Blame It on the Metabolite 35-Dichloroaniline Rather thanthe Parent Compound Is Responsible for the DecreasingDiversity and Function of Soil Microorganisms

S Vasileiadisab E Puglisia E S Papadopouloubc G Pertilea N Suciua R A Pappollaa M Tournab P A Karasb

F Papadimitrioub A Kasiotakisb N Ipsilantib A Ferrarinid S Sułowicze F Fornasierf U Menkissoglu-Spiroudic G W Nicolg

M Trevisana D G Karpouzasab

aUniversita Cattolica del Sacro Cuore Department for Sustainable Food Process Piacenza ItalybUniversity of Thessaly Department of Biochemistry and Biotechnology Laboratory of Plant andEnvironmental Biotechnology Larissa Greece

cAristotle University of Thessaloniki Faculty of Agriculture Forestry and Natural Environment School ofAgriculture Pesticide Science Laboratory Thessaloniki Greece

dUniversita Cattolica del Sacro Cuore Department of Sustainable Crop Production Piacenza ItalyeUniversity of Silesia Department of Microbiology Katowice PolandfConsiglio per la Ricerca e la Sperimentazione in Agricoltura Centro di Ricerca per lo Studio delle Relazioni traPianti e Suolo Gorizia Italy

gEcole Centrale de Lyon Group of Environmental Microbial Genomics Lyon France

ABSTRACT Pesticides are key stressors of soil microorganisms with reciprocal effectson ecosystem functioning These effects have been mainly attributed to the parent com-pounds while the impact of their transformation products (TPs) has been largely over-looked We assessed in a meadow soil (soil A) the transformation of iprodione and itstoxicity in relation to (i) the abundance of functional microbial groups (ii) the activity ofkey microbial enzymes and (iii) the diversity of bacteria fungi and ammonia-oxidizingmicroorganisms (AOM) using amplicon sequencing 35-Dichloroaniline (35-DCA) themain iprodione TP was identified as a key explanatory factor for the persistent reduc-tion in enzymatic activities and potential nitrification (PN) and for the observed struc-tural changes in the bacterial and fungal communities The abundances of certain bacte-rial (Actinobacteria Hyphomicrobiaceae Ilumatobacter and Solirubrobacter) and fungal(Pichiaceae) groups were negatively correlated with 35-DCA A subsequent study in afallow agricultural soil (soil B) showed limited formation of 35-DCA which concurredwith the lack of effects on nitrification Direct 35-DCA application in soil B induced adose-dependent reduction of PN and NO3

-N which recovered with time In vitro assayswith terrestrial AOM verified the greater toxicity of 35-DCA over iprodione ldquoCandidatusNitrosotalea sinensisrdquo Nd2 was the most sensitive AOM to both compounds Our find-ings build on previous evidence on the sensitivity of AOM to pesticides reinforcing theirpotential utilization as indicators of the soil microbial toxicity of pesticides in pesticideenvironmental risk analysis and stressing the need to consider the contribution of TPs inthe toxicity of pesticides on the soil microbial community

IMPORTANCE Pesticide toxicity on soil microorganisms is an emerging issue in pes-ticide risk assessment dictated by the pivotal role of soil microorganisms in ecosys-tem services However the focus has traditionally been on parent compounds whiletransformation products (TPs) are largely overlooked We tested the hypothesis thatTPs can be major contributors to the soil microbial toxicity of pesticides using ipro-dione and its main TP 35-dichloroaniline as model compounds We demonstratedby measuring functional and structural endpoints that 35-dichloroaniline and notiprodione was associated with adverse effects on soil microorganisms with nitrifica-tion being mostly affected Pioneering in vitro assays with relevant ammonia-

Received 22 June 2018 Accepted 29 August2018

Accepted manuscript posted online 7September 2018

Citation Vasileiadis S Puglisi E PapadopoulouES Pertile G Suciu N Pappolla RA Tourna MKaras PA Papadimitriou F Kasiotakis A IpsilantiN Ferrarini A Sułowicz S Fornasier FMenkissoglu-Spiroudi U Nicol GW Trevisan MKarpouzas DG 2018 Blame it on themetabolite 35-dichloroaniline rather than theparent compound is responsible for thedecreasing diversity and function of soilmicroorganisms Appl Environ Microbiol84e01536-18 httpsdoiorg101128AEM01536-18

Editor Rebecca E Parales University ofCalifornia Davis

Copyright copy 2018 American Society forMicrobiology All Rights Reserved

Address correspondence to D G Karpouzasdkarpouzasbiouthgr

Present address G Pertile Laboratory ofMolecular and Environmental MicrobiologyDepartment of Soil and Plant System Instituteof Agrophysics Polish Academy of SciencesLublin Poland

ENVIRONMENTAL MICROBIOLOGY

crossm

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 1Applied and Environmental Microbiology

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from

oxidizing bacteria and archaea verified the greater toxicity of 35-dichloroaniline Ourfindings are expected to advance environmental risk assessment highlighting thepotential of ammonia-oxidizing microorganisms as indicators of the soil microbialtoxicity of pesticides and stressing the need to consider the contribution of TPs topesticide soil microbial toxicity

KEYWORDS 35-dichloroaniline ammonia-oxidizing archaea ammonia-oxidizingbacteria iprodione pesticide transformation products soil microbial toxicity

The toxicity of pesticides on nontarget organisms including pollinators and aquaticand terrestrial organisms is well documented (1ndash4) In the last 10 years much

attention has also been given to the effects of pesticides on soil microorganismsconsidering their pivotal role in ecosystem functioning (5) Several studies have usedadvanced molecular and biochemical tools to assess the toxicity of pesticides in relationto the structure and function of the soil microbial community (6ndash8) The majority ofthem have considered the parent compound as the causal agent of the toxic effectsobserved while the potential toxicity of transformation products (TPs) has attractedlittle attention Recently Karas et al (9) demonstrated the major role of TPs ofchlorpyrifos and isoproturon on the inhibition of soil microbial functions SimilarlyPapadopoulou et al (10) showed that quinone imine the oxidized TP of ethoxyquin (anantioxidant used in the fruit-packaging industry) was equally as toxic as or more toxicthan the parent compound to ammonia-oxidizing microorganisms (AOM) This grouphas been shown to be particularly sensitive to environmental perturbations (11)including pesticide exposure (6 9)

Iprodione is a fungicide used for the control of foliage and soilborne fungalpathogens (12) It is a potential carcinogen (13) and an endocrine-disrupting substance(14) Microbial degradation is the main process controlling its dissipation in soil andleads to the formation of 35-dichloroaniline (35-DCA) (15) 35-DCA is neurotoxic (16)and it is considered the most recalcitrant (17) and toxic (18) dichloroaniline isomerPrevious studies have reported significant reductions in the abundance activity anddiversity of soil microorganisms in response to iprodione application (19ndash21) Howeverthe effects observed were attributed entirely to the parent compound while thetransformation of iprodione in soil and the potential contribution of its TPs were notexplored

The main aim of this study was to assess the toxicity of iprodione on the soilmicrobial community and explore the role of 35-DCA for the potential adverse effectsobserved This was achieved through a series of laboratory microcosm assays replicatedin two different soils (to verify the uniformity of effects observed) where the dissipationof iprodione and the formation of 35-DCA were determined analytically and correlatedwith changes in (i) functional enzyme activity (ii) the abundance of functional microbialgroups and (iii) the bacterial fungal and AOM community determined via high-throughput amplicon sequencing Microbial taxa responsive to iprodione and 35-DCAwere identified and the toxicity of 35-DCA was further verified in soil microcosm testswith direct application of 35-DCA The toxicity of iprodione and 35-DCA to AOM wasconfirmed using in vitro tests with isolated strains of terrestrial ammonia-oxidizingbacteria (AOB) and archaea (AOA)

RESULTSDissipation transformation and impact of iprodione on the soil microbial

community microcosm assay in the meadow soil We initially determined in a labmicrocosm study the dissipationtransformation of iprodione and its impact (applied at1 10 and 100 times the recommended dose [1 10 and 100 dose respectively])on the activity abundance and diversity of the soil microbial community in a meadowsoil The time required for 50 dissipation (DT50) of iprodione in the different treat-ments was calculated with the single first-order (SFO) kinetic model which showed thebest fit to the measured data The persistence of iprodione as depicted by the

Vasileiadis et al Applied and Environmental Microbiology

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 2

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from

calculated DT50 values did not follow a dose-dependent trend and ranged from 102days in the samples treated with the 10 dose to 140 days in the samples treated withthe 1 dose (Fig 1 and Table S1 in the supplemental material) Iprodione washydrolyzed to 35-DCA which was partially degraded in samples treated with the 1

and 10 doses but accumulated in the samples treated with the 100 dose (Fig 1)The application of iprodione induced significant main effects on the activity of

several enzymes (Fig S1) and potential nitrification (PN) (Fig 2) A temporal dose-dependent trend was evident only for leucine aminopeptidase (Leu) where the 100

dose reduced activity from 3 days onward (Fig S1g) PN activity was also significantlyreduced by iprodione application with the 10 dose transiently decreasing PN at 3 and15 days (P 005) before recovery occurred at 28 days and with the 100 doseresulting in a persistent reduction in PN from 7 days onward (Fig 2) Pearsonrsquoscorrelation testing identified significant negative correlations between the soil levels ofiprodione and the activity of acid phosphomonoesterase (AcP) (039 P 0001)beta-glucosidase (Bglu) (032 P 001) and Leu (025 P 005) (Table S2)However stronger negative correlations were evident between the soil concentrationsof 35-DCA formed by the hydrolysis of the applied iprodione and the activity of

0 10 20 30 40

01

23

4 X1

0 10 20 30 40

05

1015

0 10 20 30 40

050

100

150

200

250

300

time (days)

