uitnodiging · buijs fn, guzmán-ruiz m, león-mercado l, basualdo mc, escobar c, kalsbeek a, buijs...

526835-L-os-Buijs526835-L-os-Buijs526835-L-os-Buijs526835-L-os-Buijs Processed on: 6-12-2018Processed on: 6-12-2018Processed on: 6-12-2018Processed on: 6-12-2018

The Circadian System: A Regulatory Feedback Network of

Periphery and Brain

Uitnodiging

Voor het bijwonen van de openbare verdediging van het proefschrift

The Circadian System: A Regulatory Feedback Network of Periphery

and Brain

Donderdag 17 Januari 2019 om 12oo uur

AgnietenkapelUniversiteit van AmsterdamOudezijds Voorburgwal 231

Amsterdam

Aansluitend bent u van harte uitgenodigd

voor de receptie bijde Brakke Grond

Nes 43 Amsterdam

ParanimfenErnst Moorman

[email protected] Vermeulen

[email protected]

Cadeau tipIk ben aan het sparen

voor een mooi kunstwerkHier zou u eventueel aan

bij kunnen dragen

The C

ircadian System

: A R

egulatory Feedback Netw

ork of Periphery and B

rain Frederik Buijs Frederik Buijs

526835-L-bw-Buijs526835-L-bw-Buijs526835-L-bw-Buijs526835-L-bw-BuijsProcessed on: 14-12-2018Processed on: 14-12-2018Processed on: 14-12-2018Processed on: 14-12-2018 PDF page: 1PDF page: 1PDF page: 1PDF page: 1

THE CIRCADIAN SYSTEM:A REGULATORY FEEDBACK NETWORK OF PERIPHERY AND BRAIN

Frederik Nicolaas Buijs

181206LAYOUTversie6.indd 1 13-12-18 14:59


COLOFON

Author: Frederik BuijsCover illustration: Frederik Buijs. Photography: Michiel StockLayout: Sharon Oost, [email protected]: Ipskamp printing, www.ipskampprinting.nlISBN: 978-94-028-1324-1

The research for this thesis was carried out at Netherlands Institute for Neuroscience, Netherlands and Instituto de Investigaciones Biomedicas, Mexico.

Financial support for this thesis was kindly provided by Universidad Nacional Autónoma de México (PAPiiT), Consejo Nacional de Ciencias y Tecnologia, Mexico (CONACyT) and Universiteit van Amsterdam.

© 2018 Frederik Buijs - All Rights Reserved



The Circadian System:A Regulatory Feedback Network of

Periphery and Brain

ACADEMISCH PROEFSCHRIFT

ter verkrijging van de graad van doctoraan de Universiteit van Amsterdamop gezag van de Rector Magnifcus

prof. dr. ir. K.I.J. Maexten overstaan van een door het College voor Promoties ingestelde commissie,

in het openbaar te verdedigen in de Agnietenkapelop donderdag 17 januari 2019, te 12:00 uur

door Frederik Nicolaas Buijs

geboren te Utrecht, Nederland



PROMOTIECOMMISSIEPromotores Prof. dr. A. Kalsbeek AMC-UvA

Prof. dr. D.F. Swaab Zhejiang University

Overige leden Prof. dr. G. van Dijk Rijksuniversiteit GroningenProf. dr. S.E. la Fleur AMC-UvAProf. dr. E. Fliers AMC-UvAProf. dr. J.H. Meijer Universiteit LeidenDr. G.A. van Montfrans AMC-UvADr. C.X. Yi AMC-UvA

Faculteit der Geneeskunde



TABLE OF CONTENTChapter 1. General introduction Based upon: The circadian system: A regulatory feedback network of periphery and brain. Buijs FN, León-Mercado L, Guzmán-Ruiz M, Guerrero-Vargas NN, Romo-Nava F, Buijs RM. Physiology (Bethesda). 31(3):170-81. (2016)

Scope of the Thesis Chapter 2. The Suprachiasmatic nucleus is part of a neural feedback circuit adapting blood pressure response. Buijs FN, Cazarez F, Basualdo MC, Scheer FA, Perusquía M, Centurion D, Buijs RM. Neuroscience. 25;266:197-207. (2014) Chapter 3. Olanzapine-induced early cardiovascular effects are mediated by the biological clock and prevented by melatonin Romo-Nava F, Buijs FN, Valdés-Tovar M, Benítez-King G, Basualdo M, Perusquía M, Heinze G, Escobar C, Buijs RM. J Pineal Res. 62(4). (2017) Chapter 4. The NPY intergeniculate leaflet projections to the Suprachiasmatic nucleus transmit metabolic conditions. Saderi N, Cazarez-Márquez F, Buijs FN, Salgado-Delgado RC, Guzman-Ruiz MA, del Carmen Basualdo M, Escobar C, Buijs RM. Neuroscience. 29;246:291-300. (2013)

Chapter 5. Suprachiasmatic nucleus interaction with the Arcuate nucleus; Essential for organizing physiological rhythms. Buijs FN, Guzmán-Ruiz M, León-Mercado L, Basualdo MC, Escobar C, Kalsbeek A, Buijs RM. Eneuro 4 (2). (2017)

Chapter 6. The Suprachiasmatic nucleus is part of a Kisspeptin feedback network involving the anterior ventral part of the third ventricle and Arcuate nucleus. Buijs FN, Soto-Tinoco E, Basualdo MC, Kalsbeek A, Buijs RM. To be submitted

Chapter 7. General discussion Based upon: The circadian system: A regulatory feedback network of periphery and brain. Buijs FN, León-Mercado L, Guzmán-Ruiz M, Guerrero-Vargas NN, Romo-Nava F, Buijs RM. Physiology (Bethesda). 31(3):170-81. (2016) Appendices

Summary Samenvatting Author Affilitations Publications Portfolio Acknowledgments

7

15

25

49

77

99

127

155

183184188193196197198



6

Chapter 2



7

SCN adapts blood pressure response

GENERAL INTRODUCTION

Based upon: The circadian system: A regulatory feedback network of periphery and brain.

Buijs FNLeón-Mercado LGuzmán-Ruiz MGuerrero-Vargas NNRomo-Nava F, Buijs RM.

Physiology (Bethesda). 31(3):170-81. (2016)



8

Chapter 1

AbstractCircadian rhythms are generated by the autonomous circadian clock, the suprachiasmatic nucleus (SCN), and clock genes that are present in all tissues. The SCN times these peripheral clocks, as well as behavioral and physiological processes. Recent studies show that frequent violations of conditions set by our biological clock, such as shift work, jet lag, sleep deprivation, or simply eating at the wrong time of the day, may have deleterious effects on health. This infringement, also known as circadian desynchronization, is associated with chronic diseases like diabetes, hypertension, cancer, and psychiatric disorders. In this review, we will evaluate evidence that these diseases stem from the need of the SCN for peripheral feedback to fine-tune its output and adjust physiological processes to the requirements of the moment. This feedback can vary from neuronal or hormonal signals from the liver to changes in blood pressure. Desynchronization renders the circadian network dysfunctional, resulting in a breakdown of many functions driven by the SCN, disrupting core clock rhythms in the periphery and disorganizing cellular processes that are normally driven by the synchrony between behavior and peripheral signals with neuronal and humoral output of the hypothalamus. Consequently, we propose that the loss of synchrony between the different elements of this circadian network as may occur during shiftwork and jetlag is the reason for the occurrence of health problems.



