAU Pusa India
AF423110 B. cucurbitae Thailand
HQ378225 B. cucurbitae Nihari India
HQ378198 B. cucurbitae Mandi India
HQ378222 B. cucurbitae Karnal India
HQ378196 B. cucurbitae Bhota India
EU048560 B. cucurbitae China
AY398758 B. cucurbitae China
HQ378217 B. cucurbitae Karnal India
EU048565 B. cucurbitae China
HQ378207 B. cucurbitae Solapur India
HQ378204 B. cucurbitae Ghaziabad India
HQ378210 B. cucurbitae Solapur India
AB192452 B. cucurbitae Thailand
HQ378226 B. cucurbitae Dhankuta Nepal
EU048564 B. cucurbitae China
AY945041 B. cucurbitae USA
HQ378219 B. cucurbitae Karnal India
HQ378211 B. cucurbitae Solapur India
EU599634 B. cucurbitae China
HQ378197 B. cucurbitae Sundernagar India
HQ378223 B. cucurbitae Bangluru India
HQ378205 B. cucurbitae Delhi India
HQ378209 B. cucurbitae Solapur India
HQ378228 B. tau
HQ378244 B. scutellaris
FJ842475 Musca domestica
GU122437 Locusta migratoria
100
98
100
90
100
59
0.0 0.1 0.2 0.3 0.4
111
11
1
Comparing B. cucurbitae mtCOI sequences with outgroups, interspecific K2P
distances ranged from 0.045-0.052, 0.140-0.147, 0.215-0.217 and 0.921-0.938
with B. tau, B. scutellaris, Musca domestica and L. migratoria, respectively. This
analysis further support the homogeneity in Indian B. cucurbitae population as
observed during comparison of only Indian isolates (Section 4.3.1.5).
The present finding is in concordance with that of Hu et al. (2008), who
observed that B. cucurbitae populations present in China and south-east Asia did
not possess significant variation. The results of the present study also support
the fact that B. cucurbitae populations are homogeneous irrespective of their
geographical distribution because of very low intraspecific pairwise genetic
distance. However, high intraspecific distances were previously reported within
the species Bactrocera oleae (Ochando and Reyes 2000; Nardi et al. 2005),
Bactrocera depressa (Mun et al. 2003) and Bactrocera dorsalis (Shi et al. 2005;
2010).
Based on studies of insect mtDNA, Brower (1994b) suggested that the
molecular clock could be calibrated to 2.3% pairwise sequence divergence per
million years. Using this value, B. cucurbitae could have originated some 0.4
million years ago, exhibiting its recent evolution in nature. Using the same
estimate of Brower (1994b), Jamnongluk et al. (2003) suggested that the B. tau
complex (complex of eight cryptic species) and B. dorsalis complex could have
arisen some 5 and 15 million years ago, respectively. This B. tau species is
similar in morphology and host range like B. cucurbitae. High genetic uniformity
in the present studies also suggested that the B. cucurbitae origin is recent as
compared to B. tau and B. dorsalis and the saturation of nucleotide sequences
might not have occured to form the cryptic species or origin of complex as in
case of B. tau (Jamnongluk et al. 2003).
The similarity of B. cucurbitae population of India with that of Japan, where
it has been eradicated with SIT (sterile insect technique) programme (Koyama et
al. 2004), make this fly a suitable candidate for exploiting its management by SIT
112
11
2
in India too. This also suggests that any large scale B. cucurbitae management
programme may work in all populations including India as the genetic makeup of
the populations is same. However, the success of large scale (international/ inter-
continental) SIT programme depends on the mating compatibility of the released
laboratory strain with the wild flies. To support the above phenomenon, mating
tests among three melon fly, B. cucurbitae populations from Mauritius,
Seychelles and Hawaii (genetic sexing strain) were conducted by Sookar et al.
(2010), they observed that the sexual activity among the three melon fly
populations was similar and no significant non-random, assortative mating was
observed. Therefore, they concluded that melon flies from Mauritius, Seychelles
and the Hawaii are compatible, at least under semi-natural conditions. The
compatibility of Hawaii population with other geographically isolated population is
in agreement with the high genetic similarity observed in the present study
between India and Hawaii (USA) melon fly population. This also suggested that
the B. cucurbitae invasion in different countries is recent in nature; most possible
source might be India (origin place) and presence of B. cucurbitae in Asian
countries as well as Hawaii Island of USA showed no historical separation as
they are coming from geographically distinct places but forming single clade.
However, any international or Indian government programme may use SIT
technique with the help of sterile strain of B. cucurbitae used in Japan for the
eradication of this dreaded pest for sustainable vegetable production and better
livelihood of the farming community. This programme would also save the
environment from the indiscriminate use of pesticide as well as the farming
community and consumers from different health problems.
4.3.2 Mitochondrial cytochrome oxidase I (mtCOI) gene analysis of B. tau prevalent in Himachal Pradesh
PCR analyses of mtCOI gene of 16 B. tau isolates were amplified using
UEA7 and UEA10 primers. Gel electrophoresis photograph of mtCOI gene of 16
isolates of B. tau is presented in Plate 4.20. Sequencing of PCR product using
custom services revealed that all the test isolates consisted of optimum 611bp
sequences length.
113
11
3
Plate 4.20: mtCOI gene PCR product of Bactrocera tau isolates amplified
by using gene specific markers. (Lane 1 and 18, 100bp ladder;
lane 2 to 17 showing mtCOI gene amplification of Bactrocera
tau isolate P1, P2, P4, P5, P7, P8, P9, P10, P11, P12, P13, P14,
P15, P16, P18 and P20)
114
11
4
4.3.2.1 Sequences submission and blast analysis
The obtained sequences were first subjected to blast search against the
sequences of B. tau available online in the NCBI GenBank using BLASTN
programme and their identity confirmed as B. tau. Comparative sequence
analysis of the test and reference isolates confirmed the taxonomic status of the
test isolates determined on morphological characteristics. All the sequences
were submitted to GenBank database (NCBI) under accession number
HQ378228-HQ378243.
4.3.2.2 Multiple alignment of mtCOI gene of B. tau isolates
All the sequences of 16 isolates were compared by multiple alignment
using ClustalW programme in MEGA 4.1. Multiple alignment of 16 sequences of
B. tau revealed 16 variable positions with no indels. Variables sites were
characterized by 12 singletons and 4 parsimonious informative.
4.3.2.3 Pair wise genetic distances between B. tau isolates
The pairwise genetic distance between sequence pairs is presented in
below diagonal and standard error above diagonal in Table 4.6. The pair wise
genetic distance between the isolates varied from 0.000 to 0.012, thereby
indicating very low genetic divergence without any significant variation among B.
tau isolates. However, contrary to our observations Jamnongluk et al. (2003)
noticed higher divergence (0.006 to 0.280) in sequences of the mtCOI gene of
eight species of the B. tau complex from Thailand. The present findings revealed
that B. tau population from Thailand possess comparatively high genetic
divergence in comparison to the Indian population, however, this could be further
established by including more number of isolates from various regions of the
country.
11
5
Table 4. 6: Pair wise genetic distance based on mtCOI gene sequences between B. tau isolates of India using the K2P method in MEGA4.1
B. tau isolates Pair wise genetic distance
B. tau isolates
HQ
3782
28
HQ
3782
29
HQ
3782
30
HQ
3782
31
HQ
3782
32
HQ
3782
33
HQ
3782
34
HQ
3782
35
HQ
3782
36
HQ
3782
37
HQ
3782
38
HQ
3782
39
HQ
3782
40
HQ
3782
41
HQ
3782
42
HQ
3782
43
GU
1224
37
HQ
3781
97
HQ378228 0.004 0.003 0.005 0.003 0.003 0.004 0.004 0.003 0.004 0.003 0.003 0.003 0.003 0.003 0.004 0.071 0.010
HQ378229 0.007 0.002 0.004 0.002 0.002 0.002 0.003 0.002 0.003 0.002 0.002 0.002 0.002 0.002 0.002 0.069 0.009
HQ378230 0.005 0.002 0.003 0.000 0.000 0.003 0.002 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.070 0.010
HQ378231 0.012 0.009 0.007 0.003 0.003 0.005 0.004 0.003 0.004 0.003 0.003 0.003 0.003 0.003 0.004 0.069 0.010
HQ378232 0.005 0.002 0.000 0.007 0.000 0.003 0.002 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.070 0.010
HQ378233 0.005 0.002 0.000 0.007 0.000 0.003 0.002 0.000 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.070 0.010
HQ378234 0.011 0.003 0.005 0.012 0.005 0.005 0.004 0.003 0.003 0.003 0.003 0.003 0.003 0.003 0.004 0.068 0.009
HQ378235 0.009 0.005 0.003 0.010 0.003 0.003 0.009 0.002 0.004 0.002 0.002 0.002 0.002 0.002 0.002 0.071 0.010
HQ378236 0.005 0.002 0.000 0.007 0.000 0.000 0.005 0.003 0.002 0.000 0.000 0.000 0.000 0.000 0.002 0.070 0.010
HQ378237 0.009 0.005 0.003 0.010 0.003 0.003 0.005 0.007 0.003 0.002 0.002 0.002 0.002 0.002 0.003 0.069 0.010
HQ378238 0.005 0.002 0.000 0.007 0.000 0.000 0.005 0.003 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.070 0.010
HQ378239 0.005 0.002 0.000 0.007 0.000 0.000 0.005 0.003 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.070 0.010
HQ378240 0.005 0.002 0.000 0.007 0.000 0.000 0.005 0.003 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.070 0.010
HQ378241 0.005 0.002 0.000 0.007 0.000 0.000 0.005 0.003 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.070 0.010
HQ378242 0.005 0.002 0.000 0.007 0.000 0.000 0.005 0.003 0.000 0.003 0.000 0.000 0.000 0.000 0.002 0.070 0.010
HQ378243 0.007 0.003 0.002 0.009 0.002 0.002 0.007 0.002 0.002 0.005 0.002 0.002 0.002 0.002 0.002 0.070 0.010
GU122437 L. migratoria
0.854 0.841 0.847 0.837 0.847 0.847 0.828 0.854 0.847 0.841 0.847 0.847 0.847 0.847 0.847 0.847 0.074
HQ378197 B. cucurbitae
0.055 0.047 0.049 0.056 0.049 0.049 0.043 0.053 0.049 0.049 0.049 0.049 0.049 0.049 0.049 0.051 0.883
All results are based on the pairwise analysis of 16 B. tau mtCOI gene sequences. Below diagonal and above diagonal values are number of base substitution per site and standard error estimate(s) respectively, and were obtained by a bootstrap procedure (500 replicates).
116
11
6
4.3.2.4 Phylogenetic analysis of B. tau isolates based on mtCOI gene
Phylogenetic tree presented in Fig. 4.5 had branch length of 0.88804529
base substitutions per site. It is clear from the Fig. 4.5 that all the isolates were
clustered in a single clade with no significant variation among B. tau isolates.
Comparing B. tau mtCOI sequences with outgroups, interspecific genetic
distances ranged from 0.043-0.056 (between B. tau and B. cucurbitae) to 0.824-
0.854 (between B. tau and L. migratoria). The present results showed that no
historical separation had taken place among B. tau isolates of Himachal Pradesh
(India) infesting cucurbits, although variations were observed in the B. tau
populations of Thailand (Jamnongluk et al. 2003).
4.3.2.5 Comparative analysis of Indian isolates and other Asian isolates of B. tau available in NCBI GenBank
Sequences of 16 test isolates from India (H.P.) were compared with
sequences of B. tau available online in GenBank (NCBI) by multiple sequence
alignment using ClustalW programme in MEGA software version 4.1. The identity
and accession number of GenBank sequences is given in Table 3.6.
The pair wise genetic distance among various isolates of different origin
ranged between 0.000 to 0.184 base substitutions per site (Table 4.7). The
genetic distance among B. tau isolates from India, China, Japan, Malaysia and
one isolates from Thailand was very low ranged from 0.000 to 0.014 base
substitution per site and varied non-significantly (Bootstrap support < 50%).
However, the distance (genetic) of Indian isolates of B. tau was very high with
other species of B. tau complex (B, C, D, E, F, G, H, I) of Thailand ranged from
0.101 to 0. 150 base substitution per site (Table 4.7).
The phylogenic analysis performed with MEGA 4.1 software using
UPGMA method clustered all the B. tau isolates in one clade, whereas, Thailand
isolates showed wide variation (Fig. 4.6). This further revealed a narrow genetic
makeup of B. tau populations prevalent in north-west India, China, Japan and
Malaysia along with species A from Thailand. The optimal tree had branch length
of 1.4168769 base substitutions per site.
11
7
Table 4.7: Pair wise genetic distance based on mtCOI gene sequences between B. tau isolates of India and other countries using the K2P method in MEGA4.1
B. tau isolates Pair wise genetic distance
B. tau isolates
FJ9
0349
6
AY
3987
53
AY
5309
01
AF4
0006
7
AY
1511
38
AF4
0007
3
AF4
0007
2
AF4
0007
1
AF4
0007
0
AF4
0006
9
AF4
0006
8
EU04
8569
HQ
3782
28
HQ
3782
29
HQ
3782
30
HQ
3782
31
HQ
3782
32
HQ
3782
33
HQ
3782
34
HQ
3782
35
HQ
3782
36
HQ
3782
37
HQ
3782
38
HQ
3782
39
HQ
3782
40
HQ
3782
41
HQ
3782
42
HQ
3782
43
FJ8
4247
5
GU
1224
37
FJ903496 Malaysia 0.003 0.003 0.004 0.015 0.018 0.016 0.015 0.014 0.018 0.015 0.003 0.004 0.003 0.003 0.004 0.003 0.003 0.003 0.004 0.003 0.003 0.003 0.003 0.003 0.003 0.003 0.003 0.021 0.074
AY398753 China 0.005 0.002 0.004 0.015 0.018 0.016 0.015 0.015 0.018 0.015 0.002 0.003 0.003 0.002 0.004 0.003 0.002 0.004 0.003 0.003 0.003 0.002 0.002 0.003 0.002 0.002 0.003 0.021 0.074
AY530901 Japan 0.004 0.002 0.004 0.015 0.018 0.016 0.015 0.015 0.019 0.015 0.000 0.003 0.002 0.000 0.004 0.002 0.000 0.003 0.003 0.002 0.003 0.000 0.000 0.002 0.000 0.000 0.002 0.021 0.074
AF400067 Thailand A 0.011 0.009 0.007 0.015 0.018 0.016 0.015 0.014 0.018 0.015 0.004 0.005 0.004 0.004 0.005 0.004 0.004 0.005 0.004 0.004 0.004 0.004 0.004 0.004 0.004 0.004 0.004 0.021 0.075
AY151138 Thailand G 0.109 0.115 0.113 0.111 0.019 0.016 0.015 0.015 0.018 0.015 0.015 0.016 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.022 0.081
AF400073 Thailand I 0.144 0.144 0.146 0.149 0.157 0.021 0.020 0.018 0.017 0.020 0.018 0.018 0.018 0.018 0.018 0.018 0.018 0.018 0.018 0.018 0.018 0.018 0.018 0.018 0.018 0.018 0.018 0.024 0.090
AF400072 Thailand F 0.120 0.118 0.120 0.118 0.118 0.184 0.011 0.016 0.017 0.003 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.016 0.024 0.082
AF400071 Thailand E 0.108 0.108 0.110 0.108 0.110 0.167 0.063 0.015 0.017 0.010 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.023 0.076
AF400070 Thailand D 0.101 0.105 0.103 0.101 0.107 0.146 0.125 0.110 0.017 0.017 0.015 0.015 0.014 0.015 0.015 0.015 0.015 0.014 0.015 0.015 0.014 0.015 0.015 0.015 0.015 0.015 0.014 0.021 0.080
AF400069 Thailand C 0.151 0.151 0.154 0.151 0.145 0.137 0.140 0.138 0.133 0.017 0.019 0.018 0.019 0.019 0.019 0.019 0.019 0.018 0.019 0.019 0.019 0.019 0.019 0.019 0.019 0.019 0.018 0.024 0.088
AF400068 Thailand B 0.114 0.112 0.114 0.112 0.112 0.177 0.005 0.057 0.127 0.133 0.015 0.015 0.015 0.015 0.016 0.016 0.015 0.015 0.015 0.016 0.015 0.015 0.015 0.015 0.015 0.015 0.015 0.024 0.083
EU048569 China 0.004 0.002 0.000 0.007 0.113 0.146 0.120 0.110 0.103 0.154 0.114 0.003 0.002 0.000 0.004 0.002 0.000 0.003 0.003 0.002 0.003 0.000 0.000 0.002 0.000 0.000 0.002 0.021 0.074
HQ378228 India 0.009 0.004 0.005 0.012 0.120 0.144 0.118 0.108 0.110 0.151 0.112 0.005 0.004 0.003 0.005 0.004 0.003 0.004 0.004 0.004 0.004 0.003 0.003 0.004 0.003 0.003 0.004 0.021 0.074
HQ378229 India 0.005 0.004 0.002 0.009 0.111 0.146 0.120 0.108 0.101 0.154 0.114 0.002 0.007 0.002 0.004 0.003 0.002 0.003 0.003 0.003 0.003 0.002 0.002 0.003 0.002 0.002 0.003 0.021 0.074
HQ378230 India 0.004 0.002 0.000 0.007 0.113 0.146 0.120 0.110 0.103 0.154 0.114 0.000 0.005 0.002 0.004 0.002 0.000 0.003 0.003 0.002 0.003 0.000 0.000 0.002 0.000 0.000 0.002 0.021 0.074
HQ378231 India 0.011 0.009 0.007 0.014 0.117 0.150 0.124 0.114 0.107 0.158 0.118 0.007 0.012 0.009 0.007 0.004 0.004 0.005 0.004 0.004 0.004 0.004 0.004 0.004 0.004 0.004 0.004 0.021 0.075
HQ378232 India 0.005 0.004 0.002 0.009 0.111 0.146 0.122 0.112 0.105 0.156 0.116 0.002 0.007 0.004 0.002 0.009 0.002 0.004 0.003 0.003 0.003 0.002 0.002 0.003 0.002 0.002 0.003 0.021 0.074
HQ378233 India 0.004 0.002 0.000 0.007 0.113 0.146 0.120 0.110 0.103 0.154 0.114 0.000 0.005 0.002 0.000 0.007 0.002 0.003 0.003 0.002 0.003 0.000 0.000 0.002 0.000 0.000 0.002 0.021 0.074
HQ378234 India 0.004 0.007 0.005 0.012 0.109 0.142 0.120 0.104 0.097 0.149 0.114 0.005 0.011 0.004 0.005 0.012 0.007 0.005 0.004 0.004 0.003 0.003 0.003 0.004 0.003 0.003 0.004 0.021 0.073
HQ378235 India 0.007 0.005 0.004 0.011 0.113 0.146 0.120 0.110 0.103 0.154 0.114 0.004 0.009 0.005 0.004 0.011 0.005 0.004 0.009 0.003 0.004 0.003 0.003 0.003 0.003 0.003 0.002 0.021 0.074
HQ378236 India 0.005 0.004 0.002 0.009 0.115 0.148 0.122 0.112 0.105 0.156 0.116 0.002 0.007 0.004 0.002 0.009 0.004 0.002 0.007 0.005 0.003 0.002 0.002 0.003 0.002 0.002 0.003 0.021 0.075
HQ378237 India 0.004 0.005 0.004 0.011 0.113 0.146 0.120 0.110 0.101 0.154 0.114 0.004 0.009 0.005 0.004 0.011 0.005 0.004 0.005 0.007 0.005 0.003 0.003 0.003 0.003 0.003 0.003 0.021 0.074
HQ378238 India 0.004 0.002 0.000 0.007 0.113 0.146 0.120 0.110 0.103 0.154 0.114 0.000 0.005 0.002 0.000 0.007 0.002 0.000 0.005 0.004 0.002 0.004 0.000 0.002 0.000 0.000 0.002 0.021 0.074
HQ378239 India 0.004 0.002 0.000 0.007 0.113 0.146 0.120 0.110 0.103 0.154 0.114 0.000 0.005 0.002 0.000 0.007 0.002 0.000 0.005 0.004 0.002 0.004 0.000 0.002 0.000 0.000 0.002 0.021 0.074
HQ378240 India 0.005 0.004 0.002 0.009 0.111 0.149 0.118 0.108 0.105 0.156 0.112 0.002 0.007 0.004 0.002 0.009 0.004 0.002 0.007 0.005 0.004 0.005 0.002 0.002 0.002 0.002 0.003 0.021 0.074
HQ378241 India 0.004 0.002 0.000 0.007 0.113 0.146 0.120 0.110 0.103 0.154 0.114 0.000 0.005 0.002 0.000 0.007 0.002 0.000 0.005 0.004 0.002 0.004 0.000 0.000 0.002 0.000 0.002 0.021 0.074
HQ378242 India 0.004 0.002 0.000 0.007 0.113 0.146 0.120 0.110 0.103 0.154 0.114 0.000 0.005 0.002 0.000 0.007 0.002 0.000 0.005 0.004 0.002 0.004 0.000 0.000 0.002 0.000 0.002 0.021 0.074
HQ378243 India 0.005 0.004 0.002 0.009 0.111 0.144 0.118 0.108 0.101 0.151 0.112 0.002 0.007 0.004 0.002 0.009 0.004 0.002 0.007 0.002 0.004 0.005 0.002 0.002 0.004 0.002 0.002 0.021 0.074
FJ842475 M. domestica 0.197 0.202 0.200 0.197 0.209 0.244 0.243 0.231 0.200 0.247 0.241 0.200 0.202 0.200 0.200 0.204 0.202 0.200 0.195 0.197 0.202 0.200 0.200 0.200 0.202 0.200 0.200 0.197 0.085
GU122437 L. migratoria 0.902 0.896 0.903 0.915 0.969 1.024 0.981 0.923 0.952 1.005 0.983 0.903 0.903 0.896 0.903 0.906 0.903 0.903 0.890 0.903 0.909 0.896 0.903 0.903 0.903 0.903 0.903 0.896 1.006
All results are based on the pairwise analysis of 28 mtCOI gene sequences. Below diagonal and above diagonal values are number of base substitution per site and standard error estimate(s) respectively, and were obtained by a bootstrap procedure (500 replicates).
