-

t .J

COMMITTEE

-

TO EXAMINE SCIENTIFIC CLAIMS MADE

WITH REGARD TO THE BNLA106 EVENT

(GENETIC TRANSFORMATION OF AN ELITE

INDIAN GENOTYPE OF COTTON, Gossypium

hirsutum L.J FOR INSECT RESISTANCE

THE REPORT

AUGUST 2012

-

PREFACE

From the initial stage itself, the members of the Committee were aware that they had accepted

an unenviable assignment. It is never easy to look at the work of colleague-scientists, and to offer

critical comments and report shortcomings, if any, in their work. Naturally, my colleagues and I

personally know several of the scientists involved. In spite of this, I am confident and satisfied that the

Committee has done a fair, reasonable and professional job. I am, therefore, firstly indebted to my

colleagues for carrying out of a somewhat unpleasant task, fairly and without fear or favour. A special

word of thanks to Dr. R.Y. Sonti who prepared the first draft and to Dr B.S.Dhillon and Mr Rajiv

Mehrshi who gave their very valuable inputs that resulted in the final report

-

[ am also thankful to other officers of ICAR, specifically our Non-Member Secretary, Dr. N.

Gopalakrishnan, for ably assisting us in our work. The Committee has already expressed, in the report

itself, its thanks to both the ICAR, and the NARS scientists who participated in the processes of this

Committee.

A special word of thanks is also due to Dr. Imran Siddiqi and Dr. Pankaj Rathore who readily

agreed to assist the Committee, and made a sincere and most useful contribution.

Lastly, I would like to thank the Department of Agricultural Research & Education, specifically

the Hon'ble Agriculture Minister and Dr. S. Ayyappan, DG, ICAR for having faith in us and entrusting

this sensitive task to us.

• -----;:;(11 \ItProf. . . Sopory' \

Chairperson

Biotechnology, specially agricultural biotechnology, is still somewhat new to India. The project

which gave us BNBt was the first serious public sector effort in India to use biotechnology to develop

bollworm resistant crops. Therefore, not only is the effort rooted in honest intentions, it should also be

appreciated for being the first serious attempt at public sector agricultural biotechnology. Indeed there

were errors, as pointed out in the report, but failures/errors are the obverse side of science, All effort

will not necessarily lead to success, and sometimes the scientists must be lauded for the initiative itself.

I hope the report of the Committee is read in this background, and in this spirit, and that ICARINARS

will not only continue but further enhance their efforts in producing safe biotech crops for the benefits

of Ind ian farmers.

-

-

-...

-

-

---------

INTRODUCTION

1.01 The Bt-Bikaneri Nerma (BNBt) cotton variety was developed as a collaborative

effort of NRCPB (National Research Center on Plant Biotechnology), New Delhi, UAS

(University of Agricultural Sciences), Dharwad and CICR (Central Institute for Cotton

Research), Nagpur. The results of this project were published in Current Science, titled

"Genetic transformation of an elite Indian genotype of cotton (Gossypium hirsutum L.) for

insect resistance by 1.5. Katageri, H.M. Vamadevaiah, 5.5. Udikeri, B.M. Khadi and

Polumetla A. Kumar in 2007. According to this paper, Bt-Bikaneri Nerma ['BNLA106'

event] was developed by UAS using shoot apex explants through Agrobacterium mediated

transformation using the cry1Ac gene construct provided by NRCPB. The NRCPB

confirmed integration and copy number by a method called "Southern Analysis'.

1.02 In tests conducted using ELISA, presence of CrylAc protein was detected in the

samples. CICR co-ordinated the bio-safety and multi-Iocational field trials of the material

provided by UAS.

1.03 Upon commercial release, after the due regulatory approval, BNBt variety and the

hybrid 'Bt NHH 44' were cultivated in about 8400 hectares in Khari' 2009. In general,

farmers and state seed agencies complained that performance and yields did not match

their expectations. Further, 'BNBt' seed samples were reported to contain Monsanto's

gene/event. Consequently, ICAR had seed multiplication and commercialization

suspended.

1

----...

1.04 In this background, ICAR constituted a Committee of the following experts to

examine the research claims made by the team, which authored the Current Science

paper titled "Genetic transformation of an elite Indian genotype of cotton (Gossypium

hirsutum L.) for insect resistance" in the Vol. 93 No. 12, December, 2007 issue of the

journal [P.1843-1847].

--

(i) Dr. S.K. Sopory, VC, JNU, New Delhi(ii) Dr. B.S. Dhillon, VC, PAU, Ludhiana(iii) Dr. R.V. Sonti, Dy. Director, CCMB, Hyderabad(iv) Sh. Rajiv Mehrishi, Secretary, ICAR(v) Dr. N. Gopalakrishnan, ADG (CC), ICAR

: Chairperson: Member: Member: Member: Non-Member Secretary

...

---

-----

--

1.05 The terms of reference to the Committee are as follows:

(i) To examine whether the team achieved a separate and distinct event other than

Mon531, which they called BNLA106, and whether there was enough evidence for

a claim to be made that BNLA106 was an event separate and distinct from the

Mon531 event of Monsanto.

(ii) .To examine to the deficiencies, if any, in the entire process of development of the

BNLA106. (BNBt cotton event) and subsequent development, release and

commercialisation of BNBt cotton variety and Bt NHH 44 hybrid.

(iii) To examine whether there were any deficiencies in the various tests done at various

stages to establish the distinctive nature of the BNLA106 event.

(iv) To advise on the appropriate steps to be taken now in respect of the BNLA106

event, and the consequential development of BNBt and Bt NHH 44 varieties,

including identifying the person/s responsible.

(v) To advise appropriate steps and methods that ICAR should put in place to ensure,

in future, the purity of process in the development of genetically modified crop

plants, and the process of vetting scientific claims in this regard, from the point of

.view of having a fool proof system that would put the veracity of the claims beyond

doubt.

2

--

-------....

--

--

-

1.06 The order constituting the Committee is enclosed with this report as Annexure-I(Pgs. 19-20).

1.07 The paper published in Current Science, titled .. Genetic transformation of an eliteIndian genotype of cotton (Gossypium hirsutum L.) for insect resistance" by Drs. I.S.Katageri, H.M. Vamadevaiah, S.S. Udikeri, 8.M. Khadi and Polum~tla A. Kumar, isat Annexure-II (Pgs. 21-25).

3

----

-------

-.....

----

-

EXECUTIVE SUMMARY

2.00 Based on available evidence, it appears that an event that is different from MON531

is present in "purified" BNBt. Third party verification is needed to conclusively establish

whether the event in purified BNBt is the same as the event in original BNBt, or not. In the

original material, contamination with MON531 appears to have occurred at UAS, Dharwad

and it appears to have occurred by the T4 generation. All earlier data obtained from

biosafety studies and field trials with BNBt appear to have been conducted with material

that contained the MON531 event, and thus are invalid. The "purified BNBt", as far as its

biosafety and evaluation studies are concemed, is a new event that must now go through

the regulatory process as a fresh application, if ICAR intends to commercialize it. The

project has been poorly planned and implemented with inappropriate distribution of work

elements. The lack of event specific markers, the now apparent lack of technical expertise

at UAS and a failure to select for the relevant event particularly when another event was in

the field have been major contributors to the present situation.

4

------------

-

-

MEETINGS AND THE PROCESS FOLLOWED BY THE COMMITTEE

3.01 -The Committee had its first meeting on February 22, 2012 in the office of Dr. S.K.

Sopory, Vice Chancellor of the Jawaharlal Nehru University, and reviewed the various

documents that were provided by ICAR to the Committee. It was decided that one team

led by Dr. Sonti needs to visit NRCPB and another team led by Dr. Dhillon would visit

UAS. It was decided that Dr. Sonti would need to be accompanied by another scientist,

and the other scientist identified was Dr. Imran Siddiqi. Accordingly, in terms of para 7 of

the order constituting Committee, it was decided to co-opt Dr. Imran Siddiqi as a member

of the Committee (for the visit and reporting its outcome), with the approval of the

competent authority. The Committee also identified Dr. Pankaj Rathore, a cotton breeder

from Punjab Agricultural University, Regional Station, Faridkot to accompany Dr. Dhillon.

Accordingly, in terms of para 7 of the order of the Committee Dr. Pankaj Rathore was also

co-opted (for the visits and reporting its outcome), with the approval of the competent

authority.

3.02 The team consisting of Drs. Dhillon and Rathore visited UAS on March 23 & 24,

2012 and had discussions/meetings with Dr. I.S. Katageri, Dr. B.M. Khadi, Dr. S.S. Udikeri,

Dr. H.M. Vamadevaiah, Dr. S.S. PatH, Dr. Manjula S. Maralappanavar, Dr. Ravi Hunje, Dr.

H.L. Nadaf, Dr. L. Krishna Naik and Dr. C.P. Mansur. The record of discussion this team

had with scientists in UAS is enclosed as Annexure-III-A (Pgs. 26-48). Further queries

raised and replied to by Dr. I.S. Katageri are at Annexure-III-B (Pgs. 49-54).

3.03 The team consisting of Drs. Sonti and Siddiqi visited NRCPB on March 24, 2012,

and met Dr. Kumar, Director of NRCPB and examined the relevant records. The team also

raised certain queries, in writing, copy of which are enclosed as Annexure-IV-A (Pgs. 55­

56), and the response given by Director, NRCPB to these queries' is contained in

Annexure-IV-B (Pgs. 57-70).

3.04 The second meeting of the Committee was held on March 25, 2012 in the office of- Vice Chancellor, Jawaharlal Nehru University (JNU). It was decided that Drs. Sonti and

Siddiqi should also meet Dr. K.C. Jain, former Assistant Director General (CC), ICAR, now- 5

--

-----

---

--

-

-

-

settled in Hyderabad. In his meeting with this group in Hyderabad on April, 23, 2012, Dr.

K.C. Jain indicated that all records regarding BNBt were available with ICAR, that he was

unwell and that he could not recollect issues connected with the meetings pertaining to

BNBl. Dr. K.C. Jain's letter is at Annexure-V (Pg. 71). ICAR may like to· take note of the

fact that Dr. K. C. Jain was not forthcoming to the committee in this matter.

3.05 In the meeting of March 25, 2012, it had also been decided that the team consisting

of Drs. Dhillon and Rathore would meet the CICR scientists. Accordingly, Drs. Dhillon and

Rathore met the CICR scientists (Dr. K.R. Kranthi, Dr. Suman Bala Singh and Dr. G.

Balasubramani) on April 5, 2012, in Delhi. The record of discussion with Dr. K.R. Kranthi is

at Annexure-VI-A (Pgs. 72-81); that with Dr. Balasubramani is at Annexure-VI-B (Pgs.

82-84); and record of discussion with Dr. Suman Bala Singh is at Annexure-VI-C (Pgs.

85-86).

3.06 The third and fourth meetings of the Committee were held in the office of Vice

Chancellor, JNU on May 5, 2012 and June 7, 2012, to discuss the matter in detail, based

on the papers provided by ICAR, the interaction at NRCPB, UAS and scientists of CICR,

and replies provided by the scientists of these Institutes. The Committee discussed in

detail contents of its report in meetings held on July 24 and August 25, 2012. The

Committee's conclusions are based on the site visits and discussions with parties

concerned, as well as perusal of relevant documents.

THE REPORT

4.00 The first term of reference to the Committee is to examine whether the team

achieved a separate and distinct event other than MON531, which they called

BNLA106, and whether there was enough evidence for a claim to be made that

BNLA106 was an event separate and distinct from MON531 event of Monsanto.

4.01 The presence of MON531 event in BNBt is so extensive that the only sample of the

original BNBt that is available for analysis is the supposedly "purified" BNBl. The

committee therefore focused its attention on determining whether "purified" BNBt is

6

---

-----

-

--

-

-

-

different from MON531, and whether the characteristics of "purified" BNBt match with

those described for original BNBt in the Katageri et al., 2007, paper in Current Science.

Specifically, the committee examined the molecular characterization of "purified" BNBt that

has been carried out at NRCPB, and assessed whether the described characteristics of

the event in "purified" BNBt are, on one hand, different from MON531 and, on the other

hand, similar to those described for BNBt by Katageri et al., 2007.

4.02 The committee noted that the molecular characterization of BNLA106 event as

described by Katageri et al., 2007, was minimal. Event specific primers that would have

made a comparison with MON531 fairly straightforward had not been described. This

should have been done by NRCPB, which provided the gene construct, as it has the

requisite expertise. The Current Science paper of Katageri et al. describes Southern

hybridization analysis with one probe (cI}'1Ac) and only one restriction enzyme (Hindi II),

whereas the use of different restriction enzyme - probe combinations would have been

more descriptive of the event.

4.03 During the visit of the committee to NRCPB, Dr. Kumar presented Southern

hybridization analysis data which indicates that when the cI}'1Ac gene is used as a probe,

and plant genomic DNA is digested with Hindi II, a - 7 kb fragment is detected in purified

BNBt, and a 8 kb fragment is detected in MON531. Dr. Kumar also presented data from

flanking sequence information of the event in "purified" BNBt, and event .specific markers

for the same which have now been developed. This analysis is indicative that the "purified"

BNBt event is different from MON531. Furthermore, PCR primers that are directed against

NOS promoter (a unique feature of pBinBt3) and the vector backbone amplify a product of

1.4 kb from the "purified" BNBt, but not from MON531. All of the above evidences indicate

that "purified" BNBt is different from MON531. The Southern hybridization analysis with

"purified" BNBt indicates that a -7kb Hindlll fragment is homologous to the cI}'1Ac probe.

The analysis with original BNBt (presented in Katageri et al., 2007) indicated that a - 7kb

Hindlll fragment is homologous to cl}'1Ac. This would suggest that "purified" BNBt and the

original BNBt may have the same event. However, the fact that the -7 kb fragment

detected in "purified" BNBt is very faint calls for further analysis.

7

---

-

-

-

--

0--'

...

-

-

4.04 However, some other important issues still remain with regard to the

characterization of the event in "purified" BNBt. The complete sequence of this event has

not yet been obtained. Whatever information has been obtained indicates that there has

been significant rearrangement of the integrated DNA during the generation of the event

present in "purified" BNBt as indicated by Dr. Kumar in his letter to the committee

(Annexure-VII; Pgs. 87-88). This raises questions regarding the utility of an event with

such re-arrangements for any sort of commercialization, as it could render expression of

the gene/trait of interest unstable. Most importantly, the sequence of the event that has

been obtained to date does not explain the manner in which a -7 kb Hindlll fragment, that

is homologous to cry1Ac, can be generated in purified BNBt. The complete sequence of

the event in purified BNBt must be obtained at the earliest to clarity this point. The

Committee would also like to record, that a minimum of around 100 independent events

should generally be generated and the best eventls selected for commercialization. A

decision to commercialize, based on a single event was, and would be, ill advised.

4.05 Dr. Kumar has requested that a third party verify the Southem hybridization analysis

of the "purified" event. The committee agrees and recommends independent, third party

analysis to establish beyond doubt whether the "purified" BNBt event is the same as the

original event, which was described in the Current Science paper of Katageri et al. Plant

material for the same is to be provided by Dr. Katageri. Dr. Kumar shall provide plasmids

and information on primers. Complete sequence of the event in purified BNBt must be

obtained by NRCPB at the earliest, and if possible, before the third party analysis. In case

the "purified" event is not established to be an event same as the BNLA106, the validity of

the Current Science paper becomes questionable.

THE PROCESS OF DEVELOPMENT

5.00 The second term of reference to the Committee was to examine to the

deficiencies, if any, in the entire process of development of the BNLA106 (BNBt

cotton event) and subsequent development, release and commercialization of BNBt

cotton variety and Bt NHH 44 hybrid.

8

-

-

-

-

5.01 In hindsight, and to say the least, the project entitled "Bt-transgeni<;: pigeonpea, rice

and cotton for insect resistance" under NATP appears not to have been planned well.

Though Dr. Kumar was the P.1. for the project, the role of the P.1. seems to have been

restricted to providing the gene construct, and subsequently to assist in conducting a few

Southern hybridization analyses. As there was no expertise in UAS in crucial areas such

as homozygosity testing, and development of event specific markers, the teams at UAS

and CICR used two private service providers. In documents provided to the committee by

ICAR, both NRCPB (note submitted to DG, ICAR on 20-10-2011 by Director, NRCPB;

Annexure-VIII-A; Pgs.89-96) and CICR (note on characterization of cry lAc in purported

BNLA 106 event submitted by Director, CICR on 18-12-2010; Annexure-VIII-B; Pgs.97­

109) have expressed their doubts about the analysis conducted by one of these service

providers. It would have been appropriate if the critical task of developing event specific

primers was handled by one of the team members who had the expertise for carrying out

such a study.

5.02 'Event specific primers should have been developed for BNBt, preferably by the P.1.

of the project, and used for regular DNA based, event specific purity testing of the plants.

Purity testing should have been done by the team at UAS, or at NRCPB, by getting leaf

material from UAS. Neither did so. Dr Katageri stated that he did not have the technical

skills to carry out such studies, and also was not aware of any methodology to differentiate

various events. However, in the proposal of the NATP it has been indicated that Dr.

Katageri would be responsible for molecular analysis of BNSt. Such DNA based tests

should have also been performed when conducting selection in different generations, and

also during commercial seed production by UAS. Such DNA based testing to assess purity

is also crucial when materials are provided for regulatory studies. This was not done. Not

only did Dr. Katageri not undertake the work assigned to him as per the project proposal,

he did not request for requisite help or guidance, in view of his own admitted inability, from

the P.1. On his part, the P.1. did not perform the duties of overall coordination, monitoring

and filling in the gaps that are normally expected of the P.1.

5.03 Only two Southern positive transformants were obtained in the development of

BNBt; one of which was single copy and the other was multi-copy. As the multi-copy line

9

---

--

-

--

was not used further, it meant that only one event was available. This is grossly

inadequate, as a large number of events need to be screened in the event selection trials

to identify the best performing line having commercial potential. It may be added that it is

not impossible to get an agronomically desirable strain from a single transgenic event.

However, its probability is extremely low.

5.04 During the BNBt development programme, selection of desirable plants/progenies

was based on the presence of Cry1Ac protein. This was done in spite of knowing fUlly well

that there was already another event (MON531) in the field, which would also test positive

for Cry1Ac protein. Clearly testing for Cry1Ac protein alone was insufficient, as this would

not preclude presence of the MON531 event. Each generation should have been tested for

the event BNLA106. This was not done.

5.05 RT-PCR analysis done at NRCPB indicates that cry1Ac expression in "purified"

BNBt is significantly less, as compared to expression in MON531 (refer Annexure-VIII-A;

Pgs.89-96). If this is a correlate of effectiveness, BNBt would be much less effective than

MON531. This may be kept in view, if ICAR intends to proceed towards commercialisation

of "purified" BNBt.

5.06 The Committee is of the view that there were indications, prior to commercial- release, that BNBt was contaminated with MON531. (Please refer to para 7.05). These

were not formally brought to the attention of the relevant authorities. Neither these

indications were followed up appropriately by the scientist who observed them nor was any

attention paid by others who came to know of them. If the corrective measures had been- taken at that time, by those involved in development and commercialisation of BNBt and Bt

NHH 44, the situation that has now arisen could have been avoided.-

---

5.07 There seemed to be an extreme hurry to come up with a public sector Bt cotton.

Agronomic evaluation is normally started when strain(s) are nearly homozygous and

homogenous. But in the present case, BNBt was put under field evaluation before the

homogeneity was achieved.

10

--

-

-

-

--

-

--

5.08 Commercial seed production procedure was not followed, even though there is a

well established procedure in this regard. For example, had the breeders/seed production

scientists been more careful in monitoring, the segregation/admixture for morphological

traits like petal and pollen colour could have been easily identified and red flags raised.

5.09 The P.1. (Dr. Kumar) and Co-P.1. (Dr. Khadi) of the NATP funded project (under

which BNLA106 was developed) were members of the GEAC (Genetic Engineering

Approval Committee), and present in a meeting, when the application for approval of large

scale field trials of BNBt was discussed (Annexure-IX; Pgs.11 0-112). This is a clear case

of conflict of interest and should have been avoided. To avoid repetition in future, ICAR

should issue instructions to its scientists to recuse themselves from the meetings of GEAC

and/or RCGM (Review Committee on Genetic Manipulations) when their own work is

being discussed. The same should apply to other scientists working in NARS.

5.10 There was a clear lack of coordination amongst various cooperating

centres/scientists in the project. This began with preparation ofthe NATP project proposal,

when responsibilities were assigned to Dr. Katageri (and accepted by him) for which

according to his own current statement, he does not have the expertise. Thereafter, in

matters of preparing flanking sequences, testing for purity, proper supervision of breeder

seed production, etc. - the whole range of activities reflect this lack of coordination and

overall guidance.

THE TESTS

6.00 'The third term of reference to the Committee is to examine whether therewere any deficiencies in the various tests done at various stages to establish thedistinctive nature of the BNLA106 event.

6.01 A fundamental flaw in the development of BNBt lies in the fact that there was only

one event. The team should have developed more events before taking one of them

forward.

11

--

-----

-

---

-

6.02 A positive ELISA test is no evidence for presence of BNLA106 event. The ELISA

test is based on protein expression, and not on the presence of any specific event.

Therefore, it cannot distinguish between BNLA106 and MON531.

6.03 Event specific primers were not developed for BNBt. These should have been

developed, preferably by PI, and used by the team to test for presence of the BNLA106

event.

6.04. The NOS promoter is driving nptll in the pBinBt3 construct. This is a configuration

that is not present in MON531. This unique feature could have been exploited by NRCPB

to develop a PCR assay for distinguishing between BNBt and MON531 even in the

absence of event specific markers. This feature of the construct could have been utilized

by NRCPB during the project but this was not done.

6.05. The Southern hybridization analysis conducted in NRCPB on BNBt is somewhat

limited". Only one enzyme-probe combination was used in this analysis. Additional enzyme­

probe combinations would have provided a better description of the uniqueness of the

BNLA106 event.

FUTURE COURSE OF ACTION

7.00 The fourth term of reference to the Committee is to advise on the appropriatesteps to be taken now in respect of the BNLA106 event, and the consequentialdevelopment of BNBt and BtNHH 44 varieties, including identifying the person/sresponsible.

7.01 All biosafety studies and field trials conducted with BNBt and Bt NHH 44 are invalid,

as BNBt and Bt NHH 44 do not have the transgene sequences that they.are purported to

carry in the applications submitted to RCGM/GEAC. If these lines are to be pursued

further, fresh process would have to be made, starting at the level of IBSC (Institutional

Biosafety Committee).

12

7.02 In view of the recent RT-PCR data on BNLA106 from NRCPB (refer para 5.05), the

effectiveness of the event should be assessed before it is entered into the regulatory

process.

7.03 Individual responsibility is normally reflected in the relevant paragraphs of this

report. However, some of these are brought out in the subsequent paragraphs, either

because of their salience, or because they may not have been stated elsewhere in the ..

report.

- 7.04 Dr. Kumar, P.1. of the NATP project, should have been more active in engaging

himself with the activities at UAS. He should have been careful at the time of project

- writing and not allotted molecular biology work to Dr. Katageri. He should also have

ensured the development of event specific markers for BNBt.

-

--

---

--

7.05 Dr. Khadi should have been more careful, particularly as he had got the information

from Dr. Kranthi on the presence of MON531 in 2008. In fact, Dr. I(hadi maintained

throughout the enquiry, and even in earlier papers which were circulated to the committee

by ICAR, that he did not know about contamination with MON531, whereas the contents of

his letter dated 4.1.2012 addressed to DOG (CS) (Annexure-X; Pg.113) states otherwise.

In this letter, Dr. Khadi states, in its third paragraph that "After the decision of GEAC on

02.05.2008 regarding commercialization of BNBt, following week of May 2008, Dr. K.R.

Kranthi, HOD, Plant Protection, CICR, Nagpur informed me regarding the Mon-531

contamination I presence in the seeds tested". This indicates that Dr. Khadi was aware of

the problem, at least in May 2008. Crucially, this was before actual commercialization of

BNBt. He further states that "Immediately Hon'ble DOG (CS) and ADG (CC) were informed

regarding the same. Hon,ble DOG (CS) arranged a meeting with all concerned Scientists

and discussed the matter in detail on 21-5-2008 (Ref. F. No.2(1I) 2008 CC-1 dated

29.5.2008)" (Minutes at Annexure-XI; Pgs.114-117). However, in his discussion with the

team that visited UAS, Dr. Khadi consistently maintained that he was not aware of

conta~ination at that time and the proceedings of the meeting held on May 21, 2008, in

which there is no mention of contamination, are correct. Also, Dr. P. L. Gautam, the DOG

(CS) at that time has denied knowledge of the same and has pointed out to the minutes of

the 21-5-2008 meeting (which are signed by all participants of the meeting; Annexure-XI;

Pgs.114-117) that this matter was not discussed in the meeting (letter of Dr. Gautam at13

-

-

-

-

Annexure-XII; Pgs.118-124). As indicated above, Dr. Jain, the ADG (CC) at that time has

indicated that he is unwell and does not recollect issues related to the meetings on BNBt

(refer also paras 3.04 and 5.06).

7.06 Dr. Katageri says that he is a conventional breeder and did not have competence

and facilities to discriminate MON531 and BNLA106 events. It is pertinent to note that, in

the NATP proposal, Dr. Katageri is listed as the person responsible for molecular analysis

of the transgenics. If he had no requisite expertise, he should have had the necessary

corrections made in the project proposal, at some stage, or at least later have contacted

Dr Kumar, P.I., or any other expert, for help and scientific guidance in the areas where he

had no expertise. Dr. Katageri should have been more careful in the breeding process

(please refer to para 5.08).

7.07 .Dr. Kranthi conducted analysis which gave him reason to suspect in 2005 and 2008

that samples given to him in fact had MON531. Although these were crucial observations,

he did not give written reports to his seniors. He ventured to put his views down on paper

in October 2009 only after it had become public knowledge that BNBt had been

contaminated with MON531. Moreover, he signed and forwarded as Director, CICR,

Nagpur, the application for registration of BNBt to PPV & FR Authority (the said application

has been subsequently withdrawn).

7.08 Both Drs. Khadi and Katageri, being experienced cotton breeders, should have

conducted selection for the event (BNLA106) by testing each generation for this event,

particularly when another event (MON531) was in the field. However, they continued to

select on the basis of protein expression (please refer to Para 5.04).

7.09 In all likelihood, the "contamination" (may be outcrossing or admixture) with

MON5-31 occurred at UAS. This appears to have occurred not only before Dr. Katageri left

for USA in October 2005, but even before Dr. Khadi moved to CICR in May 2005 as the

seeds that Dr. Khadi took with him were already contaminated with MON531. Also, BNBt

has been 'purified' (recently at UAS) using progeny of plants that were reported to be

multicopy in the T4 generation (grown during 2005-06). Most of these progeny lines

carried MON531 and very few (5 out of 135) had only BNBt. This is again consistent with

the possibility that, by the T4 generation, BNBt had been contaminated with MON531. It is

14

---

-

-

-

-

difficult to say whether contamination is deliberate or accidental. However, an accidental

contamination would be difficult to explain as the T4 plants used for South.ern hybridization

analysis at NRCPB showed BNBt event, while the same material taken to and tested at

Nagpur showed extensive contamination with MON531. Thus, assuming only accidental

contamination cannot account for what has happened. Drs. Khadi and Katageri were the

persons who were primarily responsible for ensuring purity of the material at UAS,

Dharwad.

PURITY OF PROCESS

8.00 The fifth term of reference to the Committee is to advise appropriate stepsand methods that ICAR should put in place to ensure, in future, the purity ofprocess in the development of genetically modified crop plants, and the process ofvetting scientific claims in this regard, from the point of view having a fool proofsystem that would put the veracity of claims beyond doubt

8.01 A project should be planned and executed with utmost care. Further, P.1. needs to

be alert all the time to plug loopholes, if any. All concerned, ICAR and/or Universities,

depending on the involvement of their respective scientists, need to be extra cautious in

the project of such national importance, as the present one.

8.02 The P.1. ofthe project should ensure coordination of all concerned.

8.03 Multiple independently obtained transformants (at least around 100 events) should

be developed and evaluated to identify the best events for any given construct.

8.04 Event specific primersltests should be developed and used for selection of the

event in various generations.

8.05 The breeders who are involved in the project (or a biotechnologist associated with

them) should be able to perform various tests to assess the presence and purity of event

in each generation.

8.06 'Results of testing should be documented and reported in writing. Oral

communication of results to superiors is not sufficient. In fact, ICAR should issue detailed

guidelines to various institutes/Universities in NARS, specially referral laboratories,

15

covering essentiality of written requests, written reports, and maintenance of permanent

record, etc.

8.07 The comparative performance of recipient variety/line and the GM (Genetically

Modified) product should be closely monitored.

8.08 The experimental varieties/hybrids should only be tested after strain/parental line

have achieved homozygosity/homogeneity.

8.09 Seed production should be carried out following laid down procedures, including

rigorous monitoring.

8.10 All issues related to IPR for the gene of interest and other genetic elements on the

transformation construct and the methods of using the same must be sorted out at the

outset of the project, if the ultimate goal is to commercialize the transgenic line that is to be

generated.

8.11 ICAR should issue detailed guidelines regarding the process to be followed in the

development of transgenic crops. At each stage of development, from the acquisition or

utilisation of the gene/construct, to commercial seed production and actual

commercialisation, these guidelines should establish fail-safe gateways that are both

internal to the system, and external to it. The Committee would like to stress that while

third party verification is important from the point of view of objectivity, internal checks and

reviews that insist on scientific rigour, are no less important. The Committee suggests that

ICAR set up an Expert Committee for evolving such guidelines, and have them issued at

the earliest.

8.12. ICAR must abide by agreements signed by its officers/scientists which obviously

cannot be treated as "personal" (Please refer to Para 9.02). In case there is any doubt,

ICAR should seek legal opinion. Equally important is that the concerned officers/scientists

while signing an MTA should ensure that related IPR issues, if any, are not too

complicated to hinder commercialization, in view of the fact that ICAR is fully involved in

applied research.

16

OTHER ISSUES

9.00 The last term of reference to the Committee is to report on any other issuearising from, or identical to, the issue under examination.

9.01 Conflicts of interest should be avoided when ICAR scientists are members of

regulatory bodies. Instructions regarding this need to be issued, as already stated in para

5.09.

9.02 The cry1Ac gene used in the development of BNBt was developed by Dr. I.

Altosaar of the University of Ottawa. It was obtained by Dr. R. P. Sharma, former Director,

NRCPB by signing a Material Transfer Agreement (MTA) with University of Ottawa. In

2006, as informed by Dr. Kumar, he had tried to negotiate a freedom to operate agreement

with Dr. Altosaar. For reasons that are not clear, this did not materialize. At a meeting in

2006, it was surprisingly decided by ICAR that Dr. Sharma had signed on the MTA in his

"personal capacity", and that a freedom to operate agreement was not necessary at that

stage, and that henceforth the construct would be referred to as a "NRCPB construct".

Copy of the minutes of this meeting is at Annexure-XIII; Pgs.125-127). In the opinion of

the Committee this is a violation of the MTA signed with Dr. Altosaar and, to say the least,

unethical. ICAR should even now take appropriate legal opinion and ensure that a freedom

to operate agreement is in place for various genes obtained from Dr. Altosaar or other

sources. Meanwhile, ICAR should compile information on the crops in which these genes

are being incorporated, and legal opinion on infringement of IPR, or otherwise should

- govern decisions regarding further work on these genes in NARS.

9.03 The MTA with University of Ottawa stipulates that either Dr. Altosaar, or one of his

group members, should be an author in publications that arise from use of the cry genes

provided by him. In this regard, Drs. Sonti and Siddiqi were informed by D·r. Kumar that Dr.