9

General Introduction

1The planet earth revolves around the sun while rotating on its axis every 24 hours. This ubiquitous environmental factor of alternating light and darkness has resulted in almost all organisms being subject to cyclic environmental changes, enforcing a day-night rhythm on their physiology. Adapting to this cyclic world, organisms have evolved circadian (from the Latin circa, meaning “approximately”, and diēm, meaning “day”) systems synchronizing behavioral and physiological rhythms for optimal anticipation of changes in activity and food availability (Buijs and others, 2006). In mammals the circadian system consists of a central pacemaker, the suprachiasmatic nucleus (SCN), and of peripheral oscillators, found in almost all cell types in brain and body, that resonate with circadian cues originating from the SCN (Lowrey and Takahashi, 2000). Driven by the SCN these oscillators provide rhythmic behavioral, neuroendocrine and autonomic output supporting a circadian organization of physiology. Through SCN endogenous activity, behavioral and physiological rhythms are maintained even in constant dark conditions (DD) (Hastings and others, 2013) allowing organisms to anticipate day-night changes in the environment, best preparing the physiology for upcoming challenges. Since behavioral activity needs to coincide with e.g., increased body temperature, higher circulating glucose levels and elevated blood pressure, the main function of the SCN is to organize these physiological set-points, optimally adapting them to resting or active periods (Kalsbeek and Buijs, 2002).

The molecular clockworkIn the SCN, an oscillatory transcription and translation of genes inside individual SCN neurons takes place. These clock genes are part of an intrinsic oscillator, consisting of interlinked autoregulatory transcriptional–translational feedback loops. This molecular mechanism drives rhythmic, ~24hr expression patterns of core clock proteins, necessary for the generation and regulation of circadian rhythms within individual cells (Reppert and Weaver, 2002). In mammals, the protein complex CLOCK (circadian locomotor output cycles kaput)−BMAL1 (brain and muscle ARNT like protein1)—members of the basic helix-loop-helix (bHLH)-PAS (Period-Arnt-Single-minded) transcription factor family—bound to E-box promoters, form the positive limb of the feedback loop. The negative limb consists of PER-CRY, heterodimers that translocate back to the nucleus suppressing their own transcription by inhibiting CLOCK−BMAL1 activity. Secondary loops are formed with the help of orphan nuclear receptors from the REV-ERB and ROR family, which fine tune the core clock machinery modulating the transcriptional feedback loop, thus contributing to the robustness of the molecular clock (for detailed description see (Partch and others, 2014)). Interestingly, since more than two decades it has been demonstrated that a molecular clock machinery of similar composition is also present in nearly all cells of the body. Importantly, these peripheral clock genes are mainly driven by SCN output, whereby in principle all SCN driven outputs, hormonal (i.e. melatonin and corticosterone) (Balsalobre and others, 2000), behavioral (i.e. activity and food intake) (Damiola and



10

Chapter 1

others, 2000; van Oosterhout and others, 2012), as well as autonomic and physiological (i.e. temperature and glucose) contribute to peripheral clock gene rhythmicity (Brown and others, 2002b; Hirao and others, 2009). Since their discovery, clock genes have been shown to be involved in many different (cellular) functions in peripheral organs, from metabolic function to cell division (Matsuo and others, 2003). Animal models showing tissue specific clock gene deletion have permitted the investigation of the role of certain clock genes in metabolism and investigating their effect on physiology. For example, as a result of liver clock gene disruption, glucose release is altered causing fasting hypoglycemia (Lamia and others, 2008), and decreased hepatic lipogenic gene expression following refeeding after fasting (Zhang and others, 2014). Pancreas clock gene modification results in impaired glucose-stimulated insulin secretion (Sadacca and others, 2011). As in striated muscle fibers, Bmal1 knockout can cause a fast to slow fiber-type shift and a more oxidative skeletal muscle (Hodge and others, 2015), and in adipose tissue, clock gene knockout can lead to obesity (Paschos and others, 2012). These examples illustrate an essential role for tissue or organ-specific peripheral clock genes and their involvement in adequate physiological regulation.

The clockThe SCN is located above the optic chiasm (suprachiasmatic) through which it receives photic (light) information. This photic information serves to synchronize the activity of the SCN to the daily light-dark cycle. The bilaterally paired SCN is composed of a dense network of approximately 20,000 interconnected neurons (Webb and others, 2009). The SCN, as an autonomously rhythmic nucleus, distinguishes itself from other nuclei in the brain through its structure and function. During the day most SCN neurons are more depolarized, with a resting potential of -45mV approximately. This depolarized state results from the presence of a set of currents (persistent Na+, HCN, T- and L-type Ca2+) that provides the excitatory drive necessary for any neuron to be spontaneously active (Jackson and others, 2004; Wang and Huang, 2004; Irwin and Allen, 2007). The excitatory drive, mostly present during the day, is then translated into action potentials that induces the transcription of the clock genes Per1, Per2 and Cry that in turn modulate the expression of ionic channels (Yamaguchi and others, 2003; Colwell, 2011). Despite that each SCN neuron expresses clock genes and electrical machineries, not all oscillate with the same phase. Each SCN neuron remains active during the day for 4-6 hours (Vanderleest and others, 2007; Meijer and others, 2010). The coordination of these different cycles is arranged through communication within the nucleus enabling a clear and organized output (Welsh et al., 1995; Saeb-Parsy & Dyball, 2003a; Bhumbra et al., 2005). This coordination among the different cells within the SCN is, amongst others, achieved through the presence of gap junctions shared by the different neurons that propagate the electrical activity and by the synaptic association between the neurons by means of VIP, GABA, glutamate and vasopressin transmission within the individual nucleus and glutamate as a transmitter



11


1required for communication between the left and right SCN (Hafner and others, 2012; Brancaccio and others, 2014). In short, it is thought that increased excitability of SCN neurons facilitates spontaneous neuronal activity occurring even in the absence of synaptic drive, thus giving the SCN its endogenous rhythm. At early night the reverse occurs with neurons showing hyperpolarization (~-67mV), inhibiting neuronal firing and silencing the SCN (Colwell, 2011). Intercellular coupling and a close association with glia cells (Brancaccio et al. 2017) seems to be critical for a robust endogenously rhythmic SCN which distinguishes it from peripheral oscillators (Mohawk and others, 2012). SCN neuronal rhythmicity is translated into rhythmic release of SCN neurotransmitters, imposing a circadian rhythm onto target neurons. The day-time peak in neuronal activity occurs equally in nocturnal as in diurnal animals, indicating that SCN activity alone does not determine behavioral activity.