118
11
8
Fig 4.5: Phylogenetic tree based on mtCOI gene sequences showing the relationships between sixteen B. tau isolates of Himachal Pradesh and rooted at Locusta migratoria. Numbers above branches are bootstrap values calculated by UPGMA (500 replicates). Phylogenetic analyses were conducted in software MEGA4.1.
1
HQ378232 B. tau Banikhet India HQ378236 B. tau Nagwain India HQ378240 B. tau Jawalamukhi India HQ378230 B. tau Palampur India HQ378233 B. tau Nadaun India HQ378238 B. tau Barot India HQ378242 B. tau Shahpur India HQ378239 B. tau Jawalamukhi India HQ378241 B. tau Chandpur India HQ378229 B. tau Nadaun India HQ378235 B. tau Ghumarwin India HQ378243 B. tau Nihari India HQ378237 B. tau Palampur India HQ378234 B. tau Mandi India HQ378228 B. tau Nadaun India HQ378231 B. tau Nauni India HQ378197 B. cucurbitae India GU122437 Locusta migratoria
35
30
49
24
15
35 54
99
0.0 0.2 0.4 0.6 0.8
119
11
9
Fig 4.6: Phylogenetic tree based on mtCOI gene sequences showing the
relationships between twenty eight B. tau isolates of India and other countries and rooted at Locusta migratoria. Numbers above branches are bootstrap values calculated by UPGMA (500 replicates). Phylogenetic analyses were conducted in software MEGA4.1.
1
AY530901 B. tau Japan HQ378233 B. tau Nadaun India HQ378242 B. tau Shahpur India HQ378238 B. tau Barot India HQ378241 B. tau Chandpur India EU048569 B. tau China HQ378239 B. tau Jawalamukhi India HQ378230 B. tau Palampur India HQ378240 B.tau Jawalamukhi India HQ378232 B. tau Baniket India HQ378229 B. tau Nadaun India AY398753 B. tau China HQ378236 B.tau Nagwain India HQ378235 B.tau Ghumarwin India HQ378243 B. tau Nihari India HQ378234 B. tau Mandi India FJ903496 B. tau Malaysia HQ378237 B.tau Palampur India HQ378228 B. tau Nadaun India AF400067 B. tau A Thailand HQ378231 B. tau Nauni India AF400070 B. tau D Thailand AY151138 B.tau G Thailand AF400071 B. tau E Thailand AF400072 B. tau F Thailand AF400068 B. tau B Thailand AF400073 B. tau I Thailand AF400069 B. tau C Thailand FJ842475 Musca domestica GU122437 Locusta migratoria
99
99
99
89
69
99
120
12
0
Jamnongluk et al. (2003) compared sequences of the mitochondrial
cytochrome oxidase I gene of eight species of the Bactrocera tau complex from
Thailand. The sequence divergence between species in the B. tau complex
ranged from 0.006 to 0.280. However in the present study, the sequence
divergence was slightly less than that observed by Jamnongluk et al. (2003). This
variation could be ascribed due to the length of sequences included in the
analysis and the boot strap support analysis. Jamnongluk et al. (2003) included
639bp sequences and used 1000 replication for bootstrap test whereas, in the
present analysis, 611 bp sequences and 500 replications (Bootstrap) were used.
All B. tau isolates collected from Himachal Pradesh (India) were clustered
with B. tau Thailand species A, this propounds that the cucurbits infestation in
Himachal Pradesh is by B. tau Thailand species A of the B. tau species complex
as Thailand species A has been considered as the generalist cucurbits pest
(Jamnongluk et al. 2003). The presence of other species of B. tau species
complex in H.P. as well as in India should not be ignored as a total of eight
species have been reported in B. tau species complex. This however needs
further detailed investigations.
4.3.3 Molecular phylogeny of Bactrocera and Dacus species based on mtCOI gene
PCR amplification of mtCOI gene of Bactrocera (other than B. cucurbitae
and B. tau) and Dacus species is presented in Plate 4.21. Sequencing of PCR
product using custom services revealed that sequences of all test isolates
consisted of 611bp.
4.3.3.1 Sequence submission and blast analysis
The obtained sequences were first blast searched against the sequences
of Bactrocera and Dacus species available in online NCBI GenBank using
BLASTN programme. After blast search of mtCOI gene of different Bactrocera
and Dacus species isolates, it was found that mtCOI gene of three species
namely B. nigrofemoralis, Dacus longicornis, Dacus sphaeroidalis sequenced in
121
12
1
Plate 4.21: mtCOI gene PCR product of fruit fly species isolates amplified
by using gene specific markers. (Lane 1 and 14, 100bp DNA
ladder; lane 2 to 13 showing mtCOI gene amplification of fruit
fly species, lane 2-3, Bactrocera scutellaris; lane 4, Bactrocera
zonata; lane 5-9, Bactrocera dorsalis; lane 10, Bactrocera
nigrofemoralis; lane 11, Dacus longicornis and lane 12-13,
Dacus sphaeroidalis)
122
12
2
present study were new and the mtCOI sequences of these species were not
present in NCBI GenBank. All the mtCOI gene sequences of Bactrocera and
Dacus species were submitted to NCBI GenBank vide accession number
HQ446519 (B. nigrofemoralis), HQ446520 (Dacus longicornis), HQ446521-
HQ446522 (Dacus sphaeroidalis), HQ372244-HQ372245 (B. scutellaris),
HQ446513 (B. zonata) and HQ446514-HQ446518 (B. dorsalis). mtCOI gene
sequences of B. nigrofemoralis, Dacus longicornis and Dacus sphaeroidalis were
new to NCBI GenBank and constitute first record in the global GenBank
database (GenBank, NCBI, USA).
4.3.3.2 Multiple alignment and comparison of different Bactrocera and Dacus spp. isolates
All the sequences of 61 isolates of different Bactrocera and Dacus spp.
were compared by multiple alignment using ClustalW programme in MEGA 4.1.
4.3.3.3 Genetic distance within and between species
Although pair-wise genetic distance was calculated to compare any two
isolates but it gave little idea about genetic distance between and within different
Bactrocera and Dacus species groups. Keeping this in view mean genetic
distance between and within species groups was calculated and presented in
Table 4.8, revealed very low genetic distance within each species group varying
from 0.000 to 0.014. The maximum genetic distance was within B. dorsalis
(0.014) followed by B. tau (0.004), B. cucurbitae (0.002), B. scutellaris (0.00) and
Dacus sphaeroidalis (0.00). The genetic distances within a species were not
calculated for the species B. zonata, B. nigrofemoralis, D. longicornis, Musca (out
group) and Locusta (out group) because of single sequence.
12
3
Table 4.8. Estimates of evolutionary divergence over sequence pairs between species using the K2P method in
MEGA4.1
Species Number of base substitutions per site
Species
B.
scutellaris
B.
zonata
B.
dorsalis
B.
nigrofemoralis
Dacus
longicornis
Dacus
sphaeroidalis
B.
cucurbitae
B.
tau
Musca Locusta
B. scutellaris 0 0.027 0.029 0.029 0.041 0.042 0.027 0.025 0.047 1.049
B. zonata 0.158 nc* 0.018 0.018 0.040 0.044 0.032 0.035 0.044 1.023
B. dorsalis 0.172 0.097 0.014 0.004 0.041 0.039 0.029 0.029 0.045 1.007
B. nigrofemoralis 0.173 0.093 0.013 nc 0.040 0.039 0.031 0.030 0.044 1.010
Dacus longicornis 0.234 0.229 0.233 0.225 nc 0.038 0.036 0.036 0.056 1.053
Dacus sphaeroidalis 0.243 0.250 0.229 0.230 0.221 0 0.035 0.037 0.054 0.963
B. cucurbitae 0.158 0.187 0.174 0.179 0.202 0.199 0.002 0.010 0.045 0.945
B. tau 0.141 0.203 0.173 0.175 0.204 0.212 0.047 0.004 0.041 0.935
Musca 0.251 0.239 0.251 0.243 0.285 0.289 0.247 0.226 nc 1.075
Locusta 2.235 2.214 2.226 2.226 2.342 2.116 2.014 1.961 2.318 nc
*nc not calculated All results are based on the pairwise analysis of 63 sequences. Below diagonal and above diagonal values are number of base substitution per site and standard error estimate(s) between the species respectively, and were obtained by a bootstrap procedure (500 replicates).
Diagonal values are within species sequence divergence
124
12
4
Mean genetic distance (below diagonal) between Bactrocera and Dacus
species is given in Table 4.8. The mean genetic distance between species group
varied from 0.013 to 0.250 with minimum distance between B. dorsalis/ B.
nigrofemoralis (0.013) followed by B. cucurbitae/ B. tau (0.047), B. zonata/ B.
scutellaris (0.093), B. zonata/ B. dorsalis (0.97). The mean genetic distance
between out group and all other isolates was very high (0.226 to 2.342) indicating
their distinct genetic makup. Very low mean genetic distance between B.
cucurbitae and B. tau confirmed their classical taxonomic relationships as these
two species have been placed in Zeugodacus group. Lower genetic distance
among B. dorsalis, B. nigrofemoralis and B. zonata is signifying their relatedness
as a member of Bactrocera group.
4.3.3.4 Phylogenetic relationship between different Bactrocera and Dacus species using mtCOI gene sequences
In order to infer relationships among eight species of Bactrocera and
Dacus using mitochondrial DNA sequences. The optimal phylogenetic tree with a
branch length of 2.013459 base substitutions per site was generated using
UPGMA method and is given in Fig. 4.7 revealed that all the isolates were
divided into their respective species group and clustered together indicating that
all the species can be differentiated on the basis of mtCOI gene.
Further isolates of B. cucurbitae, B. tau and B. scutellaris were clustered
in a larger clade as per classical group Zeugodacus (Fig 4.7). Branch topology of
phylogenetic tree in the present study revealed that the evolution of group
Zeugodacus recovered as monophyletic and emerging from Bactrocera group of
species with high bootstrap support (74 percent). However, B. zonata, B. dorsalis
and B. nigrofemoralis members of the subgenus Bactrocera have been clustered
together outside Zeugodacus. In the present study, the genus Bactrocera also
recovered as monophyletic in origin with 81 per cent bootstrap support. Two
species of genus Dacus namely Dacus longicornis and Dacus sphaeroidalis have
been clustered together, forming Callantra group. Whereas, out group members
i.e. Musca domestica from the order Diptera and Locusta migratoria from the
order Orthoptera of class Insecta were placed outside in the phylogenetic tree
(Fig 4.7).
125
12
5
Fig 4.7: Phylogenetic tree based on mtCOI gene sequences showing the relationships between eight species of Bactrocera and Dacus spp. of India rooted at Locusta migratoria. Numbers near the branches are bootstrap values calculated by UPGMA (500 replicates). Phylogenetic analyses were conducted in software MEGA 4.1.
1
HQ378201 B. cucurbitae Patna India HQ378218 B. cucurbitae Karnal India HQ378199 B. cucurbitae Patna India HQ378215 B. cucurbitae Jawalamukhi India HQ378222 B. cucurbitae Karnal India HQ378227 B. cucurbitae Dhankuta Nepal HQ378225 B. cucurbitae Nihari India HQ378206 B. cucurbitae Ghumarwin India HQ378221 B. cucurbitae Karnal India HQ378202 B. cucurbitae Patna India HQ378212 B. cucurbitae Indora India HQ378220 B. cucurbitae Karnal India HQ378195 B. cucurbitae Nadaun India HQ378214 B. cucurbitae Nagwain India HQ378198 B. cucurbitae Mandi India HQ378203 B. cucurbitae Nalanda India HQ378208 B. cucurbitae Solapur India HQ378213 B. cucurbitae Indora India HQ378224 B. cucurbitae RAU Pusa India HQ378200 B. cucurbitae Patna India HQ378216 B. cucurbitae Haroli India HQ378196 B. cucurbitae Bhota India HQ378204 B. cucurbitae Ghaziabad India HQ378207 B. cucurbitae Solapur India HQ378210 B. cucurbitae Solapur India HQ378226 B. cucurbitae Dhankuta Nepal HQ378217 B. cucurbitae Karnal India HQ378211 B. cucurbitae Solapur India HQ378219 B. cucurbitae Karnal India HQ378197 B. cucurbitae Sundernagar India HQ378223 B. cucurbitae Bengaluru India HQ378205 B. cucurbitae Delhi India HQ378209 B. cucurbitae Solapur India HQ378231 B. tau Nauni India HQ378228 B. tau Nadaun India HQ378234 B. tau Mandi India HQ378237 B. tau Palampur India HQ378235 B. tau Ghumarwin India HQ378243 B. tau Nihari India HQ378236 B. tau Nagwain India HQ378240 B. tau Jawalamukhi India HQ378229 B. tau Nadaun India HQ378232 B. tau Baniket India HQ378241 B. tau Chandpur India HQ378239 B. tau Jawalamukhi India HQ378242 B. tau Shahpur India HQ378233 B. tau Nadaun India HQ378230 B. tau Palampur India HQ378238 B. tau Barot India HQ378244 B. scutellaris Palampur India HQ378245 B. scutellaris Palampur India HQ446513 B. zonata Palampur India HQ446518 B. dorsalis Palampur India HQ446514 B. dorsalis Palampur India HQ446515 B. dorsalis Palampur India HQ446517 B. dorsalis Palampur India HQ446516 B. dorsalis Palampur India HQ446519 B. nigrofemoralis Palampur India HQ446520 Dacus longicornis Palampur India HQ446521 Dacus sphaeroidalis Palampur India HQ446522 Dacus sphaeroidalis Palampur India FJ842475 Musca domestica GU122437 Locusta migratoria
100
100
16
7
47
9
31
37
49
0
7
1
67
2
33
100
44 100
44 63 79
100
100
100
74
81
41
83
0.0 0.2 0.4 0.6 0.8 1.0
Zeugodacus group
Bactrocera group
Callantra group
126
12
6
Some researchers have proposed a phylogenetic analysis of the
Bactrocera subgenera groupings based on morphological characters (Drew
1989b; Drew and Hancock 2000; White 2000). According to Drew (1989b), the
subgenera of Bactrocera are divided into 4 groups, the Bactrocera group,
Queenslandacus group, Zeugodacus group, and Melanodacus group. In the
present study, the subgenus Bactrocera is placed in the Bactrocera group and
the subgenus Zeugodacus in the Zeugodacus group. This is in agreement with
the classification by Drew (1989b). Analysis suggested that the subgenus
Bactrocera and Zeugodacus were monophyletic in the present study. These
results are in accordance with the findings of Drew and Hancock (2000) and
Muraji and Nakahara (2001), who suggested that the Bactrocera (Zeugodacus)
group is monophyletic, whereas, Smith et al. (2003) recovered subgenera of
Zeugodacus group as paraphyletic.
In the present study, subgenus Bactrocera was recovered as
monophyletic in origin. This is supported by the study of Drew and Hancock
(2000), who suggested that the Bactrocera group of subgenera, represented
here by B. (Bactrocera) is monophyletic. However, Smith et al. (2003) as well as
White (2000) recovered subgenera of Bactrocera group as paraphyletic.
Bactrocera and Dacus species sequenced in this study were found as
sister groups and rooted to Musca domestica (outgroup). This result is supported
by Munro (1984) and White (2000) who suggested that these two genus as sister
groups based on the morphological characteristics.
Results of the present study suggest that the sequence analysis of mtCOI
gene is very useful to elucidate phylogeny of Bactrocera and Dacus taxa.
However, more taxa must be analyzed to infer genetic diversity among them and
more genomic data must be generated that exhibit sufficient genetic variation to
resolve some of the internal nodes ambiguity.
127
12
7
4.4 Isolation of gut bacteria of fruit fly
Gut bacteria were isolated from nine populations of fruit fly B. tau on two
culture media viz. PYEA and BHIA (enriched culture media). It was found that
bacteria were associated with all the nine populations of B. tau (Table 4.9). A
total of 63 different bacterial colonies were observed on two culture media. Out of
which, 28 were isolated on PYEA and 35 on BHIA (Table 4.9). On the basis of
colony morphology, 16 and 14 isolates obtained on PYEA and BHIA,
respectively, were chosen for screening purpose to select the five most
promising gut bacteria as fruit fly attractant (Table 4.9) and for their further
characterization.
