bioinformatics why can’t it tell us everything?
DESCRIPTION
Bioinformatics Why Can’t It Tell Us Everything?. Bioinformatics What are our Data Sets?. Interested in information flow with cells Currently, the key information is mostly a matter of biological macromolecules - PowerPoint PPT PresentationTRANSCRIPT
![Page 1: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/1.jpg)
BioinformaticsWhy Can’t It Tell Us Everything?
![Page 2: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/2.jpg)
BioinformaticsWhat are our Data Sets?
• Interested in information flow with cells
• Currently, the key information is mostly a matter of biological macromolecules
• Eventually, information of interest will also include flow of nutrients, energy, and impact of small molecules on macromolecular function
![Page 3: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/3.jpg)
BioinformaticsWhat are our Questions?
• What is in there?• What does it do?• How similar is it to something else?• How does it fold?• Where does it go in a cell?• What does it interact with?• How it is regulated?• Level of confidence?
![Page 4: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/4.jpg)
* Function of organism is determined by function of its cells * Function of cells determined by chemical reactions that take place within them * Chemical reactions occur or not according to presence and activity of enzymes * Enzymes are proteins * Proteins are determined by genes * Therefore, genes determine organismal function
BioinformaticsLogical Reasoning Behind Data Sets
![Page 5: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/5.jpg)
Genomics
Proteomics
![Page 6: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/6.jpg)
Central DogmaFlow of Information
![Page 7: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/7.jpg)
Central DogmaDNA as the Blueprint for Life?
![Page 8: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/8.jpg)
Central DogmaDNA as the Blueprint for Life?
![Page 9: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/9.jpg)
Central Dogma
DNA RNA Protein
Genes & proteins are different molecular languages,
but they are colinear
![Page 10: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/10.jpg)
DNA
Basic Unit (alphabet): Nucleotide (base) Only 4: A, T, G, and C
Double-stranded: A<>T and G<>C
5’..AGCTGCATGCTAGCTGACGTCA….3’ 3’..TCGACGTACGATCGACTGCAGT….5’
“Words” (genes) to encode proteins, RNA
Double helical
![Page 11: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/11.jpg)
DNA Tower in Perth, AUS
DNAStructure Connected to Information
![Page 12: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/12.jpg)
DNAReplication & Transcription as Algorithms
• With rare exceptions, all DNA is replicated
• Crucial tool is ability to go from one strand to another
• Transcription uses same base-pairing rules with U instead of T, but occurs in packets
![Page 13: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/13.jpg)
Transcription = DNA to RNAWhere to Start is a Big Question
![Page 14: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/14.jpg)
Protein
Alphabet: amino acids
There are 20 amino acids
Met Cys Ser Leu Ala Ala Val
![Page 15: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/15.jpg)
ProteinsNumber of Possible 100-mer Peptides?20 possible residues at each
position
For 2-mers, 20 possible at position 1 and 20 possible at position 2, so 20 x 20 = 202 = 400
Same logic for 100-mers, 20100 = 2100 x 10100 =
(210) 10 x 10100 =
~ (103) 10 x 10100 = 10130
![Page 16: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/16.jpg)
beta-pleated sheet
ProteinsFolding Starts Local
alpha-helix
![Page 17: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/17.jpg)
ProteinsFolding Goes Global
![Page 18: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/18.jpg)
ProteinsPredictive Protein Folding as Holy Grail
![Page 19: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/19.jpg)
Protein
Alphabet: amino acids
There are 20 amino acidsEncoded by codons (triplets of nucleotides)
Met Cys
ATGTGCAGCCTAGCTGCCGTC
Ser
CTAGCTGCCGTC
Leu Ala Ala Val
![Page 20: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/20.jpg)
Genetic Code Found on Earth:How Does It Work?
5’-UCGACCAUGGUUGACCAUUGAUUACCACG-3’
![Page 21: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/21.jpg)
Genetic Code
• Triplet• Nonoverlapping• Comma-less• Redundant
![Page 22: Bioinformatics Why Can’t It Tell Us Everything?](https://reader035.vdocument.in/reader035/viewer/2022062718/56812bce550346895d9029d7/html5/thumbnails/22.jpg)
Bioinformatics:Mining a Mountain of Data
Where are the putative genes?