X10

X100Ipro

dion

e3

5-D

CA

con

cent

ratio

n (micro

g g sd

w-1)

FIG 1 The dissipation of iprodione (black circle) and the formation of 35-dichloroaniline (35-DCA) (redcircle) in soil samples treated with 1 10 and 100 times the recommended dose Dissipation data werefitted to the single first-order (SFO) kinetic model which provided the best fit to the dissipation data inall cases

Blame Pesticide Soil Microbial Toxicity on Metabolites Applied and Environmental Microbiology

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 3

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from

phosphodiesterase (BisP) (025 P 005) N-acetyl--D-glucosaminidase (Chit) (028P 005) Leu (0560 P 0001) pyrophosphatase (Piro) (042 P 0001) and PN(086 P 0001) Redundancy analysis (RDA) of measured enzymatic activities and PNusing the ln-transformed soil concentrations of iprodione or 35-DCA as explanatoryvariables (Fig 3) showed the following (i) a weak but still significant effect (P 0008)of the concentrations of iprodione in soil with treatment with the 100 dose clusteringaway from the other treatments along the iprodione concentration gradient and (ii) astrong significant effect (P 0001) of the concentrations of 35-DCA in soil with thesamples treated with the 10 and 100 doses grouping away from samples treatedwith the 1 dose and the untreated samples along the 35-DCA concentration gradientThe application of iprodione affected the abundance of the amoA gene of AOA and thesoxB gene of sulfur-oxidizing bacteria (SOB) (Fig S2) However the effects observedwere either isolated to a single time point (ie at 0 days for the amoA gene of AOAwhere the samples treated with the 10 and 100 doses showed a significantly lowerabundance than the control) or did not follow a dose-dependent pattern (ie theabundance of the amoA gene of AOA and of the soxB gene of SOB at 42 days was

0 3 7 15 28 42

time (days)

microg N

O2- g

sdw

-1 5

h-1

00

05

10

15

a a

b ba a a

b

aa

b

c

ab

a

b

c

a a a

b

a - 0a - X1a - X10b - X100

FIG 2 The potential nitrification (PN) rate in samples of soil A (meadow) which were either untreated (0control) or treated with iprodione at 1 10 and 100 times the recommended dose and collected at 0 37 15 28 and 42 days posttreatment Each value is the mean of three replicates the standard deviationLetters next to the dose descriptions (0 X1 X10 and X100) in the key provide the dose main-effectgroupings according to the post hoc analysis Within each time point groups designated by the sameletter are not significantly different at the selected -value levels sdw soil dry weight

ln(DCA)

0 1

10

100

Model var 243 (P 0001)

ln(IPR)

0

1 10

100

Model var 118 (P 0008)

FIG 3 Redundancy analysis (RDA) on the enzymatic activities and potential nitrification data modeled along theln-transformed measured soil levels of iprodione (IPR) and 35-dichloroaniline (35-DCA) The plots provide theinformation on the tested parameter (top left of each panel) the model shared variance and significance (999permutations) and the plotted percentages of this variance along the axes The sample points of the scatterplotsare colored according to the dose and 95 confidence ellipses are provided for each group along with the labeledcentroid In the case of continuous tested parameters the contour lines show the parameter gradients

Vasileiadis et al Applied and Environmental Microbiology

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 4

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from

significantly lower in the samples treated with the 1 dose than in samples treatedwith the 10 dose)

The effect of iprodione and 35-DCA on the - and -diversities of soil bacteriafungi and AOM was also assessed Goodrsquos coverage estimate for bacteria fungi AOBand AOA had mean values of 829 998 971 and 997 respectively suggesting goodcoverage of the bacterial (dominant) fungal and AOM operational taxonomic unit(OTU) diversity by the devoted sequencing effort Average richness values of 77101491 810 and 149 OTUs were observed in all control samples for the total bacterial16S rRNA (at 97 sequence identity used for OTU definition) fungal internal tran-scribed spacer (ITS 97 identity) and AOB amoA and AOA amoA genes (99 identityfor both amoA population OTUs) respectively No major effects of iprodione or 35-DCAon the -diversity were observed (Table S3)

Hierarchical clustering analysis of the taxonomy affiliations of the soil microorgan-isms revealed no grouping of the samples according to the applied doses or time forany of the microbial groups studied (Fig S3) Actinobacteria Proteobacteria (Alpha-Beta- Gamma- and Deltaproteobacteria) and bacilli dominated the bacterial commu-nity in all soil samples while the fungal community was dominated by unclassifiedfungi Ascomycetes Basidiomycetes and members of the family Mortierellaceae Repre-sentative sequences of AOA and AOB according to their abundances in each OTU wereselected and placed in previously generated phylogenetic trees (22 23) The vastmajority of AOB sequences were placed within Nitrosospira clades with the mostabundant OTUs (OTU00001 OTU00002 and OTU00005 encompassing 49 of theanalyzed sequences) residing in Nitrosospira sp strains Nsp17 and Nsp2 The sister cladeof the Nitrosospira multiformisMonterey Bay C clade contained other dominant OTUs(OTU00004 OTU00006 and OTU00009) (Fig S4) Other highly abundant OTUs residedin the Nitrosospira briensis (OTU00003) Nitrosospira sp strain Nsp 12 (OTU00007) andNitrosospira sp strain Nsp 65 (OTU00008) clades These OTUs all together accounted for85 of the total number of analyzed sequences AOA were dominated by OTUs whoserepresentative sequences were mainly placed in the Nitrososphaerales and clades(Fig S5) The most dominant OTUs accounting for 677 of the total number ofanalyzed sequences (OTU0001 OTU0004 and OTU00005) were placed in the Ni-trososphaerales -22 clade followed by OTUs belonging to different subgroups of theNitrososphaerales clade (OTU0003 OTU0006 OTU0007 OTU0008 and OTU0009)accounting for 161 of the total number of sequences and OTUs of the Nitrososphae-rales clade (OTU0002 OTU0010 and OTU0013) accounting for 125 of the totalnumber of analyzed sequences

Partial RDA (not considering the time factor) of OTUs of the different microbialgroups with the measured soil concentrations of iprodione (Fig S6a) and 35-DCA (FigS6b) as explanatory variables indicated that only the latter had a significant effect onthe structure of the bacterial (P 0002) and fungal (P 0019) communities Pearsonrsquoscorrelation testing showed a significant negative correlation between the soil levels of35-DCA and the abundance of Actinobacteria Hyphomicrobiaceae Ilumatobacter andSolirubrobacter and a positive correlation with Arthrobacter (Fig 4) Conversely iprodi-one soil concentrations were positively correlated with Arthrobacter Marmoricola andXanthomonadaceae Analysis of fungal ITS sequences revealed that 35-DCA concen-trations were negatively correlated with Pichiaceae and positively correlated withLasiosphaeriaceae while iprodione showed positive correlations with Sordariomycetes35-DCA and iprodione soil levels showed negative correlations with the less dominantAOB OTUs like OTU00016 (Nsp65 group) OTU00031 and OTU00038 and positivelycorrelated with OTU00051 all belonging to the N briensisN multiformisMonterey BayC group Certain AOB OTUs were affected only by 35-DCA (OTU00034 negatively) oriprodione (OTU00058 negatively OTU00042 positively) For AOA 35-DCA concentra-tions were positively correlated with dominant OTUs like OTU00003 and OTU00009(residing in the Nitrososphaerales -12 clade) while iprodione concentrations werenegatively correlated with OTU00005 (residing in the Nitrososphaerales -22 clade) oneof the most dominant AOA OTUs

Blame Pesticide Soil Microbial Toxicity on Metabolites Applied and Environmental Microbiology

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 5

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from

Dissipation transformation and impact of iprodione and 35-DCA on the soilmicrobial community microcosm assay in the agricultural soil A replicate micro-cosm study in an agricultural soil (soil B) was subsequently employed to evaluate theuniversal nature of the effects induced by the application of iprodione to the soilmicrobial community The dissipation of iprodione treated with the 1 dose was bestdescribed by the hockey stick (HS) model whereas the SFO model provided adequatefit to the dissipation data for the 10 and 100 doses (Fig S7) DT50 values ofiprodione showed a dose-dependent trend (Table S1) and varied from 035 to 425 days

Ipro

dion

e3

5-D

CA

Rare taxauncl Bacteria

-Proteobacteria-Proteobacteria-Proteobacteria

XanthomonadaceaeTuricibacterThermoleophilumSphingomonasSolirubrobacteralesSolirubrobacterSinobacteraceaeRuminococcaceaeRhizobialesPeptostreptococcaceaePedomicrobiumNitrospiraMyxococcalesMarmoricolaLachnospiraceaeKofleriaIntrasporangiaceaeIlumatobacterHyphomicrobiaceaeGemmatimonasClostridium sensu strictoBacillusArthrobacterAnaerolineaceaeActinobacteriaAcidobacteria Gp6Acidobacteria Gp4Acidobacteria Gp16Acidimicrobiales

-1 -05 0 05 1

Pearson r

Rare taxauncl FungiMortierellaceaeTrichosporonaceaeBasidiomycotaPsathyrellaceaeSordariomycetesLasiosphaeriaceaeSaccharomycetales IS 11PichiaceaePyronemataceaePezizaceaeTrichocomaceaeSporormiaceaePleosporalesPseudeurotiaceaeAscomycota