NeurotransmittersThe SCN expresses numerous neurotransmitters involved in synchronizing and maintaining an endogenous circadian rhythm of the SCN, whilst also transmitting circadian timed signals to target neurons in the hypothalamus. Based on the anatomical location of these different neural populations, the SCN is generally divided into a ventrolateral and dorsomedial region. In the ventrolateral SCN, associated with integrating external input, gastric-releasing peptide (GRP) and vasoactive intestinal peptide (VIP) expressing neurons receive direct retinal input via the melanopsin containing retinohypothalamic tract (RHT). These neurons convey light-dark information to the rest of the SCN with VIP being critical in maintaining SCN synchrony (Shinohara and others, 1993; Harmar and others, 2002; An and others, 2013). The dorsomedial SCN, i.e., where arginine vasopressin (AVP) and prokineticin 2 (PK2) is expressed, is associated with generating robust circadian rhythms (Albus and others, 2005; Yamaguchi and others, 2013). The neurons expressing AVP display robust self-sustained rhythms in clock gene expression that are necessary for adequate coupling of SCN neurons (Mieda and others, 2015). Accordingly, neuromedin S (NMS) has been shown to be important for keeping the SCN pacemaker-neurons synchronized (Lee and others, 2015). Also GABA (co-expressed in GRP, VIP and AVP neurons) is essential in synchronizing SCN neurons, adapting their activity through both excitatory and inhibitory modulation (Colwell, 2011). Interestingly, exposure to long day photoperiods changes GABAergic activity from inhibitory to excitatory, destabilizing SCN rhythmicity and possibly affecting its sensitivity to photoperiodic entrainment (Farajnia and others, 2012). The ventral and dorsal SCN show elaborate neuronal interconnectivity with the majority running from the ventral to dorsal area (Romijn and others, 1997), underlining the essential role of internal SCN communication.Finally, coordination of rhythmicity among different cells within the SCN is achieved through intercellular coupling by the presence of gap junctions, glial network encoding, phase-dependent coupling through non-redundant VIP and GABA signaling, paracrine signaling and through glutamatergic communication between the left and right SCN (for review see, Colwell, 2011).



12

Chapter 1

The SCN drives rhythms in behavior, hormone secretion and organ function.The endogenous rhythm in electrical activity of many SCN neurons (Colwell, 2011; An and others, 2013) is the basis for the rhythmic release of SCN neurotransmitters at their terminals (Buijs and Kalsbeek, 2001). However, in the rat many neurons show a—non-rhythmic—low constant neuronal activity. For example, via constant release of glutamate in the PVN, the SCN promotes melatonin release from the pineal which can only be prevented by the diurnal rhythm of SCN-induced release of GABA in the PVN (Perreau-Lenz and others, 2004). Nonetheless, the majority of SCN neurons are more active during the light period than during the dark (Meijer and others, 1997). Light is a very powerful stimulus for neuronal activation of the retino-recipient portion of the SCN, both during the day as well as at night (Meijer and others, 1998). This activation results in inhibition of locomotor behavior, at least partially, by the release of Prokineticin 2 from SCN terminals (Cheng and others, 2002). The daily light/dark cycle synchronizes SCN neurons to a precise 24 hr rhythm, translated into appropriate behavior according to the time of day and the corresponding hormonal and autonomic signaling (Buijs and Kalsbeek, 2001). This SCN output serves to drive the functionality of the organs both through the induced rhythm of clock and other genes in the organs (Oster and others, 2006; Paschos and FitzGerald, 2010) and by the circadian rhythm of autonomic output (Ishida and others, 2005).

Peripheral oscillators synchronized by the SCNIn the brain, apart from the SCN, autonomous cellular rhythms are found in the olfactory bulb and retina, while other structures, like the Arcuate nucleus (ARC), are able to express an independent rhythm for some time in vitro (Tosini and Menaker, 1996; Granados-Fuentes and others, 2006; Guilding and others, 2009). The general view is that clock genes in non-brain tissues are not autonomously rhythmic; they derive their rhythm from the SCN or from SCN driven processes. The loss of rhythm in peripheral organs following SCN lesions is probably due to the limited intercellular communication in peripheral organs and the loss of synchronizing corticosterone (Balsalobre and others, 2000; Su et al. 2016) or melatonin rhythm. This demonstrates the role of the SCN as synchronizer of peripheral rhythmicity, which is realized through various, still not fully understood pathways. First, autonomic output is capable of driving clock gene expression (Terazono and others, 2003), although autonomic denervation of an organ does not abolish clock gene rhythmicity (Cailotto and others, 2005). Second, glucocorticoids influence clock gene expression but adrenalectomy does not abolish rhythmicity (Balsalobre and others, 2000). Third, food intake during the resting phase, though also affecting temperature and glucocorticoid rhythms, completely reverses clock gene expression in the liver, kidney, heart and pancreas (Damiola and others, 2000), showing that food intake is an essential synchronizing signal for peripheral organs. However, under fasting conditions the rhythm in the liver persists for at least one cycle as it does in food synchronized SCN lesioned animals (Sabath and others, 2014). Fourth, SCN lesioned animals sharing their blood



13


1circulation with intact animals develop a rhythm in clock gene expression in the liver and kidney, indicating that circulating factors are important for their rhythmicity (Guo and others, 2005). Lastly, temperature, too, is capable of altering clock gene expression in the liver (Brown and others, 2002a). Essentially, peripheral clock genes are guided by direct and indirect signals from the SCN and can be altered significantly in their expression and phase by behavior that is not in line with SCN signaling. This is adeptly illustrated by a recent study demonstrating that animals receiving food 6 times a day, lose their rhythm in white adipose tissue in 7 out of 9 tested oscillatory metabolic/adipokine genes, but not the rhythm of clock genes. Abolishing the daily corticosterone peak also rendered the clock genes arrhythmic (Su and others, 2015). This shows that metabolic genes do not only depend on clock genes for their rhythm but may depend on other processes as well. Nonetheless, supporting a fundamental role for clock genes in peripheral organ function, are studies demonstrating that tissue specific deletion of a single core clock gene, fundamentally changes the functioning of the liver, white adipose tissue or blood vessels (Lamia and others, 2008; Paschos and FitzGerald, 2010; Paschos and others, 2012). Seemingly the mere presence of clock genes is essential for the expression or suppression of regulatory genes present in tissues and organs, organizing a cascade of rhythms (reviewed in (Kolbe and others, 2015). Several studies have reported important functional relationships between clock genes and cellular mechanisms, though the majority of these studies were conducted in vitro, thus ignoring the other components of the in vivo circadian system. Hence caution seems in place in extrapolating such conclusions and it is needed to corroborate these findings by in vivo studies. For example, in spite of in vitro data suggesting the direct production of nicotinamide phosphoribosyltransferase (NAMPT) via CLOCK/BMAL1 (Ramsey and others, 2009) it has been observed that in animals eating during the light period, nicotinamide adenine dinucleotide (NAD+) and NAMPT together with some metabolic genes do not follow the inversion of rhythm in core clock genes (Salgado-Delgado and others, 2013). These observations indicate that in vivo, alternative essential molecular relationships prevail; likely driven by other components of the circadian system such as the melatonin or corticosterone rhythm. Importantly, the inversion of clock gene rhythmicity in the liver induced by an inverted feeding pattern is accompanied by severe liver steatosis and insulin insensitivity (Salgado-Delgado and others, 2013); raising the question, why these feeding induced changes in peripheral clock gene rhythms change the physiology of the organism as a whole and why these changes induce liver steatosis. This also brings us to the general scope of this thesis where we investigated possible feedback networks to the SCN, hypothesizing thereby its possible role as integrator of peripheral feedback essential for regulating circadian oscillations in physiology.