Bacterial association with Tephritidae in general and Bactrocera in
particular is well known and has been confirmed by many workers. Gupta et al.
(1982a) isolated bacteria from different organs of B. cucurbitae, but they could
record only one type of bacteria from the fruit flies. Sood and Nath (2002)
isolated 11 types of bacteria from B. tau and B. cucurbitae and established the
true association of fruit fly type bacteria with Bactrocera spp. which is in
conformity with the present findings.
The presence of bacteria in alimentary track of B. tryoni in Australia has
been well documented (Drew and Lloyd 1987). Unlike, Gupta et al. (1982b), who
reported only one species (Pseudomonas pseudomalaii) in B. cucurbitae, Drew
and Lloyd (1987) reported six types of bacteria in B. tryoni. Whereas, three types
of bacteria were reported in B. tau by Prabhakar et al. (2009b). The variation in
number and types of bacteria associated with Bactrocera by different workers
from different species might be due to different geographical location and species
variation.
12
8
Table 4.9 : Isolation of gut bacteria from different populations of B. tau
B. tau isolates used for bacterial isolation
Culture media used
Peptone Yeast Extract Agar (PYEA) Brain Heart Infusion Agar (BHIA)
Bacterial colonies isolated
Bacterial isolates
selected for attractancy screening
Bacterial isolate number
Bacterial colonies isolated
Bacterial isolates
selected for attractancy screening
Bacterial isolate number
P1 4 4 P1A, P1B, P1C, P1D
4 2 B1A, B1B
P2 3 2 P2A, P2B 4 1 B2A
P3 3 1 P3A 3 2 B3A, B3B
P4 2 1 P4A 5 2 B4A, B4B
P5 4 2 P5A, P5B 4 1 B5A
P9 2 1 P9A 3 1 B9A
P10 4 2 P10A, P10B 4 2 B10A, B10B
P15 2 1 P15A 5 2 B15A, B15B
P18 4 2 P18A, P18B 3 1 B18A
Total 28 16 35 14
129
12
9
4.4.1. Screening of fruit fly gut bacteria as fruit fly attractant
A perusal of data presented in Table 4.10 revealed that majority of
bacteria isolated from the gut of B. tau attracted more number of B. tau adult
(female and male) than control (un-inoculated PYE broth). The five most
attractive bacterial isolates were selected on the basis of adult fruit flies visits/ 30
min. to different bacterial cultures (treatments) which were initially coded as P1B,
P3A, P10A, B4A and B10B. These bacterial isolates were characterized,
evaluated as attractant to fruit fly and subjected to GCMS analysis for
identification of volatile bacterial metabolites.
4.5 Identification of gut bacterial isolates of fruit fly
The five gut bacterial isolates of fruit fly were identified on the basis of
cultural, morphological, biochemical and 16S rDNA characteristics. The results of
different cultural morphological, biochemical tests and 16S rDNA sequences for
the identification of these bacterial isolates are presented in Table 4.11.
4.5.1 Morphological characterization
All bacterial isolates were rod shaped and Gram- negative in nature (Table
4.11). Isolates P1B, P3A, B4A and B10B were found motile, whereas isolate
P10A was non-motile.
On the basis of colony characteristics, bacterial isolate P10A was found to
produce yellow pigment, while P1B, P3A, B4A and B10B did not produce any
pigment. All the isolates P1B, P3A, P10A, B4A and B10B were found to form
sediment in PYEB medium.
4.5.2 Biochemical characterization
Isolate P1B gave a positive reaction for MR, oxidase and catalase where
as, a negative reaction for citrate, VP, TSI, D-glucose and gas production in
glucose medium. Isolate P3A was oxidase, catalase and D-glucose positive and
citrate, TSI and gas production in glucose medium negative while the reaction
was doubtful for citrate and VP (Table 4.11).
130
13
0
Table 4.10: Attractancy of bacterial isolates against fruit fly, B. tau (Walker)
Sr. No. Bacterial Isolates (72 hrs old, 2 ml broth culture)
Fruit flies visited /30 min
Female* Male* Total*
1 P1A 3.17 2.17 5.33 2 P1B** 9.83 7.17 17.00 3 P1C 3.50 3.83 7.33 4 P1D 3.17 3.50 7.17
5 P2A 1.17 1.00 2.17 6 P2B 3.00 2.00 5.00 7 P3A** 10.5 7.67 18.17 8 P4A 3.50 1.33 4.83 9 P5A 4.33 3.00 7.33 10 P5B 3.83 1.83 5.67 11 P9A 5.17 4.50 10.50 12 P10A** 8.67 6.67 15.33 13 P10B 4.67 4.83 9.50 14 P15A 2.17 2.50 4.67 15 P18A 1.67 1.33 2.17 16 P18B 3.50 4.17 7.67 17 B1A 2.33 3.83 6.17 18 B1B 3.00 2.50 5.17 19 B2A 3.50 3.17 9.50 20 B3A 3.33 2.67 6.00 21 B3B 2.17 2.50 4.67 22 B4A** 7.50 6.33 13.83 23 B4B 2.67 2.83 5.50 24 B5A 3.83 1.50 5.33 25 B9A 2.50 3.00 5.50 26 B10A 2.50 1.33 4.00 27 B10B** 6.33 5.83 12.17 28 B15A 4.33 4.17 8.83 29 B15B 3.00 2.83 6.17 30 B18A 2.67 2.17 4.83 31 Control
(Un-inoculated PYEA broth) 1.67 1.83 3.50
CD0.05 1.58 1.48 2.37
*Mean of six replications ** Selected for characterization and analysis
13
1
Table 4.11: Morphological, biochemical and molecular characteristics of promising gut bacteria of B. tau
Characteristics Bacterial isolates P1B P3A P10A B4A B10B
Morphological Shape Rod Rod Rod Rod Rod Gram's reaction - - - - - Pigment production - - Y - - growth in broth medium
Sediment Sediment Sediment Sediment Sediment
Motality + + - + + Biochemical Citrate test - d - - d Methyl red + - - - - V P test - d - - - TSI - - - - - Catalase + + + + + Oxidase + + + + + D- Glucose - + + - d Gas Production in glucose medium
- - - - -
Molecular 16S rDNA sequence blast similarity
91 % with Delftia acidovorans
97 % with Pseudomonas
putida
95 % with Flavobacterium
sp.
98 % with Defluvibacter
sp.
99 % with Ochrobactrum
sp. Bacteria identified as
Delftia acidovorans
Pseudomonas putida
Flavobacterium sp.
Defluvibacter sp.
Ochrobactrum sp.
Y yellow pigment, - negative reaction, + positive reaction, d doubtful result
132
13
2
A positive reaction for oxidase, catalase and D-glucose was obtained for
isolate P10B and it was negative for citrate, MR, VP, TSI and gas production in
glucose medium tests (Table 4.11). Isolate B4A also gave same result as isolate
P10B except that D-glucose was negative.
Isolate B10B was positive for oxidase and catalase, negative for MR, VP,
TSI, and gas production in glucose medium and doubtful for citrate and D-
glucose (Table 4.11).
4.5.3 Sequencing of 16S rRNA bacterial gene and sequence analysis
An attempt was made to characterize the promising bacteria isolated from
the fruit fly gut using 16S rRNA gene sequences to identify and to decipher their
phylogenetic affiliation. The 16S rRNA gene serve as molecular chronometer,
since it is the most conserved part during evolution (Clarridge 2004). Therefore,
16S rRNA gene sequencing is accepted worldwide for authenticated
identification and for phylogenetic analysis of the bacterium. The PCR amplified
products of 16S rRNA gene using specific primers of five gut bacterial isolates
from B. tau are presented in Plate 4.22. Sequence data of 16S rRNA gene
obtained after custom sequencing of the PCR products using specific primers
revealed the presence of 975bp in all the test isolate i.e. P1B, P3A, P10A, B4A
and B10B. Nucleotide sequence analysis of test isolates using online BLAST
nucleotide similarity search program (http://blast.ncbi.nlm.nih.gov/) revealed that
test bacterial isolates showed maximum homology (similarity) with Delftia
acidovorans (91%), Pseudomonas putida (97%), Flavobacterium sp. (95%),
Defluvibacter sp. (98%) and Ochrobactrum sp. (99%).
Thus on the basis of cultural, morphological, biochemical and 16S rDNA
gene characteristics, the bacterial isolates P1B, P3A, P10A, B4A and B10B were
identified as Delftia acidovorans, Pseudomonas putida, Flavobacterium sp.,
Defluvibacter sp. and Ochrobactrum sp., respectively (Plate 4.23).
133
13
3
Plate 4.22: 16S rRNA gene PCR product of gut bacterial isolates of B. tau
(Walker) amplified by using gene specific markers (Lane M1:
double digested DNA ladder and Lane M2: and DNA ladder
100bp)
134
13
4
Delftia acidovorans (P1B)
Pseudomonas putida (P3A)
Flavobacterium sp. (P10A)
Defluvibacter sp. (B4A)
Ochrobactrum sp. (B10B)
Plate 4.23: Promising gut bacteria of Bactrocera tau
135
13
5
The 16S rDNA gene nucleotide sequences of these isolates were
submitted to GenBank nucleotide database under accession number HQ446523
to HQ446527.
4.6 Multiple sequence alignment and pair wise genetic distance
All the sequences of 5 bacterial isolates were compared with other 42
bacterial sequences available online in GenBank (NCBI) by multiple sequence
alignment tool using ClustalW programme. The identity and accession number of
the sequences used for analysis is given in Table 3.8. The per cent pair wise
genetic distance (Table 4.12) of the five promising isolates with other selected
sequences ranged from 0.00 to 0.70 nucleotide per site.
The pair wise genetic distance was minimum (0.01) between the test
Delftia acidovorans P1B and other Delftia sequences. However, genetic distance
of this genus was very high with other bacterial genera such as Pseudomonas
(0.34-0.36), Ochrobactrum & Brucellaceae (0.38-0.43), Defluvibacter &
Phyllobacteriaceae (0.40-0.44) and Flavobacterium & Myroides (0.61-0.70) used
in the analysis (Table 4.12).
The pair wise genetic distance among test bacterial isolate P3A
(Pseudomonas putida, HQ446524) and other isolates of Pseudomonas spp.
isolates varied from 0.00 to 0.20, however, least genetic distance (0.00) among
different Pseudomonas spp. was observed with Pseudomonas putida (AY741156
and DQ387441) followed by Pseudomonas spp. (HM152635, EU372964,
FJ472861, FJ472858, AM913888 and AM930519, 0.01) and maximum genetic
distance (0.20) was observed with Pseudomonas geniculata (HM805109).
Gut bacterial isolate P10A identified as Flavobacterium sp. (HQ446525)
showed minimum genetic distance (0.01) with Flavobacterium sp. (FJ965845)
followed by 0.03 with Myroides odoratus (AB517709), Myroides sp. (GU350455),
136
13
6
Myroides odoratus (M58777) and Flavobacterium odoratum (D14019). Whereas,
maximum genetic distance (0.16) was observed with Uncultured Flavobacterium
sp. (AM910365), though overall genetic distance among various spp. used in the
analysis was very low (Table 4.12).
Genetic distance between B4A isolate identified as Defluvibacter sp.
(HQ446526) a member of bacterial family Phyllobacteriaceae, and other
Phyllobacteriaceae bacteria ranged from 0.00 to 0.06. Defluvibacter sp.
(HQ446526) showed minimum genetic distance (0.00) with Defluvibacter sp.
(FJ542910), Defluvibacter lusatiensis (EU870446) & Phyllobacteriaceae
bacterium (GQ249219 and AM884147) followed by 0.01 genetic distance with
Defluvibacter lusatiensis (FJ982919) & Phyllobacteriaceae bacterium
(AM884148) and maximum genetic distance (0.06) with Phyllobacteriaceae
bacterium (AM884144).
The test organism, Ochrobactrum sp. isolate B10B (HQ446527) of the
present study was found genetically similar to Ochrobactrum guangzhouense
(EF125185) with genetic distance of 0.00. The genetic distance of this species
with other member of the genus Ochrobactrum was 0.01. Whereas, genetic
distance was 0.03 with closely related genus Pseudochrobactrum (Table 4.12).
Dendrogram constructed by phylogenetic analysis presented in Fig 4.8 shows
that the all bacterial isolates viz., P1B, P3A, B4A and B10B clustered with Delftia,
Pseudomonas, Defluvibacter and Ochrobactrum respectively, all Proteobacteria
except P10A (Flavobacterium sp., HQ446525). Isolate P10A was clustered with
Flavobacterium, a typical Bacteroidetes. Based on their affinity with known
sequences in databank, the isolate P1B belongs to class β-Proteobacteria, P3A
to class γ-Proteobacteria and B4A & B10B to class α-Proteobacteria.
Many workers suggested that nucleic acid sequence approaches,
particularly 16S rRNA genes, have proved an important tool to settle the
taxonomic position of the microbial community of insects (Paster et al. 1996;
Brauman et al. 2001; Toth et al. 2001). Because of an immense library of
13
7
Table 4.12: Pair wise genetic distance based on 16S rDNA sequences of gut bacteria of Bactrocera tau and other bacterial sequences
Organisms
Pair wise genetic distance Organisms
HQ
446523 D
elftia a
cid
ovora
ns
HQ
446524 P
seudom
onas p
utida
HQ
446525 F
lavobacte
rium
sp.
HQ
446526 D
efluvib
acte
r sp.
HQ
446527 O
chro
bactr
um
sp.
HQ
113205 D
elftia a
cid
ovora
ns
FR
682935 D
elftia s
p.
AF
538930 D
elftia a
cid
ovora
ns
AF
149849 D
elftia a
cid
ovora
ns
FJ688376 D
elftia s
p.
AM
910363 U
nculture
d D
elftia
acid
ovora
ns
EF
692532 D
elftia s
p.
GQ
466172 D
elftia a
cid
ovora
ns
AB
517709 M
yro
ides o
dora
tus
GU
350455 M
yro
ides s
p.
M58777 M
yro
ides o
dora
tus
D14019 F
lavobacte
rium
odora
tum
GQ
857652 M
yro
ides s
p.
AJ854059 M
yro
ides o
dora
tim
imus
AM
910365 U
nculture
d F
lavobacte
rium
FJ965845 F
lavobacte
rium
sp.
EF
125185 O
chro
bactr
um
guangzhoue
nse
FJ581024 P
seudochro
bactr
um
sp.
EF
071943 B
rucella
ceae b
acte
rium
DQ
334872 O
chro
bactr
um
sp.
AM
403218 O
chro
bactr
um
sp.
AM
041247 O
chro
bactr
um
ory
zae
EU
543575 O
chro
bactr
um
sp.
AJ920029 O
chro
bactr
um
shiy
ianus
HM
468098 P
seudochro
bactr
um
sp.
GQ
249219 P
hyllo
bacte
riaceae
bacte
rium
AM
884147 P
hyllo
bacte
riaceae
bacte
rium
FJ542910 U
nculture
d D
efluvib
acte
r sp.
EU
870446 D
efluvib
acte
r lu
satiensis
AM
884144 P
hyllo
bacte
riaceae
bacte
rium
FJ982919 D
efluvib
acte
r lu
satiensis
AM
884148 P
hyllo
bacte
riaceae
bacte
rium
HM
152635 U
nculture
d P
seudom
onas
sp.
AM
910358 U
nculture
d P
seudom
onas
sp.
EU
372964 P
seudom
onas s
p.
FJ472861 P
seudom
onas p
utida
FJ472858 P
seudom
onas p
utida
AM
913888 P
seudom
onas s
p.