Rare OTUsOTU00084 N multiformis groupOTU00075 N multiformis groupOTU00059 N multiformis groupOTU00058 N multiformis groupOTU00057 N multiformis groupOTU00055 N multiformis groupOTU00052 Nsp65 groupOTU00051 N multiformis groupOTU00050 N multiformis groupOTU00049 N multiformis groupOTU00048 N multiformis groupOTU00047 N multiformis groupOTU00046 N multiformis groupOTU00045 N multiformis groupOTU00044 N multiformis groupOTU00043 N multiformis groupOTU00042 N multiformis groupOTU00041 N multiformis groupOTU00040 Nsp12 groupOTU00039 N europaea groupOTU00038 N multiformis groupOTU00037 N multiformis groupOTU00036 Nsp65 groupOTU00035 N multiformis groupOTU00034 N multiformis groupOTU00033 Nsp12 groupOTU00032 N multiformis groupOTU00031 N multiformis groupOTU00030 Nsp65 groupOTU00029 N multiformis groupOTU00028 N multiformis groupOTU00027 Nsp12 groupOTU00026 Nsp65groupOTU00025 Nsp12 groupOTU00024 N multiformis groupOTU00023 Nsp12 groupOTU00022 N multiformis groupOTU00021 N multiformis groupOTU00020 N multiformis groupOTU00019 N multiformis groupOTU00018 N multiformis groupOTU00017 N multiformis groupOTU00016 Nsp65 groupOTU00015 N multiformis groupOTU00014 N multiformis groupOTU00013 N multiformis groupOTU00012 N multiformis groupOTU00011 N multiformis groupOTU00010 N multiformis groupOTU00009 N multiformis groupOTU00008 Nsp65 groupOTU00007 Nsp12 groupOTU00006 N multiformis groupOTU00005 N multiformis groupOTU00004 N multiformis groupOTU00003 N multiformis groupOTU00002 N multiformis groupOTU00001 N multiformis group

Rare OTUsOTU0027 NS- -222OTU0023 NS- -22OTU0021 NS- -22OTU0020 NS- -311ISOTU0019 NS- -112OTU0018 NS- -22OTU0017 NS- -21OTU0016 NS- -122OTU0015 NS- -22OTU0014 NS- -221OTU0013 NS- -1122OTU0012 NS- -321OTU0011 NS- -21OTU0010 NS- -113OTU0009 NS- -12OTU0008 NS- -211OTU0007 NS- -21OTU0006 NS- -11OTU0005 NS- -22OTU0004 NS- -22OTU0003 NS- -12OTU0002 NS- -122OTU0001 NS- -22

Bacteria Fungi AOB

AOA

Ipro

dion

e3

5-D

CA

Ipro

dion

e3

5-D

CA

Ipro

dion

e3

5-D

CA

mean rel abundance

min max

FIG 4 Heat map of Pearson correlations between the ln-transformed measured concentrations of 35-dichloroaniline (35-DCA) andiprodione (IPR) in soil and bacterial phylataxafamilies fungal phylataxafamilies and OTUs of ammonia-oxidizing bacteria (AOB) andarchaea (AOA) The left-hand side gray-scale boxes are indicative of the mean relative abundances of these OTUstaxa throughout thedata set N europaea Nitrosomonas europaea NS Nitrososphaerales

Vasileiadis et al Applied and Environmental Microbiology

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 6

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from

in the samples treated with the 1 and 100 doses respectively Iprodione dissipationwas accompanied by the formation of low 35-DCA concentrations which never ex-ceeded 10 of the initially applied iprodione The fungicide induced significantchanges in the soil levels of NH3-N and the abundance of the amoA gene of AOB andAOA however no clear temporal dose-dependent patterns were observed (Fig S7)

A follow-up microcosm study was undertaken in soil B (35-DCA directly applied insoil) to test the hypothesis that the lack of effects on the activity of AOM in soil B wasa function of the limited formation of 35-DCA The dissipation of 35-DCA was welldescribed by the SFO model (Fig 5a) The dissipation of 35-DCA showed a weakdose-dependent pattern with DT50 values ranging from 41 to 66 days in the samplestreated with doses of 06 and 60 g g1 respectively (Table S1) The application of

0 10 20 30 40 50 60 70

020

4060

8010

0

time (d)

X1X10X100

o

f ini

tial c

once

ntra

tion

(a)

7 14 28 49 70time (d)

0

50

100

150

microg N

O2- g

sdw

-1 5

h-1

c

b

aa

c

b

aa

c

b

aa

b

aaa

b

a

aa

a - a - b - c -

(b)

7 14 28 49 70time (d)

0

50

100

150

200

250

300

microg N

H3

g sdw

-1 0

5 h

-1

a

bbb

aabb

a

bcca

bbb

c - bc - b - a -

(c)

7 14 28 49 70time (d)

0

50

100

150

microg N

O3- g

sdw

-1 h

-1

b

a

aa

c

b

aa

b

aaa

b

b

ab

a

a - ab - b - c -

(d)

7 28 49time (d)

00e+00

50e+06

10e+07

15e+07

AO

B a

moA

gen

es g

sdw

-1

abbab

a b

a

b

bb

b

a

b

ab - ab - a - b -

(e)

7 28 49time (d)

0e+00

2e+07

4e+07

6e+07

8e+07

1e+08

AO

A a

moA

gen

es g

sdw

-1

bbaa

a

b

ab

b

b - ab - b - a -

(f)

X1X10X100

0

DCA (X06 microg g -1)sdw DCA (X06 microg g -1)sdw

X1X10X100

0X1

X10X100

0

X1X10X100

0X1

X10X100

0

DCA (X06 microg g -1)sdwDCA (X06 microg g -1)sdw

DCA (X06 microg g -1)sdwDCA (X06 microg g -1)sdw

FIG 5 (a) The dissipation patterns of 35-dichloroaniline (35-DCA) in soil samples treated with 06 6 and60 g g1 and fitted to the single first-order (SFO) kinetics model Temporal patterns of potentialnitrification (PN) (b) NH3-N (c) NO3

-N (d) and amoA gene abundance of ammonia-oxidizing bacteria(AOB) (e) and archaea (AOA) (f) in samples from soil B which were treated with 06 6 and 60 g g1 of35-DCA Each value is the mean of three replicates the standard deviation of the mean In the bar chartsletters at the legend on the top left of each panel where present provide the dose main-effect groupingsaccording to the post hoc analysis Within each time point groups designated by the same letter are notsignificantly different at the selected -value levels d days

Blame Pesticide Soil Microbial Toxicity on Metabolites Applied and Environmental Microbiology

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 7

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from

doses of 6 and 60 g g1 induced a significant reduction (P 0001) in PN whichrecovered to levels similar to the level of the control by day 49 only in the samplestreated with a dose of 6 g g1 (Fig 5b) Regardless of the treatment applied theconcentrations of NH3-N decreased with time (Fig 5c) and this correlated with anincrease in the concentrations of NO3

-N (Fig 5d) The application of the highest doseinduced a significant increase in the concentration of NH3-N and reversibly a signifi-cant decrease in NO3

-N concentrations which persisted until day 49 35-DCA appli-cation did not induce any clear dose-dependent temporal changes in the abundanceof the amoA gene of AOB (Fig 5e) in contrast to AOA whose amoA gene abundancewas only temporarily reduced by the application of the two higher doses of 35-DCA(Fig 5f)

In vitro assessment of the toxicity of iprodione and 35-DCA on AOA and AOBThe superior toxicity of 35-DCA over iprodione on AOM was further tested in in vitroassays with selected terrestrial AOB (Nitrosospira multiformis) and AOA (ldquoCandidatusNitrosocosmicus franklandusrdquo and ldquoCandidatus Nitrosotalea sinensisrdquo) Iprodione wasnot toxic to N multiformis even at the highest concentration level tested (50 mg liter1)(Fig 6a) In contrast 35-DCA at concentrations higher than 05 mg liter1 stronglyinhibited the activity of N multiformis with a late recovery observed only in the culturesamended at 05 mg liter1 (Fig 6b) Iprodione inhibited the activity of ldquoCa Nitroso-cosmicus franklandusrdquo at concentrations of 05 mg liter1 although recovery wasobserved at all concentrations at the end of the incubation period (Fig 6a) 35-DCAinduced a significant reduction in the activity of ldquoCa Nitrosocosmicus franklandusrdquo atall concentrations however recovery was observed only in the cultures amended with

Nitrosospira multiformis

Ca Nitrosocosmicus franklandus C13

Ca Nitrosotalea sinensis Nd2

Control

01 mg l-1

0 2 4 6 8 10 12 14 16 18 20 22 24

0

50

100

150

200

0 2 4 6 8 10 12 14 16 18 20 0 2 4 6 8 10 12 14 16 18 20

NO

2- (microM

)

Time (days post inoculation)

0

200

400

600

800

1000

1200

0 2 4 6 8

(a) (b)

0

200

400

600

800

1000

1200

0

200

400

600

800

1000

1200

0

200

400

600

800

1000

1200

0 2 4 6 8

0 2 4 6 8 10 12 14 16 18 20 22 24

05 mg l-1

50 mg l-1

500 mg l-1

0

50

100

150

200

FIG 6 The effect of iprodione (a) and 35-dichloraniline (35-DCA) (b) on the ammonia oxidation activity of bacterium Nitrosospiramultiformis and the archaea ldquoCa Nitrosocosmicus franklandusrdquo strain C13 and ldquoCa Nitrosotalea sinensisrdquo strain Nd2 in liquid cultures Eachvalue is the mean of three replicates the standard deviation of the mean Arrows indicate the time point at which the chemicals wereadded in the microbial culture

Vasileiadis et al Applied and Environmental Microbiology

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 8

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from

5 mg liter1 or less (Fig 6b) Iprodione induced a nonreversible inhibition of the activityof the acidophilic AOA ldquoCa Nitrosotalea sinensisrdquo at concentrations of 05 mg liter1