14

Chapter 1

The hypothalamus as integrative neuronal network regulates physiologySCN projections reach many different target neurons—interneurons, endocrine neurons, pre-autonomic neurons and neurons that gate physiologically relevant sensory information (Buijs and others, 2013)—through which a wide range of effector organs are reached who have a somatotopic representation in the SCN (Kreier and others, 2005). This not only provides an anatomical framework for the SCN to spread circadian signals to hypothalamic targets, it also allows the SCN to modulate the access of information entering the hypothalamus. Till recently it was assumed that the SCN would execute its functions by means of timed output that was only synchronized by the light/dark cycle. However, light is not the sole input or synchronizer of the SCN, also melatonin (Slotten and others, 2002), food (Mendoza and others, 2008), blood pressure (Buijs and others, 2014) and locomotor activity (Schaap and Meijer, 2001) have a direct effect on SCN neuronal activity or its phase. Somatic information is received through various direct projections from i.e., the nucleus tractus solitarius (NTS), the intergeniculate leaflet (IGL), ARC, limbic system and raphe nucleus (Malek and others, 2007; Saderi and others, 2013; Buijs and others, 2014). In the present thesis we investigated the possibility whether the SCN could be part of a large network of oscillators all functioning within a series of feedback loops maintaining the organism in synchrony with its environment. In support of this hypothesis are recent studies illustrating functional input to the SCN from circumventricular organs, brainstem viscerosensory nuclei and hypothalamic integration nuclei (Yi and others, 2008; Owen and others, 2013; Bookout and others, 2013).



15


1Scope of the thesis

The general hypothesis of this thesis states that the SCN is not solely an autonomous master clock imposing its rhythm onto the periphery, but depends on peripheral feedback in order to effectively regulate physiological functions. Hereby we investigated whether the SCN needs to receive feedback in order to adequately regulate circadian oscillations in physiology. We hypothesized that generating and synchronizing physiological daily rhythms depends on the integration of photic and non-photic input in the SCN, whereby the SCN receives feedback information of the physiological state of the body through existing strong neuronal interconnectivity with other hypothalamic nuclei. As such we investigated cardiovascular, metabolic and reproductive feedback- and regulatory circuits with the SCN at its core.Blood pressure has long been shown to follow a ~24 hour rhythm with a critical role for the SCN independent of behavioral activity (Scheer and others, 2005) for timing of cardiovascular control. In chapter two we hypothesized that the SCN, like virtually any structure in the brain, would need feedback to execute its function properly. Therefore, we investigated whether the SCN is incorporated in a brain circuit controlling BP. We looked at the projections of the NTS because this nucleus in the brain stem is the central relay in forwarding visceral and thus also cardiovascular, sensory information to the brain. Retrograde and anterograde tracing studies were performed to determine whether the SCN indeed receives projections from the NTS to the SCN. We also looked at the functionality of this connection by examining the differential activation of the SCN following blood pressure elevations and monitoring blood pressure responses after placing SCN lesions in Wistar rats. In chapter three, we further focused on the SCN as integration center of cardiovascular information and demonstrated how cardiovascular input can influence SCN output by examining changes in activity of the SCN-parasympathetic neuronal pathway following olanzapine and melatonin administration. In view of the influence of cardiometabolic changes on the SCN and considering early reports that metabolic changes influence neuropeptide Y (NPY) concentrations in the SCN (Park et al. 2004) and that phase advances induced by time and caloric feeding restriction are appreciably decreased in IGL-lesioned rats (Challet, Malan, and Pévet 1996), we hypothesized in chapter four that the IGL—known as providing the SCN with photic and non-photic information via its NPY innervation amongst others—provides the SCN with metabolic related information. Using male Wistar rats in different metabolic states (fed, fasted and ad libitum) and by lesion studies performed either in the ARC or in the IGL we investigated a novel circuit involving the IGL in mediating metabolic information to the SCN. Considering that the ARC is the main sensory structure for metabolic information and in view of recent observations that lesions targeting specific neuronal populations in the ARC resulted in deteriorated temperature, feeding and sleep rhythms (Li and



16

Chapter 1

others, 2012; Wiater and others, 2013) we hypothesized that the ARC could provide an essential feedback pathway to the SCN, adjusting its output and facilitating changes in its neural activity in response to physiological and behavioral activity. In chapter five we thus studied the nature of ARC-SCN interconnectivity by placing knife cuts between the SCN and ARC. We observed loss in rhythms in locomotor activity, body temperature and corticosterone levels as well as changes in clock gene rhythmicity showing the importance of ARC-SCN network properties in organizing physiological functions. In chapter six we investigated the role of different hypothalamic areas including the ARC, the anteroventral periventricular nucleus (AVPV) and SCN in the complex regulation of the reproductive cycle. We hypothesized that similar to neurons in the dorsomedial hypothalamus (DMH), Kisspeptin neurons—involved in regulating reproductive function—form a feedback circuit with the SCN. Through immunohistochemistry and tracing studies we examined Kisspeptin projections from the AVPV and ARC to the SCN. Finally, in the general discussion—chapter seven—the results are placed in a broader perspective focusing on the importance of a balance between the different systems whose activity is influenced by the circadian system and we argue that consequently circadian desynchronization is associated with chronic diseases like diabetes, hypertension, cancer, and psychiatric disorders. We examine evidence that these diseases stem from the SCN requiring peripheral feedback to fine-tune its output and adjust physiological processes to the requirements of the moment. Subsequently, we discuss how the loss of synchrony between the different elements of this circadian network as may occur during shift work and jet lag can contribute to the development of health problems and disease. We end this thesis with a perspective on and recommendations for future research to further unravel the role of feedback to the SCN within the circadian system and how a more broad application of timed therapeutic intervention could improve treatment outcome for patients.



17


1



18

Chapter 1

References

Albus H, Vansteensel MJ, Michel S, Block GD, Meijer JH. 2005. A GABAergic Mechanism Is Necessary for Coupling Dissociable Ventral and Dorsal Regional Oscillators within the Circadian Clock. Curr Biol 15(10):886-93.

An S, Harang R, Meeker K, Granados-Fuentes D, Tsai CA, Mazuski C, Kim J, Doyle FJ, III, Petzold LR, Herzog ED. 2013. A neuropeptide speeds circadian entrainment by reducing intercellular synchrony. Proc Natl Acad Sci U S A 110(46):E4355-E4361.

Balsalobre A, Brown SA, Marcacci L, Tronche F, Kellendonk C, Reichardt HM, Schutz G, Schibler U. 2000. Resetting of circadian time in peripheral tissues by glucocorticoid signaling. Science 289:2344-7.