Altosaar was an author in earlier versions of the manuscript that described the

development of BNBt. Dr. Kumar indicated that he had removed Dr. Altosaar's name from

the list of authors of this manuscript after it was decided by ICAR that the construct would

henceforth be referred to as "NRCPB construct". For the same reason, the contribution of

Dr. Altosaar by way of providing the cry1Ac gene is not even acknowledged anywhere in

the Current Science paper. Dr. Kumar indicated that any acknowledgement of Dr.

Altosaar's contribution would go against the ICAR policy decision that this should be

17

considered a "NRCPB construct". Therefore, he removed Dr. Altosaar's name from the list

of authors on the BNBt manuscript, even though he felt that this was ethically incorrect. Dr.

Kumar also provided the committee with an earlier version of the manuscript that had Dr.

Altosaar listed as a co-author, a fact that if needed, can be verified with journal. Based on

the above, the committee suggests that ICAR should think about not taking policy

decisions of this nature that would compromise the ability of its scientists to take ethically

correct decisions.

9.04 In view of the fact that this was considered a project of national importance and

priority, ICAR HQ could have, and should have, interacted more with project scientists to

be able to detect the weakness of the effort on BNBt. It should also have been more alert

and sensitive in its approach to respecting Material Transfer Agreements signed by its

officers.

9.05 In some of its projects, ICAR also has the system of having a Mission Leader. In

the NATP project under question, the Mission Leader was Dr. R.P. Sharma. It is not clear

if he, or his successor, Dr. K.R. Koundal provided leadership to the project. However, the

Committee has refrained from commenting on the role of the Mission Leader because

neither Dr. Sharma nor Dr. Koundal became co-authors of the paper published in Current

Science.

10.00 At the end, the Committee would like to place on record its heartfelt thanks to all the

officers of ICAR and UAS who have interacted with it or have helped the Committee

otherwise in its work by way of secretarial assistance. The Committee would also like to

place on record its appreciation for the co-opted members, namely Dr. Imran Siddiqi of

Centre for Cellular and Molecular Biology (CCMB) and Dr. Pankaj Rathore of Punjab

Agricultural University (PAU) for willingly providing their services and assistance to the

Committee. This report has 13 Annexures which are, in view of the Committee, important

in throwing light on the Committee's recommendations.

~1-PP}",~ 1Z~O~~,,-(B.S. DHILLON) (R.V. SONTI)

18

6~~ ~6(RAJIV EHRISHI)( (

ANNEXURE-I

INDIAN COUNCIL OF AGRICULTURAL RESEARCHKRISHI BHAWAN: NEW DELHI

F.No.2-11/08-CCI

ORDER

Dated the 18th January, 2012

-

-

The Bt-Bikaneri Nanna cotton variety was developed as a collaborative effortof NRCPB (National Research Center on Plant Biotechnology, New Delhi), UAS(University of Agricultural Sciences, Dharwad) and CICR (Central Institute for CottonResearch, Nagpur),...The results of this project were published in Current Science,titled "Genetic tiansfonnation of an elite Indian genotype of cotton(Gossypiumhirsutum'L.) for insect resistance by I.S.. Katageri, H.M. Vamadevaiah,S.S. Udikeri, B.M. Khadi and Polumetla A. Kumar in 2007. According tp this paper,Bt-BikaneriNenna['BNLA106' event] was developed by UAS Oharwad using shl10tapex explants through Agrobacterium mediated transfonnalion on the basis of theCry1Ac gene construct provided by NRCPS. The NRCPB oonfimled integration andcol!ly number by a method called "Southern Analysis".

2. In tests conducted by CICR referral lab, using ELISA, presence of Bt. proteinwas detected in the samples provided by UAS, Dharwad. CICR also co-ordinatedthe bie-safety and multi-Iocational field trials of the material provided by UAS,Dharwad.

3. Upon commercial release, after the due regulatory approval, BNBt variety andthe hybrid '81 NHH 44' were reportedly cultivated in about 8400 hectares (0.08% ofcotton acreage) in Kharif 2009. In general, fanners and state seed agenciescomplained that perfonnance and yields did not match their expectations. Further,'BNBt' seed samples were reported to contain Monsanto's gene/eventConsequently, Indian Council of Agricultural Research (ICAR) had seedmultiplication and commercialization suspended after 2009.

4. In this background, President,.ICAR is pleased to constitute a Committee ofthe following experts to examine the research claims made by the team, whichauthored the Current Science paper tiUed "Genetic transformation of an elite Indiangenotype of cotton (Gossypiumhirsutum L.) for insect resistance" in the Vol. 93 No.12, December, 2007 issue of the journal [P.1843-1847].

-

(i) Dr. S.K. Sopory, VC, JNU, New Delhi(ii) Dr. B.S. Dhillon, VC, PAU, Ludhiana(iii) '-"'Or. R.V. Sonti, Dy. Director, CCMB, Hyderabad(iv) Sh. Rajiv Mehrishi, Secretary, ICAR(v) Dr. N. Gopalakrishnan, ADG (CC), ICAR

19

ChairpersonMemberMemberMemberNon-Member Secretary

!.l The terms of reference of the Committee would be as follows:

(I) To examine whether the team achieved a separate and distinct event otherthan Mon531, which they called BNLA106, and whether there was enoughevidence for a claim to be made that 8NLA106 was an event separate anddistinct from the Mon531 event of Monsanto.

(ii) To examine to the deficiencies, if any, in the entire process of development ofthe BNLA106. (BNBt cotton event) and subsequent development, release andcommercialisation of BNBt cotton variety and BtNHH44 hybrid.

(iii) To examine whether there were any defICiencies in the various tests done atvarious stages to establish the distinctive nature of the 8NLA106 event.

(iv) To advise on the appropriate steps to be taken now in respect of theBNLA106 event, and the consequential development of BNBt and Bt NHH44varieties, including identifying the personls responsible.

•(v) To advise appropriate steps and methods that ICAR should put in place to

ensure, in future, the purity of process in the development of geneticallymodified crop plants, and the process of vetting scientiflCdaims in this regard,from the point of view having a fool proof system that would put the veracity ofthe claims beyond doubt.

(vi) Any other issue arising from, or incidental to, the above.

6. The committee may submit its report within three months of the issue of thisorder.

7. The committee may examine scientists and officers of the ICAR as it deemsfit, as well as consultlco-opt other experts in the country that it feels are necessaryfor it to do its work. •

8. The committee may hold as many meetings, and visits to places concemedwith the development of BNLA106 within India, as it considers necessary, and mayhold its meetings at any such concerned venue within India.

9. The members of the Committee will be entitled to travel by air, as per Govt. ofIndia rules, from the normal place of residence to the venue of the meetings, as wellas to local transportation and daily allowance permissible to DOG rank officers ofICAR, and sitting fee payable to non-official members of the Governing Body ofICAR, as per ICAR norms.

10. Secretarial assistance of the Committee will be provided b~ARElICAR.

t-I . J.....1.'-.\~2l, \,J5l'v(N. GOP.A: AKRISHNANt

Asstt. Director General (CC)

20

ANNEXURE-II

RESEARCH PAPER PUBLISHED IN CURRENT SCIENCE

RESEARCH COMMUNICATIONS

i. R,jvindran, R. o Mishra. A. K. and Rao. J. R., On the high sera­prt'viI]t'IIC(' of oovin(' babl.'siosis in Wdyanad district of Keralil. J.Appl. Anlm. Res., 2002, 22, 43-48.

8. ~illgh. J., Miranpuri, G. S. and Borkakoly. Incidenc(' of h<lCroato­roa in bovines in nonheaslecn region of Indi.ll.lndion 1. Porosito!.,1978,2,137-138.

9. McLaughlin. G. l. et 01., PeR del£>clion and typing of parasites. InVorosilology (or 1M 11s1 Ct'nlUfY (His OU'I, M. A. and Zia alum,M.), CAD InlMlation",l. Wallingford, t:"K. 1996, pp. 261-277.

10. RilY, D., &lnsal. G. C. and Duua, B., Purification of imroX'rythro·(yllc piroplasms of Thdlulo annu/aro from infE.'<loo bovineblood. Indion J. Anim. Sci., 1998, &8, 1167-1168.

11. Samhrook. J., Fritsch. E. F. and ManLarD, T., Molecular Cloning:1\ Laboratory Manual, Cold Spring Harbor Laboralory, Cold

Sl"ring Hamor, Nf'W York, 1989, vol. 2, PI". 9.16-9.22.12. Bose, R., Jorgensen, W. K., DalgHesh, R. J., Friedhoff, K. T. and

dto Vo~, A. J., C:ulTf'nl slalf' and fulurf' In'fld~ in lhf' diagnosis ofbabf'Slosls. Vrl. Parasitol., 1995,57,61-74.

13. OIF, Rullf'lin df' L'OFFICF Inlemaliooal Of'S EpiUlOlics, Paris,

2000.14. CKcio, S., umma, C, OnUINI, M. and Sf'YMnl, c.. Tlw prubulin

gl!'fl(, 01 Ba~siQ and TlN!i1uia parasites is an infonnalivl' market'"for s(lf'cif's di\criminatinn. Int. J. Parasitol., 2000,30, 1181-11R5.

15. 5hami, U. V. and Kurundkar, V. D., OCcurrtf\c(' of B. bovis (8.argrntino) in a buffalo. Indian Vrl. I., 1981,58,61-63.

16. Gautam, O. P. and Chhabra, M. 0., Babesiosis: RKl!'fl1 .dv"all«('Swilh sp«ial r<'fl."!"cnc(' 10 India. Trap. Vr'. Anim. Sci., 1983, 1,201-207.

17. Mur;JICC'dharoJfl, K., Zlauddin, K. 5., Gopalas'ollamy, K., Mura­It'e'dhar, T. and Seshadri,S. J., Some observations on clinicalcases of &bl!'Sia bovis (Babes, 1988) Slarcovlcl, 1893, In buffa­loes (&balus bubolis}.lndian Vrt. J., 1984,61,76-79.

ACKNOWLEDGEMENTS. Wf' IhaDk Ihe DirK lor, IVRI, Iz.atnagalfor thf' facililie'S prDvidt'd and financial assi$tancl' 10 Ihe first author inIhE' form of Senior Research Fellowship.

Rf'Cf'ivf'l'l 29 January 2007; rl'viwd acceplf'd 24 OclobH 2007

Genetic transformation of an eliteIndian genotype of cotton (Gossypiumhirsutum L.) for insect resistance

I. s. Katageri J, H. M. Vamadevaiahl,

s. S. Udikeri' , B. M. Khadi' andPolumetla A. Kumar3

,.

IAgricul!ural Rf'SE'arch Siallon, Univ~IlYof Agncuhural Sdet'lcf'S,DharwoMl 580 OOC>, hHH,l

lcenual Inslilule for COllon ResE'arch. Nagpur 44{) 010, India

'Naliooal Re'S!.'arch Centre for Plolnt Biolechnology,Indian Agricultural R~earch In$litule, New Ol'lhi 110 012, India

Agfobacterium-mediated genetic transformation of anelite Indian genotype (Bikaneri Nerma) of coUon (Gos­sypium hirsutum L.) was achieved using shoot apicalmeristems isolated from seedlings as explants and a

·Fnr cOfl"f""opondt>ncp. (p·rnilll: polumf'da@holffiail.com)

CURRENT SCIENCE, VOL. 93, NO. 12, 2S DECEMBER 2007

synthetic gene encoding CrylAc 6-endotoxin of Bacillusthuringiensis. Regeneration of shoots was carried outin selection medium containing kanamycin (100 mg/I)after co-cultivation of the explants with Agrobackriumtumefaciens (strain EHA 105). Rooting was accom­plished on a medium containing naphthaleneacerjcacid and kanamycin. Prog~ny obtain~d by s~lfing T.plants was grown in th~ gr~~nbouse and screened forthe presence of neomycin phosphotransferase (nprIl),and crylAc genes by polymerase chain reaction (peR)and Southern hybridization. Expression of CrylAc inthe leaves of the transgenic plants was detected byXpress strips and quantified by Quan-T ELISA kits(DesiGen). Insect bioassays were performed with thelarvae of collon bollworm (He/icoverpa armigera).Field tests of the most promising lines ff2 and T] gen­erations) were performed under contained conditions.Results of the field tests showed considerable potentialof the transgenic cotton for resistance against cottonboUworm.

Keywords: Agrobueterium, genetic transformation, Gos­sypium hirsulUm, insect resistance, shoot apical meriMem.

COTTON is the most important source of naturaJ fibre. Indiais the world's third largest coUon producer. One of themajor limiting factors which affects cotton production inIndia, is the incidence of pests, especially bollworms,causing mOfe than 50% yield 10SSI. The limited geneticvariability for bollworm resistance in cotton landlwildraces makes the task of developing pest-resistant linesdifficult. In the past decade insecticidal proteins of Bacillusthuringiensis (Bt), a Gram-positive soil bacterium, havebeen expressed in cOUon and other crop species by geneticengineering with significant social, environmental andeconomic benefits to the fanners2

• In 2005, Be-cotton ex­pressing CrylAc protein of Be was cultivated in an areaof 20.0 million hectares in more than a dozen countries,including India3

.

Introduction of foreign genes in elite genotypes is limitedby the genotype-specific nature of gene transfer in cotton.Coker genotypes, which are amenable for regeneration inviero by somatic embryogenesis, are widely used in genetictransfonnation experiments·-i

. However, altemate proce­dures to transform non-Coker genotypes have been re­porteda--ll. In the present study, we report successfulintroduction of 8l<rylAc gene in an elite Indian genotypeof cotton follOWing a modified shoot apical meristemprocedure9 and significant protection from cotton boll­worm in field conditions.

Cotton cv. Bikaneri Nerma (Gossypium hirsurum) wasselected becau~e of its high commercial value. BikaneriNerma, which is the female parent of the popular cottonhybrid, NHH-44, is also cultivated as a variety in Punjab,Rajasthan and Haryana.

Seeds were delinted with sulphuric acid and soaked inHgCI, (50 rngll) for 30 min and kept for shaking (50 rpm)

1843

21

RESEARCH COMMUNICATIONS

.... ..• -,0"

... p.""'"

E.."tloRJ 1JM:JI1i

I • I

pBln9t3

Figure I. Reslricllon map of the binary veclOr pBioBIJ carrying truncated codon-modlflt'd Dl­cryJAc gene.

in a rotary shaker. Seeds were rinsed three times withsterile double-distilled water and germinated at 28°e inthe dark for 3 days and later shifted to light and dark(1618 h) rotation to obtain healthy seedlings. Seedlings(7-8-day-old) grown aseptically on MS medium J2

, wereused for isolation of shoot apex. Isolation of shoot apexWilS carried out as described by Gould el 01.

13•

Agrobacrerium cumefacieos (EHA 105) harbouring abin<lry vector (pBinBtJ) was grown overnight at 28°e.The binary vector carries a codon-optimized crylAc genedriven ~y CaMV 3SS promoter (Figure 1). Healthy ShOOI

apices were bisected from apex to base producing twoasymmetrical halves. Both the halves were inoculatedwith A tumefadens dilutell (1 : 20) in virulence inductionmedium (MS medium containing 2.0% glucose, octopine100 mgtl and 100 mM acetosyringone) followed by vacuuminfiltration for 5 min. The explants were incubated on co·cultivation medium (MS medium containing 2 mg/I ofbenzyladenine) for 3 days at 22°C.

After 3 days of co-cultivation, shoots were transferredto shoot growth medium (MS medium containing 100 mg/lmyo-ino!>itol, 0.5 mg/I thiamine HCI, 0.5 mgtl nicotinicacid, 0.5 mg/I pyridoxine HCL and 2% sucrose at pH 5.7)<tnd incubated in diffuse light at 26 ± 2°C for a week, fol­lowed by shifting to selectinn medium (MS medium con­taining SA 0.2 mg/I, cefotoxime 400 mgtl and kanamycin,100 mgfl). Explan15 were sub-cultured on tbe same mediaat an interval of one week. Kanamydn-resistant shoots wereexcised and rooted on MS medium containing 0.1 mgll,NAA, 15 gil ~ucrose and 400 mgll cefotaxime.

Rooted plants were rinsed well with fungicide (bav­is[in, 0.2%) and transferred to pots containing peat, soiland sand in 1: 1 : 1 ratio. Seedlings were covered withpl.astic b.ags .and kept in .a plant growth chamber (65%RH) for two weeks, before shifting to natural conditionsin .a transgenic greenhouse.

Plants were grown in a transgenic greenhouse. Stan­dard method of selfing was followed and seeds harvestedfrom the To plants were sown to raise Tt-TJ generationsin the field.

Genomic DNA!> were iwlated from the plants follow­mg the procedure of Doyle and Doyle14

. PCR analysis wasc.arried out to detect the presence of nptII .and crylAc.Southern hybridization analysis of ffindllJ restricted geno­mic DNA!> wa!> carried OUI using radiolabelled crylAc gene(1.9 kb).

1844

Analysis of crylAc gene expression in the leaves wascarried out using Xpress strips (immunodiagnostic) andQuan-T (ELISA) kits (DesiGen, India), according to themanufacturer's instructions_

Laboratory bioassays were performed using neonateand first instar larvae of H. armigero reared on artificialdiet'S. Plants (fl amI T) generations) were raised in openfield conditions with permission of the Department ofBiotechnology and following their guidelines. Natural in­festation by various pests was allowed by not spraying anyinsecticides. Severe incidence of Helicoverpa armigeraduring 2003-04 (TJ generation) facilitated analysis of theprotection conferred by the expression of CrylAc.

Agrobuclerium-mediated transformation of cotton wasfirst reponed by Firoozabady el 01." and Umbeck et ol.s.Among the genotypes of G. hirsulUm, Coker and Acalagenotypes are amenable for genetic transformation'6 be­cause of their high regeneration potential. Kumar el 01. 17

have attempted to transfer tbe regenerative competencefrom Coker varieties to recalcitrant elite cultivars and de­veloped a Coker 310FR line which coulll be used for gene­tic transformation. The transgene from the Coker 310FRcan then be transferred to elite genotypes by conventionalbreeding. However, this could also lead to introgressionof undesirahle characters from Coker 310FR. Thus trans­formation of elite genotypes is desirable. Successful ef­fons to directly transform elite genotypes by alternatemethods have been reponed.

g•tO Satyavathi el 01. 11 re­

poned genetic transformation of two Indian genotypes ofcotton using shoot apices from 3 to 5-day-old seelliings.In the present study, we attempted to transform an elite In­dian genotype of G. hirsutum by regenerating Agrobacle­rium-treated shoot apical meristems as described byGould et 01.') with minor modific.ations. The modes ofexplant preparation ilnd regeneration differ in these re­pons. In our study the explant was bisected venically andshoot regeneration occurred from the shoot apical meris­tern. The transformation efficiency was very low (0.2%)in contrast to 60-70% reponed earlierlO

• Transformationeffidency was calculated based on pbysical presence ofthe tran!'.gene a!> analy!'.ed by peR and its expression byELISA and not on the number of kanamycin-resistantshoots.

The shoot apex explantl; infected with Agrobacleriumand incubated on the selection medium gave rise toshoots in four weeks. The explants gave rise to lIark cal-

CURRENT SCIENCE, VOL. 93, NO. 12, 25 DECEMBER 2007

RESEARCH COMMUNICATrONS

T,)ble 1. PlanlSSubjft:led to various analYlicallesls

T. T, T, T1 (Tl.11)

Analysis Tesled Tested Tested Tested

Kanamycin test 79 '4peR (nptlI) 7' 12lICK (cryJAc) 79 12 '65 46 4S (Tl-a) 45 136 136

41 (Tl-lI) 41

Xpress snip lest 79 12 '65 46 170 (Tl..4) 170 917 917182 (n-II) 18'

Quan-T ELISA 79 12 46 4. 45 (Tl-4) 45 97 9741 (Tl·ll) 41

SoUlhl"rn analysis 8 ,

Table 2. Jnsen bioiSsays performed wilh waves of normal and T, generatiOn plants of Biuneri Nt'fma(ON) using firsl instilr larvnat He/{cowrpo armigera

No. of larvae died

Genotype' No. of ft'plic.alions" 24h 48b 72b CorrKted mol1alilY

HI-BN (Tl-4) 50 1 , 47 SODI-DN (Tl-II) 50 , , 46 84NBt-BN 50 1 , , 0

.One repliullon mt>ans one la..... a feediog on the leaf disc of the St'lecled plam.

figure 2. Soulh"ll} hybt"l(huliun <illd!})I) o( gl'1l0m1C DNAs re­S1rictE.'d by HindllJ and probed by radiolabellt'd crylAc (C. Control:1-8,lransformanls).

luses from which the shoots developed. Shoot growth wasslow and the kanamycin-resistant shoots were excisedand pl",ced on rooting medium after three months. Sev­enty-nine independent transformed Jines (To) of BikaneriNenna cotton were thus selected from 6520 shoot apexexplanL"i in the presence of kanamycin The leaf slices

C~RRENT SCiENCE, VOL. 93, NO. 12, 2S DECEMBER 2007

from the putative transformants remained green when in­cubated on medium containing kanamycin (100 mgll).Analysis by PCR to detect the presence of nplII andcrylAc genes showed that twelve plants were positive(data not shown). However. these plants were chimeric innature. The results were supported by observations madeusing Xpress immuntxliagnostic strips and Quan-T ELISA.The transfonnation frequency is thus very low (0.2%).The positive plants were carefully nurtured in the glass­house and seeds were collected from the bolls set fromthe selfe<! flowers.

Various procedures followed to analyse the plants be­longing to To through T) generations have been listed inTable 1. T1 generation progeny (265) of the twelve PCR·positive plants were raised in the transgenic greenhouseand subjected to various analyses. About 22 seeds fromeach To plant were planted. PCR and Xpress strip testS re­vealed gene segregation in T I generation; only 46 plantsout of 256 showed positive results in PCR (crylAc prim­ers) and XPrP"iS strip test. Southem hybridization wasperformed with samples taken from eight out of 46 PCR­positive plants, which belonged to different To lines. Theresults showed that there were clear hybridization signalsin only two samples (nos 4 and 6) and the copy numbervaried from one to two in the transfonned plants (Figure 2).Although the other six plants were po!>itive in PCR i:lndimmunological tests, no hybridization Signals were de­teeted in the Southern analysis. T1 plants originating fromtwo To events (T1-4 and Tl-l1) corresponding to South­ern-positive plants and exhibiting high CrylAc content

1845

RESEARCH COMMUNICATIONS

T~ble 3. Insect blooiSsay peorformt'd .... ith INV('S of normal and TJ geDt'falioo planlS (n-ll) of B1k..ln«i Nerma using firS( iostarlan.·;w>- 01 H. ormigtra

lnitlall.arv.ll Pl.'t" (('nt Larval Per (('01 Idrv.) Per cent pup.ll urv.1 wi (mg) PU)J'j1

GenOlY~ WI (mg) survival 10 pupation survival 10 adults survival 10 aduhs befOft' pupation WI (mg)

BN-8f (Tl- t 1) 1.20 0.0 0.0 0.0 0.0 0.0

J:\N·NBr 1.40 84.50 79.10 82.0 159.0 89.2

MECH·162 & 1.35 0.0 0.0 0.0 0.0 0.0

Artificial eliel 1.31 90.10 84.50 86,5fl 169.50 110.35

CD(l%) NS 8.01 8.43 10.11 6.93 9.96

CV 6.91 4.47 4.93 8.06 9.29 6.15

-Fihy rep)julklns. each rt>pn>sroling one larva feeding on the leaf disc of the selected plant. WI, Weight.

T ..ble 4. Economic characteristics of nornYl and some SE'leclNl transgenic. Bikaneri Nermaplants (T1·II: TI gt'~ralion) grown in the field

Plant nurnbt'r Sffd coltan TOlal number of No. of squaresl

(code) (gJplam) fruiting points bolls sh<."d Shedding %

698 740 139 47 33.8

692 695 211 63 29.8

643 555 187 63 33.7

70S 565 192 64 33.3465 S28 185 53 28.6

396 465 157 36 22.9400 450 142 35 24.6459 475 161 52 32.2468 478 183 56 30.6623 451 179 5' 28.4

638 422 140 50 35.7

656 462 '64 66 40.2

658 479 509 52 24.9OW 468 185 54 29.1675 478 192 71 37.0695 428 164 62 37.8746 430 214 64 30.0

M". 50S 194 55 31.3Non-Bc(mean of 30 plants) 65 166 148 88.0

(2' Ilg/g FW) and inse(..1 prolection (Table 2) were chosenand selfed. T1 plants (13,136) were grown in the field andvarious analyses were conducted. Plants in the T2 genera­tion (rapidly expanding leaves at SO days after planting)showed high levels of Cry1Ac protein expression asmeasured by Quan-T ELISA (1.59 to 2.46 f'glg FW). Incomparison, the levels of CrylAc protein in Mech 162 Btranged rrom 1.04 to 1.82 f'g/g FW.

T) progeny of the T2 plant (T1-11) was used for insectbioassay. Insect bioassays with first instar larvae of H.armigero on leaves collected from 45 to 55-daYo.Qld plantsrevealed high degree of larval mortality in T) generation,similar to that observed with the leaves of a commercialhybrid MECH-162 Bt (Table 3). Further, PCR aod Quan­T ELISA analyses of T) generation plants showed thepresence of crylAc gene, which indicated that the T1wllline was homozygous (Table 1). Southern analysis of fiveplants of T4 generdtion (T-1-11) was carried out and allthe five plants tested positive, indicating the homozygosity

1846

(Figure 3). Observations on morphological characters,seed cotton yield per plant, boll damage and boll shed­ding due to natural H. armigera infestation of plants (T)generation) raised under unprotected condition were made.The results are presented in Table 4. The mean seed cot­ton yield of B[-BN homozygous plants was 50S glplant asagaiost 65 glplant of NBI-BN. The pet ceDt boll sbeddingamong B[-BN plants was 31.3, while in NB[-BN plants itwas 88 per cent. The number of well-developed but dam­aged bolls due to pink bollworm in B[-BN was 1-2 perplant as against 8-11 in NB[-BN. Fibre parameters suchas micronaire value, elongation, maturity ratio and tenac­ity were measured in both normal and transgenic plants.There were no differences among the nonnal and trans­genic fibres (data not shown).

The results have shown that Cry1Ac protein in the twotransgenic lines of Bikaneli Nerma was expressed at lev­els higher than that observed in the commercially avail­able MECH-162 hybrid. It is important to achieve high

CURRENT SCIENCE. VOL. 93, NO. 12,25 DECEMBER 2007

2.4

MkB

IG.O

u

7.0

6.0

Sot

Hgur~ 3. Soulh~1l hybcidiLllion analysis of gl:'llomk DNAs of BI·k.:lneri Ncrm<l (Normal and T-4) f('strietro by HlndlJl and probed byradiolabel1ed crylAc ( ...e, Positive control; -e, Normal (allan; 1-5,Transgenic plants).

levels of Cry lAc expression in cotton tissues. especiallyterminal leaves, so as to maintain lethal levels of thetoxin during boll development. Greenplate18 has carriedout extensive analysis of CI'YIAc protein concentration inBt cotton tissues and observed that the toxin levels declinesteadily as the growing season progresses. The high lev­els of CrylAc observed in our study could be attributedto the truncated nature of the expressed toxin, while thehybrids derived from the transformation event 531 (Mon­samo Co., USA) express the CrylAc protoxin11

•

The results also demonstrated that it is possible totransform elite Indian genotypes of cotton (G. hirsutum)by adopting Agrooocter;um-sboot apex technique whichhas been successfully employed earlier in couon, sun­flower and maizeU

l.19. The degree of insect protectionconferred by the expression of Cryl Ac protein in trans­formed Bikaneri Nerma was significant Development ofa Bt-couon hybrid (NHH-44) by utilizing transgenic Bi­kaneri Nerma, which is the female parent, is in progress.

1. Atwal. G. 5., InSU:l Pnts of Indio and Soulh Easl Asia. KalyaniPublishers, New Delbi. 1976.

2. Kumar. P. A., Insect pest-resislaol Iransgenic ClOps. In Advonusin Microbial r.ontrol of InseCT Pes-rs (ed. l"padby.llY, R. K.), Klu­.....er ACiuwmlc, Ne.... York. 2003, pp. 71~2.

3. James, C., Global SeQIUS of Commercioliud GM Crops. ISAAA,Ithaca, 2006. Brid 34.

4. Flrooz.abady, E.• Deboer. D. L., Merlo. D. J., Halk, E. L, Amer­son, L. N., Rashka. K. E. and Murray. E. E., Transrormation 01cotton (Gossypium hirsutum L.) by Agrobactl!rium tumtfocitns

CURRENT SCIENCE. VOL. 93, NO. 12, 2S DECEMBER 2007

RESEARCH COMMUNICAnONS

and regene'l"ation of transgenic planls. Planl Mol. BioI., 1987. 10,IDS--U6.

5. embed, P., Johson. G., Barton, K. .lind S.....ain. W.• wneticallytransformed carton (Gossypium hin'urllm L) planls. BioITl!chnOo­logy, 1987,5,263-265.

6. Finer, J. J• .lind McMullen, M. D., Transformation of conan (Gos­SypiliM hirsullim l.) vi.ll parlicle bombardment. Plant ~fl Rep.,

1990,8. S86-S89.7. Chaudhary, B., Kumar,S., Prasad, K. V. S. K., Oio.am, G. 5.,

Bunna, P. K. and Pental. D., Slow desiculion Ie-ads 10 high­frequency shoot recovery from transformed somatic embryos ofC(ll1on (Gossypium hir.lllwm L cv Cokt"f 110 FR) Planl CdlRep., 2004, 21. 955-960.

8. McCabe, D. E. aod Martinell, B. J., Tr.llnsformalion of elile conancultivars via panicle bombardfD('nt 01 mffistems. BiolT«hnology.1993, 11, 596-598.

9. Gould, J. H. aDd MagalJanes..cedeno, M., ~dapralion of CaROnshoot apex CulIUrE" tCl Agrobartl"rum-medialed transformalion.Plam Mol. Bioi. Rl!p., 1998, 16, i-IO.

lO. Zapala, C., Park. 5. 11., EI-Zik, K. M. and Smith, R. II., Transfor­mation of a Texas callan culrivar by using AgroboCTerlim andshoot apex. Thf'or. Appl. Celll!t.• 1999,98,252-256.

11. 5alyavalhi, V. V., Prasad. V., Gila Lakshmi, B. and Laksmi Sila.G., High efficiency Iransformalion prolocol for Ihref' Indian conanvarielies via Agrobocterium fIImefacll!ns. Plan! Sci., 2002. 162,215-223.

12. Murashige, T. and Skoog. F., A revised medium for rapid gro....·thof and bioassays with lobacco 1is.'1ul" C"uhures. Plry..io/. Plan I..

1962. IS, 473-497.13. Gould. J., Banister,S., Hasegawa, 0., Fahima, M. and Smith.

R. H., Regeneration of Gossypillm h;rsulUm and G. baroodensl!from shoOl-a~Jltissues for transformarion. Plant ull Rep., 1991.

10,35-38.14. Doyle. J. J. and Doyle, J. I., lsolation of plant DNA from fresh tis­

sue. Focus, 1990, 12, 13-15.15. Chakrabarti, S. K., Mandaokar, A. J., Kllmar, P. A. and Shann,}.

R. P.. Toxicity of lepidopteran specific delta endotoxins of &eO­Ius lhuringiensis lowalds neonate lafV;l(' of Helicoverpo ormi9f'ro.J.lnvenebr. Palhol., 1998.72,336-337.

16. Rajasekarao, K., Otlan, C. A. and Clneland, T. E., Tissue cultureand genetic lransformation of COtloo. In GeMtiC Improvement ofCollon (eds lenkins, J. N. ~nd Saha, S.), Science Publishers, Eo~

field. 2001, pp. 269-290.17. Kumar, S., Shann.J, P. and Peotal, D., A genetic approach 10 in

vivo regene'l"alion of non-regeflft"ating ennon cultivan'. Plant Cl!1IRep., 1998. 18,59-63.