AM
930519 P
seudom
onas p
utida
DQ
387441 P
seudom
onas p
utida
AY
741156 P
seudom
onas p
utida
HM
805109 P
seudom
onas g
enic
ula
ta
HQ446523 Delftia acidovorans 0.10 0.26 0.14 0.12 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.23 0.23 0.23 0.23 0.23 0.22 0.30 0.25 0.12 0.13 0.12 0.12 0.12 0.12 0.12 0.12 0.13 0.14 0.14 0.14 0.14 0.13 0.14 0.14 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.11 HQ446524 Pseudomonas putida 0.34 0.17 0.09 0.09 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.05 0.18 0.18 0.18 0.18 0.16 0.17 0.19 0.17 0.09 0.10 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.00 0.00 0.05 HQ446525 Flavobacterium sp. 0.67 0.57 0.15 0.14 0.18 0.18 0.18 0.18 0.18 0.18 0.18 0.18 0.02 0.02 0.02 0.02 0.04 0.04 0.04 0.01 0.14 0.15 0.14 0.14 0.14 0.14 0.14 0.14 0.14 0.15 0.15 0.15 0.15 0.14 0.15 0.15 0.17 0.16 0.17 0.17 0.17 0.17 0.17 0.17 0.17 0.16 HQ446526 Defluvibacter sp. 0.44 0.30 0.50 0.03 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.10 0.16 0.16 0.16 0.16 0.15 0.15 0.14 0.15 0.03 0.04 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.00 0.00 0.00 0.00 0.02 0.01 0.01 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.11 HQ446527 Ochrobactrum sp. 0.41 0.30 0.44 0.10 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.14 0.14 0.14 0.14 0.15 0.15 0.15 0.13 0.00 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.11 HQ113205 Delftia acidovorans 0.10 0.20 0.53 0.33 0.31 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.17 0.17 0.17 0.17 0.15 0.15 0.21 0.17 0.09 0.11 0.09 0.09 0.09 0.09 0.09 0.09 0.10 0.10 0.10 0.10 0.10 0.09 0.10 0.10 0.06 0.06 0.06 0.06 0.06 0.06 0.06 0.05 0.05 0.06 FR682935 Delftia sp. 0.10 0.20 0.53 0.33 0.31 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.17 0.17 0.17 0.17 0.15 0.15 0.21 0.17 0.09 0.11 0.09 0.09 0.09 0.09 0.09 0.09 0.10 0.10 0.10 0.10 0.10 0.09 0.10 0.10 0.06 0.06 0.06 0.06 0.06 0.06 0.06 0.05 0.05 0.06 AF538930 Delftia acidovorans 0.10 0.20 0.53 0.33 0.31 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.17 0.17 0.17 0.17 0.15 0.15 0.21 0.17 0.09 0.11 0.09 0.09 0.09 0.09 0.09 0.09 0.10 0.10 0.10 0.10 0.10 0.09 0.10 0.10 0.06 0.06 0.06 0.06 0.06 0.06 0.06 0.05 0.05 0.06 AF149849 Delftia acidovorans 0.10 0.20 0.53 0.33 0.31 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.17 0.17 0.17 0.17 0.15 0.15 0.21 0.17 0.09 0.11 0.09 0.09 0.09 0.09 0.09 0.09 0.10 0.10 0.10 0.10 0.10 0.09 0.10 0.10 0.06 0.06 0.06 0.06 0.06 0.06 0.06 0.05 0.05 0.06 FJ688376 Delftia sp. 0.10 0.20 0.53 0.33 0.31 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.17 0.17 0.17 0.17 0.15 0.15 0.21 0.17 0.09 0.11 0.09 0.09 0.09 0.09 0.09 0.09 0.10 0.10 0.10 0.10 0.10 0.09 0.10 0.10 0.06 0.06 0.06 0.06 0.06 0.06 0.06 0.05 0.05 0.06
AM910363 Uncultured Delftia acidovorans 0.10 0.20 0.53 0.33 0.31 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.17 0.17 0.17 0.17 0.15 0.15 0.21 0.17 0.09 0.11 0.09 0.09 0.09 0.09 0.09 0.09 0.10 0.10 0.10 0.10 0.10 0.09 0.10 0.10 0.06 0.06 0.06 0.06 0.06 0.06 0.06 0.05 0.05 0.06 EF692532 Delftia sp. 0.10 0.20 0.53 0.33 0.31 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.17 0.17 0.17 0.17 0.15 0.15 0.21 0.17 0.09 0.11 0.09 0.09 0.09 0.09 0.09 0.09 0.10 0.10 0.10 0.10 0.10 0.09 0.10 0.10 0.06 0.06 0.06 0.06 0.06 0.06 0.06 0.05 0.05 0.06 GQ466172 Delftia acidovorans 0.10 0.20 0.53 0.33 0.31 0.00 0.00 0.00 0.00 0.00 0.00 0.00 0.17 0.17 0.17 0.17 0.15 0.15 0.21 0.17 0.09 0.11 0.09 0.09 0.09 0.09 0.09 0.09 0.10 0.10 0.10 0.10 0.10 0.09 0.10 0.10 0.06 0.06 0.06 0.06 0.06 0.06 0.06 0.05 0.05 0.06 AB517709 Myroides odoratus 0.62 0.60 0.03 0.52 0.46 0.50 0.50 0.50 0.50 0.50 0.50 0.50 0.50 0.00 0.00 0.00 0.03 0.04 0.05 0.02 0.14 0.16 0.15 0.15 0.15 0.15 0.15 0.15 0.14 0.16 0.16 0.16 0.16 0.15 0.16 0.16 0.19 0.18 0.19 0.19 0.19 0.19 0.19 0.18 0.18 0.14 GU350455 Myroides sp. 0.62 0.60 0.03 0.52 0.46 0.50 0.50 0.50 0.50 0.50 0.50 0.50 0.50 0.00 0.00 0.00 0.03 0.04 0.05 0.02 0.14 0.16 0.15 0.15 0.15 0.15 0.15 0.15 0.14 0.16 0.16 0.16 0.16 0.15 0.16 0.16 0.19 0.18 0.19 0.19 0.19 0.19 0.19 0.18 0.18 0.14
M58777 Myroides odoratus 0.62 0.60 0.03 0.52 0.46 0.50 0.50 0.50 0.50 0.50 0.50 0.50 0.50 0.00 0.00 0.00 0.03 0.04 0.05 0.02 0.14 0.16 0.15 0.15 0.15 0.15 0.15 0.15 0.14 0.16 0.16 0.16 0.16 0.15 0.16 0.16 0.19 0.18 0.19 0.19 0.19 0.19 0.19 0.18 0.18 0.14 D14019 Flavobacterium odoratum 0.62 0.60 0.03 0.52 0.46 0.50 0.50 0.50 0.50 0.50 0.50 0.50 0.50 0.00 0.00 0.00 0.03 0.04 0.05 0.02 0.14 0.16 0.15 0.15 0.15 0.15 0.15 0.15 0.14 0.16 0.16 0.16 0.16 0.15 0.16 0.16 0.19 0.18 0.19 0.19 0.19 0.19 0.19 0.18 0.18 0.14 GQ857652 Myroides sp. 0.61 0.54 0.12 0.48 0.47 0.47 0.47 0.47 0.47 0.47 0.47 0.47 0.47 0.09 0.09 0.09 0.09 0.03 0.04 0.04 0.15 0.17 0.15 0.15 0.15 0.15 0.15 0.15 0.14 0.15 0.15 0.15 0.15 0.15 0.15 0.15 0.17 0.16 0.17 0.17 0.17 0.17 0.17 0.16 0.16 0.14
AJ854059 Myroides odoratimimus 0.61 0.57 0.12 0.51 0.47 0.47 0.47 0.47 0.47 0.47 0.47 0.47 0.47 0.12 0.12 0.12 0.12 0.08 0.05 0.04 0.15 0.17 0.15 0.15 0.15 0.15 0.15 0.15 0.14 0.15 0.15 0.15 0.15 0.14 0.15 0.15 0.17 0.16 0.17 0.17 0.17 0.17 0.17 0.17 0.17 0.15 AM910365 Uncultured Flavobacterium 0.70 0.55 0.16 0.45 0.47 0.58 0.58 0.58 0.58 0.58 0.58 0.58 0.58 0.19 0.19 0.19 0.19 0.15 0.18 0.05 0.15 0.17 0.14 0.14 0.14 0.14 0.14 0.14 0.15 0.14 0.14 0.14 0.14 0.15 0.14 0.14 0.18 0.19 0.18 0.18 0.18 0.18 0.18 0.19 0.19 0.17 FJ965845 Flavobacterium sp. 0.65 0.56 0.01 0.52 0.43 0.52 0.52 0.52 0.52 0.52 0.52 0.52 0.52 0.03 0.03 0.03 0.03 0.12 0.12 0.17 0.13 0.15 0.14 0.14 0.14 0.14 0.14 0.14 0.13 0.15 0.15 0.15 0.15 0.14 0.15 0.15 0.17 0.17 0.17 0.17 0.17 0.17 0.17 0.17 0.17 0.15 EF125185 Ochrobactrum guangzhouense 0.41 0.30 0.44 0.10 0.00 0.31 0.31 0.31 0.31 0.31 0.31 0.31 0.31 0.46 0.46 0.46 0.46 0.47 0.47 0.47 0.43 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.11 FJ581024 Pseudochrobactrum sp. 0.43 0.34 0.49 0.13 0.03 0.36 0.36 0.36 0.36 0.36 0.36 0.36 0.36 0.51 0.51 0.51 0.51 0.53 0.51 0.53 0.47 0.03 0.02 0.02 0.02 0.02 0.02 0.02 0.02 0.04 0.04 0.04 0.04 0.04 0.04 0.04 0.11 0.10 0.11 0.11 0.11 0.11 0.11 0.10 0.10 0.12
EF071943 Brucellaceae bacterium 0.38 0.28 0.45 0.09 0.01 0.29 0.29 0.29 0.29 0.29 0.29 0.29 0.29 0.47 0.47 0.47 0.47 0.48 0.48 0.46 0.44 0.01 0.04 0.00 0.00 0.00 0.00 0.00 0.01 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.09 0.08 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.10 DQ334872 Ochrobactrum sp. 0.38 0.28 0.45 0.09 0.01 0.29 0.29 0.29 0.29 0.29 0.29 0.29 0.29 0.47 0.47 0.47 0.47 0.48 0.48 0.46 0.44 0.01 0.04 0.00 0.00 0.00 0.00 0.00 0.01 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.09 0.08 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.10 AM403218 Ochrobactrum sp. 0.38 0.28 0.45 0.09 0.01 0.29 0.29 0.29 0.29 0.29 0.29 0.29 0.29 0.47 0.47 0.47 0.47 0.48 0.48 0.46 0.44 0.01 0.04 0.00 0.00 0.00 0.00 0.00 0.01 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.09 0.08 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.10 AM041247 Ochrobactrum oryzae 0.38 0.28 0.45 0.09 0.01 0.29 0.29 0.29 0.29 0.29 0.29 0.29 0.29 0.47 0.47 0.47 0.47 0.48 0.48 0.46 0.44 0.01 0.04 0.00 0.00 0.00 0.00 0.00 0.01 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.09 0.08 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.10 EU543575 Ochrobactrum sp. 0.38 0.28 0.45 0.09 0.01 0.29 0.29 0.29 0.29 0.29 0.29 0.29 0.29 0.47 0.47 0.47 0.47 0.48 0.48 0.46 0.44 0.01 0.04 0.00 0.00 0.00 0.00 0.00 0.01 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.09 0.08 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.10 AJ920029 Ochrobactrum shiyianus 0.38 0.28 0.45 0.09 0.01 0.29 0.29 0.29 0.29 0.29 0.29 0.29 0.29 0.47 0.47 0.47 0.47 0.48 0.48 0.46 0.44 0.01 0.04 0.00 0.00 0.00 0.00 0.00 0.01 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.09 0.08 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.10 HM468098 Pseudochrobactrum sp. 0.42 0.32 0.44 0.10 0.03 0.32 0.32 0.32 0.32 0.32 0.32 0.32 0.32 0.45 0.45 0.45 0.45 0.46 0.44 0.47 0.43 0.03 0.06 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.03 0.10 0.09 0.10 0.10 0.10 0.10 0.10 0.09 0.09 0.11 GQ249219 Phyllobacteriaceae bacterium 0.44 0.30 0.50 0.00 0.10 0.33 0.33 0.33 0.33 0.33 0.33 0.33 0.33 0.52 0.52 0.52 0.52 0.48 0.51 0.45 0.52 0.10 0.13 0.09 0.09 0.09 0.09 0.09 0.09 0.10 0.00 0.00 0.00 0.02 0.01 0.01 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.11 AM884147 Phyllobacteriaceae bacterium 0.44 0.30 0.50 0.00 0.10 0.33 0.33 0.33 0.33 0.33 0.33 0.33 0.33 0.52 0.52 0.52 0.52 0.48 0.51 0.45 0.52 0.10 0.13 0.09 0.09 0.09 0.09 0.09 0.09 0.10 0.00 0.00 0.00 0.02 0.01 0.01 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.11 FJ542910_Uncultured Defluvibacter sp. 0.44 0.30 0.50 0.00 0.10 0.33 0.33 0.33 0.33 0.33 0.33 0.33 0.33 0.52 0.52 0.52 0.52 0.48 0.51 0.45 0.52 0.10 0.13 0.09 0.09 0.09 0.09 0.09 0.09 0.10 0.00 0.00 0.00 0.02 0.01 0.01 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.11 EU870446 Defluvibacter lusatiensis 0.44 0.30 0.50 0.00 0.10 0.33 0.33 0.33 0.33 0.33 0.33 0.33 0.33 0.52 0.52 0.52 0.52 0.48 0.51 0.45 0.52 0.10 0.13 0.09 0.09 0.09 0.09 0.09 0.09 0.10 0.00 0.00 0.00 0.02 0.01 0.01 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.11 AM884144 Phyllobacteriaceae bacterium 0.40 0.32 0.46 0.06 0.09 0.30 0.30 0.30 0.30 0.30 0.30 0.30 0.30 0.47 0.47 0.47 0.47 0.47 0.46 0.48 0.47 0.09 0.13 0.09 0.09 0.09 0.09 0.09 0.09 0.11 0.06 0.06 0.06 0.06 0.02 0.02 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.11
FJ982919_Defluvibacter lusatiensis 0.44 0.30 0.52 0.01 0.11 0.33 0.33 0.33 0.33 0.33 0.33 0.33 0.33 0.54 0.54 0.54 0.54 0.48 0.51 0.46 0.53 0.11 0.14 0.09 0.09 0.09 0.09 0.09 0.09 0.11 0.01 0.01 0.01 0.01 0.05 0.01 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.09 0.11 AM884148 Phyllobacteriaceae bacterium 0.43 0.29 0.52 0.01 0.12 0.32 0.32 0.32 0.32 0.32 0.32 0.32 0.32 0.54 0.54 0.54 0.54 0.48 0.51 0.46 0.53 0.12 0.15 0.10 0.10 0.10 0.10 0.10 0.10 0.12 0.01 0.01 0.01 0.01 0.06 0.01 0.08 0.08 0.08 0.08 0.08 0.08 0.08 0.09 0.09 0.11 HM152635 Uncultured Pseudomonas sp. 0.35 0.01 0.56 0.29 0.31 0.21 0.21 0.21 0.21 0.21 0.21 0.21 0.21 0.61 0.61 0.61 0.61 0.55 0.55 0.54 0.57 0.31 0.35 0.29 0.29 0.29 0.29 0.29 0.29 0.33 0.29 0.29 0.29 0.29 0.31 0.29 0.28 0.01 0.00 0.00 0.00 0.00 0.00 0.01 0.01 0.05 AM910358 Uncultured Pseudomonas sp. 0.35 0.02 0.54 0.29 0.28 0.21 0.21 0.21 0.21 0.21 0.21 0.21 0.21 0.59 0.59 0.59 0.59 0.54 0.54 0.56 0.55 0.28 0.33 0.27 0.27 0.27 0.27 0.27 0.27 0.30 0.29 0.29 0.29 0.29 0.31 0.29 0.28 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.01 0.05 EU372964 Pseudomonas sp. 0.35 0.01 0.56 0.29 0.31 0.21 0.21 0.21 0.21 0.21 0.21 0.21 0.21 0.61 0.61 0.61 0.61 0.55 0.55 0.54 0.57 0.31 0.35 0.29 0.29 0.29 0.29 0.29 0.29 0.33 0.29 0.29 0.29 0.29 0.31 0.29 0.28 0.00 0.01 0.00 0.00 0.00 0.00 0.01 0.01 0.05 FJ472861 Pseudomonas putida 0.35 0.01 0.56 0.29 0.31 0.21 0.21 0.21 0.21 0.21 0.21 0.21 0.21 0.61 0.61 0.61 0.61 0.55 0.55 0.54 0.57 0.31 0.35 0.29 0.29 0.29 0.29 0.29 0.29 0.33 0.29 0.29 0.29 0.29 0.31 0.29 0.28 0.00 0.01 0.00 0.00 0.00 0.00 0.01 0.01 0.05
FJ472858 Pseudomonas putida 0.35 0.01 0.56 0.29 0.31 0.21 0.21 0.21 0.21 0.21 0.21 0.21 0.21 0.61 0.61 0.61 0.61 0.55 0.55 0.54 0.57 0.31 0.35 0.29 0.29 0.29 0.29 0.29 0.29 0.33 0.29 0.29 0.29 0.29 0.31 0.29 0.28 0.00 0.01 0.00 0.00 0.00 0.00 0.01 0.01 0.05 AM913888 Pseudomonas sp. 0.35 0.01 0.56 0.29 0.31 0.21 0.21 0.21 0.21 0.21 0.21 0.21 0.21 0.61 0.61 0.61 0.61 0.55 0.55 0.54 0.57 0.31 0.35 0.29 0.29 0.29 0.29 0.29 0.29 0.33 0.29 0.29 0.29 0.29 0.31 0.29 0.28 0.00 0.01 0.00 0.00 0.00 0.00 0.01 0.01 0.05
AM930519 Pseudomonas putida 0.35 0.01 0.56 0.29 0.31 0.21 0.21 0.21 0.21 0.21 0.21 0.21 0.21 0.61 0.61 0.61 0.61 0.55 0.55 0.54 0.57 0.31 0.35 0.29 0.29 0.29 0.29 0.29 0.29 0.33 0.29 0.29 0.29 0.29 0.31 0.29 0.28 0.00 0.01 0.00 0.00 0.00 0.00 0.01 0.01 0.05 DQ387441 Pseudomonas putida 0.34 0.00 0.57 0.30 0.30 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.60 0.60 0.60 0.60 0.54 0.57 0.55 0.56 0.30 0.34 0.28 0.28 0.28 0.28 0.28 0.28 0.32 0.30 0.30 0.30 0.30 0.32 0.30 0.29 0.01 0.02 0.01 0.01 0.01 0.01 0.01 0.00 0.05
AY741156 Pseudomonas putida 0.34 0.00 0.57 0.30 0.30 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.20 0.60 0.60 0.60 0.60 0.54 0.57 0.55 0.56 0.30 0.34 0.28 0.28 0.28 0.28 0.28 0.28 0.32 0.30 0.30 0.30 0.30 0.32 0.30 0.29 0.01 0.02 0.01 0.01 0.01 0.01 0.01 0.00 0.05 HM805109 Pseudomonas geniculata 0.36 0.20 0.52 0.37 0.36 0.22 0.22 0.22 0.22 0.22 0.22 0.22 0.22 0.49 0.49 0.49 0.49 0.48 0.51 0.50 0.51 0.36 0.41 0.34 0.34 0.34 0.34 0.34 0.34 0.37 0.37 0.37 0.37 0.37 0.36 0.37 0.36 0.21 0.21 0.21 0.21 0.21 0.21 0.21 0.20 0.20
Note: Pair wise genetic distance (below diagonal) inferred using maximum likelihood method, each sequence was bootstrapped (500 replicates) to determine standard error (above diagonal). Distances are in the units of the number of base substitution per site. All positions containing gaps and missing data were eliminated from the dataset
138
13
8
Fig 4.8. Phylogenetic tree based on 16S rRNA gene sequences showing the relationships between five gut bacterial isolates of Bactrocera tau. Number above the branches are bootstrap values calculated by UPGMA (500 replicates). Phylogenetic analyses were conducted in software MEGA 4.1.
1
HM152635 Uncultured Pseudomonas sp. France EU372964 Pseudomonas sp. China FJ472858 Pseudomonas putida China FJ472861 Pseudomonas putida China AM913888 Pseudomonas sp. Germany AM930519 Pseudomonas putida China DQ387441 Pseudomonas putida Korea HQ446524 Pseudomonas putida India AY741156 Pseudomonas putida Korea AM910358 Uncultured Pseudomonas sp. Germany HM805109 Pseudomonas geniculata India HQ446523 Delftia acidovorans India AF538930 Delftia acidovorans Belgium AF149849 Delftia acidovorans Germany AM910363 Uncultured Delftia acidovorans HQ113205 Delftia acidovorans Canada FR682935 Delftia sp. Belgium EF692532 Delftia sp. Uruguav FJ688376 Delftia sp. France GQ466172 Delftia acidovorans Turkey AM884147 Phyllobacteriaceae bacterium Germany FJ542910 Uncultured Defluvibacter sp. USA HQ446526 Defluvibacter sp. India GQ249219 Phyllobacteriaceae bacterium China EU870446 Defluvibacter lusatiensis China FJ982919 Defluvibacter lusatiensis Spain AM884148 Phyllobacteriaceae bacterium Germany AM884144 Phyllobacteriaceae bacterium Germany FJ581024 Pseudochrobactrum sp. India HM468098 Pseudochrobactrum sp. China HQ446527 Ochrobactrum sp. India EF125185 Ochrobactrum guangzhouense China AM403218 Ochrobactrum sp. Germany EF071943 Brucellaceae bacterium China AM041247 Ochrobactrum oryzae India DQ334872 Ochrobactrum sp. china EU543575 Ochrobactrum sp. China AJ920029 Ochrobactrum shiyianus China AM910365 Uncultured Flavobacterium Germany GQ857652 Myroides sp. Korea AJ854059 Myroides odoratimimus Germany HQ446525 Flavobacterium sp. india FJ965845 Flavobacterium sp. India AB517709 Myroides odoratus Japan D14019 Flavobacterium odoratum Japan GU350455 Myroides sp. China M58777 Myroides odoratus
67
60
87
66
100
98
86
68
93
98
62
100
66
99
97
94
78
97
100
94
100
54
95
139
13
9
sequence data for 16S rRNA loci and other robust markers, allows the precise
identification of many associated species, even those that resist cultivation
(Stevenson et al. 2004). Over 200,000 bacterial entries exist currently for 16S
rRNA, and 16S sequences can place most surveyed bacterial taxa securely into
genera, if not species (Rupp 2004; Ueda et al. 2004).