Bookout AL, de Groot MH, Owen BM, Lee S, Gautron L, Lawrence HL, Ding X, Elmquist JK, Takahashi JS, Mangelsdorf DJ, Kliewer SA. 2013. FGF21 regulates metabolism and circadian behavior by acting on the nervous system. Nat Med 19(9):1147-52.

Brancaccio M, Enoki R, Mazuski CN, Jones J, Evans JA, Azzi A. 2014. Network-Mediated Encoding of Circadian Time: The Suprachiasmatic Nucleus (SCN) from Genes to Neurons to Circuits, and Back. J Neurosci 34(46):15192-9.

Brancaccio, Marco, Andrew P. Patton, Johanna E. Chesham, Elizabeth S. Maywood, and Michael H. Hastings. 2017. Astrocytes Control Circadian Timekeeping in the Suprachiasmatic Nucleus via Glutamatergic Signaling. Neuron 93 (6): 1420–1435.e5. doi:10.1016/j.neuron.2017.02.030.

Brown SA, Zumbrunn G, Fleury-Olela F, Preitner N, Schibler U. 2002a. Rhythms of mammalian body temperature can sustain peripheral circadian clocks. Curr Biol 12(18):1574-83.

Brown SA, Zumbrunn G, Fleury-Olela F, Preitner N, Schibler U. 2002b. Rhythms of mammalian body temperature can sustain peripheral circadian clocks. Curr Biol 12(18):1574-83.

Buijs FN, Cazarez F, Basualdo MC, Scheer FA, Perusquia M, Centurion D, Buijs RM. 2014. The suprachiasmatic nucleus is part of a neural feedback circuit adapting blood pressure response. Neuroscience 266:197-207.

Buijs RM, Escobar C, Swaab DF. 2013. The circadian system and the balance of the autonomic nervous system. Handb Clin Neurol 117:173-91.

Buijs RM, Kalsbeek A. 2001. Hypothalamic integration of central and peripheral clocks. Nat Rev Neurosci 2:521-6.

Buijs RM, Scheer FA, Kreier F, Yi C, Bos N, Goncharuk VD, Kalsbeek A. 2006. Chapter 20: Organization of circadian functions: interaction with the body. Prog Brain Res 153:341-60.

Cailotto C, La Fleur SE, Van Heijningen C, Wortel J, Kalsbeek A, Feenstra M, Pevet P, Buijs RM. 2005. The suprachiasmatic nucleus controls the daily variation of plasma glucose via the autonomic output to the liver: are the clock genes involved? Eur J Neurosci 22(10):2531-40.



19


1

Cheng MY, Bullock CM, Li C, Lee AG, Bermak JC, Belluzzi J, Weaver DR, Leslie FM, Zhou QY. 2002. Prokineticin 2 transmits the behavioural circadian rhythm of the suprachiasmatic nucleus. Nature 417(6887):405-10.

Colwell CS. 2011. Linking neural activity and molecular oscillations in the SCN. Nat Rev Neurosci 12:553-69.

Coomans, Claudia P., Ashna Ramkisoensing, and Johanna H. Meijer. 2015. “The Suprachiasmatic Nuclei as a Seasonal Clock.” Frontiers in Neuroendocrinology 37 (April): 29–42. doi:10.1016/j.yfrne.2014.11.002.

Damiola F, Le Minh N, Preitner N, Kornmann B, Fleury-Olela F, Schibler U. 2000. Restricted feeding uncouples circadian oscillators in peripheral tissues from the central pacemaker in the suprachiasmatic nucleus. Genes Dev 14(23):2950-61.

Farajnia S, Michel S, Deboer T, Vanderleest HT, Houben T, Rohling JH, Ramkisoensing A, Yasenkov R, Meijer JH. 2012. Evidence for neuronal desynchrony in the aged suprachiasmatic nucleus clock. J Neurosci 32(17):5891-9.

Granados-Fuentes D, Tseng A, Herzog ED. 2006. A circadian clock in the olfactory bulb controls olfactory responsivity. J Neurosci 26(47):12219-25.

Guilding C, Hughes AT, Brown TM, Namvar S, Piggins HD. 2009. A riot of rhythms: neuronal and glial circadian oscillators in the mediobasal hypothalamus. Mol Brain 2:28. doi: 10.1186/1756-6606-2-28.:28-2.

Guo H, Brewer JM, Champhekar A, Harris RB, Bittman EL. 2005. Differential control of peripheral circadian rhythms by suprachiasmatic-dependent neural signals. Proc Natl Acad Sci U S A 102(8):3111-6.

Hafner M, Koeppl H, Gonze D. 2012. Effect of network architecture on synchronization and entrainment properties of the circadian oscillations in the suprachiasmatic nucleus. PLoS Comput Biol 8(3):e1002419.

Harmar AJ, Marston HM, Shen S, Spratt C, West KM, Sheward WJ, Morrison CF, Dorin JR, Piggins HD, Reubi JC, Kelly JS, Maywood ES, Hastings MH. 2002. The VPAC(2) Receptor Is Essential for Circadian Function in the Mouse Suprachiasmatic Nuclei. Cell 109(4):497-508.

Hastings MH, Brancaccio M, Maywood ES. 2013. Circadian Pacemaking in Cells and Circuits of the Suprachiasmatic Nucleus. J Neuroendocrinol 26:2-10.

Hirao A, Tahara Y, Kimura I, Shibata S. 2009. A balanced diet is necessary for proper entrainment signals of the mouse liver clock. PLoS ONE 4(9):e6909.

Hodge BA, Wen Y, Riley LA, Zhang X, England JH, Harfmann BD, Schroder EA, Esser KA. 2015. The endogenous molecular clock orchestrates the temporal separation of substrate metabolism in skeletal muscle. Skelet Muscle 5:17. doi: 10.1186/s13395-015-0039-5. eCollection@2015.:17-0039.



20

Chapter 1

Irwin RP, Allen CN. 2007. Calcium response to retinohypothalamic tract synaptic transmission in suprachiasmatic nucleus neurons. J Neurosci 27(43):11748-57.

Ishida A, Mutoh T, Ueyama T, Bando H, Masubuchi S, Nakahara D, Tsujimoto G, Okamura H. 2005. Light activates the adrenal gland: Timing of gene expression and glucocorticoid release. Cell Metab 2(5):297-307.

Jackson AC, Yao GL, Bean BP. 2004. Mechanism of spontaneous firing in dorsomedial suprachiasmatic nucleus neurons. J Neurosci 24(37):7985-98.

Kalsbeek A, Buijs RM. 2002. Output pathways of the mammalian suprachiasmatic nucleus: coding circadian time by transmitter selection and specific targeting. Cell Tissue Res 309(1):109-18.

Kolbe I, Dumbell R, Oster H. 2015. Circadian Clocks and the Interaction between Stress Axis and Adipose Function. Int J Endocrinol 2015:693204. doi: 10.1155/2015/693204. Epub@2015 Apr 27.:693204.

Kreier F, Kap YS, Mettenleiter TC, Van Heijningen C, Van der Vliet J, Kalsbeek A, Sauerwein HP, Fliers E, Romijn JA, Buijs RM. 2005. Tracing from fat tissue, liver and pancreas: A neuroanatomical framework for the role of the brain in type 2 diabetes. end 147:1140-7.

