Bone morphogenetic proteins 2, 4, and 9 stimulatemurine hepcidin 1 expression independently of Hfe,transferrin receptor 2 (Tfr2), and IL-6Jaroslav Truksa, Hongfan Peng, Pauline Lee, and Ernest Beutler*

Department of Molecular and Experimental Medicine, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA 92037

Contributed by Ernest Beutler, April 17, 2006

Recently, it has been suggested that hepcidin, a peptide involvedin iron homeostasis, is regulated by bone morphogenetic proteins(BMPs), apparently by binding to hemojuvelin (Hjv) as a coreceptorand signaling through Smad4. We investigate the role of Hfe, Tfr2(transferrin receptor 2), and IL-6 in BMP2-, BMP4-, and BMP9-stimulated up-regulation of murine hepcidin, because these mol-ecules, like Hjv, are known to be involved in hepcidin signaling. Weshow that the BMP signaling pathway acts independently of Hfe,Tfr2, and IL-6: The response to BMP2, BMP4, and BMP9 is similar inisolated hepatocytes of wild-type, Hfe�/�, IL-6�/�, and Tfr2m mu-tant mice. The potency of different human BMPs in stimulatinghepcidin transcription by murine primary hepatocytes is BMP9 >BMP4 > BMP2. However, in human HepG2 cells, BMP4 and BMP9are equally potent, whereas BMP2 requires a higher dose tobecome an effective hepcidin activator. Moreover, all of the testedBMPs are more potent regulators of hepcidin than IL-6 and thus arethe most potent known stimulators of hepcidin transcription.

HepG2 � inflammation � iron

Bone morphogenetic proteins (BMPs) are cytokines belong-ing to the TGF-� superfamily. They play a crucial role in

regulating cell proliferation, cell differentiation, and apoptosisand in the development of tissues (1, 2). There are 20 differenthuman BMPs, with various expression profiles and tissue distri-bution. BMPs function by binding to specific receptors, which aredivided into two separate groups: BMP receptor type I and typeII. Binding to receptor homodimers is very weak, and high-affinity binding is accomplished by forming heterodimers of typeI�type II receptors (3, 4).

Formation of the BMP–BMP receptor I�II type complexplaces these receptors in close proximity, leading to phosphor-ylation of the BMP type I subunit by the constitutively activeserine�threonine kinase type II receptor. Phosphorylated recep-tor I is an active kinase that subsequently phosphorylatesintracellular messengers of BMP signaling, including the Smadproteins and mitogen-activated protein kinase (5).

Smad proteins can be divided into three groups: receptor-mediated Smads (R-Smads) (Smad1, -2, -3, -5, and -8), thecommon mediator Smads (Co-Smads) (Smad4), and inhibitorySmads (Smad6 and -7). R-Smads are associated with the recep-tor complex and, upon ligand binding, become phosphorylatedand form heterodimers with Co-Smad. The R-Smad�Co-Smadcomplexes translocate to the nucleus, where they bind directly orthrough specific transcriptional partners to promoter sequencesof the target, regulated genes that are responsible for thetranscriptional response to BMPs (6).

Recently, BMPs have been found to have a previously unex-pected role in iron metabolism. Babitt et al. (7) demonstratedthat RGMa, a homolog closely related to the protein associatedwith juvenile hemochromatosis (hemojuvelin, Hjv), was a core-ceptor for BMP2 and BMP4. Babitt et al. (8) subsequentlyshowed that Hjv was also a coreceptor for BMPs and suggestedthat the Hjv�BMP complex regulated hepcidin expressionthrough a BMP signal transduction pathway. The importance of

BMP signaling in iron homeostasis was confirmed in liver-specific Smad4-deficient mice, which showed a drastic decreasein hepcidin expression and an impaired hepcidin response to ironoverload and IL-6. In addition, these mice exhibited abnormaliron accumulation and altered expression of several other pro-teins that are involved in iron uptake and metabolism, such asdivalent metal transporter 1 (DMT1 or Nramp2), duodenalcytochrome b ferric reductase (DcytB), and ferroportin. Fur-thermore, hepcidin transcription was not stimulated by BMP4treatment in hepatic cell lines derived from liver-specific Smad4-deficient mice, in contrast to cell lines derived from wild-typemice. The Smad4 responsive element was localized to a fragmentof the murine Hepc1 promoter that spans the region 800 bpupstream of the start of transcription (9).