Delftia acidovorans was isolated from B. tau for the first time, though its
association has been reported with cotton boll worm, Helicoverpa armigera
(Hubner) (Xiang et al. 2006); wood borer, Saperda vestita (Say) (Delalibera et al.
2005), tobacco caterpillar Manduca sexta (Brinkmann et al. 2008) and mosquito,
Aedes albopictus Skuse (Zouache et al. 2009). Whereas, Pseudomonas putida
and member of genera Pseudomonas have been reported from many insects
species including fruit flies as well as from B. tau (Gupta et al. 1982b; Kuzina et
al. 2001; Sood and Nath 2002; Belcari et al. 2003; Delalibera et al. 2005;
Brinkmann et al. 2008).
The presence of Flavobacterium sp., Defluvibacter sp. and Ochrobactrum
sp. have already been reported in other insect species viz. Flavobacterium sp.
from ant, Tetraponera binghami Forel (van Borm et al. 2002); Honey bees (Mohr
and Tebbe 2006; 2007) and tobacco caterpillar, Manduca sexta (Brinkmann et al.
2008), however, their association with fruit fly has been observed for the first
time.
Defluvibacter sp. is a member of bacterial family Phyllobacteriaceae from
the class α- Proteobacteria and has not been reported from gut of any insect
species. But an unassigned bacterium (member Phyllobacteriaceae) has been
reported from the gut content of asian longhorned beetle, Anoplophora
glabripennis Motschulsky (Geib et al. 2009). Phyllobacteriaceae is a bacterial
family closely related with the family Bradyrhizobiaceae, Methylobacteriaceae
and Rhizobiaceae. Bacteria from the family Methylobacteriaceae and
Rhizobiaceae have been reported from different insect species viz. Rhizobium
and Methylobacterium from the gut of Tetraponera ants (van Borm et al. 2002)
and Rhizobium reported from the gut content of asian longhorned beetle,
Anoplophora glabripennis (Geib et al. 2009).
140
14
0
Ochrobactrum sp. belongs to the α-2 subclass of the Proteobacteria (De
Ley, 1992). This genus was first described by Holmes et al. (1988). The
phylogenetic position of Ochrobactrum sp. was defined by De Ley (1992) and
Yanagi & Yamasato (1993) on the basis of DNA±rRNA hybridization and 16S
rDNA homology studies. Its closest known relative is Brucella (De Ley 1992;
Moreno 1992; Yanagi and Yamasato 1993; Velasco et al. 1998). Ochrobactrum
sp. was reported from the insect gut (Asian longhorned beetle, Anoplophora
glabripennis) by Geib et al. (2009). Whereas, its closest relative Brucella sp. was
isolated from the gut of wood borer Saperda vestita by Delalibera et al. (2005)
and identified by 16S rDNA typing.
A wide range of bacteria belonging to different genera viz. Acetobacter,
Agrobacterium, Arthrobacter, Listeria, Enterobacter, Pantoea, Pectobacterium,
Klebsiella, Citrobacter, Erwinia, Bacillus, Lactobacillus, Kluyvera, Micrococcus,
Pseudomonas, Staphylococcus, Streptococcus, Proteus, Providencia, Hafnia,
Serratia and Xanthomonas have been isolated and characterized from the fruit fly
gut. (Lloyd et al. 1986; Drew and Lloyd 1987; Jang and Nishijima 1990; Lauzon
et al. 1998; 2000; Zinder and Dworkin 2000; Bergey et al. 2001; Kuzina et al.
2001; Marchini et al. 2002; Sood and Nath 2002; Belcari et al. 2003; Behar et al.
2005; 2008; 2009; Capuzzo et al. 2005; Sacchetti et al. 2008; Kounatidis et al.
2009; Prabhakar et al. 2009b). However, this needs further in-depth investigation
as many workers identified spectrum of bacteria from fruit fly gut.
Still, detailed investigations are needed to establish the taxonomic
positions of Flavobacterium sp., Defluvibacter sp. and Ochrobactrum sp. upto
species level using chemotaxonomic and molecular approaches.
4.7 Gut bacteria as attractants to fruit flies
The data recorded on adult fruit fly visits per 30 minutes for the
comparative efficacy of promising gut bacteria with sugar as negative and protein
hydrolyzate as positive control is presented in Table 4.13. The perusal of data
revealed that the maximum number of B. tau females (14.17) and males (12.50)
141
14
1
were attracted towards protein hydrolyzate and minimum number of B. tau
females (4.50) and males (3.33) were attracted towards sugar. Whereas, among
different gut bacteria, P. putida attracted maximum number of B. tau females
(11.17) and males (8.17) followed by D. acidovorans (10.17 females and 7.33
males). However, these two bacteria were found statistically at par with each
other but, inferior to protein hydrolyzate and superior to other treatments. All the
bacterial attractants were significantly superior over negative control (sugar) for
both the sexes, while more number of females of B. tau were attracted as
compared to males in all the treatments (Table 4.13).
Table 4.13: Attractancy of promising gut bacteria isolates to B. tau (Walker)
Sr. No. Treatments
Fruit flies visit /30 min
Female* Male* Adult*
1 Deftia acidovorans P1B (2 ml) 10.17 7.33 17.50
2 Pseudomonas putida P3A (2 ml) 11.17 8.17 19.33
3 Flavobacterium sp. P10A (2 ml) 9.33 6.17 15.50
4 Defluvibacter sp. B4A (2 ml) 7.33 6.67 14.00
5 Ochrobacter sp. B10B (2 ml) 6.17 5.67 11.83
6 Control (Sugar, 2 ml 10%) 4.50 3.33 7.833
7 Control (ProteinX ®, 2 ml 10%) 14.17 12.50 26.67
CD0.05 1.39 1.32 2.09
*Mean of six replication
Gut bacteria were highly attractive to adult fruit flies when compared to
control (sugar). The number of females attracted to different bacterial isolates
was significantly higher as compared to the males. These findings are similar to
those obtained in a laboratory experiment by Jang and Nishijima (1990). They
studied the attractancy of bacteria and PIB-7 (protein hydrolyzate) and observed
142
14
2
significantly higher response of flies to the bacteria in the absence of PIB-7, but
relatively lower response of flies to bacteria alone when PIB-7 was also a
treatment. The attractancy of gut bacteria to fruit flies can be exploited as an
important link in its effective management.
Drew (1987) also proposed that bacterial volatiles are important
attractants in Dacini and serve as a feeding attractant to females and a sex
attractant to mature males. Present findings draw considerable support from
earlier observations of Sood and Nath (1998) and Sood et al. (2010), who also
reported the attractiveness of gut bacteria to adult flies (both males and females).
4.8 GCMS analysis of Gut bacterial metabolite
Five promising gut bacteria of fruit fly B. tau were subjected to Gas
Chromatography and Mass Spectrometry for indentifying the volatile chemicals
formed after bacterial growth in culture media. Overall, 22 volatile chemicals
were identified from five bacterial isolates (Table 4.14 and Plate 4.24). The main
volatile components were cedrol, caryophyllene oxide and (Z) 9-tricosene. The
former two were produced by D. acidovorans (P1B), Flavobacterium sp. (P10A)
and Defluvibacter sp. (B4A) in culture media however, the area of detection
varied from 4.26 to 7.40 per cent in different bacterial cultures. (Z) 9-tricosene
was produced solely by P. putida (P3A) with 15.33 per cent area of detection.
The volatile chemicals (Z-(9)-tricosene, cedrol and chryophllene oxide) are
known to be associated with insect chemical communication behavior in Musca
domestica, Cryptomeria bark borer and Compoletis sonorensis, respectively. The
chemical characteristics of these three chemical compounds along with
associated insects are given in Table 4.15. Certain components of bacterial
odours serve as either feeding or ovipositional stimulants (Drew and Lloyd,
1987). Under laboratory conditions, flies frequently return to the same spot,
regurgitate and reingest several times (Lloyd, 1988). This behaviour is probably
involved in some form of host marking the help of bacterial odours. Robacker
and Flath (1995) identified ammonia, trimethylamine, isoamylamine, 2-methyl-
14
3
Table 4.14 : Identified Chemicals in promising gut bacterial culture of B. tau Sr No Retention Index Chemical identified Delftia
acidovorans (P1B)
Pseudomonas putida (P3A)
Flavobacterium sp. (P10A)
Defluvibacter sp. (B4A)
Ochrobactrum sp. (B10B)
Control
Detection Area Detection Area Detection Area Detection Area Detection Area Detection Area
1 709 Dioxo-bis (pyridine) [tretrafluoro-1,2-ethanediolato] osmium*
d 15.02 nd - nd - nd - nd - nd -
2 984 N-benzylidene-dimethylammonium chloride d 4.56 nd - nd - nd - nd - nd - 3 1110 Stationary Phase* nd - nd - nd - d 2.82 nd - nd - 4 1117 1-Propene, 3-propoxy, allyl n-propyl ether* nd - nd - nd - nd - d 7.26 nd - 5 1213 1H-indene, 1-methylene* nd - nd - nd - d 4.39 d 9.4 nd - 6 1328 Cyclohexasiloxane, dodecamethyl* nd - nd - d 8.57 nd - nd - d 0.38 7 1339 Stationary Phase* nd - nd - nd - d 2.73 nd - nd - 8 1494 Cycloheptasiloxane, tetradecamethyl d 11.28 d 1.34 d 9.47 d 11.56 d 12.25 d 1.38 9 1658 Cyclooctasiloxane, hexadecamethyl d 6.57 d 0.71 d 5.69 d 9.11 d 6.89 d 0.91 10 1753 Octadecamethylcyclonanasilioxane nd - d 3.11 nd - d 5.38 nd - d 0.71 11 1757 1,1,1,5,7,7,7-Heptamethyl-3,3-bis (trimethylsiloxy)
tetrasiloxane d 3.98 d 1.64 d 3.84 nd - d 4.46 d 0.44
12 1794 Cyclodecasiloxane, Eicosamethyl d 5.39 nd - nd - d 6.24 nd - nd - 13 1801 Butyl-2-methyl propyl phthalate d 5.12 nd - nd - nd - nd - nd - 14 1893 Triacontane nd - d 4.63 nd - nd - nd - d 0.39 15 1902 1, 2-Benzenedicarboxylic acid, bis (2-methylpropyl)
ester nd - nd - d 3.33 d 3.25 d 3.42 nd -
16 1958 1H-purin-6-amine* d 4.22 d 2.72 d 4.39 d 9.73 d 5.4 d 0.80 17 1975 Silikonfett SE30* nd - nd - d 29.05 nd - nd - nd - 18 1998 (Z) 9-Tricosene** nd - d 15.33 nd - nd - nd - nd - 19 1999 Tetracosamethylcyclododecasiloxane nd - nd - d 5.71 nd - d 6.82 nd - 20 2013 Tetratriacontane nd - nd - nd - nd - nd - d 0.35 21 2099 Silikonfett SE30* d 8.16 nd - nd - nd - nd - nd - 22 2102 Octadecane* d 8.83 nd - nd - nd - nd - d 0.37 23 2110 Cedrol, Caryophyllene oxide *** d 4.26 nd - d 7.40 d 5.33 nd - nd - 24 2117 Matairesinol nd - nd - nd - d 3.88 nd - nd - 25 2161 GC septum Bleed* nd - d 1.02 nd - nd - nd - d 5.33 26 2198 9-Octadecenamide nd - d 4.66 nd - nd - nd - nd - 27 2202 Silikonfett SE30 d 4.32 nd - nd - nd - nd - nd - 28 2207 1H-purin-6-amine* d 7.36 d 1.92 d 7.25 d 14.13 d 8 d 1.45 29 2210 1,2,2-2H(3)-4-Methoxyphenylethene, (-)-
Nortrachelogenin nd - nd - nd - nd - d 22.35 nd -
30 2227 Dodecanamide nd - d 1.46 nd - nd - nd - nd - 31 2231 Behenyl alcohol nd - d 0.78 nd - nd - nd - d 11.30 32 2238 Canophyllal nd - nd - nd - d 3.09 nd - nd - 33 2278 Cyclohexadecanolide nd - d 1.8 nd - nd - nd - d 3.55 34 2295 Hexadecanoic acid, (3-bromoprop-2-ynyl) nd - nd - d 3.8 nd - nd - d 3.55 35 2359 n-Tetracosane* d 6.96 d 56.72 d 6.21 d 13.28 d 8.42 d 70.16
*GCMS contaminant, **Insect female sex pheromone, ***Insect allomone, d-Detected, nd-Not detected
14
4
Table 4.15: Properties of insect related chemicals identified in GCMS analysis
Sr. No
Common name
IUPAC name Chemical formula
Molecular weight
Chemical structure Chemical reported from insect species
1
Caryophyllene oxide
4,12,12-trimethyl-9-methylene-5-oxatricyclo[8.2.0.0]4,6)]dodecane
C15H24O 220.35
Campoletis sonorensis (Cameron) (Hymenoptera: Ichneumonidae) Elzen et al. (1984)
European grapevine moth (Lobesia botrana Denis & Schiffermüller) (Lepidoptera: Tortricidae) Katerinopoulos et al. (2005) Tasin et al. (2006) Allomone
2 Cedrol 2,6,6,8-Tetramethyltricyclo[5.3.1.0]undecan-8-ol
C15H26O 222.37
Cryptomeria bark borer (Semanotus japonicus Lacordaire) (Coleoptera: Cerambycidae) Yatagai et al. (2002) Allomone
3 Muscalure (Z)-9-Tricosene C23H46 322.61
House fly ( Musca domestica Linnaeus) (Diptera: Muscidae) Chapman et al. (1998) Female sex pheromone
14
5
Delftia acidovorans (P1B) Flavobacterium sp. (P10A)
Pseudomonas putida (P3A) Defluvibacter sp. (B4A)
Control (Uninoculated PYE Broth) Ochrobactrum sp. (B10B)
Plate 4.24: GCMS chromatogram of promising gut bacteria of Bactrocera tau
A: Caryophyllene oxide and Cedrol; B: (Z)-9-Tricosene
146
14
6
butylamine, 2, 5-dimethylpyrazine and acetic acid from the culture of
Staphylococcus aureus. In contrary to this, Lee et al. (1995) identified 3-methyl-
1-butanol, phenethyl alcohol, 2, 5-dimethylpyrazine, 2-methyl-1-propanol and 3-
(methylthio)-1-propanol as volatile components from bacteria, K. pneumonia and
all the chemicals attracted Mexican fruit flies. However, the attractiveness of E.
agglomerans isolated from apple maggot and Mexican fruit fly towards Mexican
fruit fly did not vary significantly despite the variation in volatiles produced by
them (Robacker et al. 2004).
The response of fruit flies to gut bacteria suggests that a system of
bacterial attraction for fruit flies probably exists in nature and that might be play a
vital role in fruit fly behaviour. This, however, needs further in-depth
investigations to understand this tri-trophic interaction amongst host-fruit flies-
microbes.
147
14
7
5. SUMMARY AND CONCLUSIONS
The results obtained in the present investigation entitled ―Biodiversity
of fruit flies (Tephritidae: Diptera) and utilization of gut bacteria in their
management‖ are summarized here under:
In Himachal Pradesh, Bactrocera cucurbitae and Bactrocera tau were
observed to be serious on cucurbits. However, cucurbits sample
collected from other states indicated infestation of B. cucurbitae only.
In Himachal Pradesh, mean per cent infestation was recorded to be
65.88 per cent. The maximum infestation of 80.00 per cent was
recorded at Palampur (Kangra) and minimum of 44.44 per cent at
Banikhet (Chamba).
In the present study, 17 species of tephritid fruit flies from 5 genera
were recorded, amongst them 14 species were already present in
Himachal Pradesh. They have been recognized in 4 tribes of 2
subfamilies (Dacinae and Tephritinae).
Six fruit flies species were recorded for the first time from Himachal
Pradesh. They are Bactrocera latifrons (Hendel), Bactrocera
nigrofemoralis White & Tsuruta, Dacus longicornis Wiedemann, Dacus
sp., Cyrtostola limbata (Hendel) from subfamily Dacinae and
Pliomelaena udhampurensis Agarwal & Kapoor from subfamily
Tephritinae.
Bactrocera latifrons (Hendel) has been recognized as insect pest of
solanaceous crops in south India. Therefore the pest status and
distribution of the species need to be investigated in the Himachal
Pradesh, also.
Eight species of fruit flies (61 isolates) were molecularly characterized
with mtCOI gene and were submitted to GenBank, NCBI (USA) with
accession number HQ378195-HQ378245 and HQ446513-HQ446522.
148
14
8
mtCOI gene/s of B. nigrofemoralis, D. longicornis and Dacus
sphaeroidalis are totally new to GenBank, NCBI (USA).
The population structure of five geographically isolated populations of
B. cucurbitae from Indian subcontinent (four from India and one from
Nepal) were studied/ compared with gene sequences of B. cucurbitae
from GenBank, NCBI using a 611 bp fragment of mitochondrial
cytochrome oxidase I (COI). The genetic diversity was too low
amongst B. cucurbitae populations studied, considering the
geographic scale of the sampling.
One single haplotype (H1) of B. cucurbitae was found to be
predominant in Indian subcontinent.
On the basis of mtCOI gene (611bp) sequence analysis of 16 B. tau
isolates from Himachal Pradesh, the observed genetic diversity is
exceedingly low and is quite similar to B. tau sp A (Thailand). This
reveals that cucurbit infestation in H.P. is by B. tau sp A of B. tau
species complex.
The presence of other species of B. tau in H.P. as well as in India may
not be ignored as 7 species have been reported in B. tau species
complex. This needs further detailed investigations.
Eight species of fruit flies were clearly differentiated on the basis of
611bp mtCOI gene sequences which were grouped together as per
earlier classification. This validates the utility of mtCOI gene as a tool
for fruit fly detection and species characterization.
Out of 63 bacteria isolated from the gut of 9 populations of B. tau on
two culture media viz. BHIA and PYEA, 30 bacteria were screened as
attractant for fruit flies.
Five most attractive bacterial isolates were characterized on the basis
of morphological, biochemical and 16S rRNA gene sequence
characteristics. These were Delftia acidovorans (P1B), Pseudomonas
putida (P3A), Flavobacterium sp. (P10A), Defluvibacter sp. (B4A) and
149
14
9
Ochrobactrum sp. (B10B). Their 16S rRNA gene sequences were
submitted to GenBank, NCBI and accession numbers HQ446523 to
HQ446527 was awarded to them.
Attractancy of different bacterial isolates was in the range of 6.17 to
11.17 and 5.67 to 8.17 adults/30min for female and male,
respectively. Pseudomonas putida was found to be the most attractive
bacteria to fruit flies followed by Deftia acidovorans. All bacterial
isolates were, however, found statistically superior over sugar
(negative control) and inferior to protein hydrolyzate (positive control).