Lamia KA, Storch KF, Weitz CJ. 2008. Physiological significance of a peripheral tissue circadian clock. Proc Natl Acad Sci U S A 105(39):15172-7.

Lee IT, Chang AS, Manandhar M, Shan Y, Fan J, Izumo M, Ikeda Y, Motoike T, Dixon S, Seinfeld JE, Takahashi JS, Yanagisawa M. 2015. Neuromedin s-producing neurons act as essential pacemakers in the suprachiasmatic nucleus to couple clock neurons and dictate circadian rhythms. Neuron 85(5):1086-102.

Li AJ, Wiater MF, Oostrom MT, Smith BR, Wang Q, Dinh TT, Roberts BL, Jansen HT, Ritter S. 2012. Leptin-sensitive neurons in the arcuate nuclei contribute to endogenous feeding rhythms. Am J Physiol Regul Integr Comp Physiol 302:R1313-R1326.

Lowrey PL, Takahashi JS. 2000. GENETICS OF THE MAMMALIAN CIRCADIAN SYSTEM: Photic Entrainment, Circadian Pacemaker Mechanisms, and Posttranslational Regulation. Annu Rev Genet 2000;34:533-562 34:533-62.

Malek ZS, Sage D, Pevet P, Raison S. 2007. Daily rhythm of tryptophan hydroxylase-2 messenger ribonucleic acid within raphe neurons is induced by corticoid daily surge and modulated by enhanced locomotor activity. Endocrinology 148(11):5165-72.

Matsuo T, Yamaguchi S, Mitsui S, Emi A, Shimoda F, Okamura H. 2003. Control mechanism of the circadian clock for timing of cell division in vivo. Science 302(5643):255-9.

Meijer JH, Michel S, Vanderleest HT, Rohling JH. 2010. Daily and seasonal adaptation of the circadian clock requires plasticity of the SCN neuronal network. Eur J Neurosci 32(12):2143-51.

Meijer JH, Schaap J, Watanabe K, Albus H. 1997. Multiunit activity recordings in the suprachiasmatic nuclei: in vivo versus in vitro models. Brain Res 753:322-7.



21


1

Meijer JH, Watanabe K, Schaap J, Albus H, Dqtbri L. 1998. Light responsiveness of the suprachiasmatic nucleus: long- term multiunit and single-unit recordings in freely moving rats. J Neurosci 18:9078-87.

Mendoza J, Pevet P, Challet E. 2008. High-fat feeding alters the clock synchronization to light. J Physiol 586(Pt 24):5901-10.

Mieda M, Ono D, Hasegawa E, Okamoto H, Honma K, Honma S, Sakurai T. 2015. Cellular Clocks in AVP Neurons of the SCN Are Critical for Interneuronal Coupling Regulating Circadian Behavior Rhythm. Neuron 85(5):1103-16.

Moga, Margaret M., and Robert Y. Moore. 1997. “Organization of Neural Inputs to the Suprachiasmatic Nucleus in the Rat.” Journal of Comparative Neurology 389 (3): 508–34. doi:10.1002/(SICI)1096-9861(19971222)389:3<508::AID-CNE11>3.0.CO;2-H.

Mohawk JA, Green CB, Takahashi JS. 2012. Central and Peripheral Circadian Clocks in Mammals. Annu Rev Neurosci 35:445-62.

Oosterman, Johanneke E., Andries Kalsbeek, Susanne E. la Fleur, and Denise D. Belsham. 2015. “Impact of Nutrients on Circadian Rhythmicity.” American Journal of Physiology - Regulatory, Integrative and Comparative Physiology 308 (5): R337–50. doi:10.1152/ajpregu.00322.2014.

Oster H, Damerow S, Kiessling S, Jakubcakova V, Abraham D, Tian J, Hoffmann MW, Eichele G. 2006. The circadian rhythm of glucocorticoids is regulated by a gating mechanism residing in the adrenal cortical clock. Cell Metab 4(2):163-73.

Owen, Bryn M, Angie L Bookout, Xunshan Ding, Vicky Y Lin, Stan D Atkin, Laurent Gautron, Steven A Kliewer, and David J Mangelsdorf. 2013. “FGF21 Contributes to Neuroendocrine Control of Female Reproduction.” Nature Medicine 19 (9): 1153–56. doi:10.1038/nm.3250.

Park, Eun Sung, Seong Joon Yi, Jin Sang Kim, Heungshik S Lee, In Se Lee, Je Kyung Seong, Hee Kyung Jin, and Yeo Sung Yoon. 2004. “Changes in Orexin-A and Neuropeptide Y Expression in the Hypothalamus of the Fasted and High-Fat Diet Fed Rats.” Journal of Veterinary Science 5 (4): 295–302. http://www.ncbi.nlm.nih.gov/pubmed/15613812.

Partch CL, Green CB, Takahashi JS. 2014. Molecular architecture of the mammalian circadian clock. Trends Cell Biol 24(2):90-9.

Paschos GK, FitzGerald GA. 2010. Circadian clocks and vascular function. Circ Res 106:833-41.

Paschos GK, Ibrahim S, Song WL, Kunieda T, Grant G, Reyes TM, Bradfield CA, Vaughan CH, Eiden M, Masoodi M, Griffin JL, Wang F, Lawson JA, FitzGerald GA. 2012. Obesity in mice with adipocyte-specific deletion of clock component Arntl. Nat Med 18:1768-77.

Perreau-Lenz S, Kalsbeek A, Pevet P, Buijs RM. 2004. Glutamatergic clock output stimulates melatonin synthesis at night. Eur J Neurosci 19(2):318-24.

Pezük, Pinar, Jennifer A. Mohawk, Laura A. Wang, and Michael Menaker. 2012. Glucocorticoids as Entraining Signals for Peripheral Circadian Oscillators. Endocrinology 153 (10): 4775–83. doi:10.1210/en.2012-1486.



22

Chapter 1

Ramsey KM, Yoshino J, Brace CS, Abrassart D, Kobayashi Y, Marcheva B, Hong HK, Chong JL, Buhr ED, Lee C, Takahashi JS, Imai SI, Bass J. 2009. Circadian Clock Feedback Cycle Through NAMPT-Mediated NAD+ Biosynthesis. Science 324:651-4.

Reppert SM, Weaver DR. 2002. Coordination of circadian timing in mammals. Nature 418(6901):935-41.

Romijn HJ, Sluiter AA, Pool CW, Wortel J, Buijs RM. 1997. Evidence from confocal fluorescence microscopy for a dense, reciprocal innervation between AVP-, somatostatin-, VIP/ PHI-, GRP-, and VIP/PHI/GRP-immunoreactive neurons in the rat suprachiasmatic nucleus. Eur J Neurosci 9:2613-23.

Sabath E, Salgado-Delgado R, Guerrero-Vargas NN, Guzman-Ruiz MA, Del Carmen BM, Escobar C, Buijs RM. 2014. Food entrains clock genes but not metabolic genes in the liver of suprachiasmatic nucleus lesioned rats. FEBS Lett 588:3104-10.