Hepcidin, a small, cysteine-rich cationic peptide with antibac-terial properties, plays a key role in iron homeostasis. Expressionof hepcidin mRNA is stimulated by iron excess and inflammation(10–12), whereas the expression of hepcidin mRNA is decreasedby hypoxia and anemia (13, 14). Hepcidin binds to the ironexporter ferroportin and blocks its function by targeting ferro-portin for internalization and degradation. As a result, ironuptake by the intestine is reduced, and iron release from storesin hepatocytes and macrophages is also diminished. It may alsocontribute to the anemia of chronic inflammation by diminishingthe responsiveness of erythroid cells in the marrow to low levelsof erythropoietin (15).

The signaling pathway that regulates hepcidin involves mem-brane-bound proteins such as Hjv, Hfe, and transferrin receptor2 (Tfr2) (16, 17). Impairment of Hjv, Hfe, or Tfr2 leads tomarked decrease in hepcidin expression and, subsequently, toabnormal tissue iron loading, particularly in hepatocytes, thephenotype of hereditary hemochromatosis (16, 18–21). The factthat Hjv acts as a coreceptor for BMPs raises the question ofwhere Hfe and Tfr2 fit into the regulatory pathway. Could Hfeor Tfr2 also act as coreceptors? In this study, we examinedwhether Hfe or Tfr2 was required for BMP-induced hepcidinexpression. Furthermore, we examined the question of whetherthe predominantly liver-specific BMP9 (22) might regulate hep-cidin expression in the same manner as BMP2 and BMP4.Moreover, because the liver-specific Smad4-deficient mice havean impaired response to IL-6, we also investigated the role ofIL-6 in BMP signaling. Using knockout Hfe�/� mice, IL-6�/�

mice, and a Tfr2 mutant mouse, we demonstrate that Hfe, Tfr2,and IL-6 do not play a role in hepcidin stimulation by BMP2,BMP4, and BMP9 and thus are not in the pathway of BMP tohepcidin. Furthermore, we demonstrate that BMP9 is the mostpotent inducer of hepcidin expression currently known.

Conflict of interest statement: No conflicts declared.

Abbreviations: BMP, bone morphogenetic protein; Tfr2, transferrin receptor 2; Hjv, hemo-juvelin; RPLP2, ribosomal protein large P2.

*To whom correspondence should be addressed. E-mail: beutler@scripps.edu.

© 2006 by The National Academy of Sciences of the USA

www.pnas.org�cgi�doi�10.1073�pnas.0603124103 PNAS � July 5, 2006 � vol. 103 � no. 27 � 10289–10293

CELL

BIO

LOG

Y

ResultsBecause the Hfe�/�, Tfr2m, and IL-6�/� mice were in differentgenetic backgrounds, separate experiments were performed,comparing the mutant mice with their own congenic strain ineach case.

Hepcidin Is Up-Regulated by BMP2, BMP4, BMP9, and LPS in Wild-Type129 and Hfe�/� Primary Murine Hepatocytes. Treatment with BMP2(150 ng�ml), BMP4 (10 ng�ml), and BMP9 (1 ng�ml) for 12–16h resulted in an �10-fold increase in the expression of hepcidinin both wild-type and Hfe�/� primary hepatocytes. Treatmentwith 200 ng�ml LPS was used as a positive control because ofits documented ability to regulate hepcidin expression andresulted in an �2-fold increase in the hepcidin mRNA levels

(Fig. 1). The basal level of hepcidin expression was slightlydecreased in the Hfe�/� knockout primary hepatocytes, inagreement with most (23, 24), but not all (16), previousreports.

Hepcidin Is Up-Regulated by BMP2, BMP4, BMP9, and LPS in Wild-TypeAKR and Tfr2m Mutant Primary Hepatocytes. Treatment with BMP2(150 ng�ml), BMP4 (10 ng�ml), and BMP9 (1 ng�ml) for 12–16h resulted in an �10-fold or greater increase in the expressionof hepcidin in both wild-type and Tfr2m primary hepatocytes. Incontrast, treatment with 200 ng�ml LPS resulted in an �2-foldincrease in hepcidin mRNA levels (Fig. 1). The basal level ofhepcidin expression was decreased in the Tfr2m mutant primaryhepatocytes, in agreement with previous reports (18).