To characterize the chemicals responsible for gut bacteria attractancy
to fruit flies, GCMS analysis of five bacterial isolates was done.
Twenty two volatile chemicals were identified of which only three
chemicals viz. Z-(9)-tricosene (House fly), cedrol (Cryptomeria bark
borer) and chryophllene oxide (Compoletis sonorensis) are known to
be associated with insect chemical communication behaviour. This,
however, needs further in-depth investigation to understand this
tritrophic interaction in host-fruit flies-microbes.
150
15
0
LITERATURE CITED
Agarwal ML and Kapoor VC. 1988. Four new species of fruit flies
(Diptera:Tephritidae) together with redescription of Trupanea inaequabilis
Hering and their distribution in India. Journal Entomological Research
12(2): 117-128
Agarwal ML and Sueyoshi M. 2005. Catalogue of Indian fruit flies (Diptera:
Tephritidae). Oriental Insects 39: 371-433
Agarwal ML.1984. Fruit flies (Diptera: Tephritidae) and their host plants in Bihar.
Biological Bulletin of India 6(2): 76-82
Agarwal ML.1987. On a collection of fruit flies (Diptera: Tephritidae: Dacinae)
from India. Biological Bulletin of India 9(2): 135-143
Allen TC and Riker AJ. 1932. A rot of apple fruit caused by Phytomonas
melophthora following invasion by the apple maggot. Phytopathology
22(4): 557-571
Allen TC, Pinckard JA and Riker AJ. 1934. Frequent association of Phytomonas
melophthora with various stages in the life cycle of the apple maggot,
Rhagoletis pomonella. Phytopathology 24(2): 228-238
Altschul SF, Gish W, Miller W, Myers EW and Lipman DJ. 1990. Basic local
alignment search tool. Journal of Molecular Biology 215(3): 403-410
Altschul SF, Thomas LM, Alejandro AS, Jinghui Z, Zheng Z, Webb M and David
JL. 1997. Gaped BLAST and PSIBLAST: a new generation of protein
database search programs. Nucleic Acids Research 25(17): 3389-3402
Amann RI, Ludwig W and Schleifer KH. 1995. Phylogenetic identification and in
situ detection of individual microbial cells without cultivation.
Microbiological Reviews 59(1): 143-169
Andersson SG, Zomorodipour A, Andersson JO, Sicheritz-Pontén T, Alsmark
UC, Podowski RM, Näslund AK, Eriksson AS, Winkler HH and Kurland
CG. 1998. The genome sequence of Rickettsia prowazekii and the origin
of mitochondria. Nature 396(6): 133-140
151
15
1
Anonymous. 2010. Taxonomy Capacity Building: Indian Initiative. Ministry of
Environment and Forests, Government of India.
http://moef.nic.in/downloads/public-information/taxonomy-capacity-
building.pdf [9th November, 2010]
Aquadro CF, Kaplan N and Risko KJ. 1984. An analysis of the dynamics of
mammalian mitochondrial DNA sequence evolution. Molecular Biology
and Evolution 1(5): 423-434
Armstrong KF and Ball SL. 2005. DNA barcodes for biosecurity: invasive species
identification. Philosophical transactions of the Royal Society of London
Series B, Biological sciences 360(1462): 1813-1823
Asokan R, Krishna Kumar NK and Verghese A. 2007. Molecular identification of
fruit flies, Bactrocera spp. (Diptera: Tephritidae) using mitochondrial
cytochrome oxidase I. Current Science 93(12): 1668-1669
Baerwald RJ and Boush GM. 1968. Demonstration of the bacterial symbiote,
Pseudomonas melophthora in the apple maggot, Rhagoletis pomonella
by fluorescent antibody technique. Journal of Invertebrate Pathology
11(1): 251
Baimai V, Phinchogsakuldit J and Trinachartvanit W. 1999. Metaphase
karyotypes of fruit flies of Thailand (III): six members of the Bactrocera
dorsalis complex. Zoological Studies 38(1): 110-118
Baimai V, Phinchongsakuldit J, Sumrandee C and Tigvattananont S. 2000b.
Cytological evidence for a complex of species within the taxon
Bactrocera tau (Diptera: Tephritidae) in Thailand. Biological Journal of
the Linnean Society 69(3): 399-409
Baimai V, Samrandee C, Tigvattananont S and Trinachartvanit W. 2000a.
Metaphase karyotypes of fruit flies of Thailand. V. Cytotaxonomy of ten
additional new species of the Bactrocera dorsalis complex. Cytologia
65(4): 409-417
Baimai V, Trinachartvanit W, Tigvattananont S, Grote PJ, Poramacom R and
Kijchalao U. 1995. Metaphase karyotypes of fruit flies of Thailand. I. Five
sibling species of the Bactrocera dorsalis complex. Genome 38(5): 1015-
1022
152
15
2
Baker AC, Ston WE, Plummer CC and McPhail M. 1944. A review of studies on
Mexican fruit fly and related Mexican species. USDA Misc. publ. 531:
155
Ball SL, Hebert PDN, Burian SK and Webb JM. 2005. Biological identifications of
mayflies (Ephemeroptera) using DNA barcodes. Journal of the North
American Benthological Society 24(3): 508-524
Barton N and Jones JS. 1983. Mitochondrial DNA: new clues about evolution.
Nature 306(5941): 317-318
Bauer S, Tholen A, Overmann J and Brune A. 2000. Characterization of
abundance and diversity of lactic acid bacteria in the hindgut of wood
and soil-feeding termites by molecular and culture-dependent
techniques. Archives of Microbiology 173(2): 126-137
Baumann L, Thao ML, Hess JM, Johnson MW and Baumann P. 2002. The
genetic properties of the primary endosymbionts of mealybugs differ from
those of other endosymbionts of plant sap-sucking insects. Applied and
Environmental Microbiology 68(7): 3198-3205
Behar A, Ben-Yosef M, Lauzon CR, Yuval B and Jurkevich E. 2009. Structure
and function of the bacterial community associated with the
Mediterranean fruit fly. In: Insect Symbiosis (K Bourtzis and T Miller,
eds). CRC press, Boca Raton. pp 251-271
Behar A, Jurkevitch E and Yuval B. 2008. Bringing back the fruit into fruit fly-
bacteria interactions. Molecular Ecology 17(5): 1375-1386
Behar A, Yuval B and Jurkevitch E. 2005. Enterobacteria-mediated nitrogen
fixation in natural populations of the fruit fly, Ceratitis capitata. Molecular
Ecology 14(9): 2637-2643
Belcari A and Bobbio E. 1999. The use of copper in control of the olive fly -
Bactrocera oleae. Informatore Fitopatologico 49(12): 52-55
Belcari A, Sacchetti P, Marchi G and Surico G. 2003. The olive fly and
associated bacteria. Informatore Fitopatologico 53(9): 55-59
Bergey DH, Holt JG and Krieg NR. 2001. Bergey’s Manual of Systematic
Bacteriology. Williams and Wilkins, Baltimore 964 p.
153
15
3
Bermingham E and Lessios HA. 1993. Rate variation of protein and mtDNA
evolution as revealed by sea urchins separated by the Isthmus of
Panama. Proceedings of the National Academy of Sciences USA 90(7):
2734-2738
Bezzi M. 1913. Indian Tephritids (fruit flies) in the collection of the Indian
Museum, Calcutta. Memories of Indian Museum 3: 153-175
Bhalla OP and Pawar AD. 1977. A survey study of insect and non-insect pests of
economic importance in Himachal Pradesh. Tiku and Tiku, Kitab Mahal.
Bombay. p 80
Borah SR and Dutta SK. 1996. Comparative biology of Dacus tau (Walker) on
cucurbitaceous vegetables. Journal of the Agricultural Science Society
of North-East India 9(2): 159-165
Bose PC, Tiwari LD and Mehrotra KN. 1978. Preliminary studies on the control of
fruit fly in guava orchards by insecticide baits. Indian Journal of
Entomology 41(4): 388-390
Bousch GM and Matsumara F. 1967. Insecticidal degradation by Pseudomonas
melophthora, the bacterial symbiote of the apple maggot. Journal of
Economic Entomology 69(4): 918-920
Boykin LM, Shatters RG, Hall DG, Burns RE and Franqui RA. 2006. Analysis of
host preference and geographical distribution of Anastrepha suspensa
(Diptera: Tephritidae) using phylogenetic analyses of mitochondrial
cytochrome oxidase I DNA sequence data. Bulletin of Entomological
Research 96(5): 457-469
Brauman A, Dore J, Eggleton P, Bignell D, Breznak JA and Kane MD. 2001.
Molecular phylogenetic profiling of prokaryotic communities in guts of
termites with different feeding habits. FEMS Microbiological Ecology
35(1): 27-36
Brinkmann N, Martens R and Tebbe CC. 2008. Origin and diversity of
metabolically active gut bacteria from laboratory-bred larvae of Manduca
sexta (Sphingidae: Lepidoptera: Insecta). Applied and Environmental
Microbiology 74(23): 7189-7196
154
15
4
Brooks MA. 1963. The microorganisms of healthy insects. In: Insect Pathology:
An Advanced Treatise (EA Steinhause, eds). Academic Press, London.
pp 215-250
Brower AVZ. 1994a. Rapid morphological radiation and convergence among
races of the butterfly Heliconius erato inferred from patterns of
mitochondrial DNA evolution. Proceedings of the National Academy of
Sciences USA 91(14): 6401-6495
Brower AVZ. 1994b. Phylogeny of Heliconius butterflies inferred from
mitochondrial DNA sequences (Lepidoptera: Nymphalidae). Molecular
Phylogenetics and Evolution 3(2): 159-174
Brown GG and Simpson MV. 1981. Intra- and interspecific variation of the
mitochondrial genome in Rattus norvegicus and Rattus rattus: restriction
enzymes analysis of variant mitochondrial DNA molecules and their
evolutionary relationships. Genetics 97(1): 125-143
Brown WM, George M Jr and Wilson AC. 1979. Rapid evolution of animal
mitochondrial DNA. Proceedings of the National Academy of Sciences
USA 76(4): 1967-1971
Brown WM. 1985. Molecular Evolutionary Genetics. In: The Mitochondrial
Genome of Animals (RJ MacIntyre, ed). Plenum Press, New York, pp 95-
130
Brune A. 1998. Termite guts: the world‘s smallest bioreactors. Trends in
Biotechnology 16(1): 16-21
Buchner P. 1965. Symbiosis in animals which suck plant juices. In:
Endosymbiosis of Animals with Plant Microorganisms. Wiley
Interscience, New York, USA, pp 210-432
Capuzzo C, Firrao G, Mazzon L, Squartini A and Girolami V. 2005. ‗Candidatus
Erwinia dacicola’, a coevolved symbiotic bacterium of the olive fly
Bactrocera oleae (Gmelin). International Journal of Systematic and
Evolutionary Microbiology 55(4): 1641-1647
Chapman JW, Knapp JJ, Howse PE and Goulson D. 1998. An evaluation of
(Z)-9-tricosene and food odours for attracting house flies, Musca
domestica, to baited targets in deep-pit poultry units. Entomologia
Experimentalis et Applicata 89(2): 183-192
155
15
5
Chinnarajan AM, Jayaraj S and Narayanan K. 1972. Destruction of
endosymbionts with Oxytetracycline and Sulphanilamid in the gourd fruit
fly, Dacus cucurbitae Coq. (Diptera: Tephritidae). Hindustan Antibiotics
Bulletin 15(1): 16-22
Clark WM and Lubs HA. 1915. The differentiation of bacteria of the colon-
aerogenes family by the use of indicators. Journal Infectious Diseases
17(2): 160-173
Clarridge JE. 2004. Impact of 16S rRNA gene sequence analysis for
identification of bacteria on clinical microbiology and infectious diseases.
Clinical Microbiology Reviews 17(4): 840-862
Clement M, Posada D and Crandall KA. 2000. TCS: a computer program to
estimate gene genealogies. Molecular Ecology 9(10): 1657-1660
Courtice AC and Drew RAI. 1984. Bacterial regulation of abundance in tropical
fruit flies (Diptera: Tephritidae). Australian Zoologist 21(3): 251-268
Crotti E, Rizzi A, Chouaia B, Ricci I, Favia G, Alma A, Sacchi L, Bourtzis K,
Mandrioli M, Cherif A, Bandi C and Daffonchio D. 2010. Acetic acid
bacteria, newly emerging symbionts of insects. Applied and
Environmental Microbiology 76(21): 6963-6970
Dale C and Moran NA. 2006. Molecular interactions between bacterial symbionts
and their hosts. Cell 126(3): 453-465
De Ley J. 1992. The proteobacteria: ribosomal RNA cistron similarities and
bacterial taxonomy. In: The Prokaryotes (A Balows et al., eds.). Springer,
New York pp 2111-2140
De Meyer M, Robertson MP, Mansell MW, Ekesi S, Tsuruta K, Mwaiko W,
Vayssie`res JF and Peterson AT. 2010. Ecological niche and potential
geographic distribution of the invasive fruit fly Bactrocera invadens
(Diptera: Tephritidae). Bulletin of Entomological Research 100(1): 35-48
de Vries EJ, Breeuwer JAJ and Jacobs G. 2001a. The association of flower
thrips, Frankliniella occidentalis, with a near Erwinia species gut bacteria:
transient or permanent? Journal of Invertebrate Pathology 77(2): 120-
128
156
15
6
de Vries EJ, Jacobs G and Breeuwer JAJ. 2001b. Growth and transmission of
gut bacteria in the western flower thrips, Frankliniella occidentalis.
Journal of Invertebrate Pathology 77(2): 129-137
Degnan PH, Lazarus AB and Wernegreen JJ. 2005. Genome sequence of
Blochmannia pennsylvanicus indicates parallel evolutionary trends
among bacterial mutualists of insects. Genome Research 15(8): 1023-
1033
Delalibera I, Handelsman JO and Raffa KF. 2005. Contrasts in cellulolytic
activities of gut microorganisms between the wood borer, Saperda
vestita (Coleoptera: Cerambycidae), and the bark beetles, Ips pini and
Dendroctonus frontalis (Coleoptera: Curculionidae). Environmental
Entomology 34(3): 541-547
Dhillon MK, Singh R, Naresh JS and Sharma HC. 2005. The melon fruit fly,
Bactrocera cucurbitae: a review of its biology and management. Journal
of Insect Science 5(1): 1-16
Dillon RJ and Charnley AK. 1995. Chemical barriers to gut infection in the desert
locust—in vivo production of antimicrobial phenols associated with the
bacterium Pantoea agglomerans. Journal of Invertebrate Pathology
66(1): 72-75
Dillon RJ, Vennard CT and Charnley AK. 2000. Exploitation of gut bacteria in the
locust. Nature 403(6772): 851
Dougals AE. 1998. Nutritional interactions in insects –microbial symbioses:
aphids and their symbiotic bacteria Buchnera. Annual Review of
Entomology 43: 17-37
Douglas AE and Beard CB. 1997. Microbial symbiosis in the midgut of insects,
In: Biology of the insect midgut (M Lehane, eds). Academic Press, New
York. pp 315–333.
Douglas AE, Minto LB and Wilkinson TL. 2001. Quantifying nutrient production
by the microbial symbionts in an aphid. Journal of Experimental Biology
204(2): 349-358
Douglas AE. 1989. Mycetocyte symbiosis in insects. Biological Reviews of the
Cambridge Philosophical Society 64(4): 409-434
157
15
7
Douglas AE. 2006. Phloem-sap feeding by animals: problems and solutions.
Journal of Experimental Botany 57(4): 747-754
Dowell RV and Wange LK. 1986. Process analysis and failure avoidance in fruit
fly programs. In: Pest Control (M Mangel et al., eds.). New York, NATO
ASI Series, Springer-Verlag. pp 43-65
Drew RAI 1987. Behavioural strategies of fruit flies of the genus Dacus (Diptera:
Tephritidae) significance in mating and host plant relationships. Bulletin
of Entomological Research 77(1): 73-81
Drew RAI and Fay HA. 1988. Elucidation of the role of ammonia and bacteria in
the attraction of Dacus tryoni (Fraggatt) (Queensland fruit fly) to
proteinaceous suspensions. Journal of Plant Protection in the Tropics
5(1): 127-130
Drew RAI and Hancock DL. 2000. Phylogeny of the tribe Dacini (Dacinae) based
on morphological, distributional, and biological data. In: Fruit Flies
(Tephritidae) Phylogeny and Evolution of Behaviour (M Aluja and AL
Norrbom, eds). CRC Press, New York. pp 491-504
Drew RAI and Lloyd, AC. 1987. Relationship of fruit flies (Diptera: Tephritidae)
and their bacteria to host plants. Annals of the Entomological Society of
America 80: 629-636
Drew RAI and Raghu S. 2002. The fruit fly fauna (Diptera: Tephritidae: Dacinae)
of the rainforest habitat of the Western Ghats, India. The Raffles Bulletin
of Zoology 50(2): 327-352
Drew RAI and Romig MC. 2000. The biology and behaviour of flies in the tribe
Dacini (Dacinae). In: Fruit Flies (Tephritidae): Phylogeny and Evolution of
Behaviour (M Aluja and AL Norrbom, eds). CRC Press, New York. pp
535-546
Drew RAI, Courtice AC and Teakle DS. 1983. Bacteria as a natural source of
food for fruit flies (Diptera: Tephritidae). Oecologia 60(3): 279-284
Drew RAI, Hancock DL and White IM. 1998. Revision of the tropical fruit flies
(Diptera: Tephritidae: Dacinae) of South East Asia. II. Dacus Fabricius.
Invertebrate Taxonomy 12(4): 567-654
158
15
8
Drew RAI. 1989a. The taxonomy and distribution of tropical and subtropical
Dacinae (Diptera: Tephritidae). In: World crop pests: Fruit flies, their
biology, natural enemies and control, (AS Robinson and G Hopper, eds).
Elsevier Science Publishers, Amsterdam, Netherland. pp 9-14
Drew RAI. 1989b. The tropical fruit flies (Diptera: Tephritidae: Dacinae) of the
Australasian and Oceanic regions. Memoirs of Queensland Museum 26:
1-521.
Elzen GW, Williams HJ and Vinson SB. 1984. Isolation and identification of
cotton synomones mediating searching behavior by parasitoid
Campoletis sonorensis. Journal of Chemical Ecology 10 (11): 1251-1264
Enkerlin W and Mumford JD. 1997. Economic evaluation of three alternative
methods for control of the Mediterranean fruit fly (Diptera: Tephritidae) in
Israel, Palestinian Territories, and Jordan. Journal of Economic
Entomology 90(5): 1066-1072.