18. Greenplate. J. T., Quantiflutioo of &eillus thllringiensis illSKtconlrol prolein Cry1Ac avec time in Bollgarq cotton fruit and I('C"­minals. J. Econ. Enromol., 1999.92, 1377-1383.

19. 5cbrammeijer, B., Sljmons, P. c., Van den Elun, P. J. M. andHoekema, A., MerisU"m transfonnalioo of sunflowC!'/" vw Agroboc·tuillm. Plan! ull Rep., 1990,24, 9S1-9S4.

ACKNOWLEDGEMENTS. We ~re grateful to Ihe Nalional Agricul­tural Technology ProjK.t of the Iodian Couoc.i1 of Agricultural Res­earcb for finandaI support aDd Dr K. R. Koundal, Project Dirp<lor ~odMission Leade'l". NRCPB, IARI, Ne..... Delhi for l'flcouragemenl. Theseniol .lIuthor tbanks Dr Jean Gould, TexIS A&M university, eSA, forproviding training iu gl"lll'lic transformation of COtlOD.

Received 25 January 2006; revised accepted 8 October 2007

1847

1.5

ANNEXURE-III-A

Discussion with Drs. I.S. Katageri, B.M. Khadi, S.S. Udikeri and H.M.Vamadevaiah on March 23, 2012

2. In your opinion what is the order of these institutions on the basis of theircontribution in the development ofBikaneri Nerma Bt (BN Bt) and 'Bt NHH 44'?

1. NRCPB, New Delhi2. UAS, Dharwad3. CICR, Nagpur.

3. What was the seed source ofBN that was used for transformation?

--

--

-

I.

4.

How was the work on the development of 'BN Bt' cotton divided among the threeinstitutions, namely NRCPB, VAS and CICR?

a) NRCPB, New Delhi:(Lead centre NATP Project)(i) Providing gene construct for genetic transformation, conducting

gene integration studies through PCR and southern and othermolecularjmalysis.

(iI) Providing required information on gene construct and molecularanalysis information to RCGM and GEAC for approval.

(iii)Coordination and monitoring the NATP project in terms oftechnicaland financial aspect as a lead centre.

b) UAS, Dharwad: (Cooperating centre ofNATP Project)(i) Genetic transformation(iI) Screening and advancement of transgenic material based on ELISA

and PCR results from CICR, Nagpur and NRCPB, New Delhi.(iiI') Providing transgenic seed material for conduct of RCGM, GEAC,

Environmental safety and Biosafety trials(Iv) Seed production and Supply

c) CICR, Nagpnr: (Cooperating centre of NATP Project)(i) Time to time conduct ofELISA and PCR tests of transgenic material.(iI) Conduct ofenvironmental safety studies of Bt cotton;(iii) Facilitating to conduct biosafety studies through outsourcing.(Iv) Making application to RCGM, GEAC and PPV and FR.(v) Procurement, packing and distribution of Bt seeds received from

UAS, Dharwad.

BN seed material was obtained from CRS, Nanded of MAU, Parabhani forgelletic transformation studies.How can you explain the morphological differences in BN Bt and non-Bt BN aspresented in PPV & FR application?

The application was made by the Director, CICR, Nagpur and theinformation is available iu the Directorate, CICR, Nagpur only.

-

5. Was the BN used different from F 414?

Not aware ofcharacteristics ofF 414.6. Was there any variability in morphological traits of the BN used for

transformation?

At the time of transformation studies, morpbological traits were not

ascertained. However, available BN seeds possess variations for pollencolour.

7. When, where and how the different generations ofBN Bt were raised? &8. What was the approximate area, number of plants I progenies grown and selected

in different generations in your experiment during different years?

Generation wise seed mnltiplication in BNBt

Year Gene- Population sizeration

2001-02 To 79 plants in transgenic green house.

2002-03 T. Twelve progenies were grown in 84 rows each with differentnumbers of rows depending on availability of seeds. Each rowwas 6 m length. There was no germination for one progeny.

2003-04 T2 Only eleven progenies were continued, each with 25 rows.

2004-05 T3 917 plants of AT1 8-10 based on single copy introgression ofsouthern analysis were sown in open field under isolation. SeedsofBt positive plants were used for RCGM trial during 2005-06.

2005-06 T4 78 plants selected as homozygous based on Bt strip test weresown each aboutl5 rows under isolation in an open field. Seedsof Bt positive plants based on Bt strip test were used for RCGMtrial in 2006-07.

2006-07 Ts Progenies of 25 homozygous (Based on Bangalore Genie report)plants were raised in open field under isolation.

2007-08 T6 Progenies of25 plants were raised in open field under isolation.

2008-09 T7 Bulk seeds of homozygous plants were used in seed production atdifferent farms ofUAS, Dharwad under isolation.

2009-10 Ts Bulk seeds were grown at ARS, Dharwad

9. During the development of BN Bt, was there any trial at that Agric. ResearchStation having Bt cotton carrying 'MON 53 I ' event?

From 2002-03 itself tbe Bt cotton with Mon S31testing trials were taken up atARS, Dharwad regularly.

10. How much was the approximate area and number of plants I progenies under suchBt cotton (MON 531) at that Research Station farm during different years?

-

-

•

-

AreaBt

trialsARS,

Year Breeding Entomology Pathology Total

(in acres) (in acres) (in acres) (in acres)

2002-03 0.5 0.25 0.25 1.0

2003-04 2.0 1.0 1.0 4.0

2004-05 2.5 1.25 1.25 5.0

2005-06 2.0 1.0 1.0 4.0

2006-07 2.5 1.25 1.25 5.0

2007-08 2.5 1.25 1.25 5.0

2008-09 3.0 1.5 2.5 7.0

2009-10 1.0 1.0 2.5 4.5

2010-11 2.5 1.25 3.0 6.7

2011-12 1.0 0.5 3.0 4.5

Dharwad

undercotton

at

Details of Bt cotton sponsored trials (breedin!!:) at ARS, Dharwad from 2002 to 2010

No. of Plot Spacing ApproximSeason Repn. Rows D.S. ateEntries size (cmxcm)

Area

28

No. of Plot SpacingApproxim

SeasonEntries

Repn. Rowssize (cmxcm)

D.S. ateArea

2002-03 8 3 6 6m 90x40 01-06-02 ~ac

2003-04 19+1 2+2 6 6m 90x60 30-06-032003-04 7+1 3+3 6 6m 90x60 30-06-03

2 acHB2003-04 9+1 3+3 6 5.4 m 90x60 16-07-032004-05 16 2 6 6m 90x60 7-07-042004-05 9 3 6 6m 90x60 9-7-042004-05 9 3 6 6m 90x60 10-7-04 2 Y, ac

HB2004-05 37+3 3 3 6m 90x60 19-6-042005-06 10+4 3 6 6m 90x60 26-6-05

2005-06 29+1 3 3 6m 90x60 26-6-052 ac

2005-06 1+3 5 4 6m 90x60 26-6-05HB

2005-06 10 3 5 6m 90x60 6-7-0)2006-07 24 3 6 6m 90x60 4-7-062006-07 10 3 6 6m 90x60 4-7-062006-07 8 3 6 6m 90x60 4-7-06

HB2006-07 12 3 6 6m 90x60 4-7-06 2 Y, acRCGM2006-07 18+2 3 6 6m 90x60 12-7-062006-07 11+1 3 6 6m 90x60 12-7-062006-07 8 3 4 6m 90x60 13-7-06

2006-07 7 3 4 4.8 m 90x60 3-8-062007-08 12 2 6 7.2 m 90x60 7-7-072007-08 26 3 6 6m 90x60 2-7-072007-08 26 3 6 6m 90x60 2-7-072007-08 II 3 6 6m 90x60 2-7-07

2 Y, ac2007-08 7+1 3 6 6m 120x60 2-7-07

HB2007-08 II +1 3 6 6m 120x60 2-7-07

HB2008-09 20+2 3 6 6m 90x60 12-7-082008-09 18+2 3 6 6m 90x60 12-7-082008-09 23+1 3 6 6m 90x60 12-7-08

HB2008-09 4+2 4 6 6m 90x60 12-7-08

HB 3 ac2008-09 20 3 4 6m 90x60 12-7-08

HB2008-09 6 4 6 6m 90x60 12-7-08

HB2008-09 35+1 3 6 6m 90x60 24-7-08

HB

-

-

-

2008-09 35+1 3 6 6m 90x60 24-7-08HB

2008-09 5+2 3 6 6m 90x60 24-7-08HB

2009-10 25+3 3 6 6m 90x60 18-6-09 I ac2010-11 14 3 6 6m 90x60 4-7-102010-11 4 5 6 6m 120x60 4-7-10

HB2 Y, ac

2010-11 II +1 3 6 6m 90x60 4-7-102010-11 15+1 3 6 6m 90x60 4-7-102010-11 6+2 3 6 6m 120x60 5-7-102011-12 24 3 6 6m 90x60 23-6-11 I ae.

II. Were your experimental material in different generations grown in a plot having therequired isolation, i.e., 50 m?

All experimental material in different generations were grown with a minimumisolation distance of 50M.

12. Was there any possibility of contamination of your material with MON 531 eventduring the advancement of generations?

A minimum of 50M isolation distance was maintained in all the generationsbetween BN Bt and Mon 531 experiments. However, the possibility ofcontamination may not be ruled out due to the activity of honey bees nearvicinity, handling of material by labourers I field assistants during harvesting,storing, ginning, cleaning etc.

13. How did you select the material for advancement of generation? On the basis ofpresence of your event or on the basis ofexpression of Cry protein?

Advancement of generations was made as follows:To- TI - Tz: Based on expression of Cry 1 Ac.Tz- T]: Based on PCR and southern.T] - T4 : Based on expression of CrylAc (Bt strip test)T4 - T5 : Based on expression of CrylAc (Bt strip test) and Homozygosity test

report of Bangalore Genie Private Ltd., Bangalore.Ts - Ts: : Based on expression of Cry1Ac (Bt strip test)Ts - Ts: Seed production, not carried out any tests.

14 In your opinion, was there any deficiency in follow up of procedure in course ofdevelopment of BN Bt?

There was n't any deficiency in transformation methodology hut the procedureto differentiate between BN Bt event and Mon 531 event was not known to us.

15. Was there any methodology available during that period to differentiate eventsMON 531 and BNLA 60 I (BN Bt event)?

No methodology to differentiate different events of CrylAc was known to us atthat juncture.

16. Which institution identified MIs Awasthagen for outsourcing and who signed the

"30

agreement?

Dr. Anand Kumar, Director, NRCPB, New Delhi suggested to outsource foranalysis of flanking sequences of BN Bt event through MIs Avesthagen. Orderwas placed from CICR, Nagpur.

17. Was the information supplied by MIs Awasthagen regarding flanking sequence,event specific primers of BNLA 601 event etc., correct and working?

Test not carried out at Dharwad and report was sent to Dr. Anand Kumar,Director, NRCPB, New Delhi.

18. When did you know that the infonnation supplied by MIs Awasthagen was not correct?

Came to know only after the complete molecular analysis of purified BN Bt hyDr. Anand Kumar in October, 2011.

3\

-

---

--

---

-

-

19. What were the steps taken to rectifY the procedure in the development of BNLA 60 Ievent after knowing that the information supplied by MIs Awasthagen is notcorrect?

Dr. Anand Kumar identified new flanking sequences of BNLA601 eventthrough molecular analysis.

20. Was the non-Bt BN check in different RCGMlGEAC trials same or different fromthat of BN used for transformation?

The quantity of non BN Bt seed was limited, hence, seeds of other sources wasalso used as check in RCGM and GEAC trials.

21. Dr BM Khadi, When did you carry BN Bt materials from UAS, Dharwad to CICR,Nagpur? Please specify the generation and quantity of the material. Did you carryonly this material or some other material also? What was done with this material atCICR?

The BN Bt material of about 35-40 seeds was obtained from VAS, Dharwad.This material was of 2004-05 produce (f3). This material was used to comparewith CICR transgenic material at CICR, Nagpur.

22. Dr Khadi, was the breeding work shifted to CICR Nagpur from UAS, Dharwadafter your joining at CICR?

No Sir, the conversion of elite varieties and parental lines ofUAS and State wascontinued at UAS, Dharwad. And conversion of nationally important varietiesand parental lines of hyhrids was initiated and continued at CICR, Nagpur.

23. Dr Khadi, do you think, there was contamination or something else happened?Where and when there was possibility of contamination? Please be specific aboutthe time when you came to know about contamination?

Yes Sir, I believe it is only due to contamination. I really don't know whethercontamination was intentional or natural. The contamination must haveoccurred at Dharwad. It is rather difficult to specify the time of contamination.I was informed about the contamination 2-3 months before the DDG(CS)meeting (Dec, 2009), and immediately this was brought to the notice of theconcerned scientists.

24. Dr Khadi, did Dr. K.R. Kranthi inform you about contamination? If yes, when?

Yes Sir, Dr Kranti informed, which may be 2-3 months before the DDG(CS)meeting held during Dec, 2009.

25. Dr Khadi, in the documents supplied to us it is stated again and again that DrKranthi informed you about the presence of Mon 531 during 2005 and 2008?

No Sir, if it was informed about Mon 531 contamination, I would not haveproceeded to promote and would have stopped immediately at that juncture.

26. Dr Katageri, did any other scientist help you or you alone looked after the work atUAS throug/!out?

Until 2004-05, work was monitored by Dr. B.M. Khadi who was CCPI of theproject. Dr. H.M. Vamadevaiah and Dr. S.S. Udikeri were also helping as theywere associates of this project. Field assistants, SRF's, Skilled helpers andlabourers were helping in various field and laboratory work. In 2005-06,

32-

sowing was done in my presence and selfing was also done until I was there. Iwas relieved on 27th sept, 2005 and returned on 4th April, 2006. During thisperiod I handed over the charge to Dr S.S.Patil(Principal Scientist(Cotton) andHead), ARS Dharwad as per the University order(No.AOlEst-III/886.C/0S-06dated 21-9-2005). I handed over the details of the material, list of operationsand observations to be taken. Further with office order No.PS©IEST/4691200S­06 dated 27th Sept 2005 Dr. Manjula MaraIappanavar (Assst Cytogenetist) wasasked to look after the Bt cotton work. From April 2006, I continued handlingthe material with the help of others.

27. So Dr Katageri, you went to the USA for training from October 2005 to ApriI2006?

Sir, I went to Texas A & M University, USA from Aug, 2000 to Nov, 2000 fortraining under Dr. Jean Gold on apical metistem genetic transformationtechnique. From Oct 2005 to April 2006, I went to UK on Common wealthacademic staff fellowship.

28. When does cotton flower and is harvested at Dharwad ?

Flowering starts in August (If sown during June) and September (If sown inJuly) flowering continues until harvest or as long as sufficient moistureavailable in the soil Harvesting will be generally completed by Feb-March, forthe crop sown during Juue-July.

29. Is it easy to detect segregation for petal colour?

Yes Sir, It is easy to detect petal colour segregation.30. What is the petal colour ofBN and BN Bt?

As per the seed production guideHnes for NHH-44 cotton hybrid, the petalcolour of BN is cream and petal colour of BNDt is also cream.

31. Did anyone of you notice segregation in petal colour, anther colour, plant height,susceptibility to sucking pests in different generations and seed production plots ofboth BN Bt for its use as a variety and parent of the hybrid till2008?

No variations. with respect to petal and pollen colonr and plant height werenoticed. However, Dr. B.M.Kbadi Director, CICR, Nagpur after his visit toSurat, suggested to observe for any variations in poDen colour. After criticalobservations presence of plants having cream petal with yellow pollen and fewplants having cream petal with cream pollen were also observed. Thereforeplants having cream petal with cream pollen were discarded.

32. Dr Katageri, if something went wronglhappened T:YT. generation, then why was itnot detected during the advancement of generations up to Ts and seed productionplots before commercialization?

I was not aware of anything wrong that happened in BN Bt event until 2009.

33. How (we mean by open pollination in isolation or by selfing) and where did youproduce seed of'BN Bt' during 2008?

BN Bt seed was produced in different research stations belonging to UAS,Dharwad under 50 M of isolation during 2008.

-

-------

...

--

-

34. What was done to the seeds of BN Bt received from CICR during 2008?

It was not used in further any other programmes.35. Did any of your other colleagues/collaborators/test centres inform UAS/CICR about

variation for petal colour before commercialization?

Director, CICR,Nagpur on his visit to Surat, received feedback on variation inpollen colour and the same was communicated to Dr. I.S.Katagei.

36. Did you get information about segregation for other traits beforecommercialisation?

The BN Bt variety was uniform with respect to all other characters evenincluding petal colour. However, few plants having cream pollen instead ofyellow were observed.

37. Dr Khadi, so you got input about variation from your collaborators/test centres atSurat, what action/corrective measures did you take?

During my visit to Cotton Research Centre, Surat, Scientist informed me aboutvariations in pollen colour and the same was informed to Dr. Katageri forfurther needful.

38. Dr Kartageri, please explain in details the corrective measures yon took?

No variations with respect to petal and pollen colour and plant height werenoticed. However Dr B.M.Khadi Director, CICR,Nagpur suggested to observefor any variations in pollen colour. After critical observations presence ofplants having cream petal with yellow pollen and few plants having creampetal with cream pollen were also observed. Therefore plants having creampetal with cream pollen were roughed out.

39. Should not one have grown plant-to-progeny testing to clean up the material?

Plant to progeny row was followed for maintaining the uniformity.

40. Why was commercial seed production taken without taking any proper correctivemeasures (growing plant-ta-progeny)?

Plant to progeny rows were also maintained with no variations for plant heightand petal colour.

41. When did you come to know about contamination of BN Bt with MON 531 event?

Dr. Anand Kumar Director NRCPB New Delhi informed in Aug, 2009 aboutthe presence of Mon-531 based on his field sample survey.

42. When talking about purification, when did you identify the plants carrying BNLA60 I event and how?

It was possible to identify BN Bt plants not carrying Mon-531 in Jan, 2010.The plants were identified based on PCR test, by using Mon 531 specificprimers. The plants which did not show presence of Mon 531 were tested withprimers designed for Cry 1 Ac. The plants negative for Mon 531 and positivefor Cry lAc specific were identified.

34

-

43. Details of number of seeds/plants tested, their generation, and the results of thetests, i.e., how many plant were +ve for both MON 531 and BN Bt, +ve for MON531 and -ve for BN Bt, -ve for MON 531 and +ve for BN Bt, and -ve for both?

The details of PCR test carried out is mentioned in the table belowYear

No. of plants Mon 531 Cry lAcof GenerationTestine: screened + - + -

2009 Tg(Standing crop) ) 587 587 0 587 0

2010 T6(plants raised from old seeds 135* 130 5** 135 -of 2007(T5) produce of fiveprogenies with multiple Bttypes)

-

---

,10-10-09 74 25-10-091 75 11-11-09\

112-10-09 32 . 26-1 0-09 ! 20 ! 11-11-091

* Only 135 old seeds germmated out 0[6200 sown** cryJAc positive but negative[or Mon 531

Details ofPCR conducted at ARS, Dharwad during.l!!1rific;:;ati"'·o"=n'-r _

I Date B Date R Date B.- D.~!.~JsamPI' Date B117-08-091 04 115-10-091 08 !29-10-091 10 !14--11-091 12 1 10-02-101 24 1

i24-08-09jjD 20-10-09l~ 02-11-09 0~~~.~~~:~~9j 08 i14--02-10 i 03 i108-09-09! 18 123-1O-09! 75 ! 05-11-091 15 !17-11-09! 12 I 24--02-10 I 22 i

125-08-091~24-10-09fj ~1109 t-01~·8~·!:~:~EI12-03-1013105-10-09: 48 125-10-091 23 ! 10-11-091 49 :23-11-09: 03 : 23-03-10: 28 i

~:~~1~~~:~:~~ 07 . 25-03-10 03'

, i. ! I ! 29 128-01-101 32 1 19-04--101

20 .

114-10-09026-10-09\ 05113-11-09[!2·E?~?~~i:~ 04 119-04-10 I 04 I44. How many plants were selected from that T3 materials?

It was not theT3 plants used for purifICation but for purification, Ts generationfield grown plants and Ts generation old seed material were used.

45. How many TJ plants with multicopies were raised during 2oo9? What was thesegregation pattern for MON 531 and BNLA 601?

Progenies of five multiple Bt plants of 2007 produce was screened by raising in2010. Since germination was poor, segregation pattern was not noted; howeverMon 531 negetive but with cry lAc positive plants were identified.

46. Did Mabyco-Monsanto approach UAS, Dharwad or CICR, Nagpur to complainabout the presence ofMON 531?

Mahyco - Monsanto did not approach or complain UAS, Dharwad about thepresence ofMon - 531.

35

47. Who prepared the application for submission to RCGM and GEAC?

Applications to RCGM and GEAC were prepared by CICR, Nagpur.

48. Why the application was submitted to RCGM and GEAC without carrying out allthe required tests and purification of BN Bt?

At tbe time of making applications for RCGMlGEAC, the problem ofcontamination was not known.

49. Was th'e gene construct used to develop BN Bt was developed by NRCPB, NewDelhi or obtained from some other source?

Gene construct was supplied by NRCPB, IARI, New Delhi.

50. We understand that the construct was obtained from Prof. IIIimar Altosaar. Whythat was not acknowledge in 'Current Science' paper on BNLA 60 Ievent?

The crylAc gene construct was received form NRCPB, New Delhi

51. Where, when and by whom the work of transfer of BNLA 60 I event to genotypesother than BN was undertaken?

Transfer of BNLA601 event was intiated from 2005-06 at CICR, Nagpur underthe supervision of Dr(Smt) Sumanbala Singh. Similarly same activity wasinitiated at VAS, Dharwad during 2006-07 under the supervision of DrI.S.Katageri.

52. What is the fate of above materials? &53. So, those are also positive for MaN 531?

About 587 plants of BN Bt tested during 2009 were found Mon53! positive. Asthe same material was used in back c~ss breeding programme, all tbe materialgenerated seems to be Mon 531 positive.

54. It is stated in a meeting held under chairmanship of DOG (CS) on May 21, 2008that "The chairman pointed out that Dr Kranthi was an entomologist and thereforethe results should not be taken seriously. He also asked Dr Kranthi not to carry outany further molecular testing of the samples and only to carry forward thecommercialization process with full zeal, adhering to all instructions laid out in theproceeding"

Dr Khadi, you attended this meeting? What do you remember about this meeting?

Yes Sir, No Such statements were made by DDG(CS), The road map forcommercialisation of BN Bt was discussed in the meeting.

Other collegues: You also attended this meeting, what do you remember about thismeeting?

To the best of our knowledge and remembrance, no such statements weremade by DDG(CS), ICAR, New Delhi in that meeting.

55. Dr Khadi, you said that you did not get any information on the presence of MaN531 event in your material, i.e., BN Bt before the meeting held on Dec 10,2009.Your comment on the light of above statement in the meeting held on May 21,2008.

If I remember correctly, I came to know about contamination 2-3 monthsbefore the Dec, 2009 meeting called by DDG(CS).

56. Did Dr Kranthi mention in that meeting about the problem of presence ofMaN 531in BNBt?

Presence of Mon 531 in BN Bt was mentioned in the Dec:, 2009 meeting by DrKranthi

57. How was the performance ofBN Bt in seed production plots?

Performance of BN Bt in seed prodnction plots at different research stations ofUAS, Dharwad was satisfactory.

58. Was the seed production suspended due to segregation or presence of MaN 531?

In the meeting held on 10-12-2009 at NRCB, New Delhi under thechairmanship of DDG(CS), the seed production of BN Bt was suspended due tothe presence of Mon 531.

59. Did you visit the seed production plots ofMAHABEEJ? What was the report aboutsegregation? Please make available the reports submitted to UAS/CICR.

A team of Scientists constituted by UAS, Dharwad along with Scientists ofCICR, Nagpur visited and submitted detailed report(copy of report endosed)

60. Did you receive any complaint about segregation from indenters other thanMAHABEEJ? Did you visit the plots ofother indenters?There were no complaints from others.

61. Do you know Dr Manssor and Dr Surendra?

Yes Sir, We know both ofthem, who are working in the university.

62. Do they have any clash of interest with you?

We do not have any dash of interest with them and We have never come doserto them so far.

63. Once again, did you carry out any test on the presence or absence of cry lAc andMaN 531 and BNLA 60I; and if not why?

Test for crylAc expression was carried out from To to Ts generation throughELISA and Bt Strip test. Test for presence or absence of Mon 531 was carriedout from 2009 after knowing about the contamination.

--

-

--

SdI-(l.S KATAGERI)

SdI­(B.M.KHADI)

SdI-(S.S UDlKERI)

SdI­(H.M.VAMADEVAIAH)

REPLY TO THE QUESTIONS ASKED BY ENQUIRY COMMITTEE ONBNBt

Dr.S.S.PatH, ARS, Dharwad

Q 1) When Dr Katageri was away during 2005-06, were you Head of theCotton Research Station? We understand that the charge of thedevelopment of 'BN Bt' programme was given to you?

Ans: Yes, I was Head of the Research station, Dharward during 2005-08. AsHead of the Research station, I facilitated Dr.Katageri to get relieved on timeand proceed for his training abroad during 200S.The responsibilities of differentactivities of Dr. Katageri were allotted to different scientists as follows:

a) Breeding material and TMC projects- Dr. S. S. Patil, Principal Scientist andHead, ARS, Dharwad

b) Laboratory activities- Dr. RM. Vanadevaiah, Biochemist, AICCIP, ARS,Dharwad

c) Bt. Cotton activities- Dr. Manjula S. Maralappanavar, Asst Cytogeneticist,ARS, Dharwad

The highly specialized and advanced programme of Bt cotton beingdeveloped by Dr.Katageri and his team maintained as a confidential research.The details of the programme and experiments were not shown to us. Hence asdesired by Dr.Katageri the charge of his Bt. Cotton research programme wasgiven to Dr.Manjula on paper only, while all the detailed handling of thematerial was done by his team members, Mis. Anita Bandari, ResearchAssociate and Mr.Basavraj Tegginhalli who was managing his programme.

Q 2) As Head of Cotton Research station after Dr Khadi left VAS,DharwlJrl, what were your duties in 2005-06?

Ans: As Head my duties were to execute different developmental programme of .the station and to provide required support to all the scientists and enable themto carry out their research programme.

Q 3) Did you visit the research plot having material on BN Btdevelopment?

Ans: No, Before Dr. Katageri left, much of the flowering was over andDr,Katageri never took me to field after my taking charge as Head and hence Ihad not seen the material before he left. As mentioned earlier during his trainingperiod Dr.Manjula and I gave support to his team in the form of handling labor

bills and management. As desired by Dr.Katageri, during the remaining shortperiod of the crop we did not get into the trial for seeing the material.

Q 4) Was required isolation was kept in experiment on BN Bt?

Ans: During land allotment care was taken to maintain isolation distance indifferent programmes.

Q S) At Cotton Research Station where BN Bt development was going on,were there any 'Bt' cotton material (i.e., MON 531) other than BN Bt? Ifsoapproximate number of entries and approximate area under them? Whatwas the isolation distance?

Ans: During different years, private Bt hybrid trials were conducted where thehybrids carried Mon 531 event. Every year care was taken to maintain 50mtisolation distance between these trials and other breeding programme.

Q 6) How was the generation advanced: by selfing or only open pollinationin isolation?

Ans: During 2005-06, Dr.Katageri had handled the material during floweringand he is the right person to answer this question.

Q 7) Did you observe or get information about any segregation formorphological traits in the BN Bt material?

Ans: I have not visited the field and hence I do not have any idea about this.

Q 8) Did you report about the confidentiality of programme (that you arenot able to visit experimental plot of BN Bt) to your seniors?

Ans: When Dr.Khadi left Dharwad and handed over the charge of Principalscientist and Head of the campus to me, the complete charge of Bt researchprogramme was handed over to Dr.Katageri without associating me orDr.Manjula in it. The details of this arrangement were submitted to theUniversity. To honor the views ofDr Khadi the then Director CICR Nagpur andthe wish of Dr.Katageri, the confidentiality of this Bt programme wasmaintained and continued.

Q 9) Are you aware of petal colour of 'BN'?

Ans: No.

Q 10) MAHABEEJ reported the presence of yellow and cream colourpetals in the ratio of 50: 50? What are your comments about this?

Ans: According to my view, the percent of off type plants (segregation) seen inMAHABEEJ plot depends on the percent of off type plants present in theprevious season and the dominance relationship between the alleles responsiblefor different petal colors.

--

-

-

------

Q JI) Were you involved in the development and seed production of BNBt?

Ans: During my tenure as head, I provided all the required facilities and supportby strengthening biotechnology lab, establishing green house, generator set, labfumitures, air conditioners, equipments etc., To this extent I am involved inhelping the programme ofBN Bt cotton.

Signature: sd/­

Place: Dharwad

Date: 16.4.2012

40

.../

REPLY TO THE QUESTIONS ASKED BY ENQUIRY COMMITTEE ON BNBtDr.Manjnla S. Maralappanavar, ARS, Dharwad

Q 1) Were you involved in development or seed production of 'BN Bt'?

Ans: I was involved in the standardization of genotype independenttransfonnation protocol in the tissue culture laboratory. To this extent I wasinvolved in development of BN Bt cotton programme for standardizingtransfonnation protocol.

Q 2) We understand that during the absence of Dr Katageri (2005 - 2006),you were the inchrage of research programme on BN Bt. What is yourcontribution during that period, i.e., your activities?

Ans: During 2002 I joined for my Ph.D. From this point onwards I wasdetached from the BN Bt programme. In 2005 even though I joined back cottonresearch station, I was kept away from BN Bt programe. While leavingDharwad, Dr.Khadi handed over the entire charge of BN Bt programme to Dr.Katageri. Further the papers published during 2007 in current science and paperpresented at WCRC, USA(2007) do not include my name proving this fact.

While Dr. Katageri left for his training during 2005-06, though the chargeof Bt cotton programme was given to me, as per the wish of Dr.Katageri, thedetails of materials was not shown in the field and the details of field plan werenot given to me. The peak flowering period was over before Dr. Katageri leftDharwad. All the detailed handling of the material was done by his teammembers, Ms. Anita Bandari Research Associate and Mr.Basavraj Tegginhalliwho were managing his programme.

My contribution during the absence of Dr.Katageri was to give therequired support to his team (Ms. Anita Bandari Research Associate andMr.Basavraj Tegginhalli) for managing the crop in the last few days as peakflowering was already over and help to settle the financial issues like labourbills.

Q 3) How many times you monitored/undertook the pollination and otherfield operations particularly harvesting? We understand that you workedon cotton transformation. Did you work on transformation of BN for thedevelopment of BN Bt?

Ans: By the time Dr.Katageri left peak flowering was over. The material wasnot shown in the field and the detailed field plan was not handed over to me. Asdesired by Dr.Katageri the harvesting was taken by his team members (Mis.Anita Bandari Research Associate and Mr.Basavraj Tegginhalli) Upon hisreturn from USA, Dr. Katageri never approached me for his material as it was

--

--

---

-

-

-

-

under the custody of his team which proves my non- involvement in harvestingof the material during his absence.

Q 4) Did you hear or observe variation in experimental plot of BN Bt?

No.

Q 5 Did you receive any certificate from Dr Khadi for the recognition ofyour work in the development of BN Bt?

No.

Signature: sdl­Place: DharwadDate: 16.4.2012

Replies to the Questions on BN Bt-Cotton by Dr Ravi Runje

1. Were you involved in seed production of 'BN Bt'?

Not involved in seed production of BN Bt, but requested to co-ordinate the seedproduction ofBN Bt by special Officer (Seeds).

2. Where was the seed production programme ofBN Bt undertaken?

The Seed Production of programme of BN Bt was undertaken on 17 University ResearchStations/Farms.

3. Had you visited seed production plot ofBN Bt?

Visited seed production plots of BN Bt at ARS, Mundgod and ARS Soundalaga oncealong with Dr. 1. S Katageri and Mr. Eshanna.