Fig. 1. Effect of BMP2, BMP4, BMP9, and LPS treatment on hepcidin expression in hepatocytes isolated from Hfe�/�, IL-6�/�, and Tfr2m mutant mice. Primaryhepatocytes were isolated from perfused livers of Hfe�/� or wild-type 129 mice (A), Tfr2m mutant or AKR wild-type mice (B), and IL-6�/� or C57BL�6J mice (C),seeded at 1.5 � 105 cells per well, and allowed to attach to collagen-coated 12-well plates for 2 h, and BMP2 (150 ng�ml), BMP4 (10 ng�ml), BMP9 (1 ng�ml),or LPS (200 ng�ml) was applied for 12–16 h. Hepcidin and S18 ribosomal protein (S18 RP) (a normalization gene) expression was assayed by quantitative real-timeRT-PCR using TaqMan probes. All samples were processed in triplicate, and a graph of experimental values � SEM from at least two independent experimentsis shown.

10290 � www.pnas.org�cgi�doi�10.1073�pnas.0603124103 Truksa et al.

Hepcidin Is Up-Regulated by BMP2, BMP4, and BMP9 in Wild-TypeC57BL�6J and IL-6�/� Primary Hepatocytes. Treatment with BMP2(150 ng�ml), BMP4 (10 ng�ml), and BMP9 (1 ng�ml) for 12–16h resulted in an �10-fold or greater increase in the expressionof hepcidin in both wild-type and IL-6�/� primary hepatocytes.However, treatment with 200 ng�ml LPS resulted in an �2-foldincrease in hepcidin mRNA levels in the wild-type mice and asignificantly reduced response in IL-6�/� primary hepatocytes(Fig. 1).

Dose–Response Curves for BMP2, BMP4, BMP9, and IL-6 in MurineHepatocytes. Isolated murine hepatocytes from the C57BL�6Jstrain were treated with 10-fold serial dilutions of BMP2, BMP4,BMP9, and IL-6, ranging from 0.1 to 100 ng�ml. As shown in Fig.2, the most potent stimulator was BMP9, attaining its halfmaximal effect at �0.3 ng�ml. Approximately 1 ng�ml BMP4and �3 ng�ml BMP2 were required to achieve the same effect.Interestingly, the known hepcidin stimulatory cytokine IL-6 wasthe least potent agent in this assay, and the maximal concentra-tion of 100 ng�ml tested resulted in only approximately one-halfof the stimulatory effect of BMPs.

Hepcidin Is Up-Regulated by BMP2, BMP4, and BMP9 in Human HepG2Cells. Similar to our findings in murine primary hepatocytes,treatment with BMP2 (150 ng�ml), BMP4 (10 ng�ml), andBMP9 (1 ng�ml) for 12–16 h resulted in an �30-fold increase inthe expression of hepcidin after stimulation by BMP2, a 10-foldincrease after stimulation by BMP4, and an �5-fold increaseafter stimulation by BMP9 (Fig. 3A).

Dose–Response Curves for BMP2, BMP4, and BMP9 in Human HepG2.HepG2 cells were treated with 10-fold serial dilutions of BMP2,BMP4, BMP9, and human IL-6, ranging from 0.1 to 100 ng�ml.As shown in Fig. 3B, BMP4 and BMP9 were equally effective,attaining half-maximal effect at �3–5 ng�ml, whereas BMP2required �10 ng to achieve the same effect. Moreover, it appearsthat the induction of hepcidin transcription by BMP2 was notmaximal even at a concentration of 100 ng�ml. As shown in Fig.3A, BMP2 is able to increase hepcidin levels up to 30-foldcompared with control at a concentration of 150 ng�ml. Inter-estingly, IL-6, a known hepcidin activator, was the least potent

agent in this assay, and the maximal concentration of 100 ng�mlresulted in approximately doubling the hepcidin mRNA levels,whereas all BMPs at this concentration stimulated hepcidin�10-fold.

DiscussionHepcidin is a key regulatory molecule of iron metabolism, butthe mechanisms that regulate its expression are poorly under-stood. It has been shown that LPS; inflammatory cytokines suchas IL-6, IL-1�, and IL-1�; and iron result in increased levels ofhepcidin mRNA and protein (10–12) and that the expression ofthe hepcidin message is decreased by hypoxia and anemia (13,14). More recently, the role of other classes of cytokines such asBMP and TGF-� has emerged, although the pathway andphysiological relevance of these stimuli remain undefined (8, 9).Interestingly, the role of hepcidin processing and secretion hasnot yet been investigated as a regulatory mechanism, eventhough it may function as another level in the complex regulationof hepcidin expression and iron homeostasis.