(Fig 6a) while 35-DCA halted the activity of ldquoCa Nitrosotalea sinensisrdquo at all concen-tration levels and a slow recovery was observed only at 01 mg liter1 (Fig 6b) Theinhibition profiles determined by measuring amoA gene abundance were concomitantwith those determined via the monitoring of NO2

production (Fig S8)

DISCUSSION

The application of iprodione in a meadow soil (soil A) significantly reduced theactivity of enzymes involved in P (AcP BisP and Piro) and N (Chit and Leu) transfor-mation (see Fig S1 in the supplemental material) The activities of AcP BisP Piro Chitand Leu were strongly correlated with the soil concentrations of iprodione but mostlywith the soil concentrations of its TP 35-DCA (Fig 3) In a series of studies Zhang etal (21 24) observed a significant reduction in the activity of Bglu AcP alkalinephosphomonoesterase (AlkP) Leu and Chit upon repeated applications of the recom-mended dose of iprodione (4 15 g g1) These effects became evident at the laterstages of the incubation (from 14 days onward) and probably reflected the gradualaccumulation of iprodione andor the formation of 35-DCA However the concentra-tion of either compound was not measured in these studies preventing the identifi-cation of the inhibitory mechanism The formation of 35-DCA was also negativelycorrelated with PN although this was not in agreement with the measurements of theabundances of the amoA genes of AOA and AOB which were not altered by iprodioneapplication The discrepancy between PN and AOAAOB amoA gene abundance mea-surements is not surprising considering that these two methods determine differentattributes (potential activity versus abundance respectively with partial contribution tothe latter of relic DNA) PN has also been identified by Crouzet et al (25) as the mostsensitive functional descriptor of pesticide effects on soil microbial activity

The inhibitory effect of 35-DCA on PN (Fig 2) led us to examine further its potentialto inhibit ammonia oxidation which often constitutes the rate-limiting step in nitrifi-cation (26) In a replicate microcosm study with a soil from a fallow agricultural field(soil B) no adverse effects of iprodione on the nitrification activity and the abundanceof the amoA genes of AOA and AOB were observed (Fig S2) and this was consistentwith the limited formation of 35-DCA in this soil (Fig S7) The limited formation of35-DCA could be attributed either to the presence in the soil of a pool of efficient35-DCA-degrading microorganisms which actively degraded 35-DCA as soon as it wasformed keeping its levels low during the study or to the operation of alternativemetabolic pathways where 35-DCA does not constitute a major TP (27) Direct appli-cation of 35-DCA in soil B at concentration levels equivalent to those formed in soil Aupon application of 1 10 and 100 times the recommended dose of iprodione induceda significant reduction in nitrification activity as determined by measurements of PNand NH3-NNO3

-N soil concentrations (Fig 5b) Together these findings support ourinitial hypothesis that 35-DCA and not iprodione drives the inhibition of nitrificationin soil

The superior toxicity of 35-DCA over iprodione was verified by in vitro assays withselected soil AOB and AOA isolates (Fig 6) Although their sensitivities to iprodione and35-DCA varied 35-DCA was consistently more inhibitory than iprodione for all strainsN multiformis was tolerant to iprodione compared to the two AOA whose growth andactivity were inhibited either transiently (ldquoCa Nitrosocosmicus franklandusrdquo) or perma-nently (ldquoCa Nitrosotalea sinensisrdquo) by the higher concentrations of the fungicide Incontrast 35-DCA showed equivalent inhibitory levels to AOB and AOA strains with ldquoCaNitrosocosmicus franklandusrdquo being the most tolerant followed by N multiformis andldquoCa Nitrosotalea sinensisrdquo which was the most sensitive Previous in vitro studies withclassical (ie nonpesticide) nitrification inhibitors have also demonstrated differentlevels of sensitivity of AOB (N multiformis) versus AOA (Nitrosotalea devanaterra Nd1and Nitrososphaera viennensis) (28 29) which is perhaps a consequence of fundamentaldifferences between AOA and AOB physiologies The higher tolerance of N multiformis

Blame Pesticide Soil Microbial Toxicity on Metabolites Applied and Environmental Microbiology

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 9

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from

to iprodione might be a function of the notably high number of ABC transporters foundin its genome which are known to be involved in organic solvents and multidrug efflux(30) Conversely the consistently higher sensitivity of ldquoCa Nitrosotalea sinensisrdquo Nd2 toboth compounds is reported for the first time and warrants further study As with manyother pesticides iprodione acts at a cellular level by causing oxidative stress (31) Whilethe exact mechanism of reactive oxygen generation by iprodione is yet unknown it hasbeen recently demonstrated that some AOA in culture are highly sensitive to oxidativestress and the addition of scavenging supplements such as -keto acids or catalase isrequired for growth in culture (32) Contrasting sensitivities to iprodione may thereforeresult from differences in physiologies of AOB and AOA with respect to oxidative stress

In vitro assays provide a precise measure of the inherent toxicity of a compound toAOM identify potential differences in the toxicity of a chemical to the differentmicrobial moderators of the ammonia oxidation process (eg AOA versus AOB) andoffer a valuable experimental platform to explore toxicity mechanisms However theirresults may deviate from soil microcosm studies due to the reduced diffusion or higherdegradation of the chemicals in soil (33) To date in vitro assays have not been used forthe assessment of the soil microbial toxicity of pesticides although their inclusion inpesticide risk assessment testing as a conservative tier I step was proposed (34) In ourstudy 35-DCA inhibited the activity and growth of ldquoCa Nitrosotalea sinensisrdquo and Nmultiformis at concentrations equivalent to the inhibitory concentrations of dicyandi-amide (DCD) for the acidophilic AOA strain Nitrosotalea devanaterra Nd1 (28) and for Nmultiformis (29) Our findings suggest that 35-DCA at concentration levels of 05 to 5mg liter1 expected to be found in soil pore water upon application of the recom-mended dose of iprodione (assuming full conversion to 35-DCA) could inhibit thegrowth and activity of AOB and AOA strains

We further explored the potential effects of iprodione and 35-DCA not only on thediversity of AOB and AOA but also on the diversity of soil bacteria and fungi (Fig S6)Multivariate analysis of the diversity matrix obtained by amplicon sequencing sug-gested that iprodione and 35-DCA induced only subtle effects on the -diversity ofbacteria fungi AOB and AOA In contrast significant effects on the -diversity of thebacterial and fungal communities were observed The changes found were stronglycorrelated with the soil levels of 35-DCA and not iprodione The abundances ofActinobacteria especially of the genera Ilumatobacter and Solirubrobacter and ofalphaproteobacteria of the family Hyphomicrobiaceae were negatively correlated with35-DCA formation (Fig 4) Previous studies have also reported a sensitivity of thesebacterial phyla to high soil concentrations of pesticides (35) and other organic pollut-ants (36) The positive correlation of Arthrobacter and Xanthomonadaceae with the soillevels of iprodione is in line with the assignment of all the currently known iprodione-degrading soil bacteria to the genus Arthrobacter (37 38) and the well-documented roleof members of the family Xanthomonadaceae in the degradation of pesticides (39) andantibiotics (40) Changes in fungal community structure were observed (Fig S6) withSordariomycetes being positively correlated with iprodione soil concentrations (Fig 4)in agreement with Zhang et al (20) who reported an enrichment of OTUs belongingto families of Sordariomycetes including Cephalothecaceae Hypocreaceae and Cordy-cipitaceae Conversely 35-DCA formation favored fungi of the family Lasiosphaeriaceaeand reduced the abundance of yeasts of the family Pichiaceae The former familyencompasses coprophilous fungi like Podospora and Zopfiella which are commonlyfound in manured soils (41) like the meadow soil studied The Pichiaceae include yeastswith applications in agriculture (plant growth promoters or biocontrol agents) (42)food technology (alcohol fermentation) and biotechnology (43)

The AOB and AOA communities in the meadow soil were dominated by membersof the genus Nitrosospira and the lineage Nitrososphaerales (clades and )respectively (Fig S4 and S5) which are ubiquitous in the soil environment (44 45) withNitrososphaerales clades and representing over 65 of the currently reportedsoilsediment AOA (23) Despite the inhibitory effects on soil nitrification the-diversity of AOB and AOA was not significantly altered by iprodione and 35-DCA (Fig

Vasileiadis et al Applied and Environmental Microbiology

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 10

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from

S6) whose soil concentrations were positively correlated with rare OTUs of the AOBcommunity (Fig 4) In contrast only dominant AOA OTUs were responsive to iprodioneand 35-DCA These results might be an indication of the crucial functional role of therare and dominant members of the AOB and AOA communities respectively Alterna-tively other AOM like the comammox bacteria not considered in the current studymight have an important functional role in the nitrification in the soil studied althoughtheir ecological role in terrestrial ecosystems is still not well defined (46)

Conclusions To date most of the studies that have investigated the impact ofpesticides on soil microorganisms have attributed observed effects exclusively to theparent compound while the contribution of TPs was largely overlooked (47 48) This isparticularly true for iprodione whose structural and functional effects on the soilmicrobial community (19 20 49) and particularly on AOM (50) were fully attributed tothe parent compound We provide strong evidence that 35-DCA the main TP ofiprodione in soil is responsible for the significant reduction in the activity of AOM andthe effects on the -diversity of bacteria and fungi Our findings have importantpractical implications for pesticide environmental risk assessment since they (i) providestrong evidence for the sensitivity of AOM to pesticides in line with a series of previousstudies (4 6 9ndash11 25 47) reinforcing their potential as indicators of the soil microbialtoxicity of pesticides and (ii) demonstrate that the TPs of pesticides could have a higherintrinsic soil microbial toxicity than their parent compounds hence assessment of theirsoil microbial toxicity should be an integral part of environmental risk analysis

MATERIALS AND METHODSSoils and chemicals The impact of iprodione and 35-DCA was assessed in two different top-soils