4. Had you observed any segregation for petal colour or any other morphological trait in theseed production plot?

I have not observed.

5. What was the performance ofBN Bt in seed production plot?

General appearance was good.

6. Was there any team for monitoring of seed production ofBN Bt?

No.

7. Did any team member(s) give you information about segregation?

No.

8. Did Dr Katageri visit seed production plot? Ifso, how many times (approximate)? Did heobserved variation? If so, what remedial measure taken to remove any off-types?

Visited Seed Production plots, but I do not know how many times.

9. In your opinion whJl seed production ofBN Bt was suspended?

I do not know.

43

-

-

----

Replies by Dr HL Nadaf, Special Officer (Seeds) to the questions raised by Dr.BaldevSingh Dhillon on Bt-cotton .

1. Were you involved in seed production of 'BN Bt' and 'Bt NHH 44'?

In the capacity of Special Officer ( Seeds), I facilitated in seedproduction of BN-Bt and Bt NHH44.

2. Who actually carried out seed production of BN Bt and Bt NHH 44?

From Seed Unit, Dr.Ravi Hunje co-ordinated the seed production ofBN-Bt & BT NHH44 under the supervision of concerned cottonscientists.

3. What was the source of seed to carry out seed production of BN Bt during 2008?

The source of Seed for seed production of BN-Bt during 2008 wasfrom the concerned Cotton Scientist, ARS, Dharwad.

4. Was there any problem of variation in two seed production plots of BN Bt, i.e., seedproduction of variety BN Bt and that of its plots sown as parent ofBt NHH 44?

I am not aware of such variations in seed production plots of BN-Btand parent of Bt NHH44.

5. Was there any segregation for petal colour?

I am not aware of the segregation for petal colour.

6. Did you observe or anyone inform you about the segregation for petal colour or anyother character in seed production plots?

I did not observe and no one informed me about the segregation forpetal colour or any other character in seed production plots

7. Did monitoring team(s) visit the seed production plots ofBN Bt?

The cotton scientists only monitored the seed production plots ofBN­Bt.

8. Did Dr Katageri visit seed production plot? If so, how many times (approximate)?Did he observed variation? If so, what remedial measure taken to remove any off­types?

Dr.I.S.Katageri visited the seed production plots along with his fellowcolloquies 3-4 times. Few off type plants were observed by them whichwere removed at the time of their visits.

44-

9. Which class of seed ofBN Bt was produced during 2oo8?

Since it was only pre-release multiplication it was truthful seedproduction during 2008.

10. Were you satisfied with the yield potential of BN Bt?

The crop stand and boll bearing was normal but I left the Seed Unit aftermy transfer from there before harvest of the crop.

11. Why seed production programme ofBN Btand Bt NHH 44 was suspended?

It seems there was contamination of other events in BN-Bt andhence seed production of BN Bt and Bt NHH44 were suspended untilfurther clarifications.

-

--

--

-

-

Following are the reply on the discussions had with Dr. L. Krishna Naik,Special Officer (Seeds) from Dec.2008 - July 2010, Director of ExtensionEducation up to Dec. 2010 and Director of Research from Nov.2011 onMarch 24, 2012

Q 1) Were you associated with the seed production of 'BN Bt' and 'Bt NHH 44'?

- No. The season was over by the time I took the change of Special Officer(Seeds) (Dec.2008).

Q 2) Did you visit seed production plot ofBN Bt and that ofBt NHH 44?

- No.

Q 3) Did anybody inform about variation and rouging in BN Bt?

- No.

Q 4) Was there any serious problem of variation?

- Not aware.

Q 5) Did Dr Katageri visit seed production plot? If so, how many times(approximate)? Did he observed variation? If so, what remedial measuretaken to remove any off-types?

- This was not brought to the notice.

Q 6) What class of seed of BN Bt was produced and supplied to ClCRNagpur?

- It was 11... only.

Q 7) You said it was TL seed and you informed about that to CICR not touse the seed for hybrid seed production of Bt NHH 44. Please confirm. If itis so, can we get relevant correspondence?

- It was 11... only because BN Bt was not notified variety and was just thandeveloped.

Q 8) You have worked as special Officer (Seeds) when seed of BN Bt and BtNHH 44 were produced, and then Director of Extension Education andNow you are Director of Research. You may be aware of the fact of DrKatageri proceeding on training in 2005-06. Do you remember to whom theresponsibilities of looking after the material was given in Dr Katageriabsence, name and designation of the scientist(s) responsible for BN Bt

46

development programme in the absence of Dr Katageri from Oct. 2005 toApriI2006?

- The issue concerned to in charge arrangement of Dr.I.S. Kargeri whileproceeding on training during 2005-06 is not known to me. However, asper the office records obtained from station Head and the arrangementwas as follows. Copy enclosed.

Q 9) We understand that Dr SS Patil and Dr Manjula did not see eye-to-eyewith Dr Katageri and both these scientists did not take interest or monitorwork. Any comment.

- It is difficult to comment as I had no association with the Scientistsworking then in the station.

Q 10) In such scenario, should the need of Station (Dr SS Patil) should haveinformed the senior about the manner in which he and Dr Manjulaperformed their duties due to inter-personal relationship.

- In this regard the official attachment with respect to responsibilitiesentrusted to the official should answer.

Signature: sdJ- 16.4.2012

--

---

-

X)tscu'ssion wlUt Dr CV Mansur. Professor-of Agronomy Ott i\{arch 24. 2(l12

-'f~ .

rl.

•

'1.

2.

J.

Are you-wotkinG in dcpartme'nt ofOAS. Ob9:("A~, please'!

\'ourdesignmlonplease?~~~.

Do you ha'o'e good knowledge of~~. Plant Breeding and Biotechnoto~

-

-

-

-

ANNEXURE-Uf-B

ADDITIONAL INFORMATION RECEIVED FROM Dr. I. S. KATAGERI

Query # 1: How was the "purification" of Bn-Bt carriedout. What is the population of plants used, and over howmany generations has the purification taken place?

Query # 2: What are the primers used to separate the MON531and BNLA106 event during the process of "purification"?There has been mention of thousands of peR being done byUAS, Dharwad especially for identifying purified eventcontaining BNBt plants. Information regarding thechronology of experimentation, population size, primersused, results etc. need to be provided.

It was possible to Identify BN Bt plants not carrying Mon-531 in Jan, 2010. The plants were identified

based on PCR test, by using Mon 531·specific primers. The plants which did not show presence of Man

531 were tested with primers designed for Cry 1 Ac. The plants negative for Man 531 and positive for

Cry lAc specific were identified.

The detans of PeR test carried out Is mentioned In the table below

Vearof No. of plants Man 531 Cry lAc

TestingGeneration

screened + - + -2009 T.

(Standing crop) )587 587 0 587 0

2010 T.

(Plants raised from old seeds

of 2007(T,1 produce of five 135· 130 5·· 135 -

progenies with multicopy Bt

types)

• Only 135 old seeds germmated outof6200 sown

•• crylAc positive but negotlve for Man 531

Multiple Bt types: In 2006, homozygosity test was done by MIS. Bangalore Genie for BN Bt. Out of 78

plants tested, 25 were homozygous, 24 were heterozygous, and 18 were multicopy Bt. Seeds of only 25

homozygous plants were further used. Rest of them was rejected. Five progenies of multicopy Bt were

however sown in 2006-07 but their seed was not used. 50 this old seed was used to screen. Plantsnegative for Man 531 but positive for crylAc were identified.

Respected sirInformation for your queries is mentioned here1. How did Bangalore genie identifY multi-copy Bt plants. Did they perform Southerns11t isdifficult to identifY multi-copy plants by PCR, unless they did qPCR analysis using a singlecopy gene as a reference.

They perfonned semi-quantitative PeR using the STR-<lpecific primers. These are the primerswhich used to give semi-quantitative PCR results reproducibly and They used to do only 25cycles of PCRs using limited genomic DNA. Also, the windows of errors were huge as any databetween 0.8 and 1.2 were considered as single copy and 1.7 to 2.3 were considered 2copies.AIl conclusions were made based on experiments repeated :uimes.

2. What are the aylAc specific primers that you used?

cry 1Ac specific primers for 1kb that were designed Dr Dr.AnandKumar

With regardsKatageri

50

------

-

-

-

-

Dear Sir

Following is the formation

Was there a reason for choosing an sTR instead of single copy gene for this analysis?:

Sir, we were not sure about the method to be followed at that time. This method was decided by

the firm.

How many copies were adjudged to be present in the lines from which Bn-Bt was ultimately

repurified?

The material that was used for re purification was adjudged as multicopy Bt by Bangalore Genel

Can you send me a timeline, in terms of the years in which different generations (starting from TO/Tl

until T7/TS) were grown. This will give the committee, in a nutshell, the chronology of the

development and repurification of BnBt.

Generation wise information was Enclosed

Yours sincerely

Katageri

Dr.!. S. Katageri,

Principal Scientist (Cotton),Agriculture Research Station,Dhmwadfarm, Dharwad-580007INDIA.Mobile: +919448822266Office: 0836-2741092

51.

Generation wise seed multipliea tion in BNBt

Year Gene- Population sizeration

2001-02 To 79 plants in transgenic green housc.

2002-03 TI Twelve progenies were grown in 84 rows each with differentnumbers of rows depending on availability of seeds. Each rowwas 6 m length. There was no germination for one progeny.

2003-04 T2 Only eleven progenies were continued, each with 25 rows.

2004-05 T, 917 plants of AT, 8-10 based on single copy introgression ofsouthern analysis were sown in open field under isolation. SeedsofBt positive plants were used for RCGM trial during 2005-06.

2005-06 T. 78 plants selected as homozygous based on Bt strip test weresown each aboutl5 rows under isolation in an open field. Seedsof Bt positive plants based on Bt strip test were used for RCGMtrial in 2006-07.

2006-07 Ts Progenies of 25 homozygous (Based on Bangalore Genie report)plants were raised in open field under isolation.

2007-08 T6 Progenies of25 plants were raised in open field under isolation.

2008-09 T7 Bulk seeds of homozygous plants were used in seed production atdifferent farms ofUAS, Dharwad under isolation.

2009-10 Ts Bulk seeds were grown at ARS, Dharwad

-

-

Dear SirFollowing is the information

Answer to queries.1. The materials and methods section of the CurrentScience paper indicates that T3 generation of plants weregrown in the 2003-04 growing season. The table that youhave sent me indicates that T2 generation was grown inthe 2003-04 season. Can you please clarify? If necessary,please revise your table.

Sir, the generation raised in 2003-04 was T2 only.

2. You had indicated earlier that Bangalore Genei hasdone homozygosity test in 2006. Was this done in January2006? What was the generation of plants that was used forPCR based homozygosity testing by Bangalore genei? If thetable is being revised, please indicate the correctgeneration as per revised table.

Homozygosity test was done in May-June, 2006 byBangalore Genei. T4 generation plants were used forthis test.

3. The Current Science paper indicates that Southernanalysis was done on T4 plants. In which year and monthwas this analysis done?

Southern analysis was done at NRCPB New Delhi.Records may be available at NRCPB New Delhi

4. The Current science paper indicates that Southernanalysis in T4 generation was done on T-l-ll plants. Yourtable indicates that in T3 generation, 917 plantsbelonging to T-1-8-l0 were advanced further. Does it meanthat progeny of T-l-ll, on which Southerns were done, hadnot been advanced further?Tl-ll is nothing but Tl-8-105. You had indicated that in 2009, you had found that T8standing crop contained only MONS3l. What was the monthof testing? I presume that this crop grown during the2009-10 season.

August- November, 2009

6. You had indicated that plants containing cryIAc and

5"3

not containing MONS31 were identified in January 2010.Does this mean that old seeds (6200 in number) of multi­copy Bt containing TS generation were grown in the 2009­10 season? What was the reason to grow them during 2009­10 growing season?

Old seed was sown ~n January, 2010 ~n green house furscreening only

7. When did you first come to know that BnBt had beencontaminated with MONS31?

August 2009

Yours sincerely

Katageri

Dr.IS. Katageri,Principal Scientist (Cotton),Agriculture Research Station,Dharwad farm., Dhanuad-580007INDIA.kfobile:+919448822266~Jice:0836-2741092

-

-

Request for infonnation to be made available during visit of sub-committee

to NRCPB on 24th March 2012

• The details of the gene construct and plasmid vector provided by Dr. Ananda

Kumar to UAS, Dharwad is to be provided. This information should include the

sequence of the vector and it's restriction map.

• Was this vector and gene construct developed at NRCPB? If not, what is the

source of this vector? Was this vector obtained via an MTA? Is a copy of the

MTA available?

• Is-there a single Hindlll site within the T-DNA of the binary vector provided by Dr.

Ananda Kumar? Is Southern analysis with Hindlll digested genomic DNA

expected to reveal a junction fragment of BnBt (BNLA106 event)?

• The Southern blots presented in Kategeri et al 2007 (Current Science) and the

recently conducted Southern blots on purified Bn-Bt· are be presented to the

committee. Would original lab records from the earlier analysis and the recent

analysis be available? Are the old DNA samples still available?

• How was the sequence of the flanking DNA and vector DNA sequence at the

integration site established with the purified BnBt event? Was this outsourced or

done 'in-house'? The details of this recent work need to be provided? How is this

different from the earlier work done by Avasthagen?

• The newly obtained sequence of the BnBt event that shows the flanking DNA

and vector DNA sequence at the integration site is to be made available. Can a 7

kb Hindlll fragment, that encompasses the Cry 1Ac gene in the event, be

predicted by analysis of this sequence?

• Have the newly developed "event specific primers" been used with old genomic

DNA from the 2007 work (if that DNA sample is available)?

• How as the "purification" of Bn-Bt carried out. What is the population of plants

used, and over how many generations has the purification taken place?

• What are the primers used to separate the MON531 and BNLA106 event during

the process of "purification"? Where were these primers developed? There has

been mention of thousands of PCR being done by UAS, Dharwad especially for

identifying purified event containing BNBt plants. The details of the

55

methodology, chronology of experimentation, population size, primers used,

results etc. need to be provided.

• What is the evidence to show that the BNLA106 event is on the same

chromosome as MON531?

56

-

-

-

-

.~

ANNEXURE-IV-B

Report of the visit of Dr. Ramesh V. Sontl (RVS) and Dr. Imran Siddiqi (IS)

to NRCPB on 24"' March 2012

RVS and IS met with Dr. P. Ananda Kumar (PAK) on 24/3/12 at NRCPB. New Delhi to discuss his and

NRCPB role and contribution in the development of BNBt cotton and the issues resulting from the

same. PAK made a technical presentation describing his contribution and subsequent follow-up work

in the light of questions that have been raised on the connection between BNBt and the paper he

co-authored (corresponding author) in Current Science reporting on the development of novel Bt­

transgenic cotton. He also provided a written response to a list of questions that had been

communicated to him earlier by RVS with regard to his work relating to BNBt cotton. The

information provided by PAK and the related discussions are summarized below.

1. PAK presented data from the Southern hybridization analysis in the Current Science paper and his

recent Southern hybridization studies with purified Bn-BT. In the recent study he has also included

the MON-531 material. This study indicates that the Dharwad event is different from MON-531. Dr.

Ananda Kumar also presented data from flanking sequence information of the Dharwad event and

development of event specific markers for the same. This analysis also indicates that the Dharwad

event is different from MON-531. Dr. Ananda Kumar also requested that a third party verify the

Southern analysis. The committee agrees with same. Some grey areas in the analysis were pointed

out by PAK. These have to do with details about the event and will shed further light on the nature

of the integration and are to be carried out. Further characterization of line no. 23 (purified Bn-BT)

is in progress in PAK's laboratory with respect to the sequence of the insert which is expected to

further establish its relationship to the construct pBINBt3 that was used for making the transgenic.

Conclusion: Prima facie, it appears that the Dharwad event in the purified Bn-Bt, and presumably the

original Bn-Bt, is different from MON0531

Recommendation: Third party analysis of Southern hybridization. Dr. Veluthambi of Madurai

Kamaraj University has experience of performing Southern hybridizations with plant material. He

may be contacted by ICAR for this 'service'. Alternatively or in addition, CDFD Hyderabad may also

be requested to carry out the analysis. Plant Material to be provided by Dr. Katageri. PAK to provide

plasmids and information on primers. ICAR to facilitate the same.

2. PAK has provided MTA signed in 1996 by Dr. R. P. Sharma, then Director, NRCPB, with Dr. Altosaar

of U. of Ottawa (Annexure II provided by PAK). He indicated that he tried to negotiate a Freedom to

Operate agreement with Dr. Altosaar which attempt was unsuccessful. He also provided the minutes

of a meeting held on 5-10-2006, chaired by DOG (CS &H) and proceedings recorded by Dr. Mauria

(ADG,IPR), which indicated that the MTA "may not be considered as an agreement at the national

level" and that the said CrylAc construct should be called "truncated CrylAc toxin gene from NRCPB,

New Delhi". In the meeting "it was also decided that the freedom to operate analysis as desired by

University of Ottawa in email correspondence with Dr. P. Ananda Kumar is not required at this

stage". Subsequent to the same, PAK removed all references to Dr. Altosaar from the Katageri et

Current Science paper. The earlier version of the manuscript which had Dr. Altosaar as a co-author

was provided by PAK. He also indicated that the same can be verified from the journal.

3. PAK indicated that he was in no way connected with commercialization, breeding work and

biosafety analysis of Bn-Bt. PAK also indicated that he has never received any seed material of Bn-Bt

at any point. All his analysis has been conducted with leaf material, either sent or brought {by Dr.

(

atageri) from UAS, Dharw d. He was in no way connect . the outsourcing of work to

wasthagen for flanking sequence analysis of Bn-Bt. All of this was taken care y ClCR.

Conclusion: If indeed PAK has not received any seed material of BN-Bt, the contamination with

MON-531 would have to have happened outside NRCPB.

4. PAK does not agree with the sequence of events indicated by the proceedings released by ICAR

regarding the meeting on December 10·h 2009 which refer to earlier meetings (particular the May

21" 2008 meeting). He prOVided a draft minute ofthe meeting circulated by Dr. K. C. Jain of the

December 10'" meeting. He categorically denies that contamination with MON-531 was discussed in

the meeting held on May 21" 2008 by DOG (CS). He also denies haVing been informed at any time

prior to September 2009 by either Dr. Kranthi or Dr. Khadi that contamination with MON531 had

occurred.

The documents provided by PAK are handed over to the committee (list of the same enclosed).

58

••

--

-

~.

-

---

-

Documents provided by NRCPB to sub-committee of 50pory Committee that visited NRCPB on 24'"

March 2012.

1. Response to queries of sub-committee with thirteen annexures that contain the requested

information.

2. Letter of Dr. P. Ananda Kumar to Dr. Ramesh 50nti, member of the committee, requesting that

certain information and documentation be placed before the committee. This includes the following:

a. a note regarding the so-called proceedings of the meeting on December 10'" 2009 related to BN­

Bt variety that were not proceedings.

b. A note pointing out that Dr. Kranthi had numerous oppurtunities to indicate that the Bn-Bt that

was released has MON-531 event.

c. Draft proceedings of the meeting held on 10-12-2009 which was sent by ADG (CC) to members for

.comments. This draft is in variance to that released in response to RTI application.

d. Proceedings of the meeting on BN-Bt that was conducted by DOG (CS) on 21-5-2008. These

proceedings are not in consonance to the events that are described in the "proceedings of Dec. 10'"

2009 meeting" released in response to RTI application.

e. A letter dated June 16'" 2011 addressed to DOG (C5) indicating that certain modifications be made

to the draft minutes of a meeting held on April 27'", 2011.

3. Earlier draft of Katageri et al manuscript which indicates that I. Altosaar was listed as an author of

this paper.

4. An additional note pointing out deficiencies in the proceedings of the Dec. 10'" 2009 meeting.

5. A listing of further work that needs to be done with regard to molecular characterization of the

Bn-Bt event.

Genome walking in T·DNA part ofBNBt Event(from March 30,2012 to April 18, 2012)

-

-'InteRration pattern of crylAc-pllinBt3 in cotton Renome in RNBt event

Genome walking has been performed in T-DNA starting from the Left and Rightborers simultaneously (as indicated by arrows). The complete sequence of RB,Nos-promoter, nptll and nos-terminator are available intact. The sequence fromLB, CaMV 35 S promoter, crylAc (1000bp) are available intact.

i). Further walking beyond nos-terminator is in progress.ii). Further walking beyond 1000bp ofcrylAc is in progress.

Sequence information available so far indicates that the selectable marker genecassette and crylAc gene cassette (except the uncharted terminator region) asexist in pBinBt 3 seems to have been integrated undisturbed. Further sequencingwill indicate if the terminators are intact or deleted or rearranged.

-

-

-

Genome walking in T-DNA part of BNBt Event(from March 3D/April 18, 2012 to June 1, 2012)

----[~EE~] .plll ~ a)·IM EEEJ------ Integration pattern of crytAc·pBlnBt3 In cotton genome In BNBt event

The sequences obtained so far and which were found intact are given below:

WALK-I:

Primer Sequence: CGCTCACTGCCCGCTTTCCA (pBinl9 6965-6983)

>061-IV177_6965-3_SP6-B07.ablGGGAGCTCTCCCATATGGTCGACCTGCAGGCGGCCGCGAATTCACTAGTGATTC

cloning vector6965GCTCACTGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAA

sequence between crylAc and nptlJ gene cassettesTCGGCCAACGCGCGGGGAGAGGCGGTTTGCGTATTGGGCCAAAGACAAAAGGGCGACATTCAACCGATTGAGGGAGGGAAGGTAAATATTGACGGAAATTATTCATTAAAGGTGAATTATCACCGTCACCGACTTGAGCCATTTGGGAATTAGAGCCAGCAAAATCACCAGTAGCACCATTACCATTAGCAAGGCCGGAAACGTCACCAATGAAACCATCGATAGCAGCACCGTAATCAGTAGCGACAGAATCAAGTTTGCCTTTAGCGTCAGACTGTAGCGCGTTTTCATCGGCATTTTCGGTCATAGCCCCCTTATTAGCGTTTGCCATCTTTTCATAATCAAAATCACCGGAACCAGAGCCACCACCGGAACCGCCTCCCTCAGAGCCGCCACCCTCAGAACCGCCACCCTCAGAGCCACCACCCTCAGAGCCGCCACCAGAACCACCACCAGAGCCGCCGCCAGCATTGACAGGAGGCCCGATCTAGTAACATAGATGACACCGCGCGCGATAATfTATCCTAGTrTGCGCGCTATATrTTGTT

nos lelminalo..TTCTATCGCGTATTAAATGTATAATTGCGGGACTCTAATCATAAAI\ACCCATCTCATAAATAACGTCATGCATTACATGTTAATTATTACATGCTTAACGTAATTCAACAGAAATTATATGATAATCATCGCAAGACCGGCAACAGGATTCAATCTTAAGAAACTTTATTGCCAAATGTTTGAACGATCGGGGATC ATCCGGGTCTGTGGCGGGA ACrCCA

sequence between 1I0S tenninalor and nptTICGAAAATATCCGGAACGCAGCAGATATCGCGGTTGCATCTCGGTCTTGCATGGG

7842

>022-IVI77_6965-3_SP61-F04.abl

7746TTTGACGATCGGGGATCATCCGGGTCTGTGGCGGGAACTCCACGAAAATATCCGA

sequence between nos te~llljna{Qr and npll/

61-

ACGCAGCAAGATATCGCGGTGCATCTCGGTCTTGCCTGGGCAGTCC~CGCCGACG

CCGTTGATGTGGACGCCCNGCCCGATCATATTGTCC~TCAGGATCGTGGCGTTGT

GCTTGTCGGCCGTTGCTGTCGTAATGATATCGGCACCTTCGACCGCCTGTTCCGCAGAGATCCCGTGGGCGAAGAACTCCAGCATGAGATCCCCGCGCTGGAGGATCATC

nplllCAGCCGGCGTCCCGGAAAACGATTCCGAAGCCCAACCTTTCATAGAAGGCGGCGGTGGAATCGAAATCTCGTGATGGCAGGTTGGGCGTCGCTTGGTCGGTCATTTCGAACCCCAGAGTCCCGCTCAGAAGAACTCGTCAAGAAGGCGATAGAAGGCGATGCGCTGCGAATCGGGAGCGGCGATACCGTAAAGCACGAGGAAGCGGTCAGCCCATTCGCCGCCAAGCTCTTCAGCAATATCACGGGTAGCCAACGCTATGTCCTGATAGCGGTCCGCCACACCCAGCCGGCCACAGTCGATGAATCCAGAAAAGCGGCCATTTTCCACCATGATATTCGGTAAGCAGGCATCGCCATGGGTCACGACGAGATCATCGCCGTCGGGCATGCGCGCCTTGAGCCTGGCGAACAGTTCGGCTGGCGCGAGCCCCTGATGCTCTTCGTCCAGATCATCCTGATCGACAAGACCGGCTTCCATCCGAGTACGTGCTCGCTCGATGCGATGTTTCGCTTGGTGGTCGAATGGGCAGGTAGCCCGGATCAAGCGTATGCAGCCGCCGCATTGCATCAGCCATGATGGATACTTTCTCGGCAGGAGCAAGATGAGATGACAGGAGATCCTGCCCCGGCACTTCGCCCAATAGCAGCCAGTC ~73

WALK II: crylAc

Primer Sequence: GTTCGCCGGCTTTCCCCGTC (pBinl9 6581-6562)

>036-IVI77_6581 -3_SP6-G06.ablGCTCTCCCATATGGTCGACCTGCAGGCGGCCGCGAATTCACTAGTGATTAACCCAGCACCTGGCACGAACTCGCTGAGCAGAAACTGTGTCAAGGACAAGGAGATGTCG

CrylAcATGGGAGTGTAACCGGTTTCAATGCGTTCTCCACCAAGTACTTCAACTTCTGGGTTACTCAAGCAGTTGTATGGAATGCATTCGTTGATGTTTGGGTTGTTGTCCATGGATCCCCGGGTACCCTGTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGT

358 promoterCTTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTACGTCAGTGGAGATATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTC(11I ICCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTTCAACGATGGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGAGCCACCTTCCTTTTCCACTATCTTCACAATAAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCGGATATTACCCTTTGTTGAAAAGCCTCAATTGCCCTTTGGTCTTCTGAGACTGTATCTTTGATATI-TTTGGAGTAGACAAGCGTGTCGTGCTCCACCATGTTTGACGAAGATTTTCTTCTTGTCATTGAGTCGTAAGAGACTCTGTGTGAACTGTTCGCCAGTCTTTACGGCGAGTTCTGTTAGGTCCTCTATTTGAATCTTTGACTCCATGGGGA\ II (' '1C IGllCCGTn(!TT I AC c\.\( Ull 'G IC,,\CTGUGAAAACCCIGGCGTTAUCAAC I L\ \ I, '(itCTTGC\GCACXJ(t:CC'Cl'ITCCiCC\GCT(i{,CGT;\:\T\G('(i,\\(u\(;" «(;( .\CI (,\rCGCCCTTCCC\\(' ,\(, Inil 'CiC ,\GITTG:\:\'l GC,UiCCC(;CTCCTTf <., i,TT ICT ICCCrrCCITIC ICG,,( !\('Ci,; IU.I(:GGCTTTU'CC(; lC\G{: I(TAA;\ I(,;(;C;(,CCI, C

CI'1'6538

Primer sequence: CCCAGAAGTTGAAGTACTTGGTGG (crylAc 54-78)

-

-

----

-

'-

-

-

-----

----

--

----

GCTCCGGCCGCCATGGCGGCCGCGGGAATTCGATT~CCCAGAAGTTGAAGTAC

cloning vectorTTGGTGGAGAACGCATTGAAACCGGTTACACTCCCATCGACATCTCCTTGTCCTT

crylAcGACACAGTTTCTGCTCAGCGAGTTCGTGCCAGGTGCTGGGTTCGTTCTCGGACTAGTTGACATCATCTGGGGTATCTTTGGTCCATCTCAATGGGATGCATTCCTGGTGCAAATGAGCAGTTGATCAACCAGAGGATCGAAGAGTTCGCCAGGAACCAGGCCATCTCAGGTTGGAAGGATTGAGCAATCTCTACCAAATCTATGCAGAGAGCTTCAGAGAGTGGGAAGCCGATCCTACTAACCCAGCTCTCCGCGAGGAAATGCGTATTCAATTCAACGACATGAACAGCGCCTTGACCACAGCTATCCCATTGTTCGCAGTCCAGAACTACCAAGTTCCTCTCTTGTCCGTGTACGTTCAAGCAGCTAATCTTCACCTCAGCGTGCTTCGAGACGTTAGCGTGTTTGGGCAAAGGTGGGGATTCGATGCTGCAACCATCAATAGCCGTTACAACGACCTTACTAGGCTGATTGGAAACTACACCGACCACGCTGTTCGTTGGTACAACACTGGCTTGGAGCGTGTCTGGGGTCCTGATTCTAGAGATTGGATTAGATACAACCAGTTCAGGAGAGAATTGACCCTCACAGTTTTGGACATTGTGTCTCTCTTCCCGAACTATGACTCCAGAACCTACCCTATCCGTACAGTGTCCCAACTTACCAGAGAAATCTATACTAACCCAGTTCTTGAGAACTTCGACGGTAGCTTCCGTGGTTCTGCCCAAGGTATCGAAGCTCCATCAGAGCCCACACTTGATGGACATCCTGAACAGCATAACTATCTACACCGATGCTCACAGAGGAGAGTATTACTGGTCTGGACACAGATCAT965 GCCGTCGACCACGCGTGCCCTATAGTTCCACAGTCAGCn}

Adaptor cloning vector

832GGTAGCTTCCGTGGTTCTGCCCAAGGTATCGAAGGCTCCATCAGGAGCCCACACT

crylACTGATGGACATCCTGAACAGCATAACTATCTACACCGATGCTCACAGAGGAGAGTATTACTGGTCTGGACACCAGATCATGGCCTCTCCAGTTGGATTCAGCGGGCCCGAGTTTACCTTTCCTCTCTATGGAACTATGGGAAACGCCGCTCCACAACAACGTATCGTTGCTCAACTAGGTCAGGGTGTCTACAGAACCTTGTCTTCCACCTTGTACAGAAGACCCTTCAATATCGGTATCAACAACCAGCAACTTTCCGTTCTTGACGGAACAGAGTTCGCCTATGGAACCCCTTCTAACTTGCCATCCGCTGTTTACAGAAAGAGCGGAACCGTTGATTCCTTGGACGAAATCCCACCACAGAACAACAATGTGCCACCCAGGCAAGGATTCTCCCACAGGTTGGGCGGCGTGTCCATGTTCCGTTCCGGATTCAGCAACAGTTCCGTGAGCATCATCAGAGCTCCTATGTTCTCTTGGATACACCGTAGTGCTGAGTTCAACAACATCATCGCATCCGATAGTATTACTCAAATCCCTGCAGTGAAGGGAAACTTTl444

63

CJ"'...t'"

Location of peR Primers to amplify crylAc gene

1 486. ~

I cryl7lc >c +-

703 1554

Red : Primer pair 1; Length of of amplicon is 1068 bpBlack: Primer pair 2; Length of amplicon is 700 bp

( I 1 ( { I < ' 1 , • 1 , ( ( ,( I I (

! ( t ( t ~ { (

0'lTI

PCR amplification efficiency of new primer set within first 1OOObp of cry1Ac.

All the samples seem to amplify with equal efficiency.

M: ladder -ve: water control

C: control Ac23 :UASD Ac-23

Mon: Mon531 pBin: pBinBt3

Dear Dr Ramesh gam,

I was little perplexed and it took some time for me to comprehend the possibly correctsequence.