A different scheme of hepcidin regulation recently has beensuggested that depicts Hjv as a coreceptor of BMPs (8). Thesignal transduction pathway involves the Smad4 transcriptionfactor; however, it is not clear which, if any, of the BMP

Fig. 2. Dose–response curves of BMP2, BMP4, BMP9, and murine IL-6.Primary hepatocytes were isolated from perfused livers of C57BL�6J mice,seeded at 1.5 � 105 cells per well, allowed to attach to the collagen-coated12-well plates, and treated with BMP2, BMP4, BMP9, and murine IL-6 atconcentrations ranging from 0.1 to 100 ng�ml for 12–16 h. Hepcidin and 18Sribosomal protein (S18 RP) (a normalization gene) expression was assayed byquantitative real-time RT-PCR using TaqMan probes. All samples were pro-cessed in triplicate, and the mean and SEM are shown.

Fig. 3. Effect of BMP2, BMP4, and BMP9 treatment on hepcidin expressionin human HepG2 cells. (A) Human HepG2 hepatoma cells were seeded at 1.5 �105 cells per well and allowed to attach to 12-well plates, and BMP2 (150ng�ml), BMP4 (10 ng�ml), or BMP9 (1 ng�ml) was added. After 12–16 h ofincubation, human hepcidin and human RPLP2 (a normalization gene) ex-pression was assayed by quantitative real-time RT-PCR using TaqMan probes.All samples were processed in triplicate, and a graph of experimental values �SEM from three independent experiments is shown. (B) Dose–response curvesof BMP2, BMP4, BMP9, and human IL-6. Human hepatoma cells (HepG2) wereseeded at 1.5 � 105 cells per well, allowed to attach to 12-well plates, andtreated with BMP2, BMP4, BMP9, and human IL-6 at concentrations rangingfrom 0.1 to 100 ng�ml for 12–16 h. Human hepcidin and RPLP2 expression wasassayed by quantitative real-time RT-PCR using TaqMan probes. All sampleswere processed in triplicate, and the mean and SEM are shown.

Truksa et al. PNAS � July 5, 2006 � vol. 103 � no. 27 � 10291

CELL

BIO

LOG

Y

receptor-associated Smads (Smad1, -5, or -8) is also required.Moreover, the nature of the stimulus that up-regulates BMPexpression remains elusive, as well as the actual components andstructure of the membrane-bound signaling complex.

To define this pathway more precisely, we have focused onother molecules that are involved in hepcidin regulation andsignaling: in particular, Hfe and Tfr2. We hypothesized that ifHjv can act as a coreceptor of BMPs, it is possible that Hfe orTfr2 is also a part of the signaling complex and�or it maymodulate the response to BMPs. Furthermore, we testedwhether IL-6�/� mice had impaired or modified BMP signalingbecause liver-specific Smad4-deficient mice do not respond toIL-6 treatment (9).

Our results show that human recombinant BMP2, BMP4, andBMP9 markedly up-regulated hepcidin mRNA in primary murinehepatocytes isolated from wild-type mice as well as Hfe�/� mice,IL-6�/� mice, and Tfr2m mutant mice. The observed increase inhepcidin expression was similar to that observed by Babitt et al. (8)and Wang et al. (9). However, we now show that BMP9 alsoup-regulate hepcidin. Moreover, we have demonstrated that BMP9is the most potent inducer of murine hepcidin expression, followedby BMP4 and BMP2. Interestingly, all of the tested BMPs weremore efficient in up-regulating murine hepcidin than the knownhepcidin regulator, inflammatory cytokine IL-6.

Furthermore, the fact that human BMP2, BMP4, and BMP9efficiently up-regulated hepcidin in primary murine hepatocytesas well as human hepatoma cell line HepG2 suggest that thissignaling pathway is conserved in evolution. The dose of BMPsrequired to obtain a similar up-regulation of hepcidin wasgenerally higher in HepG2 cells than in primary hepatocytes, andBMP4 and BMP9 were equipotent. However, the observeddifferences between murine primary hepatocytes and humanHepG2 cells might be due to species differences or, more likely,to the transformed nature of the HepG2 cell line. The highpotency and liver specificity of BMP9 suggest that it might be apreviously unrecognized target for therapeutic intervention iniron overload disease and�or anemia of chronic inflammation.