Evans JD and Armstrong TN. 2006. Antagonistic interactions between honey bee
bacterial symbionts and implications for disease. BMC Ecology 6:4
doi:10.1186/1472-6785-6-4http://www.biomedcentral.com/1472-6785/6/4
Excoffier L, Laval G and Schneider S. 2005. Arlequin (version 3.0): an integrated
software package for population genetics data analysis. Evolutionary
Bioinformatics (online) 1: 47-50
Felsenstein J. 1985. Confidence limits on phylogenies: An approach using the
bootstrap. Evolution 39(4): 783-791
Fletcher, BS. 1987. The biology of Dacini fruit flies. Annual Review of
Entomology 32: 115-144
Foottit RG, Maw HEL, von Dohlen CD and Herbert PDN. 2008. Species
identification of aphids (Insecta: Hemiptera: Aphididae) through DNA
barcodes. Molecular Ecology Resources 8(6): 1189-1201
Fytizas E and Tzanakakis ME. 1966a. Some effects of streptomycin, when added
to the adult food on the adults of Dacus oleae and the progeny. Annals of
Entomological Society of America 59: 269-273
159
15
9
Fytizas E and Tzanakakis ME. 1966b. Action de quelques antibiotique sur less
adultes de Dacus oleae et leur descendance. Meded. Rijksfac.
landbouwwetensch Gent. 31: 782-789
Geib SM, Jimenez-Gasco MDM, Carlson JE, Tien M and Hoover K. 2009. Effect
of host tree species on cellulase activity and bacterial community
composition in the gut of larval asian longhorned beetle. Environmental
Entomology 38(3): 686-699
Gil R, Silva FJ, Zientz E, Delmotte F, Gonzalez-Candelas F, Latorre A, Rausell
C, Kamerbeek J, Gadau J and Holldobler Bl. 2003. The genome
sequence of Blochmannia floridanus: Comparative analysis of reduced
genomes. Proceedings of the National Academy of Sciences USA
100(16): 9388-9393
Girolami V. 1973. Reperti morfo-istologicisulle battenosimbiosi del Dacus oleae
Gmelin e di attri ditteri tripetidi, in natura e negli allevamenti su substrati
artificiali. Estratto da Redia 54: 269-294
Girolami V. 1983. Fruit fly symbiosis and adult survival: general aspects. In: Fruit
Flies of Economic Importance (R Cavalloro, ed.). Balkema, Rotterdam. p
74
Gow PL. 1954. Proteinaceous bait for the oriental fruit fly. Journal of Economic
Entomology 47(1): 153-160
Grenier AM, Duport G, Pages S, Condemine G and Rahbe Y. 2006. The
phytopathogen Dickeya dadantii (Erwinia chrysanthemi 3937) is a
pathogen of the pea aphid. Applied and Environmental Microbiology
72(3): 1956-1965
Gupta D, Verma AK and Gupta PR. 1992. Population fluctuations of the maggots
of fruit flies (Dacus cucurbitae Coquillette and D. tau Walker) infesting
cucurbitaceous crops. Advances of Plant Sciences 5: 518-523
Gupta M and Pant NC. 1983. Symbiotes of Dacus cucurbitae and their in vitro
physiology. IV. Function of symbiotes in ovarian development.
Endocytobiology 2: 739-749
160
16
0
Gupta M, Pant NC and Lal BS. 1982a. Symbiotes of Dacus cucurbitae
(Coquillette). I Location and nature of association. Indian Journal of
Entomology 44(4): 325-330
Gupta M, Pant NC and Lal BS. 1982b. Symbiotes of Dacus cucurbitae
(Coquillette). II Cultivation and identification. Indian Journal of
Entomology 44(4): 331-336
Hajibabaei M, Janzen DH, Burns JM, Hallwachs W and Hebert PD. 2006. DNA
barcodes distinguish species of tropical Lepidoptera. Proceedings of the
National Academy of Sciences USA 103(4): 968-971
Hancock DL and Drew RAI. 1999. Bamboo-shoot fruit flies of Asia (Diptera:
Tephritidae: Ceratitidinae). Journal of Natural History 33(5): 633-755
Hardy DE and Drew RAI. 1996. Revision of the Australian Tephritini (Diptera:
Tephritidae). Invertebrate Taxonomy 10(2): 213-405
Head IM, Saunders JR and Piclup RW. 1998. Microbiological evolution, diversity
and ecology: A decade of ribosomal RNA analysis of uncultivated
microorganisms. Microbial Ecology 35(1): 1-21
Hebert PDN, Cywinska A, Ball SL and Dewaard JR. 2003. Biological
identifications through DNA barcodes. Proceedings of the Royal Society
B, Biological sciences 270(1514): 313-321
Heddi A, Charles H, Khatchadourian C, Bonnot G and Nardon P. 1998.
Molecular characterization of the principal symbiotic bacteria of the
weevil Sitophilus oryzae: A peculiar G + C content of an endocytobiotic
DNA. Journal of Molecular Evolution 47(1): 52-61
Higgins DG, Thompson JD and Gibson TJ. 1994. CLUSTALW: Improving the
sensitivity of progressive multiple sequence alignment through sequence
weighing, position-specific gap penalties and weight matrix choice.
Nucleic Acids Research 22(22): 4673-4680
Holmes B, Popoff M, Kiredjian M and Kersters K. 1988. Ochrobactrum anthropi
gen. nov., sp. nov. from human clinical specimens and previously known
as group Vd. International Journal of Systematic Bacteriology 38(4): 406-
416
161
16
1
Holt JG, Krieg NR, Sneath PHA, Staley JT and Williams ST. 2000. Bergey's
Manual of Determinative Bacteriology. LIPPNCOTT Williams and
Wilkins, New York. pp 175-533
Hosokawa T, Kikuchi Y, Meng XY and Fukatsu T. 2005. The making of symbiont
capsule in the plataspid stinkbug Megacopta punctatissima. FEMS
Microbiology Ecology 54(3): 471-477
Hosokawa T, Kikuchi Y, Nikoh N, Shimada M and Fukatsu T. 2006. Strict host
symbiont cospeciation and reductive genome evolution in insect gut
bacteria. PLoS Biology 4(10): e337
Howard DJ, Bush GL and Breznak JA. 1985. The evolutionary significance of
bacteria associated with Rhagoletis. Evolution 39(2): 405-417
Hu J, Zhang JL, Nardi F and Zhang RJ. 2008. Population genetic structure of the
melon fly, Bactrocera cucurbitae (Diptera: Tephritidae), from China and
Southeast Asia. Genetica 134(3): 319-324
Huque R. 2006. Comparative studies on the susceptibility of various vegetables
to Bactrocera tau (Diptera: Tephritidae). Pakistan Journal of Biological
Sciences 9(1): 93-95
Jamnongluk W, Baimai V and Kittayapong P. 2003. Molecular evolution of
tephritid fruit flies in the genus Bactrocera based on the cytochrome
oxidase I gene. Genetica 119(1): 19-25
Jamnongluk W, Kittayapong P, Baimai V and O'Neill SL. 2002. Wolbachia
infections of tephritid fruit flies: Molecular evidence for five distinct strains
in a single host species. Current Microbiology 45(4): 255-260
Jang EB and Nishijima KA 1990. Identificaiton and attractancy of bacteria
associated with Dacus dorsalis (Diptera: Tephritidae). Environmental
Entomology 19(6): 1726-1731
Kanwar SS, Gupta MK and Punj V. 1997. Laboratory Manual of Basic
Microbiology. Department of Microbiology, CSK HPKV, Palampur, H.P.
India 84 pp.
Kapoor VC and Agarwal ML. 1983. Fruit flies and their natural enemies in India.
In: Fruit flies of economic importance (R Cavalloro, ed). Balkema,
Rotterdam. pp 252-257
162
16
2
Kapoor VC, Hardy DE, Agarwal ML and Grewal JS 1980. Fruit Fly (Diptera:
Tephritidae) Systematics of Indian Subcontinent. Export Indian
Publishers, Jalandhar. p 113
Kapoor VC. 1993. Indian Fruit Flies (Insecta: Diptera: Tephritidae). Oxford & IBH
Publications, New Delhi, p 228
Katerinopoulos HE, Pagona G, Afratis A, Stratigakis N and Roditakis N. 2005.
Composition and insect attracting activity of the essential oil of
Rosmarinus officinalis. Journal of Chemical Ecology 31(1): 111-122
Kimura M. 1980. A simple method for estimating evolutionary rate of base
substitutions through comparative studies of nucleotide sequences.
Journal of Molecular Evolution 16(2): 111-120
Kounatidis I, Crotti E, Sapountzis P, Sacchi L, Rizzi A, Chouaia B, Bandi C, Alma
A, Daffonchio D, Mavragani-Tsipidou P and Bourtzis K. 2009.
Acetobacter tropicalis is a major symbiont of the olive fruit fly (Bactrocera
oleae). Applied and Environmental Microbiology 75(10): 3281-3288
Kovacs K. 1956. Identification of Pseudomonas pyocyanea by the oxidase
reaction. Nature 178(4535): 703
Koyama J, Kakinohana H and Miyatake T. 2004. Eradication of the melon fly,
Bactrocera cucurbitae, in Japan: importance of behaviour, ecology,
genetics, and evolution. Annual Review of Entomology 49: 331-349
Kuzina LV, Peloquin JJ, Vacek DC and Miller TA. 2001. Isolation and
identification of bacteria associated with adult laboratory Mexican fruit
flies, Anastrepha ludens (Diptera: Tephritidae). Current Microbiology
42(4): 290-294
Lauzon CR, Sjogren RE and Prokopy RJ. 2000. Enzymatic capabilities of
bacteria associated with apple maggot flies, a postulated role in
attraction. Journal of Chemical Ecology 26(4): 953-967
Lauzon CR, Sjogren RE, Wright SE and Prokopy, RJ. 1998. Attraction of
Rhagoletis pomonella (Diptera: Tephritidae) flies to odour of bacteria:
apparent confinement of specialized members of enterobacteriaceae.
Environmental Entomology 27(4): 853-857
163
16
3
Lee CJ, DeMilo AB, Moreno DS and Martinez AJ. 1995. Analysis of the volatile
components of a bacterial fermentation that is attractive to the Mexican
fruit fly, Anastrepha ludens. Journal of Agricultural and Food Chemistry
43(5): 1348-1351
Lee W, Kim H, Lim J, Choi H, Kim Y, Kim YS, Ji JY, Foottit RG and Lee S. 2011.
Barcoding aphids (Hemiptera: Aphididae) of the Korean Peninsula:
updating the global data set. Molecular Ecology Resources 11(1): 32-37
Liu J, Shi W and Ye H. 2007. Population genetics analysis of the origin of the
Oriental fruit fly, Bactrocera dorsalis Hendel (Diptera: Tephritidae), in
northern Yunnan Province, China. Entomological Science 10(1): 11-19
Lloyd AC, Drew RAI, Teakle DS and Hayward AC. 1986. Bacteria associated
with some Dacus species (Diptera: Tephritidae) and their host fruits in
Queensland. Australian Journal of Biological Sciences 39(4): 361-368
Lloyd AC. 1988. The introduction of alimentary tract bacteria into the host tree by
Dacus tryoni. In: First international symposium on fruit flies in the tropics
(S Vijaysegaran and AG Ibrahim, eds). Kuala Lumpur, Malaysia.
Lobl I and Leschen RAB. 2005. Demography of coleopterists and their thoughts
on DNA barcoding and the phylocode, with Commentary. The
Coleopterists Bulletin 59(3): 284-292
Lunt DH, Zhang DX, Szymura JM and Hewitt GM. 1996. The insect cytochrome
oxidase I gene: evolutionary patterns and conserved primers for
phylogenetic studies. Insect Molecular Biology 5(3): 153-165
Marchini D, Rosetto M, Dallai R and Marri L. 2002. Bacteria associated with the
oesophageal bulb of the medfly Ceratitis capitata (Diptera: Tephritidae).
Current Microbiology 44(2): 120-124
McPheron BA and Steck GJ.1996. Fruit Fly Pests: A World Assessment of Their
Biology and Management. St Lucie Press, Delray Beach, Florida.
Michaux B and White IM. 1999. Systematics and biogeography of southwest
Pacific Bactrocera (Diptera: Tephritadae: Dacini). Palaeogeography,
Palaeoclimatology and Palaeoecology 153(1-4): 337-351
164
16
4
Mohr KI and Tebbe CC. 2006. Diversity and phylotype consistency of bacteria in
the guts of three bee species (Apoidea) at an oilseed rape field.
Environmental Microbiology 8(2):258-272
Mohr KI and Tebbe CC. 2007. Field study results on the probability and risk of a
horizontal gene transfer from transgenic herbicide-resistant oilseed rape
pollen to gut bacteria of bees. Applied Microbiology and Biotechnology
75(3): 573-582.
Moran NA, Degnan PH, Santos SR, Dunbar HE and Ochman H. 2005. The
players in a mutualistic symbiosis: Insects, bacteria, viruses, and
virulence genes. Proceedings of the National Academy of Sciences USA
102(47): 16919-16926
Moran NA, McCutcheon JP and Nakabachi A. 2008. Genomics and evolution of
heritable bacterial symbionts. Annual Review of Genetics 42: 165-190
Moreno E. 1992. Evolution of Brucella. In: Advances in Brucellosis Research (M
Plommet ed.). Pudoc Scientific Publishers, Wageningen pp 198-218
Moya A, Pereto J, Gil R and Latorre A. 2008. Learning how to live together:
genomic insights into prokaryote-animal symbioses. Nature Reviews
Genetics 9(3): 218-229
Mun J, Bohonak AJ and Roderick GK. 2003. Population structure of the pumpkin
fruit fly Bactrocera depressa (Tephritidae) in Korea and Japan: Pliocene
allopatry or recent invasion? Molecular Ecology 12(11): 2941-2951
Munro HK. 1938. Studies on Indian trypetidae. Records of Indian Museum 40:
28-37
Munro HK. 1984. A taxonomic treatise on the Dacinae (Tephritoidea, Diptera) of
Africa. Entomology Museum of South Africa, Department of Agriculture
61: 1-313
Muraji M and Nakahara S. 2001. Phylogenetic relationships among fruit flies,
Bactrocera (Diptera, Tephritidae), based on the mitochondrial rDNA
sequences. Insect Molecular Biology 10(6): 549-559
Muraji M and Nakahara S. 2002. Discrimination among pest species of
Bactrocera (Diptera: Tephritidae) based on PCR-RFLP of mitochondrial
DNA. Applied Entomology and Zoology 37(3): 437-446
165
16
5
Murphy KM, MacRae IC and Teakle DS. 1988. Nitrogenase activity in the
Queensland fruit fly, Dacus tryoni. Australian Journal of Biological
Sciences 41(4): 447-451
Murphy KM, Teakle DS and MacRae IC. 1994. Kinetics of colonization of adult
Queensland fruit flies (Bactrocera tryoni) by dinitrogen-fixing alimentary
tract bacteria. Applied and Environmental Microbiology 60(7): 2508-2517
Narayanan ES and Batra HN 1960. Fruit flies and their control. ICAR, New Delhi
68 p.
Nardi F, Carapelli A, Dallai R and Frati F. 2003. The mitochondrial genome of the
olive fly Bactrocera oleae: two haplotypes from distant geographical
locations. Insect Molecular Biology 12(6): 605-601
Nardi F, Carapelli A, Dallai R, Roderick GK and Frati F. 2005. Population
structure and colonization history of the olive fly, Bactrocera oleae
(Diptera, Tephritidae). Molecular Ecology 14 (9): 2729–2738
Nishiwaki H, Ito K, Otsuki K, Yamamoto H, Komai K and Matsuda K. 2004.
Purification and functional characterization of insecticidal
sphingomyelinase produced by Bacillus cereus. European Journal of
Biochemistry 271(3): 601-606
Nishiwaki H, Ito K, Shimomura M, Nakashima K and Matsuda K. 2007.
Insecticidal bacteria isolated from predatory larvae of the antlion species
Myrmeleon bore (Neuroptera: Myrmeleontidae). Journal of Invertebrate
Pathology 96 (1): 80-88
Norrbom AL, Carroll LE and Friedberg A. 1998. Status of Knowledge. Myia 9: 9-
48
Ochando MD and Reyes A. 2000. Genetic population structure in olive fly
Bactrocera oleae (Gmelin): gene flow and patterns of geographic
differentiation. Journal of Applied Entomology 124(3/4): 177-183
Oliver KM, Moran NA and Hunter MS. 2005. Variation in resistance to parasitism
in aphids is due to symbionts and not host genotype. Proceedings of the
National Academy of Sciences USA 102(36): 12795-12800
166
16
6
Oliver KM, Russell JA, Moran NA and Hunter MS. 2003. Facultative bacterial
symbionts in aphids confer resistance to parasitic wasps. Proceedings of
the National Academy of Sciences USA 100(4): 1803-1807
Page RDM. 1996. TREEVIEW: An application to display phylogenetic trees on
personal computers. Computer Applications in the Biosciences 12(4):
357-358
Palumbi SR and Cipriano F. 1998. Species identification using genetic tools: the
value of nuclear and mitochondrial gene sequences in whale
conservation. Journal of Heredity 89(5): 459-464
Paster BJ, Dewhirst FE, Cooke SM, Fussing V, Poulsen LK and Breznak JA.
1996. Phylogeny of not yet cultured spirochetes from termite guts.
Applied and Environmental Microbiology 62(2): 347-352
Peck SL, Mcquate GT, Vargas RI, Seager DC, Revis HC, Jang EB and Mcinns
DO. 2005. Movement of sterile male Bactrocera cucurbitae (Diptera:
Tephritidae) in Hawaiian agroecosystem. Journal of Economic
Entomology 98:1539-1550
Perez-Brocal V, Gil R, Ramos S, Lamelas A, Postigo M, Michelena JM, Silva FJ,
Moya A and Latorre A. 2006. A small microbial genome: the end of a
long symbiotic relationship? Science 314(5797): 312-313
Petri, L. 1909. Ricerche sopra i batteri intestinali della mosca olearia. Memorie
della Regia Stazione di Patologia Vegetale di Roma, Rome, Italy 1-130.
Petri, L. 1910. Untersuchung uber die Darmbakterien der Olivenfliege.