I spoke to Dr Khadi at length and I could construct the events as:

1. Year 2003-2004 (July 2003 - January 2004): T 3 generation

2. Year 2004-2005 (July 2004 - January 2005): T-4 generation (sampled forSouthern). Dharwad station celebrated centenary in November 2004. The researchstaffwas busy with preparations and celebrations. It seems several visitors visited theBNBt site. Not much data collection took place.

3. Year 2005-2006 (July 2005 - January 2006): T-5 generation (Dr Khadi was inNagpur and Dr Katageri was in UK; Dr Khadi raised plants in the Glass house; DrKhadi must have referred to the seed he obtained from T-4 plants. That means theplants he raised in Nagpur would be T-5 generation; It seems Dr Sumanbala did a fewcrosses during this time)

4. Year 2006-2007: As I understand, large scale crossings were done in 2006 byutilizing the seed from the glass house raised plants as well as seed from UAS­Dharwad (collected under the supervision ofDr S. S. Patillo

I do not rule out some errors. I tried my best by keeping myself in the place in animaginary situation.

Sincerely

P. Ananda Kumar

On Sun, Apr 8, 2012 at 1:59 PM, Ramesh Sonti <sonti@Ccmb.res.in> wrote:Dear Dr. Ananda Kumar gam,We are not going by Dr. Kranthi's version ofevents.However, a scientist at CICR started a crossing program to transfer BoBt event into othergennplasm. All of her material also has MON53 I. Therefore, MON53 I was already presentin the donor material tbat she used in the crossing program.Dr. Dhillon's impression was tbat she bad used T4 plants as donors. Could it be that she usedT5 plants instead. Can you please shed some light regarding the same.Regards,Ramesh sonti

On Sat, Apr 7,2012 at 5:11 PM, polumetla kumar <polumetla@gmail.com>wrote:Dear Dr Ramesh gam,

66

--

-----------

-

-

-----

--

-

----

-

--

Here is a private account of matters related to BNBt development.

The Southern data (T1- and T-4) showed that the BNBt is quite different from Mon 531. T-lSouthern was carried out in mid-20OJ and T-4 Southern in early 2005 (samples from theplants probably raised from fresh seeds collected in December 2004/January 2005).

What happened/might have happened in 2005-2006:

In the following account, I tried to reconstruct a scenario of what happened/might havehappened during 2005-2006, which was the crucial transition period. I also told you and DrImran certain things for which tangible evidence/proofcannot be provided at this juncture.

The seeds ofthis generation (collected during November 2004 to January 20(5) might havebeen planted in VAS--Dharwad during Kharif2005 (usually starts in June-July). Dr Khadi leftfor CICR in May 2005 and Dr Katageri left for UK in October, 2005. The plants must havestarted flowering when Dr Katageri was about to leave.

The experiment/field/plot was entrusted to Dr S. S. PatH and his associate scientist DrManjula Maralappannavar during the absence ofDr Katageri (such records exist in VAS-D).

Dr Khadi took the permission ofDr Kalloo, DOG (CS) to conduct an experiment at CICR tocompare Dharwad material and CICR material. He was asked to go ahead. Dr Khadi musthave used the seed given by Dr Katageri. Dr Kranthi did ELISA and informed Dr Khadi thatDharwad material was better.

There was no evidence to show that Dr Kranthi carried out PeR to detect Mon 531, at leastat this stage (Please do not go by the "Proceedings" of December 2009 meeting. Please askDr Kranthi to furnish proofofthese tests and that he communicated them to Dr Khadi).

Even if he did the testing, one wonders what was the logic that prompted him to test for Mon531?

Assuming that Dr Kranthi did carry out PCR and informed Dr Khadi that the material testedpositive for Mon 531, Dr Khadi would not have ventured to continue further. Dr Khadi, infact, gave it in writing to ICAR recently that Dr Kranthi never informed him aboutsuch a thing (A copy ofthis letter might have been given to you).

Also, Dr Khadi would have certainly informed me that Dr Kranthi found something wrongwith the material.

The seed collected by Dr S. S. PatH and his associate(s) was handed over to Dr Katageri uponhis return in 2006. This was the T-5 seed, which was sent by Dr Katageri in 2006 to CICR

and which was used for making hybrid NHH-44 and for biosafety testing at CICR. Iunderstand that they also sent samples in 2006 to MIS Bangalore Genei for testing.

Sincerely

Anandakumar

P.s:

My official involvement with BNBt ended in December 2004. The material for thepublication was collated by Dr Katageri (up to the data from field experiment conducted in2003-04) and he requested me to write the manuscript and communicate it, which I did so.

It was only when DOG (CS) asked me in December 2009 to help facilitate isolation of thelost event I started having a relook at what happened. You know the rest as I explained in theMarch 24tb meeting.

-

-

-----

--....

-

-

-

-

-

Dear Dr Santi,

My Gmail message was sent incomplete. I continue here again:

As I indicated ear1ler in my Gmail message dated April 9, 2012:

""-1 Southern was carried out in mid-2003 and T~ Southern in earty 2005 (samples from the plants probably raised from freshseeds collected In December 2O<WJanuary 2005)".

T-1 plants (gfOMl in glasshoose) were sampled by Dhatwad group <rid leaves were brought 10 NRCPB from january 2003 on wards.Southerns we-e repeated about three times and were canplete by mid-2003.

T-<4 plants were raised in glasshouse at UAS-O and leaf sanples were.sent 10 Delhi by courier in moist pdythene bags (8 couple 0(

times) in January 2005. As mentioned above, these plants were young raised fran fresh seed cdlected from 2004-2005 plants..Reganing the information frml Or Kalageri about T-2 generation raised in 2003-04. I sh~ go with his laboratory records.

SincerelyDr P. Ananda KumarProject DirectorNRC on Plant BiotechnologylARl CampusNew Delhi 110012, IndiaPhone: 091-11-25848783Fax: 091-11-25843984Email: polumetla@hotmail.comkumarpa@nrcpb.orgWeb: www.nrcpb.org

~- --~

VB RB NOS- nptll NOS:' OCS3 NOS3 crylAc 35S-P LB VB - -+-

..uo

+-

peR Primers Specific to BNBt

Set No. Sequence Size ofAmplicon

l(LB) S~'11l

5' TGCAACTCAATTTGATCCACCAGCC

Z(RB)

5' CTTGGCGACAAGGCGGCTCC

{ , I , ( ( I I I f 1 t /' f f ! I I

'-

ANNEXURE_V I

j

j

j

j

j

j

j

j

j

j

j

j

j

j

j

I j

j

j

. j

j

-=1-1

1Q/

~- R\). g,CN\~

CcM~

t-\~ (M)

~~ .'. To~ ~\.s ~CN) ~ fcJNtb1--

~~ tZ\ k'e:i ~Y' 'IQ1'>1 'hO'\­~~ r kJ~ Q~Q\ u"n~.--tb (Qc.nt\~+

. ~a%~ 1N) ~ ~rcl~~~~. R~J.,! ~ hQ. avel\~ ~:Lc-A-R _ l ~ VlP~J ~ ~~

f\,C~P)'Ortj lCi<.~"

M~1f

S~~.

.....

-

---

-

...---

-

--

----

ANNEXURE-VI-A

Discussion meeting with Dr K.R. Kranthi, Director, CICR, Nagpur on April OS, 2012

- 1. How was the work on the development of'BN-Bt' cotton divided among the threeinstitutions, namely NRCPB, VAS and CICR?

- BN-Bt was developed under NATP project 1999 to 2004. Details of the roles ofinstitutions are clearly mentioned in the current science paper: Genetic transformation ofan elite Indian genotype ofcotton (Gossypium hirsutum L.) for insect resistance. 2007. I. S.Katageri, H. M. Varnadevaiah, S. S. Udikeri, B. M. Khadi and Polumetla A. Kumar. CurrentScience, 93,1843-1847.

- a) NRCPB was to provide gene constructs, confirm gene integration, eventcharacterization and assess expression

b) VAS Dharwad for transformation ofBikaneri Narma (BN), and Sahanac) CICR for transformation of LRA 5166 and LRK 516.

2. In your opinion wbat is the order of tbese institutions on tbe basis of theircontribution in tbe development of Bikaneri Nerma Bt (BN-Bt) and 'Bt NHH 44'?

-

...,.

-

-

The Current Science paper, 2007 is a published document that describes the entiremethodology used to develop BN-Bt and the institutions where the development.took place.The same may please be referred to for clarity on the contribution of individuals and theiraffiliation with institutions.

a) VAS Dharwad developed the event 'BNLA601 ' through transformation andregeneration of BN to produce BN-Bt and Bt NHH 44. UAS Dharwad also producedthe seed.

b) NRCPB for gene construct and molecular analysis of gene integration and eventcharacterization of the original BN Bt and subsequently for purification of the BN­BtBNLA601.

c) CICR for co-ordinating biosafety from 2005-2008 ofBN Bt and Bt NHH 44 when Dr.B. M. Khadi was the Director

3. Wbat was the role of CICR in tbe development of BN Bt?

Bio-safety studies were coordinated from 2005-2008 through CICR under the leadership ofDr B. M. Khadi, Director CICR

4. We understand tbat tbe 'BN Bt' material from TI to T 3 generations during 2001­2004 were tested for presence of cry lAc at 'Bt referral lab' at CICR, Nagpur. Whattype of planl malerial and huw many samples were tested?

Samples from VAS Dharwad were brought only once to CICR in 2002. 874 vials containingcrushed leaf homogenates were brought on 9 th December 2002 by Dr Vamadevaiah, Assoc.Prof Biochemistry and Miss Anita (RA VAS Dharwad). All the samples were tested throughELISA for presence ofCrylAc protein.

The analysis was carried out only to help/assist the researchers. I was not associated in theNATP project, though some initial preliminary proposal documents listed my name foraspects on resistance management.

5. When was the 'Bt Referral Lab' established at CICR, Nagpur?

The CICR laboratory was declared as Bt referral laboratory on 1211> N<>vember 2003

6. What were the techniques used to detect the presence ofcry lAc, BN Bt event andCry protein? Were the samples also tested for 'MON 531'? What were the resultsand were these communicated to UAS, Dharwad?

Only ELISA techoique was used to test the samples for the presence ofCryIAc protein. Thesamples were not tested for Mon 531. Some samples were positive. Dr Vamadevaiah carriedthe results with him personally.

7. DUring 2005, what plant material and how many samples were analysed for thepresence ofcry lAc, 'BN Bt' event and Cry protein.

a) Twenty leafsamples were sent by Dr V. V. Singh in August 2005. Sixteen werepositive forCrylAc protein on ELISA test. Sixteen samples were also positive onPCR for 500 bp amplicon ofcrylAc gene. PeR gel was run on 21-8-2005.

b) Twenty two Ieafsamples were sent by Dr V. V. Singh on 13-9-2005 and tested for thepresence ofCrylAc protein using dip-sticks. Nineteen were positive.

c) Nine leafsamples were sent to the lab on 26-9-2005 by Dr Sumanbala Singh forCrylAc ELISA. Seven were positive for CrylAc protein.

d) Ten DNA samples (DNA extracted on 19-8-05 and positive for crylAc) were testedfor Mon 531 5'-junction region specific primers using PeR on 27-9-05. All ten werepositive for Mon 531.

e) Thirty seven leafsamples were sent by Dr V. V. Singh on 27-9-05. PCR testing wasdone on 29-9-05 using three primers specific for Mon 531. Six were homozygous andtwenty three were heterozygous for Mon 531.

f) Sixteen samples were sent by Dr V. V. Singh on 9-10-2005. Mon 531 event specificprimers were used in PCR on 11-10-2005. Six samples were homozygous and eightwere heterozygous for Mon 531.

g) No primers were available for BN Bt.h) The results (ELISA print-out and gel photographs) were communicated, to Dr V. V.

Singh, Dr Sumanbala Singh and Dr B. M. Khadi immediately after the tests.

8. What was the sonrce of these samples, i.e., who provided these samples?

The names ofscientists who sent the samples to the Bt ReferraVtesting Lab have beenmentioned above. Source ofthe samples may please be obtained from Dr B. M. Khadi.

9. What were the results?

Results presented above

10. We understand that these samples were also tested for presence ofMON 531 event.What prompted to test the samples for presence ofMON 531 event when it was notdone in previous years, i.e., from 2001-2004?

The samples tested on 911> December 2002 were only tested through ELISA for thepresence ofCry1Ac protein-toxin as requested by Dr KhadiIDr KatageriIVamadevaiah.

-,--

-

----

--------

-

---

-

--

-...

----

--

Dr Khadi requested for crylAc specific PCR test in August 2005. The crylAc specificprimers used in the referral laboratory were actually specific for a region at 2619 bp to3117bp in the full length 3534 bp crylAc gene ofMonsanto's Mon 531 event. Theseprimers were used routinely in the lab with the samples in PCR tests carried out on 21-8­2005. The primers were designed in the Bt-referral lab for routine testing of Monsanto'sBt-cotton. It was realized later that the amplicon was not expected to have been presentin the truncated 1848 bp crylAc gene used in BN-Bt. Therefore PeR tests wereconducted on 27-9-2005 with Mon 531 5'-junction region specific primers on 10 samplesthat had been previously tested positive for crylAc on 21-8-2005. All the samples thatwere positive for the crylAc gene were also found to be positive for Mon53 I -5'junctionregion.

Subsequently 37 samples were tested on 29-9-2005 for the 'three-primer Mon 531 eventspecific test'. Six samples were homozygous for Mon 531.

n. Were the results communicated to Dr Khadi and/or Dr Katageri? Werecommunicated, verbally or in writing? Ifnot in writing, why?

The results were communicated to Dr B. M. Khadi verbally as well as the result sheetswere given to him. The gel pictures were shown and the implications were explainedclearly. The Bt-testing laboratory facilities at the institute are used commonly to assistscientists in their work. There is no such practice at the institute to prepare a writtenreport for internal samples provided by scientist colleagues. However result sheets areprovided and verbal communication is done normally as was done in this case.

12. Did 'Bt referral Laboratory' test the samples between 2005-2008? What were theresults? Were the results communicated to the concerned?

Samples for DNA tests were NOT received by the Bt referral laboratory after 11-10-2005 andbefore 26-4-2008. ELISA tests may have been done sometimes since the laboratory assists allthe scientists of the institute for Bt ELISA testing routinely.

13. Did you inform your seniors about the presence of MON 531 event in the BN Btmaterial?

Yes. The presence ofMon 531 event in the putative 'BN-Bt' material as a 'perceivedconcern' was informed in August 2005 to

I. Dr B. M. Khadi, Director, CICR2. Dr Sheoraj, Head Crop Protection and3. Dr S. K. Banerjee, Principal Scientist Entomology.

14. Why not others, i.e., DDG (CS), Dr V.V. Singh and Dr Sumanbals Singh?

It was only a perceived concern at this stage in 2005 and Dr B. M. Khadi was to takeremedial measures ifneeded. In any case, it would be the job of the Director to inform DOG(CS), not that ofa senior scientist (I was senior scientist in 2005). After the matter wasbrought to the notice of the immediate seniors Dr S. K. Banerjee, Principal Scientist,Entomology, Dr Sheoraj HOD, and Dr B. M. Khadi, Director, there was no perceived need to

--

mention the same to anyone else. Dr V. V. Singh and Dr Sumanbala Singh were providedwith the result sheets as is the normal practice.

15. There are various documentslletters from CICR during 2008-2009 regarding theperformance, spacing, fertilizer requirement, seed production, t"lXation of price forprocurement of BN Bt from UAS, Dharwad and t"lXlItion ofsale price. Under whatcircumstances these communications have been carried out keeping in context theproblem existing with the BN Bt event?

There was never any context ofany admitted problem with the BN-Bt event about thepresence of Mon 531, mentioned by either NRCPB or VAS Dharwad until date at any pointoftime, until date, either before distribution of seeds for cultivation or thereafter. Howeverthe possible presence ofMon 531 in the 'purported' 10 BN-Bt seeds was discussed on 21 st

May 2008, only at the behest ofDr B. M. Khadi who brought it to the notice of the DOG(CS). There were no instructions from the ICAR headquarters, or any contra-indications fromNRCPB or VAS Dhawad subsequent to the meeting held on 21 st May 2008, at any point oftime before the seeds were distributed for cultivation, either to go slow or stop distribution orre-examine the commercialization or any such instruction contrary to the process ofcommercialization. Therefore CICR went ahead with the process ofcommercialization.

There were two meetings held in 2008 under the chairmanship ofthe DOG (CS). The fIrstmeeting was 'regarding road map for the promotion and utilization ofBN-Bt cotton' held on21 st May 2008 and the second meeting held on 12th December 2008.

In the fIrst meeting on 21 st May 2008, the 'presence ofMon 531 in eight out often seedsprovided by Dr B. M. Khadi' was discussed. Also the issue offlanking sequences(Avesthagen data) submitted to GEAC for BNLA60 I was discussed. The Avesthagen datacharacterizing BNLA601 event showed right border cotton genome sequences flanking the T­DNA insert which were convincing, since the junction region specifIc primers amplifIed theBNLA60l-event-speciflC amplicon in the WD tests as presented by Dr KatageriIDr P. A.Kumar. However the right border flanking sequences were not contiguous with left bordersequences ofcotton on the corresponding bac clone sequence available on NCBI. I hadsuggested that these sequences may be re-examined and also that an independent laboratoryconfIrmation may be carried outto rule out the possibility ofany presence ofMon 53 I.However the Director NRCPB asserted that the data were correct He made a presentation ofthe unique nature of the Dharwad event based on flanking sequence analysis. The left borderflanking sequences belongs to cotton hac clone No. I06 I 22(NCBI) and Right border belongsto Iipoxygenase (Lox I) gene. Dr Kumar also presented the results of BN-Bt analysis to showthat the Dharwad event is different from that of the other known Bt transgene events.

---

...

--

----

The Director NRCPB asserted that molecular studies conducted by him using seeds providedby Dr Katageri, did not show any presence ofMon S31 in the seeds tested by them. DrKatageri also said that pure seeds were available at VAS Dharwad which did not containMon S3 I. Further, strong convincing evidence ofLOD (limits ofdetection) data based on thejunction region ofthe right border ofthe T-DNA of the 'BNLA601' event was presented toshow that an original event was present. The data were oulsourced from Avesthagen. ...

Based on the discussions all members agreed to make efforts to commercialize this event bydeveloping popular -Bt varieties and hybrids. VAS Dharwad was asked to take up seed

...

----

--

--

-

....

-

-

--

production ofBN-Bt in 150 acres and Bt-NHH-44 in 200 plots ofUAS Dharwad farm. DrKatageri assured to produce pure BN-Bt seeds without any chance of Mon 531 in the seeds.

Between 21 st May 2008 until 12lh December 2008, at the instance of the AOG (CC), only onedocument was prepared to finalize commercialization modalities.

The second meeting was held on 12lh December 2008 under the chairmanship of the DOG(CS), to f"malize the commercialization modalities of 'BN-Bt' Bt-cotton event, BN-Bt varietyand the Bt-cotton hybrids developed using the 'BN-Bt' event. It was expected that if any Mon531 presence would have been detected by NRCPB and UAS Dharwad in the BN-Btfoundation seed at UAS Dharwad in the interim period of6 months between 21st May and12th December 2008, the same would be pointed out by the concerned scientists. However,the Director NRCPB and Dr Katageri participated in the meeting and the discussions clearlyindicated that all required tests were conducted by all concerned and that everything was fmewith the seed production and the seeds were ready for commercialization and the same wouldbe transported to CICR in Jan-Feb 2009.

The proceedings of the meeting held on 12th December 2008, emphasized on the need topopularize BN-Bt, submit PPV & FR application and finalization ofcommercializationformalities by CICR. The Director NRCPB and the scientists from UAS Dharwad wereabsolutely confident and assured that everything was fine with the BN-Bt seed produced forsale. The documentslletters from CICR during 2009 regarding the performance, spacing,fertiljzer requirement, seed production, fixation ofprice for procurement ofBN Bt fromUAS, Dharwad and fixation 'ofsale price etc were based on these meetings and were done incompliance with the proceedings ofthe meetings held on the 12th December 2008.

The proceedings emphasized on active commercialization, based on which the process tocommercialize was intensified by CICR immediately from January 2009. Preparatoryarrangements for seed packing were made, commercialization modalities worked out, Pressnotes were issued and PPV & FR application filed.

16. CICR sent some quantity ofseed to UAS Dbarwad tbrougb special messenger, SbS.P. Mucbali on June 13,2008. Wbat was tbe quantity ofseed? Wbere and how thisseed was produced? Wbat was tbe source of seed to produce this seed?

The seed may have been about two to three kg packet received by Dr P. R. Bharambe, Head,Crop Production Division, at his residence address. Dr Bharambe handed it over to Dr V. V.Singh who did not open it and the same was returned back to Dr Katageri through Sh S. P.Muchali. The original source ofthe seed was Dr Katageri who sent it for trial purposes toCICR.

17. Was tbe seed received from UAS Dharwad packed in different lots?

Yes. Seeds were received in only two lots as. The lot-I was 165 q and and lot-2 had 84 q.

18. We understand that UAS Dharwad sent seed ofBN Bt packed in different lots. Wasthe packing done at CICR? WhO monitored the packing ofseed? Do you have lot-

.wise record ofseed sold to different seed producing agencies? Please provide therelevant record.

There were only two lots which were packed. The seed given to Mahabeej were from the lot­I and lot-2. All other agencies received material from lot-2. The packing was done at CICRunder the direct supervision of Dr V. V. Singh and Dr P. R. Vijaya Kumari, Senior Scientist(Seed Technology). Relevant records have been submitted to AOG (Ce).

19. We understand that the seed sent by UAS Dharwad to CICR during 2009 was TL.Why TL seed was sold to various agencies to produce seed of BN Bt and Bt NHH44?

A letter written by Director ofResearch UAS Dharwad to Mahabeej on 2-6-2010 clearlymentions 'the BNBt seeds produced by the scientists ofAgricultural Research Station,Dharwad during 2009-10 were supplied to CICR, Nagpur for seedproduction ofNHH 44Bt'. A copy of the letter has been submitted. Please note that the letter erroneously mentionsthe date as 2009-10 instead of2008-09 which was when the seeds were supplied to CICR,Nagpur. In the discussions that were held previously with Dr Katageri regarding seedproduction, he stated that the BN-Bt seed provided to CICR could be used for further seedproduction, since this was the only lot available at VAS Dharwad which was multiplied underhis direct supervision.

20. Test were performed by CICR and NBPGR on the seeds drawn from seedproduction lots (report submitted in 2010 stating that all the samples containedMON 531 event). What was the source of seed? If it was received from VASDharwad during 2009 then why the seed was sold to different seed producingagencies in the light of above report? Please provide the report received fromNBPGR.

The study was carried out in 2010 by CICR and NRCPB under the instructions ofthe DOG(CS) for re-confmnation. When the study was carried out in 2010, the results couldn't haveany reference for seed distribution done in 2009.

Seeds were randomly drawn from lot-I and lot-2 and mixed. One batch of 100 gms was sentto NBPGR and other kept at CICR for future reference. These seeds were tested for ELISA inMay 2009 for the presence ofCry lAc. The seeds were 94% positive for CryIAc. The seedswere tested later in August/September/October 2009 for Mon 531 only after repeatedproblems were noticed in fields. Copy of the NBPGR report has been provided to the ADG(Ce).

21. Why did yon not get tested BN Bt seed received from UAS Dharwad and given tovarious indenters during 2009 for the presence or absence ofMON 531 since youare the Director, CICR, Nagpur?

Farmers in Central India procure seeds in April-May. The seeds from VAS Dharwad werereceived very late in May 2009. Sowing starts immediately after the flI'5t rains in early June.The seeds had to be manually weighed and packed into :::13,000 packets. Farmers, Mahabeejand other agencies were extremely anxious. There was hardly any time for any detailedmolecular testing during the period. Since the VAS Dharwad and NRCPB had stronglyassured their responsibility for the event purity and seed purity ofBN-Bt, the immediateurgency to conduct molecular testing was not felt.

-----------

-

--

-

-

--

--

--

22. Did CICR receive any complaint from seed producing agencies otber tbanMAHABEEJ?

Seed production was taken up only by Mahabeej and no other seed producing agency.

23. MAHBEEJ never mentioned segregation for petal colour (visibly one of the mostprominent traits to observe), bowever, in tbe various documents submitted in Iigbtof above complaint tbe segregation for petal colour was mentioned. Was it from thereports of various monitoring teams visited seed production plots of differentagencies? Please provide the reports.

The MAHABEEJ mentioned segregation for petal colour in their letters. Copy of the letterhas been provided. Copies of monitoring team reports were sent to the ADG (CC).

24. When you know the problem as early as 2005, why did not inform seniors?

Whatever information was known to me in 2005 was informed to my immediate seniors, DrS. K. Banerjee, Principal Scientist, Entomology, Dr Sheoraj HOD, and Dr B. M. Khadi,Director at CICR.

25. Why did not inform DDG (CS) and DG, after you took over as the Director, CICRparticularly at the Directors' Conference wherein all are present?

I took over as Director in February 2010. By then the matter was discussed in detail on lOthDecember 2009 under the chairmanship of the DDG (CS) and decisions were taken. I tookover as acting-Director on May 24th 2008 and the matter was already discussed in detailunder the chairmanship of the DDG (CS) on 21 st May 2008 and decisions were taken. Therewas no perceived need for any further discussion in any forum. Once the matter has beendiscussed in detail with the DOG (CS), it is his prerogative to take it further with the DG ifneeded, not that of the Director.

26. You praised performance ofBN Bt even after taking over as the Director, CICRbut your stand changed after the problem came into open. Please comment.

Whatever I did to promote and commercialize BN-Bt and Bt-NHH-44, was in compliancewith the decisions taken by ICAR headquarters as laid out in the proceedings of the meetingheld on 21 st May 2008 and also the crucial meeting held on 12th.December 2008 under thechairmanship of the DDG (CS). As the acting-Director of an ICAR institute I followed theinstructions. I did not praise the performance ofBN Bt. I only spoke about the possiblevirtues of a Bt variety, which I helieve can be superior to a Bt hybrid, since the seeds do notsegregate for the Cry toxin in the bolls of straight varieties as it happens in hybrid plants. Weat CICR would have certainly been happy if the seeds were pure for the BN-Bt event asassured by the breeders ofUAS Dharwad and the Director NRCPB. Based on their confidentassurances, the support was complete from CICR and in compliance with the proceedings ofthe meetings held on 21 $I May 2008 and 12th December 2008.

I informed the DDG (CS) immediately after our results showed that all the BN-Bt Cry1Actoxin positive seeds were found to contain Mon 531 event. The problem never came intoopen before that. I also informed the DDG (CS) in a detailed letter in October describing allthe issues related to BN-Bt in detail requesting for guidance.

27. CICR under you takes credit in the development of BN-Bt but your stand changedto that BN Bt is developed by VAS Dharwad. Please comment.

It is grossly incorrect to say that CICR took any deliberate credit for the development ofBN­Bt cotton. The role ofCICR was clearly that ofbio-safety prior to 2008 andcommercialization subsequently. The commercialization process was in continuation of DrKhadi's biosafety co-ordination work at CICR. It was known to the entire cotton fraternity,that the BN-Bt product was developed under his leadership at VAS Dharwad in collaborationwith NRCPB. There was no other second opinion to that and it is wrong to say that CICRclaimed any credit at any point oftime. The current Science paner on BN-Bt (I. S. Katageri.H. M. Yamadevaiah. S. S. Vdikeri, B. M. Khadi and Polwnetla A. Kumar. 2007. Genetictransformation ofan elite Indian genotype ofcotton (Gossvoiwn hirsutwn L.) for insectresistance. Current Science. 93, 1843-1847> and the WCRC-4 paper and several otherdocuments credited the development ofBN Bt only to NRCPB and VAS Dharwad. CICRwas mentioned because Dr B. M. Khadi was the Director CICR when the paper wassubmitted and published. There was no attempt whatsoever by any of the CICR scientists tostake or make any claim in the development ofBN-Bt, which is very clear from the paper,wherein, there are no acknowledgements or any references to the role ofCICR in the processofproduct development and testing or any role ofany kind until 200712008. It was only inMay 2009 that at the insistence ofDr Khadi, the names ofDr Sumanbala Singh and DrBalasubramani were included in the PPY & FR application.

The role ofCICR was in compliance ofthe ICAR meeting proceedings that the BN-Bt was tobe promoted and commercialized, which we effi:ctively did.

There is no evidence anywhere that I have ever used or even mentioned BN-Bt anywhere inmy bie-data at any point oftime or for that matter for any purpose ofcredit whatsoever. As amatter ofprinciple, I have always taken credit only for whatever scientific work that I havedone. I was recogniied as the ICAC International researcher of the year in 2009 by ICACWashington only for the work that I did on development of immunological strips and IRMstrategies for bollworms. I never felt the need to take even an iota ofcredit for the productBN-Bt which was not developed by CICR. I have my own standing as a scientist and havenever felt the need to include anything not done by me for credit.

28. When you were aware of the problem, why did not inform GEAC? Did you sign theapplication submitted to GEAC?

I was not aware of any problem. I only analysed samples provided by Dr B. M. Khadi. I didperceive it as a possible problem in 2005 if the tested material was authentic BN-Bt whichcould be authenticated only by Dr B. M. Khadi. I informed my seniors including Dr Khadi,who informed that he would sort out the issue in consultation with Dr P. A. Kumar and DrKatageri. The matter ended there from my perspective. Subsequently when Dr Khadi gaveme 10 seeds in 2008 and asked me to test for the presence ofMon 531, Itested them andinformed the results. Only he knew the authenticity of the material he had provided in 2005and the seeds that he gave for testing in 2008. Ifanything Dr Khadi may have been aware ofthe problem, not me. The samples tested, were and still are considered by our lab as unknownsamples which were found to contain Mon 531. I had always maintained and shall still do sothat the results reflect concern only ifthe test-sample material and the test-seeds areauthenticated by Dr Khadi as original BN-Bt seeds, something which he never ascertained.

------....

....

-

-----

....

-

-

--

-

-

,.....

I became aware of the problem only after August/September/October 2009 when moleculartests conducted at CICR revealed that the BN-Bt seeds provided to farmers, contained Mon531 event. I informed the DDG (CS) immediately verbally in August/September and later inwritten form in October 2009. Until August 2009, ClCR supported and promoted BN Bt andBt-NHH 44. If the ICAR would have instructed me to inform GEAC, I would have done so atany time after the problem surfaced.

I requested the GEAC in a signed letter in May 2009 to approve Bt NHH 44 in compliance ofthe proceedings of the meeting held on 12th December 2008.

29. Wben you were aware of tbe problems, wby CICR submitted tbe application forregistration of BN Bt during May 2009 to PPY & FR Autbority? Moreover, whydid you sign tbe application?

The Bt-testing lab at CICR assists all scientists in a routine manner. I only tested the fewunknown samples provided by Dr Khadi in 2005 and once in 2008. That does not make meaware of any problems. As mentioned before, the persons providing the samples only wouldknow the nature of the problems after coming to know the results depending on theauthenticity of the samples which only they can vouch for. They would have known theproblem and should have taken remedial measures, which was certainly not my'responsibility.

The two meetings held in 2008 under the chairmanship of the DOG (CS) discussed theconcerns tissues and prepared the proceedings giving the go-ahead for BN-Bt promotion andcommercialization. I was not aware of anything more which was not discussed in themeetings and of any other facts that were not known to the participants of the meetingsincluding the DDG (CS), Director NRCPB, Dr B. M. Khadi, Dr Katageri, UAS Dharwad andconcerned AOGs.

The submission of the PPY & FR application was in compliance of the following:

a) The meeting proceedings of21 st May 2008 and 12th Dec 2008 emphasized theneed for PPY registration as important recommendation.

b) A letter received from the Director NRCPB dated 9-1-2009 andc) The letter received from AOG (IPR), ICAR on 13th April 2009 linked the PPY

FR application as mandatory requirement prior to commercialization and alsostated that only CICR should submit the PPY & FR application.