We conclude that the BMP signaling pathway acts indepen-dently of Hfe, Tfr2, and IL-6, which suggests that either the BMPpathway is not involved in the iron sensing or, if it is, it functionsdownstream of Hfe and Tfr2. The studies of Wang et al. (9)indicate that liver cells in which the Smad4 gene is disrupted donot respond to IL-6 by up-regulating hepcidin transcription. Weshow, moreover, that IL-6 is not required for BMP-mediated(and therefore, presumably, Smad4-mediated) up-regulation ofhepcidin transcription.

Materials and MethodsMaterials. Human recombinant BMP2, BMP4, BMP9, and IL-6and murine recombinant IL-6 were obtained from R & DSystems. LPS and collagenase were from Sigma. Hepatocytewash medium, minimal essential medium, Williams’ medium E,and liver digest medium were from Invitrogen.

Mice. IL-6�/� mice were on a background of C57BL�6J (002650)and were obtained from The Jackson Laboratory. Hfe�/�

mice and Tfr2 mutant (Tfr2m) mice were kind gifts from WilliamSly and Robert Fleming (both of Saint Louis University, St.Louis), respectively. We backcrossed the Hfe�/� mice into the129 strain for 10 generations. The Tfr2m mutant mice, transgenicmice with a hypomorphic mutation that is found in humans, wereon an AKR background.

Cells. Human hepatoma cell line HepG2 was obtained from theAmerican Type Culture Collection and cultivated in minimalessential medium supplemented with 5% FBS�100 units/mlpenicillin�100 �g/ml streptomycin�1 mM sodium pyruvate�2mM L-glutamine.

Isolation of Murine Primary Hepatocytes. Each mouse was anesthe-tized and placed on a warm surface to keep the body temperatureat 37°C. The abdominal and chest cavities were opened, and theinferior vena cava, portal vein, and heart were exposed. The inferiorvena cava was cannulated with a 21-gauge catheter attached to aperfusion line, the heart was clamped, and the portal vein was cutto route retrograde perfusion primarily through the liver. A peri-staltic pump was used to perfuse the liver with solutions placed ina 48°C water bath. Travel through the tubing lowered the temper-ature of the solutions entering the mouse to 37°C. The livers wereperfused consecutively with 0.5 mM EGTA at a rate of 5 ml�minfor 5 min, PBS at 5 ml�min for 2 min, and liver digest mediumcontaining an additional 0.15 mg�ml collagenase at 2 ml�min for 10min. The digested liver was excised and disaggregated by gentlerubbing with a cell scraper in a Petri dish with hepatocyte washmedium. The mixture was passed through a 70-�m nylon cellstrainer (BD Biosciences) to obtain single cells, and the cells werewashed twice with hepatocyte wash medium with centrifugation at50 � g. To enrich the cells in hepatocytes, the cell pellet wasresuspended in 25 ml of Williams’ medium E, layered over 20 ml ofPercoll (Amersham Pharmacia Biosciences):Hanks’ balanced saltsolution (9:1), and centrifuged at 250 � g for 10 min. Pelletedhepatocytes were resuspended in 12 ml of Williams’ medium E andcentrifuged at 50 � g for 5 min. The hepatocyte pellet wasresuspended in 12 ml of Williams’ medium E supplemented with5% FBS, counted in a hemocytometer after staining with Trypanblue, and seeded at a density of 1.5 � 105 hepatocytes per well ina 12-well plate coated with collagen (BD Biosciences). Williams’medium E and hepatocyte wash medium were supplemented with100 units/ml penicillin�100 �g/ml streptomycin�2 mM L-glutaminebefore use.

BMP2, BMP4, BMP9, IL-6, and LPS Treatment of Primary Hepatocytesor HepG2 Cells. BMP2, BMP4, and BMP9 and murine and humanIL-6 were reconstituted according to the manufacturer’s instruc-tions by dissolving in either a sterile aqueous solution containing4 mM HCl and 0.1% BSA or a sterile aqueous PBS solutioncontaining 0.1% BSA. Two to four hours after plating oncollagen-coated 12-well plates, adherent murine hepatocyteswere treated for 12–16 h with BMP2 (0.1–150 ng�ml), BMP4(0.1–100 ng�ml), BMP9 (0.1–100 ng�ml), murine IL-6 (0.1–100ng�ml), or LPS (200 ng�ml). HepG2 cells were plated into12-well plates and treated for 12–16 h with BMP2 (0.1–150ng�ml), BMP4 (0.1–100 ng�ml), BMP9 (0.1–100 ng�ml), andhuman IL-6 (0.1–100 ng�ml). The concentrations of BMPs usedin this study were based on the concentrations described byNakamura et al. (25) to activate the alkaline phosphatase gene.