(0 to 20 cm) (i) a Cambisol loam (pH 69 organic carbon content 298) collected from a meadow innorthern Italy (Fontidella Gaverina 45deg27=5569N 9deg38=2005 E soil A) and (ii) a Cambisol clay loam (pH76 organic carbon content 11) collected from a fallow agricultural field of the Hellenic AgriculturalOrganization-Demeter in Larissa Greece with no recent history of pesticide application (39deg63=27N22deg36=74E soil B) Both soils were collected from the top 20 cm according to a protocol of theInternational Organization for Standardization (httpswwwisoorgstandard43691html) for collectionand handling of samples Upon collection soils were homogenized partially air dried sieved (2-mm poresize) and stored at 4degC for a week before use Iprodione and 35-DCA analytical standards (97 purity)were used for analytical purposes and in vitro tests while a commercial formulation of iprodione (Rovral50WP) and the analytical standard of 35-DCA were used in microcosm tests

Soil microcosm experiments Four 1-kg (each) subsamples of soils A and B were pretreated with 25ml of a 05 M solution of (NH4)2SO4 (corresponding to 154 mg N kg1 soil dry weight) Samples were leftto equilibrate overnight and then spiked with appropriate volumes of aqueous solutions of iprodionecorresponding to application of 1 10 and 100 times the recommended dose and soil concentrations of2 20 and 200 g of iprodione g1 soil respectively The fourth soil sample received the same amountof water without iprodione as a control The soil moisture content was adjusted to 40 of thewater-holding capacity Bulk soil samples were divided into 50-g subsamples which were placed inaerated plastic bags and incubated in the dark at 25degC At regular intervals triplicate samples pertreatment were sampled and analyzed for iprodione and 35-DCA residues or used for determination ofenzyme activity PN or DNA extraction

To further explore the microbial toxicity of 35-DCA (in soil B) NH4-amended soil samples were

treated with 33 ml of methanolic solutions of 35-DCA at concentrations of 100 1000 and 10000 gml1 resulting in final soil 35-DCA concentrations of 06 6 and 60 g g1 soil respectively Thesecorresponded to the maximum concentrations of 35-DCA formed in soil by the application of 1 10 and100 times the recommended dose of iprodione in soil A The fourth subsample received the same volumeof methanol without 35-DCA as an untreated control Samples were left for 1 h to allow evaporation ofmethanol and were then processed as described above Immediately after 35-DCA application and atregular intervals thereafter triplicate microcosms were sampled per treatment and analyzed for 35-DCANO3

-N and NH4-N concentrations or processed for DNA extraction and PN measurements

Pesticide residue and NH3NO3-N analysis Iprodione and 35-DCA residues were extracted from

soil as described by Vanni et al (51) with the sole modification that the final acetonitrile extract was driedunder a flow of nitrogen and the samples were resuspended in acetone containing the internal standardanthracene-d10 (mz 188) Extracts were analyzed in an Agilent 6890 gas chromatograph-mass spec-trometry (GC-MS) system equipped with an Agilent Technologies 5973 series mass selective detector Thecolumn used was a Supelco SLB-5 MS type (30 m by 025-mm internal diameter by 025-m filmthickness) The carrier gas was high-grade helium used at a constant flow rate of 10 ml min1 Injectiontemperature was 250degC with an injection volume of 1 l and a 05-min purge time The GC-MS oventemperature was maintained at 70degC for 2 min and then increased at a rate of 10degC min1 until 230degCThis temperature was maintained for 3 min and finally increased at a rate of 25degC min1 until it reached280degC and it remained constant for 6 min The detector temperatures were 150degC (MS quadrupole) and230degC (MS source) The compounds were identified in total ion-monitoring mode at mz 161 for 35-DCA

Blame Pesticide Soil Microbial Toxicity on Metabolites Applied and Environmental Microbiology

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 11

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from

and mz 187 for iprodione Soil levels of NH4-N and NO3

-N were determined as described by Kandelerand Gerber (52) and Doane and Horwaacuteth (53) respectively

In vitro assays The inhibitory effects of iprodione and 35-DCA on soil AOB (N multiformis) and AOA(ldquoCa Nitrosotalea sinensisrdquo strain Nd2 and ldquoCa Nitrosocosmicus franklandusrdquo strain C13) were investi-gated in liquid batch cultures ldquoCa Nitrosocosmicus franklandusrdquo was isolated from a Scottish agriculturalsoil with pH 75 (54) and ldquoCa Nitrosotalea sinensisrdquo was from a Chinese acidic paddy soil (pH 47) (55 56)All strains were grown aerobically in the dark without shaking N multiformis was grown at 28degC inSkinner and Walkerrsquos medium (57) (pH of 75) AOA strains were incubated at 35degC in medium supple-mented with 1 mM NH4

ldquoCa Nitrosocosmicus franklandusrdquo C13 was cultured in HEPES-bufferedmodified fresh water medium (pH 75) (54) while ldquoCa Nitrosotalea sinensisrdquo was grown in an acidicmorpholineethanesulfonic acid (MES)-buffered (pH 52) freshwater medium (58) For each treatmenttriplicate 100-ml Duran bottles containing 50 ml of growth medium were inoculated with a 1 or 2(volvol) transfer of AOB and AOA culture respectively in exponential growth Iprodione and 35-DCAwere added to the cultures at four concentration levels 01 05 5 and 50 mg liter1 in 01 (volvol)dimethyl sulfoxide (DMSO) once exponential growth was observed Triplicate cultures amended with01 (volvol) DMSO without iprodione and 35-DCA served as controls The effects of iprodione and35-DCA on the growth and activity of AOM were measured regularly via determination of the amoAgene abundance and NO2

levels (59) respectively DNA was extracted from a cell pellet obtained from2-ml aliquots of the microbial cultures using a tissue DNA extraction kit (Macherey-Nagel Germany)

DNA extraction from soil DNA was extracted from 500 mg of soil using a FastDNA Spin kit for soiland a FastPrep instrument (MP Biomedicals USA) and quantified using a Qubit fluorometer with aQuant-iT HS double-stranded DNA (dsDNA) assay kit (Invitrogen USA)

qPCR analysis of functional genes The abundances of AOB and AOA amoA genes weredetermined with primers amoA1F-amoA1R (60) and CrenamoA23f-CrenamoA616r (61) respectivelyas described by Rousidou et al (62) and the soxB gene using primers soxB_710f-soxB1184R asdescribed in Tourna et al (63) Quantitative PCR (qPCR) amplification efficiencies were between 85and 102 with R2 values of 0993 Standard curves were obtained using serial dilutions of plasmidvectors containing amplicons of nearly full-length target genes

Community structure analysis of bacteria fungi and AOM Microbial diversity analysis for totalbacteria fungi AOB and AOA was performed on samples from all treatments collected at 0 15 and 42 daysvia multiplex amplicon sequencing in an Illumina MiSeq sequencer generating 300-bp paired-end reads asdescribed previously (64) Primers primer-indexing sequences PCR conditions and programs are shown inTable 1 and in Table S4 in the supplemental material Sequence screening alignment to reference databasesand generation of OTU matrices for bacteria AOB and AOA were performed with mothur version 1361 (65)while the fungal ITS1 amplicon screening was performed with USEARCH version 9 (66) Bacterial 16S rRNAgene amplicon sequences were obtained through assembly of the read pairs subsequently aligned againstthe Silva version 128 bacterial database (67 68) AOBAOA amoA amplicons were compared with thealignments of Abell et al (22) and Alves et al (23) respectively for generating OTUs Sequences were thenclustered into groups differing by 1 in identity Chimeric amplicons were identified and removed usingUCHIME version 42 (69) Sequence distances were calculated for the aligned sequences while hierarchicalclustering using the average linkage algorithm (70) was performed for identifying OTUs at 002 sequencedistances Sequence divergences of 002 and 003 were used for bacteria and ammonia oxidizer OTUdefinition respectively Fungal ITS amplicons were clustered with the USEARCH version 9 implemented withthe UCLUST algorithm (66) using the UNITE (71) version 72 database ITS reference data set at a 003-distanceOTU definition The most abundant sequences of each OTU were selected as representatives and wereclassified according to the Ribosomal Database Project (RDP) with the naive Bayesian classifier moduleresiding in mothur version 1361 for bacteria and the UNITE database for fungi with the USEARCH version9 native SINTAX algorithm AOB and AOA amoA gene OTU representative sequences were placed in thepreviously curated phylogenies of Abell et al (22) and Alves et al (23) respectively This was performed usingthe parsimony-based phylogeny-aware short-read alignment approach of PaPaRa version 24 combined witha maximum likelihood evolutionary placement algorithm as implemented in RAxML version 824 (72ndash74)

TABLE 1 Primer sequences used for PCR amplification for multiplexed sequencing

Target gene Primer name Sequencea Thermal cycling conditionsb Reference

Bacterial 16S rRNA 343f NNNNNNNTATACGGRAGGCAGCAG 94degC for 30 s 50degC for 30 s72degC for 30 s (25 7 cycles)

64802r TACNVGGGTWTCTAATCC

Fungal ITS1 ITS-1 NNNNNNNAATCCGTAGGTGAACCTGCGG 94degC for 30 s 56degC for 30 s72degC for 60 s (28 7 cycles)

84ITS-2 GCTGCGTTCTTCATCGATGC

AOB amoA amoA-1f NNNNNNNAAGGGGTTTCTACTGGTGGT 94degC for 30 s 54degC for 30 s72degC for 60 s (25 5 cycles)

60amoA-2r CCCCTCKGSAAAGCCTTCTTC

AOA amoA amoA-310f NNNNNNNGGTGGATACCBTCWGCAATG 94degC for 30 s 54degC for 30 s72degC for 60 s (25 5 cycles)