Therefore CICR forwarded the application on 7th May 2009 before commercialization tocomply with all the stated requirements as per the instructions laid out in the meetingproceedings and the letter received from ADG (IPR).

I signed the PPY & FR application as the forwarding authority as the acting Director of CICR(lCAR) on behalf of the five scientists. I signed on all the pages because it was a mandatoryrequirement.

30. Tbere are some differences in tbe minutes of various meetings like May 21, 2008and Dec. 10,2009 and scbedule of events in tbe development ofBN-Bt? Wbat areyour views particularly regarding discussion on BN-Bt in two proceedings?

80

The proceedings of the 10th December 2009 meeting were actually based on the text that Ipresented as slides in the meeting. The detailed text in my slides was presented in achronological manner constructing the sequence of events so as to apprise the DDG (CS)with complete details ofthe entire matter as much as was known to me. The followingpersons were present in the meeting DDG (CS), ICAR., Chairman, ADG (CC), ADG (lPR),Director, NRCPB; Dr K. R. Kranthi, Acting Director, CICR, Nagpur; Dr Suman Bala Singh,Principal Scientist, Plant Breeding, ClCR, Nagpur; Dr Shalimath, Director, Research UASDharwad; Dr Krishna Kant, Director, Seeds, UAS Dharwad; Dr B. M. Khad~ Director,Instruction, UAS Dharwad; Dr Katageri, Principal Scientist, UAS, Dharwad; DrVamadevaiah, Principal Scientist, UAS, Dharwad and Dr Udikeri, Senior Scientist, UAS,Dharwad. The proceedings were prepared by me at the request of the ADG (CC) andsubmitted to him in December 2009.

31. Please authenticate the proceedings of the meeting held on 10.12.2009 with records.

All the pages of the proceedings prepared by me were signed /authenticated and sent to theADG (CC). The matter was discussed in complete detail in the presence of the DG on 27th

December 20i I. Kindly refer to the proceedings approved by tbe DDG (CS). Therecords/data mentioned in the proceedings have been submitted to the ADG (CC) and can beobtained from his files.

I hereby affum thal the information provided above is true to the best ofmy knowledge andinforllUlJion.

CII1'-..".. '.'..... <.' '

, . ,"

K. R. KranthiDirector, ClCR

25-4-2012

-...

...

...

-...

--...

------

--

-

---

--------

--

ANNEXlJRE-VI-B

Discussion meeting with Dr G. Balasubramanl, Senior Selentist (Biotech), CICR, Nagpur on April OS,

2012

1. What was your role in the development of BN Bt?

Iassisted Dr B. M. Khadl, Director, CICR In the b10safety requirements for BN Bt. I compliedthe data prepared reports for submission to RCGM!GEAC, New Deihl.

2. Old you take various tests to ascertain the presence of cry lAc in BN Bt?

During Multl-location Confined field trial (2006-07), expression of CRY protein

was tested in BN Bt at various stages of plant growth viz., 60, 90, 130 and 160

days by conducting ELISA in my lab. ELISA testing was ALSO carried out at

respective centres by the concemed scientists using ELISA kits sent from CICR.

3. Old you test the various samples proVided by Dr Katageri ! Dr Khadi for the presence of cry lAc

in BN Bt material?

No, I did not receive any samples from Dr. Katageri I Dr. Khadi for testing

cry1Ac gene presence in BN Bt.

4. Specify the years when the various tests were undertaken?

Only ELISA (Bt-Quant) was carried out by me during RCGM trial (2006-07) with

BN Bt.

5. What were the results? Please provide details about material received and tested also.

CRY Protein results are attached herewith. No separate materials were received or tested,only leaf samples from RCGM trials of BN Bt were collected and were tested with EUSA (Bt­

Quant)

6. Did you inform the results of various tests undertaken by you to concerned quarters? Please ifpossible provide relevant records.

CRY protein expressions were submitted to Dr B. M. Khadl and reported to

RCGM/GEAC, the results are provided In the following table.

7. In which year, the BN Bt material was tested for the presence of MON 531 event? Whatprompted you to test the material for MON 5311 What were the results? If the material were

positive to MON 531, did you inform the seniors about this? Please provide relevant records, if

available?

Not applicable, I did not test for the presence of MON 531 event.'

8. Old you know about the presence of MON 531 in BN Bt?I was Informed that there might be a contamination with MON 531 event, but It was not

confirmed. I believed BN Bt was a genuine event.

9. When did you come to know about this? What was the source?

-----

In May 2008, Dr. B. M. Khadi was worried about some results reported by Dr. K. R. Kranthi,

I.e. MON 531 event contaminations, but he did not believe and told me that BN Bt event(BNLAI06)Is a pure one, flanking sequences were also confirmed. Thus I trusted and

continued to support the BN Bt. Since in May 2009, Dr Khadl asked me to Include my name In

the PPV & FR application, In recognition of the hard work that I did for biosafety testing, data

compilation and report preparation. I agreed and collated the PPV & FR fonns, obtained the

signatures, signed the application and submitted the same personally at the PPV & FR office.

But after commercialization It became big Issues.

Cry Protein estimation by ELISA test

-

--

-

Title

Objects

Experiment conducted at

Date of study

Date of submission of RCGM

Experimental Design:

Quantification of crystal toxic protein production

in transgenic plants using Bt-Quant).

Estimation of Cry! Ac Cry protein production at

various stages of plant growth in the transgenic

cotton plants.

ClCR, Panjari farm, Nagpur.

During Kharif 2006-07

After the trial, the results were submitted to

RCGM, DBT, New Deihl.

-Fresh leaf samples (second or third leaf from top) were collected from the field using cold

container. Around 10-12 mg of leaf disc was made and proteins were extracted by ice-cold buffer.

Then 50 ttl of samples were used for estimation of Cry protein using ELISA protocol. The estimated

values are. presented in the table-21. In general the protein expression found highest In early stage

of plant growth (S-71J1l) and decreasing trend in later stage. However the Cry protein expression was

recorded 4-6 IJIl even after 130 ~ays of plant growth.

Table: 21. Cumulative data of Cry protein expression In leaves at different stages of plant growth

(l'I!g of fresh leaf total protein).

Entry Name 6O-days 9O-days 13O-days l6O-days

OBt- HI 7.230 6.102 4.250 0.337

NHH-44 5.852 5.165 5.178 0.221

OBt- H2 5.123 4.836 4.180 0.259

OBt- H5 5.558 5.758 4.398 0.346

BN-Bt 6.160 5.129 4.642 0.245

--------...

----"---...

---

--

ANNEXURE-VI-C

Discussion meeting with Dr Suman Bala Singh, Principal Scientist, CICR, Nagpur on April OS, 2012

The presence of cry protein was tested at all the stages of back crossing using Elisa kits and Dipsticks.

-9. Did you inform the results to your seniors? Provide details.

Yes, the results were presented / discussed dUring the monthly meetings and IRe.

-

-

-

10. How many genotypes were taken for transfer of cry lAc from BN Bt?

Sixty one genotypes from different cotton growing regions of the country were selected forconversion.

11. What were the tests performed for the detection of cry lAc during transfer?

Elisa kits and Dip sticks were used.

12. What was the segregation pattern of cry lAc during backcrossing?

50:50

13. Was this material also tested for the presence of MON 531 event? If yes, when was thepresence of MON 531 conveyed to your seniors? Give details.

No.

14. What is the present status of this material?

The material is in various stages of backcross (BC 2 to BC 4F3).

15. We understand that some quantity of BN Bt seed was sent to UAS Dharwad during 2008 fortaking seed production? Where and how much seed was produced? What was the quantity ofseed sent to UAS Dharwad?

BN Bt seed was not sent to Dharwad. The seed which was receiv.ed from Dharwad itself was

sent back without opening the packet and was delivered by hand.

16. Did you observe any variation/~ation for morphological traits during seedmultiplication?

The seed was not multiplied at Nagpur.

17. Were you also involved in the packing and sale of BN Bt?

No. Dr. V.V. Singh and Dr. P.R. Vijayakumari were involved in seed packing

18. Old you raise any trials to know the performance of BN Bt and Bt NHH 44 at eleR? If yes, inwhich year and what was the source of seed? What was the performance of BN Bt and BtNHH 44 In these trials?

Yes. RCGM trial was conducted in 2006-{)7 to test the performance of BN Bt and NHH 44 Bt.

TIie seed was received from Dharwad.The performance of BN Bt and NHH 44 Bt was better than their non Bt counterpart as well as

the local check varieties and hybrids.

19. There are some reports from elCR about the presence of MON 531 In the transformed BN?Were you aware of that, if so, when did you know of that? Did somebqdy inform you takeaction?

I was not aware of the presence of MON 531 in the transformed BN as it was never discussed inany meetings. I came to know only after the commercialisation of BN BT when complaintsstarted coming in about the variations in pollen and petal colour, presences of non BT plantsbased on boll worm attack and presence of MON 531 event.

20. If no action was taken, why so please?

Since Iwas not aware of the presence of MON 531 in transformed BN, no action was taken.

&6

----

---

-------

--

Zimbra

ANNEXURE-VII

Zimbra

RE: CrylAc-NRCP,B

sonti@ccmb.res.in- .._--------_._- -_..__._----- --

..... -. ------ ---------_._--_.

From: Polumetla Ananda kumar<polumetla@hotmail.com>,

Subject: RE: Cry1Ac-NRCPB

To : sonti@Ccmb.res.in

Qear Dr Ramesh garu,

Fri, Jun 29, 2012 10:58 AM

01 attachment

The sequencing of T-DNA of BNBt event has shown a few interesting things.

1. A short stretch of OCS terminator got deleted (104 bp) which explains why wenever got PCR amplification (based on OCS-terminator primer sequences).2. Nos terminator and interstitial space got duplicated in reverted direction.

I attached a PPT slide depicting the current status and features.The sequence files Wi!' be sent after arranging them in order.

SincerelyDr P; Ananda KumarProject DirectorNRC on Plant BiotechnologyIAR! CampusNew Delhi 110012, IndiaPhone: 091-11-25848783Fax: 091-11-25843984Email: polumetla@hotmail.comkumarpa@nrcpb.orgWeb: www.nrcpb.org

From: polumetla@hotmail.comTo: sonti@ccmb.res.inSubject: RE: Cry1Ac-NRCPBDate: Tue, 5 Jun 2012 10:25:18 +0000

Dear Dr Ramesh garu,

The sequencing of T-DNA of BNBt is almost complete but for a small segment at thecentre.The progress is slow because of reasons associated with my RA's health and familyproblems.

http://webQla!1.ccmb_res.inIzimbralh/printmess~e?icl'C4312J!if.. '.~ _. .... •

SEQUENCING OF BNBt T-DNA(June 29, 2012)

't "riA, 1358

-p EJ VB I

?

HindIlI

IVB Bios-f kOS3'~o;'1nptlI110r:f)

OCS3'(87 bp)104 bp deletion

NOS3'(28 bp)To be sequenced further

1. IS: Interstitial space2. 1848 bp of cryIAe is intact.3. A deletion of 104 bp occurred in OeS-terminator4. IS and Nos-terminator got inserted in inverted direction after OeS-terminatorS. Nos-terminator of cryIAe is sequenced up to 28 bp. To be continued further.6. A short distance is yet to be covered by sequencing (designated as: ?)

ANNEXURE-VIII-A

¥tl.'!\ .

.' 'k

~:!.3'

~I~~ q]Gq ~~~m;:r~NATIONAL RESEARCH CENTRE ON PLANT BIOTECHNOLOGY

'iffi '!fuR. ~ ~-110012 ('lfffil)PUSA CAMPUS, NEW DELHI-110012 (INDIA)

<no '!fto 311'10<~q~4)\iI"'1 ~

Please find enclosed a Comprehensive analysis of trallllllotlio cotton (BNBt)developed by UAS-DharwadlCICR. As per the suggestion of DOO (CS), BNBtevent has been purified by UAS (0) and provided to NRCI'D tbr analysis and itscomparison With Mon 531 (Monsanto's BG I event).

---

-

Dr. P. Ananda Kumar

Project Director t--I u' r--.I (J..c.(' f3rf' So - '1 'L.(~er '7

Dr S. Ayyapp;:nDirector Genel'll!, ICAR and Secreatary DAREKrishi BhavanNew Delhi 110114

Sub: Molecular analysis ofBNBt

Dear Sir,

Ocl"hcl 20, 20 I I

~ analysis wteqiJivocally confirmed dllit BNBt is a uniqllf ',*,I and is exactlysiIIJiIar to that cksaibed in the Pl!bJicalion in Ctum1tS~7) by Katageriera!. . '. -

I MqUest you to take suitable actlon for further~ of BNBt by itsdt:pIoymeDt incotton hybrids ofNARS. ... '

a..regairds

Si~

.,'

E-mail: kumarpa@nrllt,b,"'ll and poIumetl

Copy: .

~J. ·~\t\1

--;;/d /~\ V. V I

Dr S. K. Datta. DDG (CS), lCAR . t- (U.~Dr R.R. HancbinaI, Ville Chancellor, UAS-D I.Dr B. M. Khadi,.Dean, PG Studies, UAS-D &)), 'L (( )Dr K.R. Krantbi, Director, CICR r ~Dr L S. Katageri, Principal Cotton Breeder, UAS-D blo4 ~1.(.. ,r ,,.\

. :;iI, \\'1 ~

~ .PP·"P.Aninda Kumar

!'hone: (0) 01'1-25848783. Fax: 011-25843984 (R) 011·25841748.

I-

-

ANALYSIS OF BNBt

1. Gene

Comparison ofcrylAc-NRCPB and crylAc-Monsanto (Mon 531)

._------ --_. --_.Cry1AcrNRCP8 Cry1Ac-Monsanto

1. Length (bases) 1.848kb 3.51cb2. Promoter CilMV 355 Enhanced 35 S3. Terminator QcsandNos 7S terminator

4. Marker nptll nptllS. Vector pBin Bt3(12.7kb) f>lM>HBK04{1l.4kb)6.80rders RB and LB (from Only RB (from p1137)

pl137)

PeR ani!lyslsfor transgene i~t1on.(A) PCR with crylAc speelfltprillUllS gIvIng an ampUcon of 1kb(8) peR lInalysiswith nptll spedfu; primers ~v1hllan ampltconof 750bp(e) PCR anatysis with cry1Ac C·terminus prirnelS that liTe specific to MON531 giving an

amplicon of 1.1kbM-1kb ONA ladder 1- IlQn-tran.tgenk:amtrol 2- MONS:U3 - BNBt 4 - water control S.p8InBt3

~o

---------------

-

---

,,I

____~ 1'1-'''1 ElEB__"_"_"_'_-...JEEEJ---­-

PeR analysis of dY1Ac-nos terminator: Forward primer specific to (ryIAeand reverse primer specific to nos terminator 'Were used to amplify aproduct of 1.2 kbM-lkb DNA ladder 1· non-transgenic control 2- MON5313· DN81 4- water control S·pBinBt3

2. Event

BNBt Mon 531

1. CoPY"number One One full insertion alongwith truncated copy

2. Integration site Gossyploides kirkii Similar to Ochromaclone GKH016Uo- pyramidale 265jmd ribosomal RNA gene

3. Features Has an integration Has an truncated Insertof-4kb vector at RB end and -2.5kbbackbone at LB and vector backbone at-1.8kb at RB opposite end

Integration pattern of crylAc-pvGHBK04 In cotton genome in MON531 event

Integration pattern of crylAc-pBinBt3 In cotton genome in BNBt event

----I VB m nptll ~ cry/A.c ~---J

I

'11

PeR analysis of presence of NOS proniater a unlque feature of the vector.Forward primer was designed in Nos promoter and reverse primer onbackbone of vector that is inserted Into cotton genome. The amplieon sizeIsof 1.4kb.M-lkb DNA ladder 1- non-transgenlc.controt 2- MON5313 - BNBt 4- water control S-pBinBt3

+-,-----__.:"'"_~ nptll

~

3. Southern Analysis

,-_""_'_A_C E:EEJ----.

-

-

-

-

--

20jig ofDNA from each sample wasrestricted to camplelion with HfnOllland probed with 1.Bkb Cl)'lAc framnent.

1- AHindIIl; 2- control DNA; "3- MON 531:2- 4- BNBt

Katageri et al. 2001(Current Science)

-

/,

-

4. Expression analysis

Northern analysisof transcript sizes of MON531 Jnd BN Bt. 1.8kb cry lAcprobe was used. The picture depicts the transCrIpts length in MON531 is

3.5kb and in BNBt it is 1.8kb.M- RNA ladder M53l- MON531 BNBt- Bt Bikaneri Nerma

l-

I'

qRT-PCRanalysisofexpression levels of c!vlAc In t\I 0M531 and BNBt

J

s.rCRby .Eveq.t Spe<:ilic primers

----EEE3 npIll

PCAantJ.ysis wl1h_ tpOCffio primeIs.~ primerJs plelIellt in_bocibooc oud_primerispn!OClIt ....oolIon genomic DNA .Tbcompllfiedproduct ofsize - 2.SI:b Is tJaIy_t in BNBtM-IId>DNAladder 1- nooH:nnIsg<niccontloI2-M0N5313· BNBt 4- water coDtmI SoflBinBt3

Primers Specific for BNBt

-

--

-

---

Z S'AACl;CGCGGC'rGAG S'CGCGGCCGTGAGGC 1.4kb

TGGCTCCTI'CAAC3' T'OOGACGC'rAGGG3'

3 S~CMQC;A 5'TGCMCTCAATM" 2,Skb

GG,lGCGCAiCCGACT3' GATI:CACCAOCe 3'

SoNo Pol"WU'd primer

1 S'ACGCCGC'OCCACA

ACAACGTS'

Reverse Ptimer Ampltoon

S'TAGATGACACCGCG Ukb

CGCGAT3' .

Feature

Coustluctspecific(Ac-n()ST)

BventspedficpriBJersl

BventSJIOGI1icprf$~

M0N531 BNBt

-ve +ve

-ve +ve

-ve +ve

rr-I-

94-

-

1-

Annexure I

Insect Bioassay of the leaves ofBNBt (Left) Bikaneri Nerma (Right)with the larvae ofHelicoverpa armigera

IAnnexure II

Wltat Is wroq Wltll Ranking ScqUlllltos alUl~(Av~t...genl:

• Tho fWIk1118 ~giOJ1S are CKpectlld f(j ~ Iire$8ll1118 II contiguous stretch of

l)N""1li:thlligM()mic seqUOMe ofnolmal (nOn.it'attsglmicI plants where the T·

fjhJif, ,.ij~ the genome at the integflltiot1 silll. In ·dIe -.Alysis carried out by

A.v~ lite integration sites at left border and right bonier regions are two

<tdtWhf genomic regions allro&elber. as MaI)rsod from sequence Ilomology.

The dglrt border i~on site~ AF3611193A (Avesthagen) and me left

b<lrllcr integnrtion site viz.. AY~:l360.1 (A~) de not overlap 01" show

me sequence homology to ... other.

• The lent bordeI' ftlIIIking~ obhriMd OQI1tlUos no signlfiollnt bomoIogy

tll the vector sequence used. The homoWgy shown conWns only the primer

sequence used fOf amplifying the f\anklng region. The odds ofhaving the. .

integnltion site exactly at the end ofprimclI" sequence are too low. This can

happen due tll non specific binding and{UllJIftficatinn ofthe primers used.

The above two reasons are .llmeient tll belteve the earlier flanking

sequence ~erimellts eondncted .were aawed and not sllfTtciently

analysed.

----------------

-

ANNEXURE-VIII-B

Characterization of the cry1Ac in the purported 'BNLA106' event

Submitted by Director CICR, Nagpur 18th December 2010

Objective: Testing of BN BT variety cotton seeds for cry1Ac gene events withspecific reference to the presence of 'Mon531' event and or 'BNLA106' event.

Summary: Event specific primers of 'MON531' and 'BNLA106' were used tocharacterize the seed lots of BNBt and BtNHH44 that were produced by UASDharwad and commercialized through CICR, Nagpur. The primers for 'MON531'event are standard and used regularly in the Bt referral laboratory to detect theevent for all legal purposes as directed by the judiciary. The primers for 'BNLA106'were based on the flanking regions of the cry1Ac insert of 'NRCPB' New Delhi.The gene construct and the sequences were provided by Dr P. Ananda Kumar,Director, NRCPB and submitted to the GEAC prior to approval. The genesequences of cry1Ac of Mon531 and the gene sequence from prof lIIimar Altosaarare >99.4% identical up to 1857 bp of the 5' region. The cry1Ac in 'MON531' eventof Monsanto is a full length gene and is 3534 bp in length. The details of primersand the brief methods are provided below:

Samples: A total of 8 randomly selected packets of BNBt I BtNHH44 (2 each)belonging to different seed lots were used for the study. Twenty five seeds fromeach packet (2kg pack BNBt and 750g pack of BtNHH44) were drawn and 100seeds were sent to the GM referral laboratory of NBPGR, New Delhi forindependent analysis to detect the cry1Ac event in the seed lots and 100 seedswere tested at the Bt referral laboratory CICR, Nagpur. Thus seeds of 8 differentcommercial packs representing 4 different seed lots were used for the test beingreported herein and the test carried out by NBPGR, New Delhi.

peR: Genomic DNA was isolated from both BNBt and Bollgard MRC6301 seedswith the latter serving as reference for the MON531 event. DNA was isolated from50 seeds, each of BNBt, BtNHH44 and MON 531, using standard ammoniumacetate protocols. Seeds of non-Gm were used as control. PCR was carried outwith each DNA sample in 25 ul volumes, using the following event specific primers'MON 531' and 'BNLA106' that are specific for the 5' and 3' junction regions (asseparate PCR reactions) as listed below. The amplified prodUcts were resolved on1.2 % agarose gel and visualized under the Alpha Innotech Gel documentationunit.

Primers specific for 'MON531' 5' junction region ­Forward primer: 5'-aaccaatgccaccccactga-3'Reverse primer: 5'-<:tccttgtaagcggtcacac-3'Amplicon size: 499 bp

Primers specific for 'MON531' 3' junction region­Forward primer: 5'-<:gttttcgccgatttgcgag-3'Reverse primer: 5'-gccaatgcctcgtcgtcattgtt-3'Amplicon size: 274 bp

Cot primers - Cotton primers were used as control which amplifies cotton DNA.Forward primer: 5'-ccgggttgaaattgggttcatttatg-3'Reverse primer: 5'-cactacttttatgcacataagatgaaag-3'Amplicon size: 400 bp

'Flanking sequences specific to 'BNLA106' Event (Avesthagen)

TGTCAACTACGGACAATACGCTTACGGAGGCTACTTCCCCAACCBCCCAACACTAAGCCGAAGGTTCATGCCTGAGAAAGGCACCCCTBAGTATGCAGAGCTTGAAAAGAACCCTGAGAAGGTCTTCTTTAGAATCATGTCTTCGCAGCTACAGTCCCTBATTGTCATTACBGTGGTCGAAACGCTGTCAAACCACGCATCGGATGAGGTBTATCTTBGACAGCGAACCCCCAACTGGACCACTGATGCAGTTCCGCTACAAGCTTCGGATGCTTTCAATAGGAGACTTGCTGAAATCGAAGGGGAAATCTTAAAGATGAACAGCGACAATCTGATCATGAGCGGAGAATTAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACGTTTGGAACTGACAGAACCGCAACGTT»

Left borderCATTAAAAACGTCCGCAATTTGTTATCAAAGTCAAAGTCCAGACTCGGGAAAGATGAATGTGCTTTTTGTCATGAGAAATGCCAGTGGAAGAAAAATTGTCCAAAGCTGAAGAATAAGGGAAAAGCTGCTGTAGATGCTTGTGTTGCTAAGCATGATACTAGTGACTCTGAACTATCACTGGTTGCATCATCATCGTCGTTCCATTCAGATGAGTGGATATTGGATGCATATTGATACCAGCCCGGGCCGTCGACCACGCGTGCCCTATAG

Right BorderCTGTGTCAACTACGGACAATACGCTTACBGAGGCTACTTCCCCAACCGCCCAACACTAAGCCGAAGGTTCATGCCTGAGAAAGGCACCCCTGAGTATGCAGAGCTTGAAAAGAACCCTGAGAAGGTCTTCTTTAGAATCATGTCTTCGCAGCTACAGTCCCTGATTGTCATTACGGTGGTCGAAACGCTGTCAAACCACGCATCGGATGAGGTGTATCTTGGACAGCGAACCCCCAACTBGACCACTGATGCAGTTCCGCTACAAGCTTCGGATGCTTTCAATAGGAGACTTGCTGAAATCGAAGGGGAAATCTTAAAGATGAACAG

BNBtRB F: 5' 'tGTCAACTACGGACAATACGC 3'BNBtRB R2: 5' AACGTIGCGGTICTGTCAGTICC 3'BNBtRB R1: 5' TICGATTICAGCAAGTCTCCT 3'

PCR profile - 38 Cycles: 94°C 10 min followed by 38 cycles of 94°C 1 min; 54 °c/58°C 1 min; 72 °c 1 min and finally 72 °Cl0 min. Annealing temperatures weredetermined by gradient PCR.

PCR reaction'Reactants Volume per 25 ul Concentration Companv nameDistilled water 16.7 ul10 X Taa buffer 2.5 ul 1 X Bannalare GeneidNTPs (2.5mMl 1 ul 100 uM Banaalare GeneiMgCI2 (25mM) 1.5 ul 1.5mM Banaalare GeneiForward orimer (10 uM 1 ul 10 amales Siama-A1drichReverse orimer (10uM 1 ul 10 nmoles Siama-A1drichTaa palvmerase (3U/u 0.3 ul 1 U Banaalare GeneiTemplate DNA 1 ul 100na (aoDroxl

PCR amplification using Cot AlCot B primer set:Primer: Cot AlCot BExpected product size: 400bp

-

-

-

Cot A and Cot B primers are specific to the cotton genome and is present in BNBT,Mon 531 Bt and non Bt. Since amplification with this primer set was observed in allreactions, it indicated the suitability of reaction mix and the absence of anyinhibitors.

Presence of MON531 5' junction region (499 bp) in BNBt

Cotton-F 5'-aaccaatgccaccccactga-3'ctyfAc-R 5'-etccttgtaagcggtcacac-3'

peR amplification using primers specific to the 5' junction region:Primer: 5' junction forward primer/5' junction reverse primerExpected amplicon: 500 bp

500bp --';>- of- 400 bp

500bp -7-

9'1

~ 400bp

S'JunctionBNBt-RCBNBt-FMon 531-RCMon 531-F

Alignment of 5' junction region (499bp fragment):•••• 1•••• 1 ..•• 1•..• 1 •••• 1•••• 1 •••• 1•••• 1 •••• 1•••• 1 •••• 1••.• 1

5 15 25 35 45 55AACCAATGCC ACCCCACTGA CCCACTTAGC AGAGAAGAAG TGGAGGGACA AACGTGAGAA-ACCAATGCC ACCCCACTGA CCCACTTAGC AGAGAAGAAG TGGAGGGACA AACGTGAGM---------- ---------- ---------- ---------- ---------- -ACGTGAGAA---CAATGCC ACCCCACTGA CCCACTTAGC AGAGAAGAAG TGGAGGGACA AACGTGA.GAA

----

S'JunctionBNBt-RCBNBt-FMon 531-RCMOn 531-F

5 'JunctionBNBt-RCBNBt-F"Mon 531-RCMon 531-F

S'JunctionBNBt-RCBNBt-FMon 531-RCMon 531-F

S'JunctionBNBt-RCBNBt-FMon 531-RCMon 531-F

5'JunctionBNBt-RCBNBt-FMon 531-RCMon 531-F

5' JunctionBNBt-RCBNBt-FMon 531-RCMon 531-F

•••• 1•••• 1 •••• 1•••• 1 •••• 1•••• 1 •••• 1•••. 1 •••. 1•••• 1 .••• 1••.• 165 75 85 95 105 115

ACTCGAATGG GAAACTAACA TCGTTTACAA GGAGGCCAAA GAGTCCGTGG ATGCTTTGTTACTCGAATGG GAAACTAACA TCGTTTACAA GGAGGCCAAA GAGTCCGTGG ATGCTTTGTTACTCG~~.TGG G~_~.CT~~CA TCGTTTAChA GGAGGCC~~~ GACTCCGTGG ATGC~~TGTT

ACTCGAATGG GAAACTAACA TCGTTTACAA ~AGGCCAAA GAGTCCGTGG ATGCTTTGTT---------- ---------- ---------- --------AA GAGTCCGTGG ATGCTTTGTT

• ••• 1•••• 1 •••• I •••• 1 •••• 1•••• 1 ••• - I. ... 1 •••• 1•••• 1 •••• 1•••. I125 135 145 155 165 175

CGTGAACTCC CAATATGATC AGTTGCAAGC CGACACCAAC ATCGCCATGA TCCACGCCGCCGTGAACTCC CAATATGATC AGT'l'GCAAGC CGACACCAAC ATCGCCATGA TCCACGCCGCCGTGAACTCC CAATATGATC AGTTGCAAGC CGACACCAAC ATCGCCATGA TCCACGCCGCCGTGAACTCC CAATATGA'I'C AGTTGCAAGC CGACACCAAC ATCGCCATGA TCCACGCCGCCGTGAACTCC CAATATGATC AGTTGCAAGC CGACACCAAC ATCGCCATGA TCCACGCCGC

•••• 1•••• 1 •••• 1•• ··1 •••• 1•••• 1 •••• 1•••• 1 •••• 1••• ·1 •••• 1••• ·1185 195 205 215 225 235

AGACAAACGT GTGCACAGCA TTCGT-GAGGC TTACTTGCCT GAGTTGTCCG TGATCCCTGGAGACAAACGT GTGCACAGCA TTCGTGhGGC TTACTTGCCT GAGTTGTCCG TGATCCCTGGAGACAAACGT GTGCACAGCA TTCGTGAGGC TTACTTGCCT GAGTTGTCCG TGATCCCTGGAGACAAACGT GTGCACAGCA TTCGTGAGGC TTACTTGCCT GAGTTGTCCG TGATCCCTGGAGACAAACGT GTGCACAGCA TTCGT-GAGGC TTACTTGCCT GAGTTGTCCG TGATCCCTGG

•••• 1•• _.1 •••• 1•••• 1 •••• 1•••• 1 •••• 1•••• 1 •••• 1•••• 1 •••• 1•••• 1245 255 2f;5 275 285 295

TGTGAACGCT GCCATCTTCG AGGAACTTGA GGGACGTATC TTTACCGCAT TCTCCTTGTATGTGAACGCT GCCATCTTCG AGGAACTTGA GGGACGTATC TTTACCGCAT TCTCCTTGTATGTGAACGCT GCCATCTTCG AGGAACTTGA GGGACGTATC TTTACCGCAT TCTCCTTGTATGTGAACGCT GCCATCTTCG AGGAACTTGA GGGACGTATC TTTACCGCAT TCTCCTTGTATGTGAACGCT GCCATCTTCG AGGAACTTGA GGGACGTATC TTTACCGCAT TCTCCTTGTA

• _•• 1•• _.1 •••• 1•••• 1 •••• 1•••• 1 •••• 1.... 1 •••• 1•••• 1 •••• 1•••• 1305 315 325 335 345 355

CGATGCCAGA AACGTCATCA AGAACGGTGA CTTCAACAAT GGCCTCAGCT GCTGGAATGTCGATGCCAGA AACGTCATCA AGAACGGTGA CTTCAACAAT GGCCTCAGCT GCTGGAATGTCGATGCCAGA AACGTCATCA AGAACGGTGA CTTCAACAAT GGCCTCAGCT GCTGGAATGTCGATGCCAGA AACGTCATCA AGAACGGTGA CTTCAACAAT GGCCTCAGCT GCTGGAATGTCGATGCCAGA AACGTCATCA AGAACGGTGA CTTCAACAAT GGCCTCAGCT GCTGGAATGT

•••• 1•••• 1 •••• 1•••• 1 .: •• 1•••• 1 •••• 1•••• 1 •••• 1•••• 1 •••• 1•••• 1365 375 385 395 405 415

GAAAGGTCAT GTGGACGTGG AGGAACAGAA CAATCAGCGT TCCGTCCTGG TTGTGCCTGAGAAAGGTCAT GTGGACGTGG AGGAACAGAA CAATCAGCGT TCCG------ ---------­GAAAGGTCAT GTGGACGTGG AGGAACAGAA CAATCAGCGT TCCGTCCTGG TTGTGCCTGAGAAAGGTCAT GTGGACGTGG AGGAACAGAA C--------- ---------- ----------GAAAG----- ---------- ---------- ---------- ---------- ----------

--

---

---

5'JunctionBNBt-RCBNBt-FMon 531-RCMon 531-F

• - •• 1•••• 1 •••• 1•••• 1 •••• 1•••• 1 •••• 1•• ' • 1425 435 445 455

GTGGGAAGCT GAAGTGTCCC AAGAGGTTAG AGTCTGTCCA

GTGGGA---- ----------

100

•• ' .1 •••. 1465

GGTAGAGGCT

•••• 1•••• 1475

ACATTCTCCG

-

5'JunctionBNBt-RCBNBt-f'Hon S31-RCMon 531-f'

•••• 1 •••• 1 •••• 1••••485 495

TGTGACCGCT TACAAGGAG

Sequences from the MON531 5' junction regionderived from the 499 bp BNBt amplicon

~oe~04~

aaccaatgccaccccactgacccacttagcagagaagaagtggagggacaaacgtgagaaactcgaatgggaaactaacatcgtttacaaggaggccaaagagtccgtggatgctttgttcgtgaactcccaatatgatcagttgcaagccgacaccaacatcgccatgatccacgccgcagacaaacgtgtgcacagcattcgtgaggcttacttgcctgagttgtccgtgatccctggtgtgaacgctgccatcttcgaggaacttgagggacgtatctttaccgcattctccttgtacgatgccagaaacgtcatcaagaacggtgacttcaacaatggcctcagctgctggaatgtgaaaggtcatgtggacgtggaggaacagaacaatcagcgttccgtcctggttgtgcctgagtgggaagctgaagtgtcccaagaggttagagtctgtccaggtagaggctacattctccgtgtgaccgcttacaaggag

peR amplification using primers specific to the 3' junction region:Primers: Forward primer 3' junctionl Reverse primer 3' junctionAmplicon: 274bp

~ 274 bp

The bands were eluted; DNA was pooled and sequenced with Eurofins, Bangalore.The sequences of 5' and 3' junction regions of BNBt and MON 531 were alignedseparately and were found to be identical.