RNA Isolation, cDNA Synthesis, and Quantitative Real-Time RT-PCR.Total RNA was isolated from primary hepatocytes or HepG2cells by using the Versagene RNA Purification Kit (GentraSystems), including the DNase treatment step to avoid con-tamination with genomic DNA. cDNA first-strand synthesiswas performed with 5–10 �g of RNA, Moloney murineleukemia virus reverse transcriptase (Invitrogen), and oli-go(dT) primer (IDT) in a 20-�l volume. Quantitative PCR wascarried out by using the Bio-Rad iCycler, using primers specificfor murine Hepc1 (GenBank accession no. AF503444), withS18 ribosomal protein mRNA (GenBank accession no.AK050626) serving as a normalization gene. The hepcidinprimers were designed to amplify only murine hepcidin 1(Hepc1) and not hepcidin 2 (Hepc2) and are listed in Table 1.Amplification of human hepcidin (HEPC) (GenBank acces-sion no. NC�0000019) and human ribosomal protein large P2(RPLP2) (GenBank accession no. NM�001004) was performedwith the primers listed in Table 1.

The iCycler amplification was performed according to themanufacturer’s instructions in a buffer containing 20 mM

10292 � www.pnas.org�cgi�doi�10.1073�pnas.0603124103 Truksa et al.

Tris�HCl (pH 8.4), 50 mM KCl, 4.0 mM MgCl2, 200 �M dNTPs,0.625 units of iTaq DNA polymerase (Bio-Rad), 300 nM senseprimer, 300 nM antisense primer, and 300 nM 5� 6-carboxyfluo-rescein-labeled TaqMan probe. One microliter of a 1:5 dilutionof synthesized cDNA or standard was used in a 25-�l reaction,and all samples were analyzed in triplicate. The amplificationprotocol was as follows: 5 min of initial denaturation at 95°Cfollowed by 40 cycles of 20-s denaturation at 95°C, 20 s ofannealing at 59°C, and 20 s of extension at 72°C. A murine hepc1standard curve was generated by using a murine hepc1 PCRproduct ranging from 0.068 to 680 amol per reaction. A murineS18 ribosomal protein standard curve was generated by using aPCR product ranging from 0.065 to 650 amol per reaction. Ahuman hepcidin standard curve was generated by using a human

hepcidin PCR product ranging from 0.069 to 690 amol perreaction. A human RPLP2 standard curve was generated byusing a PCR product ranging from 0.014 to 140 amol perreaction. After 40 amplification cycles, threshold cycle valueswere automatically calculated, attomoles of target cDNA werededuced from the standard curve, and expression levels of hepc1were expressed as the murine hepc 1�S18 ribosomal proteincDNA ratio in experiments with murine primary hepatocytes orthe human hepc�RPLP2 cDNA ratio in experiments withHepG2 cells.

This work was supported by National Institutes of Health GrantDK53505 and the Stein Endowment Fund. This manuscript is no.18141-MEM.

1. Varga, A. C. & Wrana, J. L. (2005) Oncogene 24, 5713–5721.2. Gambaro, K., Aberdam, E., Virolle, T., Aberdam, D. & Rouleau, M. (2006)

Cell Death Differ. 13, 1075–1087.3. Ten, D. P., Korchynskyi, O., Valdimarsdottir, G. & Goumans, M. J. (2003) Mol.

Cell. Endocrinol. 211, 105–113.4. Ten, D. P. & Hill, C. S. (2004) Trends Biochem. Sci. 29, 265–273.5. Liu, F. (2003) Front. Biosci. 8, s1280–s1303.6. Massague, J., Seoane, J. & Wotton, D. (2005) Genes Dev. 19, 2783–2810.7. Babitt, J. L., Zhang, Y., Samad, T. A., Xia, Y., Tang, J., Campagna, J. A.,

Schneyer, A. L., Woolf, C. J. & Lin, H. Y. (2005) J. Biol. Chem. 280,29820–29827.