Sadacca LA, Lamia KA, deLemos AS, Blum B, Weitz CJ. 2011. An intrinsic circadian clock of the pancreas is required for normal insulin release and glucose homeostasis in mice. Diabetologia 54(1):120-4.

Saderi N, Cazarez-Marquez F, Buijs FN, Salgado-Delgado RC, Guzman-Ruiz MA, Del Carmen BM, Escobar C, Buijs RM. 2013. The NPY intergeniculate leaflet projections to the suprachiasmatic nucleus transmit metabolic conditions. Neuroscience 246:291-300.

Salgado-Delgado RC, Saderi N, Basualdo MC, Guerrero-Vargas NN, Escobar C, Buijs RM. 2013. Shift Work or Food Intake during the Rest Phase Promotes Metabolic Disruption and Desynchrony of Liver Genes in Male Rats. PLoS ONE 8(4):e60052.

Schaap J, Meijer JH. 2001. Opposing effects of behavioural activity and light on neurons of the suprachiasmatic nucleus. Eur J Neurosci 2001 May;13(10):1955-62 13:1955-162.

Scheer FA, Pirovano C, van Someren EJ, Buijs RM. 2005. Environmental light and suprachiasmatic nucleus interact in the regulation of body temperature. Neuroscience 132(2):465-77.

Shinohara K, Tominaga K, Isobe Y, Inouye ST. 1993. Photic regulation of peptides located in the ventrolateral subdivision of the suprachiasmatic nucleus of the rat: daily variations of vasoactive intestinal polypeptide, gastrin-releasing peptide, and neuropeptide Y. J Neurosci 13(2):793-800.

Slotten HA, Krekling S, Sicard B, Pevet P. 2002. Daily infusion of melatonin entrains circadian activity rhythms in the diurnal rodent Arvicanthis ansorgei. Behav Brain Res 133(1):11-9.

Su Y, Foppen E, Zhang Z, Fliers E, Kalsbeek A. 2015. Effects of 6-meals-a-day feeding and 6-meals-a-day feeding combined with adrenalectomy on daily gene expression rhythms in rat epididymal white adipose tissue. Genes Cells:10.

Su, Yan, Cathy Cailotto, Ewout Foppen, Remi Jansen, Zhi Zhang, Ruud Buijs, Eric Fliers, and Andries Kalsbeek. 2016. The Role of Feeding Rhythm, Adrenal Hormones and Neuronal Inputs in Synchronizing Daily Clock Gene Rhythms in the Liver. Molecular and Cellular Endocrinology 422 (February): 125–31.



23


1

Terazono H, Mutoh T, Yamaguchi S, Kobayashi M, Akiyama M, Udo R, Ohdo S, Okamura H, Shibata S. 2003. Adrenergic regulation of clock gene expression in mouse liver. Proc Natl Acad Sci U S A 100(11):6795-800.

Tosini G, Menaker M. 1996. Circadian rhythms in cultured mammalian retina. Science 272:419-21.

van Oosterhout F, Lucassen EA, Houben T, Vanderleest HT, Antle MC, Meijer JH. 2012. Amplitude of the SCN Clock Enhanced by the Behavioral Activity Rhythm. PLoS ONE 7(6):e39693.

Vanderleest HT, Houben T, Michel S, Deboer T, Albus H, Vansteensel MJ, Block GD, Meijer JH. 2007. Seasonal Encoding by the Circadian Pacemaker of the SCN. Curr Biol .

Wang HY, Huang RC. 2004. Diurnal Modulation of the Na+/K+-ATPase and Spontaneous Firing in the Rat Retinorecipient Clock Neurons. J Neurophysiol 92(4):2295-301.

Webb AB, Angelo N, Huettner JE, Herzog ED. 2009. Intrinsic, nondeterministic circadian rhythm generation in identified mammalian neurons. Proc Natl Acad Sci U S A 106(38):16493-8.

Wiater MF, Li AJ, Dinh TT, Jansen HT, Ritter S. 2013. Leptin-sensitive neurons in the arcuate nucleus integrate activity and temperature circadian rhythms and anticipatory responses to food restriction. Am J Physiol Regul Integr Comp Physiol 305(8):R949-R960.

Yamaguchi S, Isejima H, Matsuo T, Okura R, Yagita K, Kobayashi M, Okamura H. 2003. Synchronization of cellular clocks in the suprachiasmatic nucleus. Science 302(5649):1408-12.

Yamaguchi Y, Suzuki T, Mizoro Y, Kori H, Okada K, Chen Y, Fustin JM, Yamazaki F, Mizuguchi N, Zhang J, Dong X, Tsujimoto G, Okuno Y, Doi M, Okamura H. 2013. Mice genetically deficient in vasopressin V1a and V1b receptors are resistant to jet lag. Science 342(6154):85-90.

Yi CX, Challet E, Pevet P, Kalsbeek A, Escobar C, Buijs RM. 2008. A circulating ghrelin mimetic attenuates light-induced phase delay of mice and light-induced Fos expression in the suprachiasmatic nucleus of rats. Eur J Neurosci 27(8):1965-72.

Zhang D, Tong X, Arthurs B, Guha A, Rui L, Kamath A, Inoki K, Yin L. 2014. Liver clock protein BMAL1 promotes de novo lipogenesis through insulin-mTORC2-AKT signaling. J Biol Chem 289(37):25925-35.



CHAPTER 2

The Suprachiasmatic nucleus is part of a neural feedback circuit adapting blood pressure response.

Buijs FNCazarez FBasualdo MCScheer FAPerusquía MCenturion DBuijs RM.

Neuroscience. 25;266:197-207. (2014)



26

Chapter 2

AbstractThe suprachiasmatic nucleus (SCN) is typically considered our autonomous clock synchronizing behavior with physiological parameters such as blood pressure, just transmitting time independent of physiology. Yet several studies show that the SCN is involved in the etiology of hypertension. Here, we demonstrate that the SCN is incorporated in a neuronal feedback circuit arising from the nucleus tractus solitarius (NTS), modulating cardiovascular reactivity. Tracer injections into the SCN of male Wistar rats revealed retrogradely filled neurons in the caudal NTS, where blood pressure (BP) information is integrated. These NTS projections to the SCN were shown to be glutamatergic and to terminate in the ventrolateral part of the SCN where also light information enters. BP elevations not only induced increased neuronal activity as measured by c-Fos in the NTS but also in the SCN. Lesioning the caudal NTS prevented this activation. The increase of SCN neuronal activity by hypertensive stimuli suggested involvement of the SCN in counteracting BP elevations. Examining this possibility we observed that elevation of BP, induced by ɑ1-agonist infusion, was more than twice the magnitude in SCN-lesioned animals as compared to in controls, indicating indeed an active involvement of the SCN in short-term BP regulation. We propose that the SCN receives BP information directly from the NTS enabling it to react to hemodynamic perturbations, suggesting the SCN to be part of a homeostatic circuit adapting BP response. We discuss how these findings could explain why lifestyle conditions violating signals of the biological clock may, in the long-term, result in cardiovascular disease.