101

274 bp

oriV-F 5'-cgttttcgccgatttgcgag-3'cotton-R 5'-gccaatgcctcgtcgtcattgtt-3'

-

-

3' junctionMON 531-FBNBt-F

Alignment of 3' junction ngion (274bp band):•••• 1 •••• 1 •••• 1•••• 1

5 15CGTTTTCGCC GATTTGCGAG

•••• 1•••• 125

GCTGGCCAGC

•••• 1 •••• 135

TCCACGTCGC

•••• 1 •••• 1 •••• 1•••• 145 55

CGGCCGAAAT CGAGCCTGCC

--

•••• 1 •••• 1 ••.• 1•••• 1 •••• 1 •••• 1 •.•. 1 •••• 1 •••• 1 •••• 1 •••• 1.••• 165 15 85 95 105 115

3' junction CCTCATCTGT CAACGCCGCG CCGGGTGAGT CGGCCCCTCA AGTGTCAACG TCCGCCCCTCMON 531-F ---------- ---------- ---------- ---------- ---------- TCCGCCCCTCBNBt-F ---------- ----GCCGCG CCGGGTGAGT CGGCCCCTCA AGTGTCAACG TCCGCCCCTC

3' junctionMON 531-FBNBt-F

•••• 1•••• 1125

ATCTGTCAGTATCTGTCAGTATCTGTCAGT

•••• 1•••• 1 •••• 1•••• 1135 145

GAGGGCCAAG TTTTCCGCGAGAGGGCCAAG TTTTCCGCGAGAGGGCCAAG TTTTCCGCGA

•.•• 1 •••• 1 •••• 1 •••• 1 •••• 1•••• 1155 165 175

GGTATCCACA ACGCCGGCGG CCGCGGTGTCGGTATCCACA ACGCCGGCGG CCGCGGTGTCGGTATCCACA ACGCCGGCGG CCGCGGTGTC

3' junctionMON 531-FBNBt-F

3' junctionMON 531-FBNBt-F

•••• 1 •••• 1 •••• 1•••• 1 •••• 1•••• 1 •••• 1 •••• 1 •••• 1.••• 1 •••• 1•..• 1185 195 205 215 225 235

TCGCACACGG CTTCGACGGC GTTTCTGGTT ATAATATACA CATATATAAT TTATCACTGTTCGCACACGG CTTCGACGGC GTTTCTGGTT ATAATATACA CATATATAAT TTATCACTGTTCGCACACGG CTTCGACGGC GTTTCTGGTT ATAATATACA CATATATAAT TTATCACTGT

•••• 1 •••• 1 •••• 1•••• 1 •••• 1 •••• 1245 255 265

ATATTCTTGC AGAGAACAAT CACGAGGCAT TGGCATATTCTTG- ---------- ---------­ATATTCTTG- ---------- ----------

io:L

--

Sequences from the MON531 3' junction regionderived from the 274 bp BNBt amplicon

-

cgttttcgccgatttgcgaggctggccagctccacgtcgccggccgaaatcgagcctgcccctcatctgtcaacgccgcgccgggtgagtcggcccctcaagtgtcaacgtccgcccctcatctgtcagtgagggccaagttttccgcgaggtatccacaacgccggcggccgcggtgtctcgcacacggcttcgacggcgtttctggttataatatacacatatataatttatcactgtatattcttgcagagaacaatcacgaggcattggc

Reconfirmation of the presence of Mon531 3' junction274 kb amplicon in BNBt and NHH44 seeds

:1..03

Event! Zygosity detection through PCR

~ B..~b=:J2!~=I~i=='!"'~d~

C

A: Cotton-F 5'-tccgagactcctagtacctcaact-3'B: OriV-F 5''1Jatttgcgaggctggccagctccacg-3'C: Cotton-R 5''1Jgtttcctcttcttcttgaccttgtaag-3'

Evidence for the presence of full length crylAc gene in BNBt

CONCLUSIONS:

1. Ninety two seeds were positive for cry1Ac from the 100 seeds tested fromthe lots produced by UAS Dharwad. All the 92 seeds were found to containonly 'MON531' event of Monsanto and did not amplify positive for thepurported 'BNLA106'. Eight seeds were negative for Cry1Ac. The flankingregions of the event 'BNLA106' provided by Dr P. Ananda Kumar and theprimer sequences of purported 'BNLA106' were used to examine if theevent was present in any of the seeds. None of the seeds was found to bepositive for any primers tested, thereby indicating that the seeds do notcontain the purported 'BNLA106' event.

-

-

2. Seeds samples from the BNBt seed lots produced by UAS Dharwad werealso sent to the GM referral laboratory of NBPGR for testing. The resultsreceived from them confirmed the findings of Bt referral laboratory CICR,that all the seeds contained only the MON531 event.

Sequence (3534 bpI of cry1Ac full length Monsanto geneSequences in blue are identical to NRCPB/Dharwad Cry1 Ac truncated gene 1857 bp

itggacucaacccaucatcucgutgcattccatacuetgcttgagtaacceag:ugttgugtaettggrggagucgcattgUiccggttacattcecatcgilCatetccngtccttgacaca.gtnagetagcgagttcgtgccaggtgctgggttcgrtacggaetagtrgaCl.tcatagngtatetnggtttatclcutgggalgclUCQgglgcaaallgagCilgttgarcaaccagaggatcgugagttcgccaggucaggccatetetaggttggaaggattgagcaataetacca.a.atctatgcagagagetlcagagagtgggaagccgatccuetaacccagetetccgcgaggaulgcgU.acuttcu.cgacatgucilgcgccng<1CCacagd:UCCCutgttcgcagtccagucuccugttcetetatgtccgtgu.cgttcu.gagetutclIucetcagcgtgCa.cgagacgttagcgtgra:gggcauggrggggattcgatgagcaaccatcuugccgtucucgacclticuggaganggaaaetacaccgaccacgetgncgttggtacaacaetggatggilgcgtgtctggggtC'Ctgatt~agagaugganag.acu.ccagttcaggagagu.ttgaccctca.cagttttggacattgtgt<tctatcccguetatgactccaguccu.ccetatCCg1aca

i1gt:cccuQtaCQgaguuaataauccCigttettgagaaettcgacggt:a.gcn~gittaacccaa.g;gtatcgl.iigc[ccarQ.gg~a:ca.octtga.tgglcata[guagc

atueta.taacaccg:atgC1caca.gagglg~anlctggret:gglcacagatcatggcetet:cca.gttggattagcgggcccgagtttacetncetttetatggaaaatgggaucgccgetc

~acucalcgt4tcgngaCllttaggtc.agggtt't<:tlca.gaacCttgta[ccacettgucagaagaccettcutatcggtatcucaaccagcuetuccgtlcttgacggucagagtlcgcc

tuggaacClatacaettgccaccgetgmacagl.u.gagcggaaccgngancmggacguatccca.ccacagucaacutgtgccacccaggcaaggattacccacaggngagccacgl gtccatgttccgnccggattca.gcaacagnccgtgagcatcatcagagacaatgttaettggau.ca.ccgtagtgagagttcaacuca.tcatcgcatccgatagtattaClcautccagcigtgugggauanacncucggttetgtca.tncaggaccagganciaggtggagaa:t.eguagattcloacagcagtggu..ataac.attcagi,.fagagggt.ttl.ngugnc(uncaettcccatce.tcatetaccagUallgagttcgtgtgaggtatgett<1gtgacecetauacctcucgttaattggggtUgtc.atccllettetccutacagttccagetl.c.agaaceteatggafutetccutccagcsatttcggttaetttgaugtgccaargettttaca.tettaacggtucatcgtgggtgttagu.aetttagtgggaagcaggagtgattatcgaagancgigncanccagtUetgcucaacgaggetgagtilC:aacettgagagagcccagaasgetgtgaacgccetetnacaccaccaucagatggcnguaactucgttaetgactatca.cattgacca.agtgtccuettggtcaceticettagcgatgagttagcetcgacgagugcgtguetetccgagaaa.gttuacacgccugcgtetcagcgacgagaggaatetCltgcugaetccuetlcuugacalcl.acaggcl.gccagia<:glggnggggtggugcaccgggatcaccatccuggaggcgacgl.tgtgttcuggaguctacgtcaceetaccggaaetttcgacgagtgetaccal.CClICllgtaccagugatcgatgl.gtccauetca.u.gcenca.ccaggtatcaaataglggetacacgugacagcca.agl.Cettga.aatClaacgatcaggtacutgccugcacgagaccgtgutgtccc.aggtaaggttceetetggccaerttagcocutetet:ca.ttgggugtgtggagagcaucagatgcgetccaca.cettgagtggutcctgaatggaagetcetgcl.gggatggcgaglagtgtgcce.tccantteatcaettetcCltggacatcgatctgggaz:gtaagacetgaatga.g;gaeetcgga.gt:etgggtea.tettcugatcaagacccugacggacacgcuga.cn.ggcu

cettgagmacguglguaccanggtcggtgaagctctcgctcgtgtgugagacc.aglgugugtggagggaculcgtgl.gUlCiega.atgggulClucatcgtttaclaggaggceuagagtccgtggatgetttgttcgtguClcca.atatgatcagt:tgcaagcrgacaccaacatcgc:catgatccacgccgcagaca.u.cgtgtgcacagattcgtgaggettaettgcagagngtccgtgatccetggJgJgucgagccarcttcgaggaacugagggacgtuanaccgcattaccttgtacga.tgccagaaacgtcatcaagl.acggtgacncucaatggcacagetgetggutgtga.uggtc.atgtggacgtggl.ggucagucu.tcagcgnccgtcctggttgtgcctgagtgggugagugtgtcccugaggttagagtagtcca.ggtagaggeti.

cattetccgtgtgac,cgcttacaaggagggatacggtgagggngcgtgaccatccacgagatcgagaaC2l.Cl.ccgacgagctu.a.gttetecuetgcgtcgagguguatetatcccaacaacaccgttaettgcaacgacra.cactgtga.a1caggaagagta.cggaggtgeetacacu.gccgtaa.cagaggttacucgaagetcettccgncagagacratgcetccgtgtacgaggaguatcetacaca.gl1ggcagacgtgagucccttgcga..gttcucagaggttacagggactacacacacttocagttggetatgttacca.a.gga.gatgagtaetttcctgl.gl.cegaca.ugtgtggarcgagatcggtgul.ccgaggguccncalcgtggacagcgtggagettetatgarggt.ggu

Development of 'BNBt' and 'Bt-NHH44' with 'BNLA106' event

1. 2000-2001: Dr P. Ananda Kumar provided the cry1Ac gene construct to Dr Katageriand Dr Khadi, UAS Dharwad.

2. 2000-2001: Dr Katageri used shoot apex explants using Agrobacterium mediatedtransformation to develop the event 'BNBtLA106'.

3. 2001-2002: Dr Anand Kumar confirmed gene integration and conducted the completemolecular studies to confirm the original event.

4. 2001-2004: Dr Khadi, Dr Katageri, Dr Udikeri and Dr Vamadevaiah used ELISA andbioassays to identify homozygous lines and advanced the BN Bt to T3 generation atUAS Dharwad.

5. The work was published in Current Science (I. S. Katageri, H. M. Vamadevaiah, S. S.Udikeri, B. M. Khadi and Polumetla A. Kumar. 2007. Genetic transfonnation of anelite Indian genotype of cotton (Gossypium hirsutum L.) for insect resistance.Current Science, 93, 1843-1847).

6. 2005: Dr Khadi joined as Director CICR in May 2005 and brought a few T4 'BN Beseeds with him.

7. 2005: The seeds were given to Dr Suman Bala Singh, Plant Breeder, CICR, andgrown in a polyhouse at CICR, Nagpur and biosafety studies were initiated throughCICR under the leadership of Dr Khadi.

8. 2005: Subsequently, in August 2005, Dr Khadi sent twenty leaf samples from twentyplants to Dr Kranthi, Bt referral laboratory CICR requesting ELISA and PCR tests.

9. ELISA ·results showed that sixteen leaf samples were positive for Cry1Ac. The PCRresults for cry1Ac showed that the samples contained a full length gene of 3534 bpwhich indicated the probability of 'Mon531' event.

10. The samples were subjected to Mon531 5' junction and Mon531 3' junctionspecific primers to amplify 499bp and 274bp amplicons. The samples confirmed tocontain cry1 Ac from Mon531.

11. The samples were SUbjected to PCR using a three primer set (derived from inversePCR) that detects 'Mon531' event of Monsanto. All sixteen samples were found to bepositive for 'Mon531 '. Six samples were homozygous and ten were hemizygous for the'Mon531'. The results were communicated to Dr B. M. Khadi.

12. The plants in nethouse were tested with Bt-Express strips and 37 leaf samples weresubjected to the Mon three primer test. Nine plants were homozygous.

13.2005: Dr Khadi expressed that the presence of 'Mon531' in the putative 'BN Bt' T5generation plants could have been due to contamination and care would be taken toremove the same from the original event. He informed that he communicated theresults and concerns to Dr Katageri and Dr Ananda Kumar and that appropriate stepswould be taken up.

-

-

-

-

------

-

...

14. 2005-2008: Contained Open Field Trial, Multi Location Research trials and Biosafetystudies were carried out by Dr Khadi, Director CICR and applications to RCGM andGEAC were submitted through CICR.

15. The BN Bt variety and 'Bt NHH 44' was tested under RCGM "Contained Open FieldTrial" at three locations in three collon growing zones during 2005-2006 and Multi­Location Research Trials (MLRT) in 12 locations in all the three zones in 2006-07 and2007-08. The BN Bt and Bt NHH 44 showed over-all yield superiority in both seedcollon and lint yield when compared with Non-Bt check and local checks.

16. 2006-2008: Biosafety studies were carried out at various institutions through CICR.

17.2006-07: The Dharwad event was characterized by Dr Khadi and Dr Ananda Kumarthrough outsourcing the work to MIS Awasthagen, Bangalore. The right border and leftborder flanking regions of the 'Dharwad event' were identified through inverse PCRand Primers were designed based on the flanking regions.

18. 2008: After completing all the mandatory biosafety testing and field experimentation,the 'BN Bt variety' was approved for commercial cultivation in the 84th meeting ofGenetic Engineering Approval Committee (GEAC) held on 2nd May 2008

19. Subsequently, Dr Khadi sent ten seeds to the Bt referral laboratory on 4" May 2008,for reconfirmation of the event present in 'BN Bt'. He provided results of the flankingregion sequences and primers from Awasthagen. PCR was carried out using theprimers but there was no amplification in any of the samples. The samples were thensubjected to PCR using a three primer set that detects 'Mon531' event of Monsanto.Eight samples were found to be positive for ELISA and also for 'Mon531'. The samewas communicated to Dr Khadi.

20. A meeting was convened by the DDG, CS, (Dr P. L. Gautam) and the issues relatedto the Mon531 event were discussed in depth in his chamber on the 21" May 2008 inthe presence of Dr P. Anand Kumar, Dr B. M. Khadi, Dr Katageri and other officialsincluding the ADGs, Dr K C. Jain and Dr Jhambhale.

21. Dr Kranthi described the results obtained by the Bt referral laboratory and requestedthat it would be appropriate to take remedial measures in view of the detection of'Mon531' in the purported 'BN Bt' seed samples. He pointed out that the Awasthagendata were flawed since the left border sequences of the insert were not contiguouswith the right border sequences on the bac clone and also the primers were notfunctional. He requested for a third party analysis to reconfirm the event data so thatserious repercussions could be avoided in future.

22. Dr Ananda Kumar made a presentation of the unique nature of the Dharwad eventbased on flanking sequence analysis. The left border flanking sequences belongs tocollon bac clone No. 106122 (NCBI) and the right border belongs to lipoxygenase(Lox1) gene. Dr Kumar also presented the results of BN-Bt analysis to show that theDharwad event was different from that of the other known Bt transgene events.

23. The chairman asked Dr Kranthi not to carry out any further molecular testinll of thesamples and only to carry forward the commercialization process with full zeal,adhering to all instructions laid out in the proceedings.

24. The chairman decided that the BN-Bt seeds would be produced only by UASDharwad in about 150 acres. UAS Dharwad was also asked to produce 200 quintalsof the hybrid 'Bt NHH 44'. Accordingly the seed production was taken up only by UASDharwad by the original breeders.

25. Dr B. M. Khadi joined back UAS Dharwad on the 23'" May 2008.

26. Dr K R. Kranthi took over as acting Director of CICR on 24th May 2008.

27. A meeting was held on 12th December 2008 under the Chairmanship ofDr P. L. Gau1am, Deputy Director General (CS) on the 12" December 2008 in KrishiBhavan, New Delhi, to finalize the commercialization modalities of 'BN-Bt' Bt-eottonevent, BN-Bt variety and the Bt-eotton hybrids developed using the 'BN-Bt' event.

28. Commercialization and seed production plans were finalized.

29. UAS Dharwad produced 250 quintal seed in 2008-09 kharif season. The seed wassent to CICR in two lots (165 Q on 4" May and 84 Q on 6" May 2009) at Rs 50 per Kg.

30. The seeds were packed at CICR in 2kg seed bag containing packs of 2009 pigeonpearefugia seed to be sold at Rs 200. A total of

10,900 bags were given to MSSC, Maharashtra during 14-19" May 2009500 bags to GSSC, Gujarat on 25" May 2009119 bags to MSSRF (Prof Swaminathan Foundation), 1-8th June 2009200 bags to MAFSU (Animal and Fisheries University, Nagpur) 6" June 09275 bags to APSSDCI, Andhra Pradesh on 9" July 200950 bags to Ratan Tata Trust, Maharashtra on 14th May 2009Rest of the bags were given for FLDs dUring July 2009

31. The hybrid 'Bt NHH 44' was approved by GEAC on 13th May 2009 for commercialcultivation in the Central and South zones during Kharif season 2009. 'BN Bt' is femaleparent and AC738 is the male parent for Bt NHH 44.

32. UAS Dharwad produced 15 quintals Bt NHH 44 seed and sent to CICR at Rs 370 perKg on 28th May 2009. The seeds were packed at CICR in 750 g Bt NHH 44 seeds perbag containing packs of 200g pigeonpea seed for refugia purposes, to be sold at Rs400.

1600 bags were given to MSSC, Maharashtra during 15-17th May 2009100 bags to MAFSU (Animal and Fisheries University, Nagpur) 8th June 09100 bags to APSSDCI, Andhra Pradesh on 9th July 2009Rest of the bags were given for FLDs during July 2009

33. The Maharashtra state seed corporation (MAHABEEJ) has taken up seed productionof Bt NHH 44 in 360 hectares in Gujarat and 595 ha of BN Bt in Maharashtra with 1875farmers. They have entered into an agreement with the seed producers to procure the'Bt NHH 44' hybrid seed at Rs 210 per 450 g and Rs 50 per Kg of the BN Bt variety.

34. All the seed producing farmers have complained that the 'BN Bt' seed is not pure withrespect to several traits including the Cry1 Ac. Therefore the hybrid seed would faceproblems at the time of certification and 'grow out test'.

---

--

-

-

35. CICR scientist teams (Including Dr Katageri, UAS Dharwad and Dr Kumar, GAU,Surat) visited the seed producing plots in GUjarat and Maharashtra. Six independentscientist teams from CICR have been making constant visits to assess theperformance and have confinmed trait segregation.

36. The MAHABEEJ reported the matter to the Principal Secretary (Agriculture),Govemment of Maharashtra and a meeting was convened on the 8'" October 2009 inMumbai, to discuss the steps that can be taken up as remedial measures to minimizethe possible financial losses (Rs 5-6 crores) on account of the impure parent 'BN Bt'.

37. MAHABEEJ sold 1.25 lakh packets of 'Bt-NHH 44' DURING 2010 using the seed lotsthat were rigorously tested and certified by CICR through ELISA testing of individualseed lots. There ·was not even a single complaint during the 2010 season and farmerswere very happy with the performance.

38. Monsanto (MMB India) have stated that their tests have revealed the completepresence of Mon531 in all positive seeds and are constantly reminding MAHABEEJand CICR for possible royalties.

Certified that the above report contains data from the Bt Referral laboratory, CICR,Nagpur carried out under my direct supervision. The chronological list of eventsreported in the report above have been presented without any bias to individual orinstitution and represent only facts best known to me.

Date: 18th December 2010

CwSK. R. Kranthi

Director, CICR

IO~

Zimbra

ANNEXURE-IX

Zimbra

Re: regarding BnBt

From: RANJINI <warrier@nic.in>

Sender: warrier@nic.in

Subject: Re: regarding BnBt

To : sonti@ccmb.res.in

Cc : vc@mail.jnu.ac.in, vc@pau.edu, secy iear<secy.icar@nic.in>, imran<imran@ccmb.res.in>

sonti@ccmb.res.in

Fri, May 04, 2012 04:17 PM

Dear Dr Ramesh Sonti, .

PI ignore the earlier mail. Revised information with minor correction on the date ofRCGM meeting may be seen below:

Please find below factual information on the two queries raised by the EnqUiryCommittee in respect of BnBt Cotton.

1. Could you please let us know the name of the person who made thepresentation regarding BnBt to the GEAC?

No presentation was made to the GEAC on the Biosafety Studies conductedon BnBt. However, the 'proposal of CICR seeking approval of GEAC for largescale field trials with BnBt was considered in the 83rd and 84th meetings of theGEAC held on 2.4.2008 and 2.5.2008 respectively.

In the 83rd meeting of the GEAC, Dr Kranthi, Senior Scientist, CICR, Nagpurhad made a presentation on "Results on monitoring the susceptibility of bollworms to Bt gene and development of insect resistance" (ref Agenda Item 4.2)

2. Were Dr. Ananda Kumar and Dr. Khadi, who were members of GEAC, sittingin on this presentation regarding BnBT?

Both Dr. Ananda Kumar, Project Director, NRCPB and Dr. B.M. Khadi,Director, OCR, Nagpur (former) were present in the 83rd GEAC meeting heldon 2.4.2008 while the BnBt proposal was discussed. There was nopresentation on the subject matter.

Dr. B.M. Khadi was present in the meeting held on 2.5.2008.

It may also be noted that Dr B.M. Khadi had made a presentation to the

RCGM in the 53rd meeting held 22.5.2007 on the Biosafety Studies conductedwith Bt Transgenic Cotton Hybrid NHH44 Bt. Based on the RCGM

http://webmail.ccmb.res.inlzimbrafh/prinunessage?id=41292

\10

i,I

Ii

IIiII!I

!

•

Zimbra

recommendation, the proposal was considered by the GEAC.

With regards,

(Dr. R. Warrier)Director & M~, GEAC

.1-

• •1I ,

--

-

-

--

--

-

-

Ltmbra

On 04/24/12, sonti@ccmb.res.in wrote:

Dear Dr. Ranjini Warrier,

I am writing in cOllnection with the enquiry committee that has been set upby ICAR, under the chairmanship of Prof. Sudhir Sopory, to enquire into theevents surrounding development and release of BnBt (Bikaneri Narma-Bt). Inthis connection, I am writing on behalf of Prof. Sopory and the committee torequest the following information:

1. Could you please let us know the know the name of the person who madethe presentation regarding BnBt to the GEAC?

2. Were Dr. Ananda Kumar and Dr. Khadi, who were members of GEAC,sitting in on this presentation regarding BnBT?

I am looking forward to hearing from you at your earliest convenience.

Best regards,

Ramesh Sonti

Dr. R WarnerDirectorMinistry of Environment & ForestsGovernment of IndiaParyavaran BhawanCGO Complex, Lodhi RoadNew Delhi - 110 003Tel: +91-11-24363964email: warrier@nic.in

http://webmail.ccmb.res.inlzimbralhlprintmessage?id=41292

II)...

Grams: UNIVAGRISTele Fox-91-836-2446272e-mail: dipgs.u:J.sd..@gmaiLcom

dipgs_u<lsd@re.diffmail.colObTukhad i@rcdirfmail.com

ANNEXURE-X

Tel: (0) 0836-24409472448321 Ext. 213

(R) 0836- 2776263(M) ?44849531I

No. Dean (PGSY 1a 12011·12 Dale: 04-01-2012

-

Respected Sir,

nlallk )'OU Sir for the proceedings of lhe meeting held on 27·12·2011 at Committee room ofICAR, New Delhi regarding issues related to BNBt colton. Sir, I would like 10 bring 10 your kind nOlia:Ih~ following points for your kind consider.uion and needful.

Regarding point No. 4 of proceedings; we as a \earn in CICR wanted to take up back. crosshreeding (or conversion of he<;r varietie.li and hybrid!' parental line.~ of the country (about 45 lines)simuttaneousty (0 avoid the time lapse. Hence, it was decided to identify the homozygous pl3nls from theBNSt pl3nts grown 2.1 eleR in 2005. HOD. Plant Protection made analysis on homozygosity andindicated that there were about six plants that were: homozygous. So. nowers of these plants w~re used forconversion orhesl varieties and hybrids parental lines by the breeders. If we would have known that il \....asMonsanto 8t, IoI.'C would not have made any venlure of promoting, convening the elile Hoes and conducling'he trials. FUrlher, the RCGM and GEAC trials were conducted during ,he period by obtaining seeds fromUAS, Dharwad. Each and every step of promo'ion, conversion, testing was discussed with HODs andconcerned Sciemists of ClCR, Scientists of UAS, Dharwad and NRCPB, New Delhi. I am unawue ofprocess or procedure of analysis of homozygosity, but I am dear chat whal an "event' is. Several in·housemeelings, IRC, RAC. IBSC as well as during visits of dignitaries including Hon'ble [)G, DOG (CS),AOGs and otl"'rs were apprnised time to time, collectively by all of us including the Heads and Scientistsconcerned about (he progress of Bt cotton in eleR. The progress of the work was presented time to timeand the informa'ion conlen' was prepared colleclively by concerned Scientists and Heads.

After the decision of GEAC on 2·;·2008 regarding commercializa'ion of BNBt, following weekof May 2008 Dr. K.R. Kranthi. HOD, Plant Protection infonned me regarding the Mon·53I contaminationI presence in the seeds 'ested. Immediatel)' Hon'ble DOG (CS) and AOG (cq were informed regardingthe same. Hon'ble DOG (CS) arranged a meeting with all concerned Scientists and discussed the mailer indetail on 21-5-2008 (Ref. F.No.2 (II) 2008 CC-I dated 29.5."2008).

Hence, I request you to kindly consider and do Ihe needful. Please mention that only homozygousplfllnts (not Mon-53l) were identified and informed to use them for conversion programme. Hence. Irequest you to kindly consider the corrections in the proceedings.

This is for your kind infonnation and needful.

Thanking you, with kind regards,

nle Hon'ble Deput)' Director General (Crop Science)Indian Council of Agricultural Research (ICAR)Krishi Bhawan, New Delhi - 11000 I.

COP)' submitted to the Hon'ble Director General, ICAR, Krishi Bhawan, New Delhi for kind information.Copy submitted 10 the Hon'ble Vice Chancellor, UAS, EJharwad for kind informalion.

1/3

•

•

f- ---:-,;- -

l \ -'./ ." .

.'~~ 3fjfftrR~

INDIAN COUNCIL OF A6RICULTURAL RESEARCH

~ 'lfq.l, ~~ I;ffiK 1Wf. '% ~-110001

Krishi Bhawan. Dr. Rajendra Prasad Road New Delhi 110 114

F.No. 2(11)(2008 CC-!

DRKR.Kranthi.·Principal Scientist,Head Crops Protection DivisionCICR-440 010

Dated 29-5-2008

'.

Sub: Pr<>eeedings of the meeting under the chairmanship of Dr. P.L.Gautam,. DDG(CS), IcAR on 21-5-08 regarding road map for the promotion andutilization of BN-Bt cotton.

Sir,

I am to enclose· herewith the proceedings of the meeting under thechairmanship of Dr. P.L.Gautam, DOG(CS), ICAR on 21-5-08 regardiilgroad mapfor the promotion and utilization of BN-Bt cotton for information and necessaryaction,

Yours faithfully,

(K.C. m)Asstt. Director General(CC)

Enel : As above.

\Ilj-

"

/

-/r

Proceedings of the meeting with Dr. P. L. Gautam, Deputy DirectorGeneral (Crop Science), ICAR;-New Delhi on 21-05-2008 regarding theroad map for the promotion and utilization of BN-Bt cotton

\

\

,1,I

'/ii

IAttendance: As per AnnekI

The meeeting was held at ICAR HQ under the chairmanship of Dr. P.L.Gautam,Deputy Dirdtor of General (Crop Science), ICAR, New Delhi to discuss futurestrategies

The' Chairman congratulated all those involved in the development of BN BL. . .

Thereafter discussions were held on the different aspects related to the popularization ofthe product and future research work. AcCordingly discussions were held and thefollowing decisions were taken.