85amoA-529r GCAACMGGACTATTGTAGAA

aThe sample index (consecutive Ns) and linker (bold letters) prior to the extension bases in the forward primer are indicatedbThe first number in parentheses indicates the number of cycles performed in the fist PCR where the unindexed primers were used while the second numberindicates the additional cycles performed in the sample indexing PCR step

Vasileiadis et al Applied and Environmental Microbiology

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 12

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from

Soil enzyme activities and PN measurements The activities of AcP (EC 3132) AlkP (EC 3131)BisP (EC 3141) and Piro (EC 3611) involved in P cycling arylsulfatase (AryS EC 3161) involved in Scycling Chit (EC 32152) and Leu (EC 34111) involved in N cycling and Bglu (EC 32121) involved inC cycling were determined using fluorescent 4-methyl-umbelliferyl and 7-amino-4-methyl coumarin (forLeu) linked to appropriate enzyme substrates and determined in a fluorometric plate reader system asdescribed by Karas et al (9) PN was determined by the method of Kandeler (75) Briefly 5-g soil sampleswere amended with 20 ml of 1 mM (NH4)2SO4 and 01 ml of 15 M NaClO3 and incubated under constantagitation at 20degC for 5 h while triplicate control samples were treated in the same way and incubatedat 20degC for the same period At the end of the incubation period NO2

was extracted from all sampleswith 2 M KCl The extract (5 ml) was amended with 3 ml of 019 M NH4Cl and 2 ml of a colorimetricindicator prior to final determination of its adsorption at 520 nm The PN in the soil samples was thendetermined with an external calibration curve prepared by measurement of the adsorption of a series ofNaNO2 solutions

Data analysis The SFO kinetic model or the biphasic model HS was used to calculate the soildissipation kinetics of iprodione and 35-DCA (76) The SFO kinetic model is based on the assumption thatthe change in a chemicalrsquos concentration with time (dCdt) is directly proportional to its concentrationat this time The HS model involves two sequential first-order degradation phases with different rates (k1

and k2) and having a breakpoint between them (tb) (24) The goodness of fit was assessed using a 2 test(15 for an of 005) visual inspection and the distribution of residuals

Microbial functional measurements in vitro assays and -diversity index data were analyzed bytwo-way analysis of variance (ANOVA) and associated post hoc tests RDA of the PN and enzyme activitieswith the ln-transformed soil concentrations of iprodione and 35-DCA as explanatory variables wasemployed to identify associations between compounds and the effects observed The OTU matrices ofbacteria fungi AOA and AOB were used to assess the impact of iprodione and 35-DCA on the - and-diversity values A-diversity indices used included Goodrsquos coverage estimate (77) the Shannon indexthe inverse Simpson index (78) observed richness (S) and ACE (abundance-based coverage estimator)richness estimation (79) -Diversity analysis included hierarchical clustering using the Bray-Curtisdissimilarity and RDA on the Hellinger-transformed matrices (80ndash82) Correlation tests between themeasured concentrations of iprodione and 35-DCA in soil and the OTU-assigned sequence countsidentified possible effects of the two chemicals on the microbial community members All statisticalanalyses were performed with R version 332 software (83) More details on data analysis are providedin the supplemental material

Accession number(s) The sequence data are publicly available in the National Center for Biotech-nology Information (NCBI) database under BioProject accession number PRJNA472261

SUPPLEMENTAL MATERIAL

Supplemental material for this article may be found at httpsdoiorg101128AEM01536-18

SUPPLEMENTAL FILE 1 PDF file 10 MB

ACKNOWLEDGMENTSThis work was performed within the frame of the project SNAC financially supported by

the Cariplo Foundation (grant number 2011-1088) The Doctoral School of the Agro-FoodSystem (Agrisystem) of the Universitagrave Cattolica del Sacro Cuore Italy is also acknowledgedby the authors for funding E S Papadopoulou was supported by the State ScholarshipFoundation of Greece through the action Supporting Postdoctoral Fellows using fundsfrom the EP Development of Human Resources Education and Life-Long Learning and wascofunded by the European Social Fund and the Greek State F Papadimitriou was sup-ported by the postgraduate program Molecular Biology-Genetics-Diagnostic Biomarkers(grant no 3817) of the University of Thessaly Department of Biochemistry and Biotechnol-ogy G W Nicol is funded by the AXA Research Fund

We have no conflicts of interest to declare

REFERENCES1 Pereira JL Antunes SC Castro BB Marques CR Gonccedilalves AMM Gon-

ccedilalves F Pereira R 2009 Toxicity evaluation of three pesticides onnon-target aquatic and soil organisms commercial formulation versusactive ingredient Ecotoxicology 18455ndash 463 httpsdoiorg101007s10646-009-0300-y

2 Beketov MA Kefford BJ Schaumlfer RB Liess M 2013 Pesticides reduceregional biodiversity of stream invertebrates Proc Natl Acad Sci U S A11011039 ndash11043 httpsdoiorg101073pnas1305618110

3 Laycock I Cotterell KC OrsquoShea-Wheller TA Cresswell JE 2014 Effects of theneonicotinoid pesticide thiamethoxam at field-realistic levels on microcolo-

nies of Bombus terrestris worker bumble bees Ecotoxicol Environ Saf100153ndash158 httpsdoiorg101016jecoenv201310027

4 Puglisi E Vasileiadis S Demiris K Bassi D Karpouzas DG Capri E Coc-concelli PS Trevisan M 2012 Impact of fungicides on the diversity andfunction of non-target ammonia-oxidizing microorganisms residing in alitter soil cover Microb Ecol 64692ndash701 httpsdoiorg101007s00248-012-0064-4

5 Falkowski PG Fenchel T Delong EF 2008 The microbial engines thatdrive Earthrsquos biogeochemical cycles Science 3201034 ndash1039 httpsdoiorg101126science1153213

Blame Pesticide Soil Microbial Toxicity on Metabolites Applied and Environmental Microbiology

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 13

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from

6 Feld L Hjelmsoslash MH Nielsen MS Jacobsen AD Roslashnn R Ekelund F KroghPH Strobel BW Jacobsen CS 2015 Pesticide side effects in an agricul-tural soil ecosystem as measured by amoA expression quantification andbacterial diversity changes PLoS One 10e0126080 httpsdoiorg101371journalpone0126080

7 Wang C Wang F Zhang Q Liang W 2016 Individual and combinedeffects of tebuconazole and carbendazim on soil microbial activity EurJ Soil Biol 726 ndash13 httpsdoiorg101016jejsobi201512005

8 Romdhane S Devers-Lamrani M Barthelmebs L Calvayrac C Bertrand CCooper J-F Dayan FE Martin-Laurent F 2016 Ecotoxicological impact ofthe bioherbicide leptospermone on the microbial community of twoarable soils Front Microbiol 7775 httpsdoiorg103389fmicb201600775

9 Karas P Trevisan M Ferrarini A Fornasier F Vasileiadis S Tsiamis GMartin-Laurent F Karpouzas DG 2018 Assessment of the impact ofthree pesticides on microbial dynamics and functions in a lab-to-fieldexperimental approach Sci Total Environ 637ndash 638636 ndash 646

10 Papadopoulou ES Tsachidou B Sułowicz S Menkissoglu-Spiroudi UKarpouzas DG 2016 Land spreading of wastewaters from the fruit-packaging industry and potential effects on soil microbes effects ofthe antioxidant ethoxyquin and its metabolites on ammonia oxidiz-ers Appl Environ Microbiol 82747ndash755 httpsdoiorg101128AEM03437-15

11 Wesseacuten E Hallin S 2011 Abundance of archaeal and bacterial ammoniaoxidizersmdashpossible bioindicator for soil monitoring Ecol Indic 111696 ndash1698 httpsdoiorg101016jecolind201104018

12 Grabke A Fernaacutendez-Ortuntildeo D Amiri A Li X Peres NA Smith P Schna-bel G 2014 Characterization of iprodione resistance in Botrytis cinereafrom strawberry and blackberry Phytopathology 104396 ndash 402 httpsdoiorg101094PHYTO-06-13-0156-R

13 European Food Safety Authority 2016 Peer review of the pesticide riskassessment of the active substance iprodione EFSA J 14e04609

14 Blystone CR Lambright CS Furr J Wilson VS Gray LE 2007 Iprodionedelays male rat pubertal development reduces serum testosteronelevels and decreases ex vivo testicular testosterone production ToxicolLett 17474 ndash 81 httpsdoiorg101016jtoxlet200708010

15 Mercadier C Garcia D Vega D Bastide J Coste C 1996 Metabolism ofiprodione in adapted and non-adapted soils effect of soil inoculationwith an iprodione-degrading Arthrobacter strain Soil Biol Biochem 281791ndash1796 httpsdoiorg101016S0038-0717(96)00285-4

16 Lo H-H Brown PI Rankin GO 1990 Acute nephrotoxicity induced byisomeric dichloroanilines in Fischer 344 rats Toxicology 63215ndash231httpsdoiorg1010160300-483X(90)90044-H

17 Yao X-F Khan F Pandey R Pandey J Mourant RG Jain RK Guo J-HRussell RJ Oakeshott JG Pandey G 2011 Degradation of dichloroanilineisomers by a newly isolated strain Bacillus megaterium IMT21 Microbi-ology 157721ndash726 httpsdoiorg101099mic0045393-0

18 Valentovic MA Ball JG Anestis DK Rankin GO 1995 Comparison of thein vitro toxicity of dichloroaniline structural isomers Toxicol In Vitro975ndash 81 httpsdoiorg1010160887-2333(94)00188-Z

19 Verdenelli RA Lamarque AL Meriles JM 2012 Short-term effects ofcombined iprodione and vermicompost applications on soil microbialcommunity structure Sci Total Environ 414210 ndash219 httpsdoiorg101016jscitotenv201110066