8. Babitt, J. L., Huang, F. W., Wrighting, D. M., Xia, Y., Sidis, Y., Samad, T. A.,Campagna, J. A., Chung, R. T., Schneyer, A. L., Woolf, C. J., et al. (2006) Nat.Genet. 38, 531–539.

9. Wang, R. H., Li, C. L., Xu, X. L., Zheng, Y., Xiao, C. Y., Zerfas, P.,Cooperman, S., Eckhaus, M., Rouault, T., Mishra, L., et al. (2005) Cell Metab.2, 399–409.

10. Lee, P., Peng, H., Gelbart, T., Wang, L. & Beutler, E. (2005) Proc. Natl. Acad.Sci. USA 102, 1906–1910.

11. Lee, P., Peng, H., Gelbart, T. & Beutler, E. (2006) Proc. Natl. Acad. Sci. USA101, 9263–9265.

12. Ganz, T. (2004) Curr. Opin. Hematol. 11, 251–254.13. Means, R. T. (2004) Blood Rev. 18, 219–225.

14. Nicolas, G., Chauvet, C., Viatte, L., Danan, J. L., Bigard, X., Devaux, I.,Beaumont, C., Kahn, A. & Vaulont, S. (2002) J. Clin. Invest. 110, 1037–1044.

15. Dallalio, G., Law, E. & Means, R. T. (2006) Blood 107, 2702–2704.16. Ahmad, K. A., Ahmann, J. R., Migas, M. C., Waheed, A., Britton, R. S.,

Bacon, B. R., Sly, W. S. & Fleming, R. E. (2002) Blood Cells Mol. Dis. 29,361–366.

17. Biasiotto, G., Belloli, S., Ruggeri, G., Zanella, I., Gerardi, G., Corrado, M.,Gobbi, E., Albertini, A. & Arosio, P. (2003) Clin. Chem. 49, 1981–1988.

18. Kawabata, H., Fleming, R. E., Gui, D., Moon, S. Y., Saitoh, T., O’Kelly, J.,Umehara, Y., Wano, Y., Said, J. W. & Koeffler, H. P. (2005) Blood 105,376–381.

19. Nemeth, E., Roetto, A., Garozzo, G., Ganz, T. & Camaschella, C. (2005) Blood105, 1803–1806.

20. Niederkofler, V., Salie, R. & Arber, S. (2005) J. Clin. Invest. 115, 2180–2186.21. Lee, P. L., Beutler, E., Rao, S. V. & Barton, J. C. (2004) Blood 103, 4669–4671.22. Miller, A. F., Harvey, S. A., Thies, R. S. & Olson, M. S. (2000) J. Biol. Chem.

275, 17937–17945.23. Frazer, D. M., Wilkins, S. J., Millard, K. N., McKie, A. T., Vulpe, C. D. &

Anderson, G. J. (2004) Br. J. Haematol. 126, 434–436.24. Lee, P. L., Peng, H., Gelbart, T. & Beutler, E. (2004) Proc. Natl. Acad. Sci. USA

101, 9263–9265.25. Nakamura, K., Shirai, T., Morishita, S., Uchida, S., Saeki-Miura, K. &

Makishima, F. (1999) Exp. Cell Res. 250, 351–363.

Table 1. Quantitative real-time RT-PCR primers and probes

Gene Sense primer, 5�-3� Antisense primer, 5�-3� 5�-6-FAM�3BHQ 1-3� probe

mhepcidin 1 TTGCGATACCAATGCAGAAGA GATGTGGCTCTAGGCTATGTT AGAGACACCAACTTCCCCATCTGC

mS18 ribosomal protein ACTTTTGGGGCCTTCGTGTC GCCCAGAGACTCATTTCTTCTTG ACACCAAGACCACTGGCCGCAG

hhepcidin CACAACAGACGGGACAACTTG CTCGCCTCCTTCGCCTCTGG CCAGGACAGAGCTGGAGCCA

hRPLP2 CGTCGCCTCCTACCTGCT CCATTCAGCTCACTGATAACCTTG TCGTCGTCCGCCTCGATACCCAC

6-FAM, 6-carboxyfluorescein; 3BHQ 1, 3-black hole quencher-1.

Truksa et al. PNAS � July 5, 2006 � vol. 103 � no. 27 � 10293

CELL

BIO

LOG

Y