1. Seed production ofBN Bt will be taken up on ISO acres ofUAS Dharwad Farmsd '2008-09.unng . >

(Action: vAs, Dhal'?':l.d)- z. Seed production ofNHH-44 Bt will be organized by UAS Dharwad on 200 plotsto pro<Juce minimum of 200 q.(Action: UAS Dharwad)

3. BN Bt seeds sale price was discussed and it was decided that VAS Dharwad maywork out the cost by taking into account the cost of seed production, etc.(Action-: VAS, Dharwad)

4. Package ofpractices of cultivadon of'BN Bt and NHH-44 :St has to be developed.(Action:~ Concerned centreslProject Co-ordinator, AICCIl')

5. Refugia seeds of similar fibre quality or BN nonBt and NHH-44 Non Bt may besupplied along With Bt seeds as per GEAC guidelines.(Action: VAS, DJ,llirwad)

6. ConverSion of popular varieties! parents of hybrids of Bt using the Dharwad eventwill continue.(Adion: VAS, DhaIWad, CICR, Nagpur, NRCPB, New Delhi)

7';""~~P}>~'~'. <'Ia iilfi :-.m~det'·~·'r~enta~6??ofl tk:Jmiqu!;>nan,ue of-.~e.",qJk~ad.W!~6~eo on 'f1anking sequence· analysIs. The jeft border f1iliililiig sequeI1,ces~IoE.gs to cotton bac clone No.106 I 22(Nc;BI) and Right border belongs 10

1~~?7~~ase .(Lox I). gene. Dr Kuma~ also presented the results of B~til$..-l!SlS t~!}.ow that the Dharn:ad event IS different from that of the other known, f'ti'3bsgene events. .

~~4t/~~ ~B' ~\(~\~/'-:l.'\~:?' 'u\\ 'V\ z\·~ ..

liS"

"

'j,

,•

.f-IJ

1

-

-

-I

8. DDG (CS) instructed the group to identify the particular chromosome in which Btgene got inserted.(Action: Director, NRCPB, New Delhi)

9. Registration of BN pt with PVPFR has to be done on priority jointly by, NRCPB,CICR, UAS, Dharwad and Rajasthan Agriculture University, Rajasthan.(Action: Director, NRCPB)

10. Further work on gene pyramiding has to be taken up.(Action: NRCPB, VAS Dharwad and CICR Nagpur)

11. 1m: compliance of GEAC and RCGM orders and permission have to be done by-Dr P. Ananda Kumar NRCPB, New Delhi, Dr G. Balasubrarnani, CICR, Nagpurand Dr 1. S. Katageri, Senior cotton Breeder VAS, Dharwad immediately.(Action: NRCPB & VAS Dharwad)

12. Trypsin inhibitor trait identified already in the cotton germplasm should also beincorporated in BN Bt which will be better option for broaden protection againstlepidopteran insects.(Action: OCR, Nagpur)

All me)Ilbers agreed to make efforts ,to commercialize this event by developing popular-Bt varieties and hybrids. '

The meeting ended with a vote of thanks to the chair:

;l

~lII

116

7. Dr. KR.Kranthi, Principal Scientist, Head, Crop Protection Division,

Jlr,n t.

CICR. Nagpur.

ccdings ofthe meeting with Dr. P.L.Gautgam, Deputy II'tral(Crop Science), ICAR, New Delhi on 21-05-2008 at

l. Dr K.CJain ADG(CC)

"'1\2. N.D.Jarn~e ADG(Seeds)

3. Dr P Anandlrumar, Director, NRCPB, New Delhi

4. Dr...B.M.Khadi, Director, CICR, Nagpur

5. Dr I.S.Katageri, Senior Cotlon Breeder, UAS, Dharwad

6. Dr H.M.Varnadevaiah, Biochemist, UAS Dharwad'.".,

6 following members were present

I

!!

-II

/11-

ANNEXURE-XII

Confidential

PPV&FRA/PS-2/01 June 2012

CHAIRPERSON

protE-ct .•.'" of Plart Vartetles and ra!'"l""1e rs

R;g~t~ I.utlle It'l 'Mlnlstry of Agncu!ture,

GovernMent of 'nd1a21d Floor SOCieties Blon NASC Cornpl":!~

OPS Marg !\lpw De-It"! 1100 2

~

G'I>l1 f'l;?~ 3/r7 ~ "j'./'l>f( 4HI"l

~I ~ ~1 '1J7~ ,=~ ilM -q\-H~ii iffi<l;.

. ~ ~ .1(-l.11.~.Hl .."rq 4"1 "".t... tJIT1

~ ~-IIO UI~-;;r i

~ Ir>l~f:' ... ~

tE: ! ~i"'~..:d~ g~ .;i~;:: , ~fO~d.J~ '.~ .'" ~ Please refer to your D.O. letter No.2-11/0B-CLI dt.l6 May 2012, regarding queries~ E-1 i- raised by the Expert Committee examining the issues relating to contamination of BnBt with

~ ~ ~ &: MONS3!.

2. At the very outset. it would be relevant and significant to point out that I served asDeputy Director General (Crop Science), ICAR from 12/10/2007 to 31/12/2008 Le. about 14months. Thereafter. 1 was Chairman of National Biodiversity Authority. Chennai, an autonomousbody of Ministry of Environment and Forests from 31/12/2008 to 3/11/2010. Consequent upon myappointment as Chairperson, Protection of Plant Varieties & Farmers. Rights Authority, anautonomous body of the Ministry of Agriculture, I am carrying this responsibility from 4/11/2010 tilldate.

3. The matter under reference pertained to the meetings held in 2008, about 4 yearsago, and hence I had to request for referring / consulting the relevant records on the subjectmaintained by the Crop Science Division of ICAR 1 am thankful to you for providi.ng me theopportunity to browse the related documents and fOlwarding the copies oftbe relevant papers.

4. After inspection of the records, 1 find the following documents of relevance to theissues indicated in your letter under reference:

Minutes of the meeting held on 21 May 2008 under my Chairmanship.Minutes oftbe meeting held on 12 Dec 2008 under my Chairmanship.General note ofDr Khadi on 'Development of Blkaneri Nerma (BN) Bt' dtI7/0S/2008.Letter of Dr. Kranthl addressed to Dr. K. C. Jain, ADG (CC) (F.No.PS.l/2/2008dtOS/09/2008) regarding "Draft Proposal for Licensing BN Bt Bt-Cotton".Confidential letter from Dr Kranthi addressed to Dr K C lain, ADG (Ce)F.No.PS/ConfidentiaI/2009 dt21/10/2009 on 'Development of Bt BIkaneri Nanna withBt event BNLA 106'.So called proceedings of 'meeting held under the Chairmanship of DDG (CS) on 10thDecember 2009' at NRCPB, New Delhi.Minutes of the meeting held under the Chairmanship of Dr S K Dutta, DDG (CS) on27/12/2011. .Meeting held under the Chairmanship of Dr 5 K Dutta, DDG (CS) on 7/1/2012 forresponding to letter from Lok Sabha SecretariatList of points reqUired by Lok Sabha Secretariat pertaining to BNBt issue (F.No.2-11/08­Cc.l dt,24-/01/2012).News clipping in Express India and Hindustan Times.

Tel: 011·25848127. fa. 011·2S840478 Website www.pl.ntauthorlty.gov.in'. f mall: c.hatrperson--ppvfra@nic.in. pl-l~utam@tYanoo.com

118

•

5. In addition, In my present capacity as Chairperson. Protection of Plant Varieties &Farmers' Rights Authority. New Delhi. a file was put up for my orders in Jan 2012 for withdrawal ofthe registration of the BnBt variety. Application for registration of the BNat variety was receivedfrom Director, CleR by PPV&FR Authority {application assigned no.REG/2009/241 file na.N13 GH12609241 - Tetraploid Cotton, Gossypium hirsutum L • BN 8t Variety, filed on 08/05/2009}. The requestto withdraw /cancel the said application for BN Bt was received from Dr K R Kranthi, CICR, Napgurvide F.No.PS.l/2/2012/2 dt.t4.01.2012. Leave for withdrawal of appIkation of registration ofBN Otwas granted by PPV & FR Authority .vlde order No.PPVFRA/Registrar/18-13/2007/2885dt.16.01.2012 [Annex I).

6. Based on the aforesaid documents, the following facts are being stated with respectto the two points indicated in your letter under reference:

i) Dr Kranthi did not inform me about the cQlltamlnation of BnBt with MONS31 either dUringor after the meetings he:ld under my Chairmanship In 21 May and 12 Dec 2008. The minutes ofthese meetings are official records reflecting the unanimous decisions of the members and werecirculated to all concerned. Even after circulatio.n of the minutes, no member reported anydlscrepancy or any issue pertaining to recordingof the minutes. It is pertinent to mention that DrKranthi was present in both the meetings held in May and Dec 2008. Further, in the letterdt.OS/09/2008 addressed by Dr Kranthi to Dr K CJain. ADG (CC). in the draft proposal for licensingof ON Bt cotton ofICAR, Dr Kranthl has narrated as under:

'The first Bt cotton variety in G. hlrsuI:UQI·Li,nn 'BIkaneri Nanna·Bt'developed by ICAR(UAS, Dharwad, CICR, Nagpur ami 1ARl, new DeDit) was offldally released for tlOIDilterdalCUltivation In 2008 in the IJ4th Jneeling of GtlA(: held on 2nd May 2008. This Is a landmarkathJevement In biotech research in the institute as well in dae K:AR. This is the first biotechproduct of the public Institute research and has for dae first lime created an eamolnil:a1option for the farmers in India".

In addition. Dr Kranthi has written the folloWing letters, wherein he has not mentioned aboutany contamination of the QNBt.

• 3/2/2009 ro DlfeCtorO/Seeds, Dhll/woo;• 11/2/2009 ro DrK Cjain, ADG (CC);• 19/2/2009 roDrKCjOin,ADG (CC}-'NriJiTglySigned.as 19/2/2008;• S/03/2(}fJ9 to 1'Jr KCjair!, ADG (CC);• 24/3/2009 to DrS Mauria, ADG (IPR&Pol/cy);• 30/3/2009 ro Via Chancellor, DharWGd;• 2/4/2Q09; email dt 16/6/2009 atfdre$Sed to Dr KCjain, ADG (CC)

i1) Similarly, Dr Kbadi also did not inform ~! after GEAC clearance for com.merctalizatilln ofBnBt. that BoBtha(l been-COlltamiJlated with t@llS3+ either.during or after the m.eetings ofMayor,Dec 2008. Dr Khadi was present!n the meeting held. inMay 2.000 and has signed the iIlinutes of themeeting allke other merl1bats. Had the matter been r'l!jJoi'tl!tl /conveyed to ICAR or the undersigned.It could have been discussed and necessary action·~ inclnding the issuance of corrigendum, ifreqnired.

Further, Dr. Khadi's note dt.17/0S/2008 on development of Bikaneri Narma (BN Bt) alsodoes not indicate any contamination. Rather, lie Is full of praise and acimowleilges theentouragement of all I!fficers of ICAR including the undersigned, in guiding the develppl1lent of BNBt. (Annex II)

2/Poge

//9

------

-----------

-i-

Even in the letter dt23 May 2008 of Dr Khadi (written before his leaving CICR, Nagpur tojoin UAS, Dharwad) addressed to Dr Ranjini Warrier, Member Secretary, GEAC, (with a copy to ADG(CC), there is no mention of any contamination.

7, The perusal and scrutiny of the documents reveals that it was only through the'Confidential note doted 21/10/2009' on development ofBt Bikaneri Narma with Bt event BNLA106; addressed to Dr KCJain. ADG (CC), that Dr Kranthi for the first time reported to the ICAR aboutthe contamination of BNBt with Man 531. W~i1e doing so, he has tried to distort the minutes of themeetings held under my Chairmanship in May 2008 and Dec 2008. which is apparent from the factsstated in Annex III.

8. Subsequently, in the so called meeting held on 10 Dec 2009, Dr Kranthi has addednew dimensions to the matter, which are at variance from the recorded facts. The minutes of thismeeting held on 10 Dec 2009 are signed by Dr Kranthi only. The same is neither appended withany covering letter, nor It appears to have been circulated or Issued by the competent officer ofthe lCAR HQ. The said meeting was also attended by Dr Henchinal, V.C, Dharwad and Dr C 0 Mayee.the then Chairman, ARSB. I could have also been invited as 1was available in India for any guidance /clarification on the subject Alternatively, the author of the so called minutes could have referred tothe original proceedings of the May and December 2008 or could have sent the minutes for mycomments / inputs. However. none of these courses were followed. Instead, information as distortedby the author of the so called minutes was taken as the basis for inclusion in some of the subsequentmeetings/events on the subject including providiog the information under RTI and / orcommunication to press / media. Hence this act on the part of the author of the distortedproceedings is abnormal. unexpected. unacceptable and undesirable. In this regard. some glaringdistortions in the so called minutes of the meeting held on 10 Dec 2009 are mentioned in Annex lV.

9. Based on the above facts and circumstances, it is reiterated that neither Dr Kranthinor Dr Khadi had informed me about the contamination of the BN Bt with MON531 during my tenureas DDG (CS) ICAR from 12/10/2007 to 31/12/2008 or thereafter. Such narrations on their part areunnatural. shocking and undesirable, being far from facts on record. 1hope that this clarifies the factson the matter as available on records. which may be helpful to the Expert Committee.

Yours sincerely,

~(P LGautam)

Sh. Rajiv MehrishiSpedal Secretary, DAREGoVt. of IndiaMinistry of Agriculture,Krishi Bhavan, New Delhi 110014

End: As above

3fP09~

l:l..O

Annex I

----

Leave for withdrawal ofapplication ufregistration ofBN Btgranl:JJd by PPV& FR Authority

dmtierlh....C..... G'''C4U

To.

DlNctOl'_ ....~tA.""e-_rch IClCRlPIlet _ NO. 2, SIl......"-PO........ -t4O 1110 """"""-'11tldIe

PratactilMl .. PIHt VadeIIes and........... RIgfll AlIdIOrIY

M!lIItIry " ~"""...su....·....

--

-M:'~Iof JltliJlIc.lout of caftdld•• .,.,.... 8M 8t ~

,.....ac= 'c, Cd •• _ ftI!GI:2UlOIt)".... _10 ,.... _ _ F No. P8 1OJ2012 d-.cIJInuwy 13. 2012 ,.c._ irI __ -, In _ NlJ8"l.•• 10 _"-h you _ ,.,... F No

PS.11212Q10r.D55 -»57 _ ~ 03. 20" IQr_._-.f.....__.. 'M" ..OMce.ltiltDlnIormyou"'''~ Lr'dW are und!Ir"pror "4~'''' I. etlan...- _ 24 (6} olPP\I&FR IvI. 2001. In _ ""_"' "'_ I; " tilW'_

10<__'" STV,,- "" _ 01_e-"'~''''IR_I d\(ICAAl wlIl

nl:lt be PIC ," furth«...m me pRWiMJnat pfC'oQ'gn aIeo ... oa"c.,tlldwMh urn, tilall

~.

......... _forWllhlt4....of~IQr..Q 1J_,ot8NIll-*y"~101I\ll

........ot.~.• dUll' ......, _ 01 wi .... ,.....1_ hOIdete· _ III

.. 1C...orotol"'~bI~~forNQllldl.

copy"".

./ 1. C1ii11tt...._ ••,PmtDtioo or .....V..I1t."~'"~.IW....I. 'it .. 11..~ ...'I.odo"..r..-""""'1 ,,.,,.a-,,,lJdlOIiCr.Hw

0eIlil.

•

"'"~ __ -ttteu (1lItW)fWltClJlllill'., -..-.TICI, OMIlI-UDal1NllJt)

~1I11-_lCm.-'15 ~ott.25M04.,.

....l .............. t :JftAlI"f 11[""'" aodft

4/"g.

1.2-1

------

--

.•,

Annex 11

Note ofDr BM Khadi dated 17/05/2008 onThe development ofBlkaneri Henna Bt (G.hlrsutumj

It is a great pleasure to place on record about the development of Blkoneri Hermo Bt (G.hirsutum). The workstarted under the NATP Mission Mode programme with the provision oJ Cry 1 Ac gene by Dr.P.Anand Kumar. I·

NRCPB New Delhi and PI oJ the project involving VAS Dharwad and CICR Nagpur. The tronsJormation wassuccessfully done at ARS Dharwad by Dr I S Katageri. Senior Cotton Breeder after obtaining training at Texas II

A&M USA and identified with preliminary tests alongwith DrS.5.Udikeri. Dr H M Vamadevaiah and Dr.ManjulaM. under Cooperating Center PI Dr.B.M.Khadi. Most oJ the molecular aspect of presence and integration oJ!gene by Dr.P.Ananda Kumar. NRCP8 New Velhi and gene expression through E"/,ISA by Vr.K.R.Kranthi werecarried out at NRCPB New Delhi and CICR Nagpur respect/vely.wter the conduct oJ strip trial. RCGM Multilacation trials were proposed from ClCR involving ClCR Regionalstations. SAUs oJall the three catton growing zones. The data on required traits were collected by group oJscientists at ClCR Nagpur; Caimbotare. Sirsa. SAUs. HAU Hisar. PAU /'udhiana, RAU Sriganganagar, MAUNanded, NAU Surat, ]NKW Khandwa, VAS Dharwad, ANGARU, /,am and Nandyal. Dr.I.S.Katageri, Dr.SB.Patii.Dr.SS.Pat/l, Dr.S.N.Chattonnavar and Dr.5.5.Hallikeri involved in multiplication, providing of requiredquantity oJseeds ta different trials and data. Dr.B.M.Khadi, Dlreetor, ClCR Nagpur and his scientists Jacilitatedin conducting field trials in the centres and biosaJety tests at different ICAR and private Institutes with the helpoJ scientists from ClCR Nagpur and VAS Dharwad and the environmental safety studies like pallen flow(Dr.VSanthyJ, soil microflara (Dr.P.K.Chakraborty), effects on earthworms (Dr.Blaise), crossability with wildspecies (Dr. Vinito Gotmare) were corried aut at ClCR Nagpur under Networlc project on Tronsgenics ofICAR.Simultaneously conversion oJdifferent elite varieties and parentollines ofhybrids were carried out at ClCR byDr.5uman Bola Singh, Dr. V. V.5ingh and at VAS Dharwad by Dr.I.5.Katageri and his group. I acknowledge thework carried out by Dr.LS.Katageri, Dr.P.Anandakumar, Dr.KR.Kranthl, Dr G.Balasubramani, Heads, ClCRNOBpur, Regional Station Sirsa and operating centres and their Involvement right from initiation toidentification ofBN BtJar commercialization.

DurifllJ the course aJtransfonnation and testing ofBN Bt the encouragement received from Dr.5. Lingappa andDr SAPatil, then Director a! Research and Vice Chancellor respectively and present Vice Chancellor Dr.].H.Kulkami is duly acknowledged. It is a great pleasure in placifllJ on record the encouragements receiveddurifllJ the course ofdevelopment, testifllJ and identification ofBNBt for commercial cultivation especially byDr.CD.Moyee, as a Director, CICR Nagpur, Agriculture Commissioner and Chairman ASRB New Delhi.Dr,/(Cjai1l, ADG(CC) Dr.G.Kalloo, fanner DDG(CS) and Dr.P.LGautam, DDG(CS), ICAR New Delhi, theirencouragement, advise and help is a so duly acknowledged.

It is a matter of great pleasure ta acknowledge Han'ble DG ICAR Dr.Mangala Rai for his constantencouragement and guidance right from the initiation of the work as a DDG(CS) lCAR under NATP andthroughout the course ofdevelopment and testing and identificatian. Everyone directly or indirectly involvedand helped In the develapment ofBNBt Is duly acknowledged.

Sdl-BMKhadiDirectorClCR, NagpurDated 1Z 1)S '2008

Annex III

Confidential note ofDr Kranthi dated Zl/1O/Z009 on 'Development ofBtBlkaneriNorma with Bt event BNLA 106; addressed to Dr KCJain, ADG (cq

Point No. Misrenresentatlon I distortions I facts on record8/9 2005, _The peR result,; for crylAc showed that the samples IThis was never discussed or reported in the meetings

contained a full length gene of 3435 bp which indicated the held in May and Dec 2008

I probability or MonS31 cvent...__The rcswlts were IcommuOIcated to Dr KhadL Dr Khadl fell thal lh.e PI'eSCtlCt:'of MonS31 in the putative BN Bt TS generation plants couldnave been due to cont3minatlon and care would be taken toremove the same from the original event. He Infonned thathe communicated the results and concerns to Dr Katgeriand Dr Ananda Kumar and the appropriate steps would betaken un

I' 2008: After completing all the mandatory biosafety testing Neither Or Khadi nor Dr Kranthi raised the issue ofand field expenmentation, the BN Bt variety was approved contamina.tion dur1ng tbe GEAC meetingfor commerda.1 cultivation in the 84th meeting of the GEACon Z Mav Z008

115Dr Khadi sent ten seeds to the Bt referraJ labs on 4th May This was also not discussed or reported in the meetings2008 (which was a Sunday) tar reconfirmation of the event held in May and Dec 2008present in BN Bt...... Eight samples were found to be

, ~sitjve for £USA and also for MONS31.16 A meeting was convened by Honourable DOC ( Dr P L No meeting was held an the ZI" of March 2008.

Gautam J and the issues related to MONS31 event were However, two meetings were held under mydiscussed tn depth in his chamber on the 215\ March 2008 chairmanship as DOG (CS).in the presence of Or P Aoanda Kumar. Dr B M Khadi. Dr The first meeting on 21- May 2008 was "for discussingKatageri and other officials including the ADGs. Dr K C Jain the road map I fut1Jre st:r'aUflY for the promotion andand Dr Jahalemb utiliSQtfon ofBN St cotton" and the second meeting on

12 Dec 2008 was convened to ..dlsalss the m,odaJitiesfor c:ommerdaUsatton / liunslng of BN Bt cottonevent BN Bt variety and lire Bt catton h,ybrklsdeveloped using the BN Bt n'eIIt'.This was neitheT discussed nor reported in the minutesof the meetings held in May and Dec 2008. Had DrKranthi or Dr Khadi or Dr Anaeda Kumar infonnedabout the contamination in the BN Bt cotton. the sa~e

could have been recorded in the minutes and c:orreec;iveaction/me.asur:es ensured. The m1nutes of the twomeeting are official documents and ma.y be re(erred'(orauthenticitv.

17 Dr Kranthi described the results obtained by the Bt referral As indiated above. no such d1scusslon took place eitherlaboratory and requested that if would be appropriate to in the meeting held on 21 May or 12 Dec 2008. This istake remedLal measures. in view of me detection of the false and call be verifIed from the proceedings ofMon531 in the nUnlortcd BN Btsamnles. met!tinJZS held in Mav and D.ec,2008.

19 The chairman pointed out that Dr KTantbi was an As IndIcated above, this Is touJly an after lhollibt tnentomologtst: and therefore the results should not be blken order to mislead and misrepresent the facts. as t:}l.eseriously. He also asked Dr Kranthl not to carry out any statement is far from (acts on records.further moleroJar testing Qf the samples and only to tarI')'

forward the commercialisation process with full zul,iildherinp to all the instructions laid out in the nroceedfn~.

20 The chairman decided that the BN Bt seeds would be All the decisions """ere taken unanimously afterproduced by UAS Dharwad. considerable discussions and deliberations and w;th the

conCUrrence oJ all tlle..meOlbert present In the" meetings,inclUding Dr. Khadi (May ZOOS) and Dr Kranthl (Mayand Dec 2008). It was a consensus decision and doesnot reflect the Views of any individual.

6/Pogt

1:2.3.

--

-

--

--

Annex IV

Minutes of the so called meeting held on 10 Dec 2009 viz-a-viz facts on record

51 I Para I Distortions as indicated In the so called meeting Facts on recordPue of 10 Dec 2009Para 7, A meeting was convened by DOG (CS) Dr P L Gautam The meeting on 21.5.2008 held under the10.12.2009 and issues related to Mon531 were discussed in chainnanship of Dr P L Gautam was "for dtscussln.o(page 3): depth on 2I" May 2008 in the presence of Dr A the rood map / future strategy far the promotIon

Ku~ar, Dr Khadi, Dr Katagen and offfidals Including and utIlIsatIon ofBN Bt cotton" and not as reported.ADGs etc. No report to this effect was received and hence these

~ chairman instructed that eN et seeds should bt'

sentences are out of context as they are not at all part'ofminutes of these meetings circulated to allconcerned

Para 7 . li was derided th;"lf "rcd production will be taken up10.12.2009 produced~ VAS Dharwad tn about 150 acres by all the concerned institutions and "not only by VAS(page 3) Dharwad". It was a consensus decision and does not

reflect the views of any individual.Para 7: Dr Kranthi described the results obtained by the Bt The entire paragraph as Indicated is not at all in10.12.2009 referral labs. and requested that It would be confonnlty being totally at variance from the(page 3) : appropriate to take remedial measures in view of the recorded minutes of the meetings held in May and

detection of Mon531In all the purported BN et seed December 200B. It has been wrougly quoted as mysamples. He pointed out that the Awasthagen data statement with ulterior motives in my absence.were flawed since the lell: border sequences of theinsert were not contiguous with the right bordersequences on the bac done and also the primers werenot functional. He requested for a third pany analysisto reconfinn the event data so that sertollsrepercussions couJd be avoided in future.................The chairman (Dr P LGautam) had thenconcluded that the possible presence of Mon531 wasnot an issue any more because of the strongmolecular evidence produced by Dr Ananda Kumar.He said that the issue was dosed and asked theDirector OCR to carty forward the commercialisationprocess with full zeal. adhering to all instructions laidout in the nrocee,Hno<

Para 12: Dr Ananda Kumar said \h;Jt even pri.or to the 21 May The contamination of BN Bt event with that of10,12.2009 200e meeting. he had been Infomed by the seed MonS31 event In BN Bt cotton seeds was neither(page 5): industry sources about the possibility of the presence pointed out in IBSC meetlugs held in May 2007 and

of the MOD 531 event In the BN Bt seeds. In response, March 200S nor in the GEAC meetings held In 2008he had conducted event testing with Mon531 specific or at the time of filing for registration of the varietyprimers using old DNA samples that were obtained with PPV&FR Authority In May 2009. It wasfrom the original eNLAI06 event of VAS Dharwad. Incumbent on the part of the respective Institutions IThe results were negative. He saId It was possible scientists involved in the development of the saidthat contamination with MonS31 would have variety to report the problem, if any, to the ICAR asoccurred sometime before the testfng was CllTried out and when noticed,In Dr Kranti's lab in 2005. In specific response to aquery by the cbainnan. Dr Ananda Kumar _.._agreed that the flanking region sequences ofthepurporte<l eNLAI06 event provlded by Awasthagen ,were flawed and the primers suggested by them donot wod< for event Identification

No~:OnO' signed by Dr Krantht has no covering letter~nd does nat appear to hove been circulated or issued by ,the.Camperento!ficers ofthe'/CAR HQ

INDIAN COUNCIL OF AGRICULTURAL RESEARCHKRISHI BHAVAN: NEW DELHI

F.No. 13(6)/2006-IPRDated 16.10,2006

SUB: PROCEEDINGS OF THE MEETING ON THE "ISSUE OFCOMMERCIALIZATION OF Bt-Gry1Ac GENE OBTAINED FROMUNIVERSITY OF OTTAWA, CANADA FOR THE BENEFIT OF COTTONFARMERS IN INDIA" HELD UNDER THE CHAIRMANSHIP OF DDG(CS & H)ON 5.10.2006 AT 12.00 NOON

Please find enclosed herewith the above proceedingsinformation/necessary action.

for your kind

~Asst!. Director General (IPR & Policy)

Distribution

1. Dr. N.D. Jambhale, ADG (Seeds)

2. Dr. V.D. Patil, ADG (PP)

3. Dr. S.N. Shukla, ADG (FFC)

4. Dr. K.C. Jain, ADG (GG)

5. Dr. T.P. Rajendran, ADG(OP)

6. Dr. S.N. Pandey, ADG(H)

7. Dr. KV Ramanna, ADG(PC)

8. Dr. 8.M. Khadi, Director, C'CR, Nagpur

9 Dr. P. Ananda Kumar, Principal Scientist, NRCP8

1Lf: .. ;" ;.._,,,:,j,,,., Di,dctC,I, t,I',CPB, Pusa. New Delhi.12

11. Copy for kind information PS to DDG(CS&H)

.//

PROCEEDINGS OF THE MEETING ON THE "ISSUE OF COMMERCIALIZATION OFBt-Cry1Ac GENE OBTAINED FROM UNIVERSITY OF OTTAWA, CANADA FOR THEBENEFIT OF COTTON FARMERS IN INDIA" HELD UNDER THE CHAIRMANSHIPOF DDG(CS & H) ON 5.10.2006 AT 12.00 NOON

The list of participants is placed as Annexure-I.

The meeting began with a brief background on the issue by ADG (IPR). Twofacts that emerged in the preliminary discussion were as follows:

1. R&D work related to release of indigenously developed Bt cottonhybrids/varieties and containing Cry1Ac gene obtained from the University ofOttawa, Canada is at a very advanced stage. It is expected that the ICAR­SAU system may be able to propose the release of these materials forcultivation by the farmers by the year 2008. The release of indigenouslydeveloped Bt cotton varieties is an issue of immense interest for the poorcotton farmers. Farmers cultivating these Bt cotton varieties shall not have tobuy the expensive hybrid Bt cotton seed from the private seed companiesevery year. Even the cost of indigenously developed Bt cotton hybrids fromthe ICAR-SAU system is expected to be much less than the cost of similarseed from the private sector.

2. In view of the advanced stage of research and the likely economic benefits toIndian cotton farmers and the economy, the legality of the 'agreement'between Dr. RP. Sharma, the then Director NRCPB, New Delhi and theUniversity of Ottawa to use this CryiAc gene is an issue to be examined forits implications in the Indian context.

Subsequently, the following decisions were taken.

1. The so-called 'Biological Material Transfer and Collaboration Agreement' inquestion is between Dr. RP. Sharma, the then Director NRCPB, New Delhi andthe University of Ottawa. It appears to be only a kind of understanding at theirpersonal level. It may not be considered as an agreement at the national level.This view emerged in view of the fact that this matter was never referred byNRCPB at that stage to the ICAR Hqrs., and Dr. R P. Sharma signed theunderstanding in his individual capacity. Accordingly, it was felt that in' caseICAR-SAU system has to submit in future the proposals for release ofindigenously developed varieties/hybrids in India and containing this gene, theissue of IPR or ownership on this gene may not be any issue at the nationallevel. However, it was considered appropriate to send the so-called 'agreement'and these proceedings to Legal Advisor ICAR for the opinion of Law SectionICAR on the 'legal validity' of the so-called 'agreement' in India. ADG (IPR) canexplain the case to Legal Advisor ICAR for arriving at an opinion.

(Action: ADG (IPR) and LA. ICAR)

\ )..6

//

..

2. The nature of the gene was discussed in detail. Four Cry1Ac genes in the Indiancontext were referred to. It was noted that other than the Cry1Ac gene ofMonsanto-Mahyco venture which was first released in the form of different 8tcotton hybrids in India, two other similar CrY1Ac gene(s) from the public sectorhave also been allowed in the current year 2006 by GEAC, Ministry ofEnvironment and Forests, Gal to two other Indian private companies for releaseinto the environment in the form of Bt cotton hybrids. Accordingly, it was felt thatfor all practical purposes this gene in question from NRCPB shall be called

1\ 'truncated Cry1Ac toxin gene from NRCPB, New Delhi'. Nevertheless, it was feltthat the ICAR-SAU system should be prepared to meet any GEAC requirementat the time the question of release of materials containing NRCPB gene arises. Itwas, accordingly, decided that as a preparatory exercise we must be ready withthe likely GEAC requirement with respect to the NRCP8's gene vis-a-vis all otherCry1Ac gene.s in India'. For the purpose, a note ·be jointly prepared by Drs. P.Ananda Kumar and B. M. Khadi. This note will be strictly confidential for internaluse only.

(Action: Drs. P. Ananda Kumar and B. M. Khadi)

3. It was decided that we should continue with R&D and bio-safety related work forrelease of indigenously de·veloped Bt cotton varieties/hybrids. If any difficulty isencountered in future, ·that will be handled at that time in future. For the samereason, it was also decided that the 'Freedom to Operate' analysis as desired bythe University of Ottawa in its e-mail correspondence with Dr. P. Ananda Kumaris not required at this stage.

The meeting ended with a vote of ihanks to the House and the Chair.

•.•