20 Zhang M Teng Y Zhang Y Ford R Xu Z 2017 Effects of nitrificationinhibitor 34-dimethylpyrazole phosphate and fungicide iprodione onsoil fungal biomass and community based on internal transcribedspacer region J Soils Sediments 171021ndash1029 httpsdoiorg101007s11368-016-1644-6

21 Zhang M Wang W Wang J Teng Y Xu Z 2017 Dynamics of biochemicalproperties associated with soil nitrogen mineralization following nitrifi-cation inhibitor and fungicide applications Environ Sci Pollut Res 2411340 ndash11348 httpsdoiorg101007s11356-017-8762-6

22 Abell GCJ Robert SS Frampton DMF Volkman JK Rizwi F Csontos JBodrossy L 2012 High-throughput analysis of ammonia oxidiser com-munity composition via a novel amoA based functional gene arrayPLoS One 7e51542 httpsdoiorg101371journalpone0051542

23 Alves RJE Minh BQ Urich T von Haeseler A Schleper C 2018 Unifyingthe global phylogeny and environmental distribution of ammonia-oxidising archaea based on amoA genes Nat Commun 91517 httpsdoiorg101038s41467-018-03861-1

24 Zhang M Wang W Zhang Y Teng Y Xu Z 2017 Effects of fungicideiprodione and nitrification inhibitor 3 4-dimethylpyrazole phosphate

on soil enzyme and bacterial properties Sci Total Environ 599 ndash 600254 ndash263 httpsdoiorg101016jscitotenv201705011

25 Crouzet O Devers M Pesce S Martin-Laurent F 2017 Assessment ofthe ecotoxicological impact of pesticides on soil microbial function-ing in agroecosystems how to define suitable indicators and for whatpurposes Poster B-15 7th Int Conf Pestic Behav Soils Water AirSymp York United Kingdom 30 August to 1 September 2017httpswwwyorkacukmediaenvironmentdocumentspesticides2017posterpresentationsB-15pdf

26 Prosser JI Nicol GW 2008 Relative contributions of archaea and bacteriato aerobic ammonia oxidation in the environment Environ Microbiol102931ndash2941 httpsdoiorg101111j1462-2920200801775x

27 Zadra C Cardinali G Corte L Fatichenti F Marucchini C 2006 Biodeg-radation of the fungicide iprodione by Zygosaccharomyces rouxii strainDBVPG 6399 J Agric Food Chem 544734 ndash 4739 httpsdoiorg101021jf060764j

28 Lehtovirta-Morley LE Verhamme DT Nicol GW Prosser JI 2013 Effect ofnitrification inhibitors on the growth and activity of Nitrosotaleadevanaterra in culture and soil Soil Biol Biochem 62129 ndash133 httpsdoiorg101016jsoilbio201301020

29 Shen T Stieglmeier M Dai J Urich T Schleper C 2013 Responses of theterrestrial ammonia-oxidizing archaeon Ca Nitrososphaera viennensisand the ammonia-oxidizing bacterium Nitrosospira multiformis to nitri-fication inhibitors FEMS Microbiol Lett 344121ndash129 httpsdoiorg1011111574-696812164

30 Norton JM Klotz MG Stein LY Arp DJ Bottomley PJ Chain PSG HauserLJ Land ML Larimer FW Shin MW Starkenburg SR 2008 Completegenome sequence of Nitrosospira multiformis an ammonia-oxidizingbacterium from the soil environment Appl Environ Microbiol 743559 ndash3572 httpsdoiorg101128AEM02722-07

31 Radice S Ferraris M Marabini L Grande S Chiesara E 2001 Effect ofiprodione a dicarboximide fungicide on primary cultured rainbow trout(Oncorhynchus mykiss) hepatocytes Aquat Toxicol 5451ndash58 httpsdoiorg101016S0166-445X(00)00175-2

32 Kim J-G Park S-J Sinninghe Damsteacute JS Schouten S Rijpstra WIC JungM-Y Kim S-J Gwak J-H Hong H Si O-J Lee S Madsen EL Rhee S-K 2016Hydrogen peroxide detoxification is a key mechanism for growth ofammonia-oxidizing archaea Proc Natl Acad Sci U S A 1137888 ndash7893httpsdoiorg101073pnas1605501113

33 Taylor AE Zeglin LH Dooley S Myrold DD Bottomley PJ 2010 Evidencefor different contributions of archaea and bacteria to the ammonia-oxidizing potential of diverse Oregon soils Appl Environ Microbiol767691ndash7698 httpsdoiorg101128AEM01324-10

34 Karpouzas DG Tsiamis G Trevisan M Ferrari F Malandain C Sibourg OMartin-Laurent F 2016 ldquoLove to haterdquo pesticides felicity or curse for thesoil microbial community An FP7 IAPP Marie Curie project aiming toestablish tools for the assessment of the mechanisms controlling theinteractions of pesticides with soil microorganisms Environ Sci PollutRes 2318947ndash18951

35 Papadopoulou ES Genitsaris S Omirou M Perruchon C StamatopoulouA Ioannides I Karpouzas DG 2018 Bioaugmentation of thiabendazole-contaminated soils from a wastewater disposal site factors driving theefficacy of this strategy and the diversity of the indigenous soil bacterialcommunity Environ Pollut 23316 ndash25 httpsdoiorg101016jenvpol201710021

36 Kuppusamy S Thavamani P Megharaj M Venkateswarlu K Lee YBNaidu R 2016 Pyrosequencing analysis of bacterial diversity in soilscontaminated long-term with PAHs and heavy metals implications tobioremediation J Hazard Mater 317169 ndash179 httpsdoiorg101016jjhazmat201605066

37 Athiel P Alfizar Mercadier C Vega D Bastide J Davet P Brunel BCleyet-Marel JC 1995 Degradation of iprodione by a soil Arthrobacter-like strain Appl Environ Microbiol 613216 ndash3220

38 Campos M Perruchon C Vasilieiadis S Menkissoglu-Spiroudi U Karpou-zas DG Diez MC 2015 Isolation and characterization of bacteria fromacidic pristine soil environment able to transform iprodione and 35-dichloraniline Int Biodeterior Biodegrad 104201ndash211 httpsdoiorg101016jibiod201506009

39 Liu YJ Liu SJ Drake HL Horn MA 2011 Alphaproteobacteria dominateactive 2-methyl-4-chlorophenoxyacetic acid herbicide degraders in ag-ricultural soil and drilosphere Environ Microbiol 13991ndash1009 httpsdoiorg101111j1462-2920201002405x

40 Thelusmond J-R Strathmann TJ Cupples AM 2016 The identificationof carbamazepine biodegrading phylotypes and phylotypes sensitive

Vasileiadis et al Applied and Environmental Microbiology

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 14

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from

to carbamazepine exposure in two soil microbial communities SciTotal Environ 5711241ndash1252 httpsdoiorg101016jscitotenv201607154

41 Hartmann M Frey B Mayer J Maumlder P Widmer F 2015 Distinct soilmicrobial diversity under long-term organic and conventional farmingISME J 91177ndash1194 httpsdoiorg101038ismej2014210

42 Fredlund E Druvefors U Boysen ME Lingsten KJ Schnuumlrer J 2002Physiological characteristics of the biocontrol yeast Pichia anomala J121FEMS Yeast Res 2395ndash 402 httpsdoiorg101111j1567-13642002tb00109x

43 Zahrl RJ Pentildea DA Mattanovich D Gasser B 2017 Systems biotechnol-ogy for protein production in Pichia pastoris FEMS Yeast Res 177httpsdoiorg101093femsyrfox068

44 Jia Z Conrad R 2009 Bacteria rather than Archaea dominate microbialammonia oxidation in an agricultural soil Environ Microbiol 111658 ndash1671 httpsdoiorg101111j1462-2920200901891x

45 Shi X Hu H-W Muumlller C He J-Z Chen D Suter HC 2016 Effects of thenitrification inhibitor 34-dimethylpyrazole phosphate on nitrificationand nitrifiers in two contrasting agricultural soils Appl Environ Microbiol825236 ndash5248 httpsdoiorg101128AEM01031-16

46 Pjevac P Schauberger C Poghosyan L Herbold CW van Kessel MAHJDaebeler A Steinberger M Jetten MSM Luumlcker S Wagner M Daims H2017 AmoA-targeted polymerase chain reaction primers for the specificdetection and quantification of comammox Nitrospira in the environ-ment Front Microbiol 81508 httpsdoiorg103389fmicb201701508

47 Singh S Gupta R Kumari M Sharma S 2015 Nontarget effects ofchemical pesticides and biological pesticide on rhizospheric microbialcommunity structure and function in Vigna radiata Environ Sci PollutRes 2211290 ndash11300 httpsdoiorg101007s11356-015-4341-x

48 Sanchez-Hernandez JC Sandoval M Pierart A 2017 Short-term responseof soil enzyme activities in a chlorpyrifos-treated mesocosm use ofenzyme-based indexes Ecol Indic 73525ndash535 httpsdoiorg101016jecolind201610022

49 Mintildeambres GG Conles MY Lucini EI Verdenelli RA Meriles JM ZygadloJA 2009 Application of thymol and iprodione to control garlic white rot(Sclerotium cepivorum) and its effect on soil microbial communitiesWorld J Microbiol Biotechnol 26161

50 Zhang M Wang W Bai SH Zhou X Teng Y Xu Z 2018 Antagonisticeffects of nitrification inhibitor 34-dimethylpyrazole phosphate andfungicide iprodione on net nitrification in an agricultural soil Soil BiolBiochem 116167ndash170 httpsdoiorg101016jsoilbio201710014