Zentralblatt Bakteriol. Parasitenkd. Infekt. Hyg. 26: 357-367
Pinero JC, Jacome I, Vargas R and Prokopy RJ. 2006. Response of female
melon fly, Bactrocera cucurbitae, to host-associated visual and olfactory
stimuli. Entomologia Experimentalis et Applicata 121(3): 261-269
Prabhakar CS, Sood P, Kapoor V, Kanwar SS, Mehta PK and Sharma PN
2009b. Molecular and biochemical characterization of three bacterial
symbionts of fruit fly, Bactrocera tau (Tephritidae: Diptera). Journal of
General and Applied Microbiology 55 (6): 213-220
167
16
7
Prabhakar CS, Sood P, Mehta PK and Choudhary A. 2007. Fruit fly, Bactrocera
scutellaris (Bezzi): a potential threat to cucurbit cultivation under low and
mid hills of Himachal Pradesh. Pest Management and Economic Zoology
15(2): 181-185
Prabhakar CS, Sood P, Mehta PK and Choudhary A. 2009a. Distribution and
developmental biology of fruit flies infesting cucurbits in north-western
Himalaya. Journal of Insect Science 22(3): 300-308
Raghu S, Clarke AR and Bradly J. 2002. Microbial mediation of fruit fly-host plant
interactions: Is the host plant ―the center of activity‖? Oikos 97(3): 319-
328
Ratnasingham S and Hebert PDN. 2007. BOLD: the Barcode of Life Data
System (http://www.barcodinglife.org). Molecular Ecology Notes 7(3):
355-364
Reyes A and Ochando MD. 2004. Mitochondrial DNA variation in Spanish
populations of Ceratitis capitata (Wiedemann) (Tephritidae) and the
colonization process. Journal of Applied Entomology 128(5): 358-364
Robacker DC and Flath RA. 1995. Attractants from Staphylococcus aureus
cultures for Mexican fruit fly, Anastrepha ludens. Journal of Chemical
Ecology 21(11): 1861-1874
Robacker DC, Lauzon CR and He XD. 2004. Volatiles production and
attractiveness to the Mexican fruit fly of Enterobacter agglomerans
isolated from apple maggot and Mexican fruit flies. Journal of Chemical
Ecology 30(7): 1329-1347
Roderick GK. 1996. Geographic structure of insect populations: gene flow,
phylogeography and their uses. Annual Review of Entomology 41: 263-
290
Roderick GK. 2004. Tracing the origin of pests and natural enemies: genetic and
statistical approaches. In: Genetics, Evolution and Biological Control (LE
Ehler et al., eds.). CAB International, Wallingford, UK pp 97-112
Rossiter MC, Howard DJ and Bush GL. 1983. Symbiotic bacteria of Rhagoletis
pomonella. In: Fruit flies of Economic Importance (R Vacalloro, ed.).
Balkema, Rotterdam pp 77-84
168
16
8
Rupp S. 2004. Proteomics on its way to study host-pathogen interaction in
Candida albicans. Current Opinion in Microbiology 7(4): 330-335
Sacchetti P, Granchietti A, Landini S, Viti L, Giovannetti L and Belcari A. 2008.
Relationships between the olive fly and bacteria. Journal of Applied
Entomology 132(9-10): 682-689
Saitou N and Nei M. 1987. The neighbor-joining method: A new method for
reconstructing phylogenetic trees. Molecular Biology and Evolution 4(5):
406-425
Sardana HR, Tyagi A and Singh A. 2005. Knowledge Resources on Fruit Flies
(Tephritidae: Diptera) in India. National Centre for Integrated Pest
Management, New Delhi 174 p.
Satarkar VR, Faleiro JR, Krishnamurthy SV, Ramesh R and Verghese A. 2009. A
review on the behaviour of Bactrocera fruit flies. Current Biotica 3(2):
264-277
Scheffer SJ, Lewis ML and Joshi RC. 2006. DNA Barcoding Applied to Invasive
Leafminers (Diptera: Agromyzidae) in the Philippines. Annals of the
Entomological Society of America 99: 204-210
Sharma PN, Kaur M, Sharma OP, Sharma P and Pathania A. 2005.
Morphological, pathological and molecular variability in Colletotrichum
capsici, the cause of fruit rot of chillies in the subtropical region of North-
Western India. Journal of Phytopathology 153(3): 141-148
Shi W, Kerdelhue C and Ye H. 2005. Population genetics of the Oriental fruit fly,
Bactrocera dorsalis (Diptera: Tephritidae), in Yunnan (China) based on
mitochondrial DNA sequences. Environmental Entomology 34(4): 977-
983
Shi W, Kerdelhue C and Ye H. 2010. Population genetic structure of the oriental
fruit fly, Bactrocera dorsalis (Hendel)(Diptera: Tephritidae) from Yunnan
province and nearby sites across the border. Genetica 138(3): 377-385
Shigenobu S, Watanabe H, Hattori M, Sakaki Y and Ishikawa H. 2000. Genome
sequence of the endocellular bacterial symbiont of aphids Buchnera sp
APS. Nature 407(6800): 81-86
169
16
9
Simmons JS. 1926. A culture medium for differentiating organisms of typhoid-
colon aerogenes groups and for isolation of certain fungi. Journal of
Infectious Disease 39(3): 209-212
Simon C, Frati F, Beckenback A, Crespi B, Hong L and Flook P. 1994. Evolution,
weighting, and phylogenetic utility of mitochondrial gene sequences and
a compilation of conserved polymerase chain reaction primers. Annals of
the Entomological Society of America 87: 651-701
Smith MA, Rodriguez JJ, Whitfield JB, Deans AR, Janzen DH, Hallwachs W and
Hebert PDN. 2008. Extreme diversity of tropical parasitoid wasps
exposed by iterative integration of natural history, DNA barcoding,
morphology, and collections. Proceedings of the National Academy of
Sciences USA 105(34): 12359-12364
Smith MS and Szathmary E. 1995. The ecology of symbiosis. In: The Major
Transitions in Evolution. Oxford University Press, Oxford pp189-190
Smith PT, Kambhampati S and Armstrong KA. 2003. Phylogenetic relationships
among Bactrocera species (Diptera: Tephritidae) inferred from
mitochondrial DNA sequences. Molecular Phylogenetics and Evolution
26 (1): 8-17
Sneath PHA and Sokal RR. 1973. Numerical Taxonomy. Freeman, San
Francisco
Sood P and Nath A. 1998. Evaluation of insecticide baits for control of fruit fly,
Bactrocera tau (Walker) in mid hills of Himachal Pradesh. Journal of Hill
Research 11(2): 171-177
Sood P and Nath A. 1999. Fruit flies associated with cucurbits in Himachal
Pradesh. Journal of Hill Research 12(1): 52-54
Sood P and Nath A. 2002. Bacteria associated with Bactrocera sp. (Diptera:
Tephritidae) – Isolation and identification. Pest Management and
Economic Zoology 10(1): 1-9
Sood P and Nath A. 2005. Colonization of marker strains of bacteria in fruit fly,
Bactrocera tau. Indian Journal of Agricultural Research 39(1): 103-109
170
17
0
Sood P and Prabhakar CS. 2009. Molecular diversity and antibiotic sensitivity of
gut bacterial symbionts of fruit fly, Bactrocera tau. Journal of Biological
Control 23(3): 213-220
Sood P, Prabhakar CS and Mehta PK. 2010. Eco-friendly management of fruit
flies through their gut bacteria. Journal of Insect Science 23(3): 275-283
Sookar P, Haq I, Jessup A, McInnis D, Franz G, Wornoayporn V and Permalloo
S. 2010. Mating compatibility among Bactrocera cucurbitae (Diptera:
Tephritidae) populations from three different origins. Journal of Applied
Entomology doi: 10.1111/j.1439-0418.2010.01576.x
Srinivasan PM and Narayanaswamy PS. 1961. Appropriate time for taking up
control measures against fruit flies on ash gourd (Benincasa cerefera L.)
and pumpkin (Cucurbita moschata L.). Madras Agricultural Journal 48:
395-396
Stammer HJ. 1929. Die Bakterien symbiose der Trypetiden (Diptera). Z. Morphol.
Oekol. Tiere 15(3): 481-523
Stevenson BS, Eichorst SA, Wertz JT, Schmidt TM and Breznak JA.2004. New
strategies for cultivation and detection of previously uncultured microbes.
Applied and Environmental Microbiology 70(8): 4748-4755
Stonehouse JM, Mumford JD, Verghese A, Shukla RP, Satpathy S, Singh HS, Jiji
T, Thomas J, Patel ZP, Jhala RC, Patel RK, Manzar A, Shivalingaswamy
TM, Mohantha AK, Nair B, Vidya CV, Jagadale VS, Sisodiya DB and
Joshi BK. 2007. Village-level area-wide fruit fly suppression in India: Bait
application and male annihilation at village level and farm level. Crop
Protection 26(5): 788-793
Stouthamer R, Breeuwer JAJ and Hurst GDD. 1999. Wolbachia pipientis:
microbial manipulator of arthropod reproduction. Annual Review of
Microbiology 53: 71-102
Sunandita and Gupta D. 2007. A note on host range of fruit fly species infesting
summer vegetable crops in mid hills of Himachal Pradesh. Journal of
Insect Science 20(1): 106-107
171
17
1
Sunnucks P. 2000. Efficient genetic markers for population biology. Trends in
Ecology and Evolution 15(5): 199-203
Tamas I, Klasson L, Canback B, Naslund AK, Eriksson AS, Wernegreen JJ,
Sandstrom JP, Moran NA and Andersson SGE. 2002. 50 million years of
genomic stasis in endosymbiotic bacteria. Science 296(5577): 2376-
2379
Tamura K, Dudley J, Nei M and Kumar S. 2007. MEGA4: Molecular Evolutionary
Genetics Analysis (MEGA) software version 4.0. Molecular Biology and
Evolution 24(8): 1596-1599
Tamura K, Nei M and Kumar S. 2004. Prospects for inferring very large
phylogenies by using the neighbor-joining method. Proceedings of the
National Academy of Sciences USA 101(30): 11030-11035
Tasin M., Bäckman AC, Bengtsson M., Ioriatti C and Witzgall P. 2006. Essential
host plant cues in the grapevine moth. Naturwissenschaften 93(3): 141-
144
Thao ML and Baumann P. 2004. Evolutionary relationships of primary
prokaryotic endosymbionts of whiteflies and their hosts. Applied and
Environmental Microbiology 70(6): 3401-3406
Thimm T, Hoffmann A, Borkott H, Munch JC and Tebbe CC. 1998. The gut of the
soil microarthropod Folsomia candida (Collembola) is a frequently
changeable but selective habitat and a vector for microorganisms.
Applied and Environmental Microbiology 64(7): 2660-2669
Thompson FE. 1998. Fruit fly expert identification system and systematic
information data base. Myia 9: 1-594
Toth E, Kovacs G, Schumann P, Kovacs AL. and Steiner U. 2001. Shineria
larvae gen.nov.sp.nov. isolated from the 1st and 2nd larval stages of
Wohlfahrtia magnifica (Diptera: Sarcophagidae). International Journal of
Systematic and Evolutionary Microbiology 51(2): 401-407
Tsiropoulos GJ. 1976. Bacteria associated with the walnut husk fly, Rhagoletis
completa. Environmental Entomology 5(1): 83-85
172
17
2
Ueda K, Yamashita A, Ishikawa J, Shimada M, Watsuji TO, Morimura K, Ikeda H,
Hattori M and Beppu T. 2004. Genome sequence of Symbiobacterium
thermophilum, an uncultivable bacterium that depends on microbial
commensalism. Nucleic Acids Research 32(16): 4937-4944
van Borm S, Buschinger A, Boomsma JJ and Billen J. 2002. Tetraponera ants
have gut symbionts related to nitrogen-fixing root-nodule bacteria.
Proceedings of the Royal Society of London B (Biological Sciences)
269(1504): 2023–2027
van Ham RCHJ, Kamerbeek J, Palacios C, Rausell C, Abascal F, Bastolla U,
Fernandez JM, Jimenez L, Postigo M, Silva FJ. 2003. Reductive genome
evolution in Buchnera aphidicola. Proceedings of the National Academy
of Sciences USA 100(2): 581-586
Velasco J, Romero C, Lopez-Goni I, Leiva J, Diaz R and Moriyon I. 1998.
Evaluation of the relatedness of Brucella spp. and Ochrobactrum
anthropi and description of Ochrobactrum intermedium sp. nov., a new
species with a closer relationship to Brucella spp. International Journal of
Systematic Bacteriology 48(3): 759-768
Verghese A, Madhura HS, Jayanthi PDK and Stonehouse JM. 2004. Fruit flies of
economic significance in India with special reference to Bactrocera
dorsalis Hendel. In: Proceedings of the Sixth International Symposium on
Fruit Flies of Economic Importance, Stellenbosch, South Africa, 6-10
May 2002 (BN Barnes, ed.). pp. 317-324
Virgilio M, Delatte H, Backeljau T and De Meyer M. 2010. Macrogeographic
population structuring in the cosmopolitan agricultural pest Bactrocera
cucurbitae (Diptera: Tephritidae). Molecular Ecology 19( ): 2713-2724
Waleron M, Waleron K, Podhajska AJ and Lojkowska E. 2002. Genotyping of
bacteria belonging to the former Erwinia genus by PCR-RFLP analysis of
a recA gene fragment. Microbiology 148(2): 583-595
Weems HV Jr and Heppner JB. 2001. Melon fly, Bactrocera cucurbitae Coquillett
(Insecta: Diptera: Tephritidae). Florida Department of Agriculture and
Consumer Services, Division of Plant Industry, and T.R. Fasulo,
University of Florida. University of Florida Publication EENY- 199
Wernegreen JJ. 2002. Genome evolution in bacterial endosymbionts of insects.
Nature Reviews Genetics 3(11): 850-861
173
17
3
Werren JH and O‘Neill SL. 1997. The evolution of heritable symbionts. In:
Influential Passengers (SL O‘Neill et al., eds.). Oxford University Press,
Oxford, pp1-41
White I. 1987. The status of fruit fly taxonomy and future research priorities. In:
Proceedings of Fruit Flies of Economic Importance. CEC/IOBS
International symposium, Rome, Italy. p 626
White IM and Elson-Harris MM. 1992. Fruit flies of Economic Significance: Their
Identification and Bionomics. Centre for Agriculture and Biosciences
International, Wallingford, U.K. p 601
White IM and Hancock DL. 1997. CABIKEY to the Indo-Australasian Dacini Fruit
Flies. CAB International, Wallingford, CDROM
White IM. 2000. Morphological features of the Dacini (Dacinae): their significance
to behavior and classification. In: Fruit Flies (Tephritidae): Phylogeny and
Evolution of Behaviour (M Aluja and AL Norrbom, eds). CRC Press,
Boca Raton, FL pp 505-533
Williams JGK, Kubelik AR, Livak KJ, Rafalski JA and Tingey SV. 1990. DNA
polymorphisms amplified by arbitrary primers are useful as genetic
markers. Nucleic Acids Research 18(22): 6531-6535
Wu D, Daugherty SC, Van Aken SE, Pai GH, Watkins KL, Khouri H, Tallon LJ,
Zaborsky JM, Dunbar HE and Tran PL. 2006. Metabolic
complementarities and genomics of the dual bacterial symbiosis of
sharpshooters. PLoS Biology 4(6): 1079-1092
Xiang H, Wei GF, Jia S, Huang J, Miao XX, Zhou Z, Zhao LP and Huang YP.
2006. Microbial communities in the larval midgut of laboratory and field
populations of cotton bollworm (Helicoverpa armigera). Canadian Journal
Microbiology 52(11):1085-1092
Xie L, Hong XY and Xue XF. 2006. Population genetic structure of the two
spotted spider mite (Acari: Tetranychidae) from China. Annals of the
Entomological Society of America 99: 959-965
Yamvrias C, Panagopoulos C and Psailidus PG. 1970. Preliminary study of the
intestinal bacterial flora of the olive fruit fly, Dacus oleae (Gmelin). Annals
of the Institute of Phytopathology 9: 201-206
174
17
4
Yanagi M and Yamasato K. 1993. Phylogenetic analysis of the family
Rhizobiaceae and related bacteria by sequencing of 16S rRNA gene
using PCR and DNA sequencer. FEMS Microbiology Letters 107(1): 115-
120
Yang PJ, Carey JR and Dowell RV. 1994a. Host specific demographic studies of
wild Bactrocera tau (Walker) (Diptera: Tephritidae). Pan-Pacific
Entomology 70(3): 253-258
Yang PJ, Carey JR and Dowell RV. 1994b. Comparative demography of two
cucurbit attacking fruit flies, Bactrocera tau and B. cucurbitae (Diptera:
Tephritidae). Annals of the Entomological Society of America 87: 538-
545
Yatagai M, Makihara H and Oba K. 2002. Volatile components of Japanese
cedar cultivars as repellents related to resistance to Cryptomeria bark
borer. Journal of Wood Science 48(1): 51-55
Yoshida N, Oeda K, Watanabe E, Mikami T, Fukita Y, Nishimura K, Komai K and
Matsuda K. 2001. Protein function - Chaperonin turned insect toxin.
Nature 411(6833): 44
Zaka-ur-Rab M. 1984. Host plants of fruit flies (Diptera: Tephritidae) of the Indian
sub-continent, exclusively of the sub-family Dacinae. Journal of the
Bombay Natural History Society 81(1): 99-104
Zhang B, Liu YH, Wu WX and Wang ZL. 2010. Molecular Phylogeny of
Bactrocera Species (Diptera: Tephritidae: Dacini) Inferred from
Mitochondrial Sequences of 16S rDNA and COI Sequences. Florida
Entomologist 93(3): 369-377
Zientz E, Beyaert N, Gross R and Feldhaar H. 2006. Relevance of the
endosymbiosis of Blochmannia floridanus and carpenter ants at different
stages of the life cycle of the host. Applied and Environmental
Microbiology 72(9): 6027-6033
Zinder DE and Dworkin M. 2000. Morphological and physiological diversity. In:
The Prokaryotes (M Dworkin et al., eds.). Springer Verlag, New York
(online) http://www.prokaryotes.com.
175
17
5
Zouache K, Voronin D, Tran-Van V, Mousson L, Failloux AB, Mavingui P. 2009
Persistent Wolbachia and cultivable bacterial infection in the reproductive
and somatic tissues of the mosquito vector Aedes albopictus. PLoS ONE
4(7): e6388 doi:10.1371/journal.pone.0006388
Zwolfer H. 1987. Tephritids as a challenge for taxonomists. In: Proceedings of
Fruit Flies of Economic Importance. CEC/IOBS International symposium,
Rome, Italy p 626
176
17
6
Brief Biodata of the Student
Name : Chandra Shekhar Prabhakar
Father’s Name : Sh. Ramdeo Prasad Prabhakar
Mother’s Name : Smt. Rajkumari Devi
Date of Birth : 17th Sept. 1981
Permanent Address: VPO: Bisai Bigha, Teh: Parwalpur, Distt: Nalanda
(Bihar), India- 801303
Academic Qualifications: (Starting with 10th class)
Standard/ Degree
Month/ Year
School/ College Board/ University
Marks (%)
Division
Matriculation June, 1996
K. H. School, Nawada
B. S. E. B., Patna, Bihar
59.28
Second
I. Sc. June, 1998
K. L. S. College, Nawada
B. I. E. C., Patna, Bihar
71.00 First
B. Sc. Agriculture
Aug., 2005
B. A. College of Agriculture
A.A.U., Anand, Gujarat
77.10 First
M. Sc. Entomology
Oct., 2007
College of Agriculture
CSK HPKV, Palampur, H.P.
72.70 First
Thesis Title in M.Sc.:
Bacterial symbiotes of fruit flies, Bactrocera spp. (Tephritidae: Diptera) and their role in insect-host interface Fellowships/Scholarships/Gold Medals/Awards/Any Other Distinction:
Best research poster award in National Conference ―Plant Protection in Agriculture through Eco-friendly Techniques and Traditional Farming Practices‖ at Jaipur, 2010. Publications: (Give numbers only)
Total: 24 Research papers (in peered journals): 8 Scientific Popular Articles: 7 Others: 9 Papers presented in International and National Conference
and Symposia 71 submitted sequences in the NCBI GenBank database
Visits Abroad along with duration and purpose of visit: Nil Any Other Remarks: Nil