51 Vanni A Gamberini R Calabria A Pellegrino V 2000 Determination ofpresence of fungicides by their common metabolite 35-DCA in com-post Chemosphere 41453ndash 458 httpsdoiorg101016S0045-6535(99)00223-4

52 Kandeler E Gerber H 1988 Short-term assay of soil urease activity usingcolorimetric determination of ammonium Biol Fertil Soils 668 ndash72httpsdoiorg101007BF00257924

53 Doane TA Horwaacuteth WR 2003 Spectrophotometric determination ofnitrate with a single reagent Anal Lett 362713ndash2722 httpsdoiorg101081AL-120024647

54 Lehtovirta-Morley LE Ross J Hink L Weber EB Gubry-Rangin C Thion CProsser JI Nicol GW 2016 Isolation of ldquoCandidatus Nitrosocosmicusfranklandusrdquo a novel ureolytic soil archaeal ammonia oxidiser withtolerance to high ammonia concentration FEMS Microbiol Ecol 92fiw057 httpsdoiorg101093femsecfiw057

55 Lehtovirta-Morley LE Ge C Ross J Yao H Nicol GW Prosser JI 2014Characterisation of terrestrial acidophilic archaeal ammonia oxidisersand their inhibition and stimulation by organic compounds FEMS Mi-crobiol Ecol 89542ndash552 httpsdoiorg1011111574-694112353

56 Herbold CW Lehtovirta-Morley LE Jung MY Jehmlich N Hausmann BHan P Loy A Pester M Sayavedra-Soto LA Rhee SK Prosser JI Nicol GWWagner M Gubry-Rangin C 2017 Ammonia-oxidising archaea living atlow pH insights from comparative genomics Environ Microbiol 194939 ndash 4952 httpsdoiorg1011111462-292013971

57 Skinner FA Walker N 1961 Growth of Nitrosomonas europaea in batchand continuous culture Arch Mikrobiol 38339 ndash349 httpsdoiorg101007BF00408008

58 Lehtovirta-Morley LE Stoecker K Vilcinskas A Prosser JI Nicol GW 2011Cultivation of an obligate acidophilic ammonia oxidizer from a nitrifyingacid soil Proc Natl Acad Sci U S A 10815892ndash15897 httpsdoiorg101073pnas1107196108

59 Keeney DR Nelson DW 1982 Nitrogen in organic forms p 643ndash 698 InPage AL Miller RH Keeney DR (ed) Methods of soil analysis Part 2

chemical and microbiological properties 2nd ed American Society ofAgronomy Madison WI

60 Rotthauwe JH Witzel KP Liesack W 1997 The ammonia monooxygen-ase structural gene amoA as a functional marker molecular fine-scaleanalysis of natural ammonia-oxidizing populations Appl Environ Micro-biol 634704 ndash 4712

61 Tourna M Freitag TE Nicol GW Prosser JI 2008 Growth activity andtemperature responses of ammonia-oxidizing archaea and bacteria insoil microcosms Environ Microbiol 101357ndash1364 httpsdoiorg101111j1462-2920200701563x

62 Rousidou C Papadopoulou ES Kortsinidou M Giannakou IO Singh BKMenkissoglu-Spiroudi U Karpouzas DG 2013 Bio-pesticides harmful orharmless to ammonia oxidizing microorganisms The case of a Paecilo-myces lilacinus-based nematicide Soil Biol Biochem 6798 ndash105 httpsdoiorg101016jsoilbio201308014

63 Tourna M Maclean P Condron L OrsquoCallaghan M Wakelin SA 2014 Linksbetween sulphur oxidation and sulphur-oxidising bacteria abundance anddiversity in soil microcosms based on soxB functional gene analysis FEMSMicrobiol Ecol 88538ndash549 httpsdoiorg1011111574-694112323

64 Vasileiadis S Puglisi E Trevisan M Scheckel KG Langdon KA McLaughlinMJ Lombi E Donner E 2015 Changes in soil bacterial communities anddiversity in response to long-term silver exposure FEMS Microbiol Ecol91fiv114 httpsdoiorg101093femsecfiv114

65 Schloss PD Westcott SL Ryabin T Hall JR Hartmann M Hollister EBLesniewski RA Oakley BB Parks DH Robinson CJ Sahl JW Stres BThallinger GG Van Horn DJ Weber CF 2009 Introducing mothur open-source platform-independent community-supported software for de-scribing and comparing microbial communities Appl Environ Microbiol757537ndash7541 httpsdoiorg101128AEM01541-09

66 Edgar RC 2010 Search and clustering orders of magnitude fasterthan BLAST Bioinformatics 262460 ndash2461 httpsdoiorg101093bioinformaticsbtq461

67 Pruesse E Quast C Knittel K Fuchs BM Ludwig W Peplies J GlocknerFO 2007 SILVA a comprehensive online resource for quality checkedand aligned ribosomal RNA sequence data compatible with ARB NucleicAcids Res 357188 ndash7196 httpsdoiorg101093nargkm864

68 Quast C Pruesse E Yilmaz P Gerken J Schweer T Yarza P Peplies JGloumlckner FO 2013 The SILVA ribosomal RNA gene database projectimproved data processing and web-based tools Nucleic Acids Res 41D590 ndashD596 httpsdoiorg101093nargks1219

69 Edgar RC Haas BJ Clemente JC Quince C Knight R 2011 UCHIMEimproves sensitivity and speed of chimera detection Bioinformatics272194 ndash2200 httpsdoiorg101093bioinformaticsbtr381

70 Schloss PD Westcott SL 2011 Assessing and improving methods used inOTU-based approaches for 16S rRNA gene sequence analysis Appl EnvironMicrobiol 773219ndash3226 httpsdoiorg101128AEM02810-10

71 Kotildeljalg U Nilsson RH Abarenkov K Tedersoo L Taylor AFS Bahram MBates ST Bruns TD Bengtsson-Palme J Callaghan TM Douglas B Dren-khan T Eberhardt U Duentildeas M Grebenc T Griffith GW Hartmann M KirkPM Kohout P Larsson E Lindahl BD Luumlcking R Martiacuten MP Matheny PBNguyen NH Niskanen T Oja J Peay KG Peintner U Peterson M PotildeldmaaK Saag L Saar I Schuumlszligler A Scott JA Seneacutes C Smith ME Suija A TaylorDL Telleria MT Weiss M Larsson K-H 2013 Towards a unified paradigmfor sequence-based identification of fungi Mol Ecol 225271ndash5277httpsdoiorg101111mec12481

72 Berger SA Stamatakis A 2011 Aligning short reads to reference align-ments and trees Bioinformatics 272068 ndash2075 httpsdoiorg101093bioinformaticsbtr320

73 Berger SA Krompass D Stamatakis A 2011 Performance accuracy andweb server for evolutionary placement of short sequence reads undermaximum likelihood Syst Biol 60291ndash302 httpsdoiorg101093sysbiosyr010

74 Stamatakis A 2014 RAxML version 8 a tool for phylogenetic analysisand post-analysis of large phylogenies Bioinformatics 301312ndash1313httpsdoiorg101093bioinformaticsbtu033

75 Kandeler E 1995 Potential nitrification p 146 ndash149 In Schinner FOhlinger R Kandeler E Margesin R (ed) Methods in soil biologySpringer Heidelberg Germany

76 Boesten JJ Aden K Beigel C Beulke S Dust M Dyson JS Fomsgaard ISJones RL Karlsson S van der Linden AMA Richter O Magrans JO SoulasG 2006 Guidance document on estimating persistence and degradationkinetics from environmental fate studies on pesticides in EU registrationReport of the FOCUS work group on degradation kinetics EC document

Blame Pesticide Soil Microbial Toxicity on Metabolites Applied and Environmental Microbiology

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 15

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from

reference Sanco100582005 version 20 European Soil Data CentreBrussels Belgium

77 Good IJ 1953 The population frequencies of species and the estimationof population parameters Biometrika 40237ndash264 httpsdoiorg1023072333344

78 Jost L 2006 Entropy and diversity Oikos 113363ndash375 httpsdoiorg101111j20060030-129914714x

79 Chao A 1987 Estimating the population size for capture-recapture datawith unequal catchability Biometrics 43783ndash791 httpsdoiorg1023072531532

80 Bray JR Curtis JT 1957 An ordination of the upland forest communitiesof southern Wisconsin Ecol Monogr 27326 ndash349 httpsdoiorg1023071942268

81 Legendre P Gallagher E 2001 Ecologically meaningful transformationsfor ordination of species data Oecologia 129271ndash280 httpsdoiorg101007s004420100716

82 Legendre P Anderson MJ 1999 Distance-based redundancy analysistesting multispecies responses in multifactorial ecological experimentsEcol Monogr 691ndash24 httpsdoiorg1018900012-9615(1999)069[0001DBRATM]20CO2

83 R Core Team 2017 R a language and environment for statistical com-puting reference index version 333 R Foundation for Statistical Com-puting Vienna Austria

84 White T Bruns T Lee S Taylor J 1990 Amplification and direct sequenc-ing of fungal ribosomal RNA genes for phylogenetics p 315ndash322 In InnisM Gelfand D Shinsky J White T (ed) PCR protocols a guide to methodsand applications Academic Press London United Kingdom

85 Marusenko Y Bates ST Anderson I Johnson SL Soule T Garcia-Pichel F2013 Ammonia-oxidizing archaea and bacteria are structured by geog-raphy in biological soil crusts across North American arid lands EcolProcess 29 httpsdoiorg1011862192-1709-2-9

Vasileiadis et al Applied and Environmental Microbiology

November 2018 Volume 84 Issue 22 e01536-18 aemasmorg 16

on Novem

ber 12 2020 by guesthttpaem

asmorg

Dow

nloaded from