27


2

IntroductionNumerous aspects of physiological functions such as temperature regulation, hormonal control, autonomic tone, and metabolism show circadian rhythms(Hastings et al., 2003c). These processes are regulated by the suprachiasmatic nucleus (SCN), in interaction with peripheral oscillators(Buijs and Kalsbeek, 2001). Imbalance in the circadian system is thought to contribute to development of disease, i.e., obesity, metabolic syndrome, diabetes and cardiovascular disease(Gangwisch et al., 2006). The latter is a leading cause of death in the world today, though still many questions remain over what pathology gives rise to its development. Recent human studies show that BP is influenced by the circadian system, independent of sleep/wake or fasting/feeding(Scheer et al., 2010c; Shea et al., 2011c). Evidence ranging from animal experimental and clinical data, to post mortem studies, suggests involvement of the SCN in hypertension(Brugger et al., 1995; Goncharuk et al., 2001; Shaw et al., 2001).

Recent studies emphasized a role for peripheral clock genes in cellular processes associated with BP control. Within the adrenal, absence of CRY clock genes has been associated with hyperaldosteronism(Doi et al., 2010b; Okamura et al., 2011). In the kidney, PER1 has been associated with regulation of renal epithelial sodium channels(Gumz et al., 2009), while clock genes have also been implicated in vascular endothelial function(Viswambharan et al., 2007; Anea et al., 2009; Cheng et al., 2011a) and trombogenesis(Westgate et al., 2008) with potential relevance also in humans(Scheer et al., 2011). Hereby, it is important to note that the SCN synchronizes rhythms of clock gene expression in all organs(Buijs and Kalsbeek, 2001). Disturbance in this function of the SCN could, in time, result in the development of hypertension.

Consequently, a picture has emerged of the circadian system as a regulating entity for body homeostasis, including BP control. In addition to timing rhythmicity of peripheral clock genes, the SCN influences several organs that may affect BP; either by timing autonomic output to, e.g., blood vessels, heart and kidney; or by timing hormonal secretion e.g. (nor)adrenalin, cortisol and aldosterone(Buijs and Kalsbeek, 2001; Hastings et al., 2003b). Furthermore, postmortem analysis of hypertensive humans and animals exhibited changes in the SCN and hypothalamus(Peters et al., 1994; Goncharuk et al., 2001; Goncharuk et al., 2002), but have not provided evidence whether such changes are cause or consequence of hypertension. Based on knowledge that the SCN is important for timing cardiovascular control we hypothesized that the SCN, like virtually any structure in the brain, would need feedback to execute its function properly. Therefore, we investigated whether the SCN is incorporated in a brain circuit controlling blood pressure.

Hereto neuronal tracers were injected into the SCN demonstrating retrogradely labeled neurons in the the nucleus tractus solitarius (NTS) suggesting the presence of NTS projections to the SCN. These projections were confirmed by neuronal tracer injection into the NTS revealing anterogradely labeled fibers in the SCN. These fibers were shown



28

Chapter 2

to be glutamatergic and activated the SCN after blood pressure increase. The present data show further that the SCN may use this homeostatic feedback directly from, the NTS, to adjust its output resulting in an attenuation of blood pressure increase since lesioning the SCN resulted in a marked increase in blood pressure response. Materials and MethodsAnimals. Experiments were performed on male Wistar rats (250-300g) housed individually on a 12:12h LD cycle (lights on 0700 h). Rats were provided food and water ad libitum. All experiments were performed in accordance with the committee for ethical evaluation at the Institute for Biomedical Research, Universidad Nacional Autonoma de Mexico and international guidelines for animal handling. All animals undergoing surgery were anesthetized with ketamine (50 mg/kg) and xylazine (2 mg/kg) (Pisa-Agropecuaria S.A. de C.V.; Atitalaqia, Mexico).

Tracer injections. SCN CtB injections. To detect projections to the SCN, Cholera toxin B (CtB) injections labeled with Alexa Fluor 555 fluorescent (Molecular Probes, Eugene, OR, USA) were made unilaterally into the SCN (n=9). After anesthesia, rats were mounted in a stereotact (David Kopf Instruments; Tujunga, USA) using coordinates for SCN injections(Buijs et al., 1993b). The glass micropipette (20-40 μm tip) was aimed at the SCN, with the animal in the stereotactic (toothbar at +5mm) and from bregma, 0.16 anterior; 0.05 lateral and 0.86 ventral from the dura, under an angle of 2⁰. With the glass micropipette, 0.05μl, 1% CtB was pressure injected (10 mbar, 5 sec) with the pipette left in place for 5 minutes in order to minimize tracer leakage. Injections were only accepted showing minimal leakage along the injection tract and positioned completely inside the SCN (Fig. 1a). NTS CtB injections. After anesthesia, rats were placed in the stereotact with the head fixed at 45°. Dura and arachnoid membranes were dissected exposing the dorsal surface of the medulla at the level of the area postrema. To target the NTS, the tip of the micropipette was aligned perpendicular to the medulla and placed 0.4 mm rostral, 0.5 mm lateral of the obex and 0.5 mm below the surface of the brainstem. Injections were made with CtB using a glass micropipette as mentioned above (Fig. 1b). Ocular CtB injections. Immediately following the injection of CtB in the NTS, animals received an injection of 0.5μl Alexa Fluor 488 labeled CtB (Molecular Probes) in the vitreous of the eye. Rats were sacrificed after 14 days, allowing optimal transport of CtB.



29


2

Figure 1. Sites of CtB injections and NTS neurons projecting to the SCN.

A) Representative CtB injection site in the SCN (White arrow showing injection tract). B) Representative picture at the level of the obex

demontrating CtB injection in the NTS. C) Photomicrograph of the caudal NTS after CtB injection into the SCN demonstrating the

presence of retrogradely labeled neurons bilaterally at the level of the obex. D) Represents the higher magnification of the square in A

which was ipsilateral to the injection site. The black bar represents 140μm in A and 50μm in B. Bregma – 14.35. SCN: suprachiasmatic

nucleus, Och: optic chiasm, DMV: dorsal motor nucleus of the vagus, NTS: nucleus tractus solitarius, ts: tractus solitarius, XII:

hypoglossal nucleus, cc: central canal.

Immunohistochemistry. Under an overdose of sodium pentobarbital (Sedal-Vet 65 mg/mL) animals were perfused transcardially with 0.9% saline followed by 4% paraformaldehyde in 0.1M Phosphate buffered saline (PBS; pH 7.5)(Buijs et al., 1993b). Brains were removed, post fixed for 24 h, cryo protected in 30% sucrose for 3 to 4 days, frozen and cut in sections of 35 μm at –20 °C. Analysis NTS CtB injections. Co-localization of CtB labeled terminals with antibodies to the glutamate transporter VGlut 2 or Glutamate decarboxylase (GAD) (Chemicon (Millipore) Billerica, MA, USA) were examined by double-labeled immuno fluorescence(Acosta-Galvan et al., 2011c). SCN sections were incubated with rabbit VGlut2 or goat GAD-67 (Chemicon) antibody followed by a secondary fluorescent antibody conjugated with Cy-2 or Cy-5 (Jackson Immunoresearch, West Grove, PO, USA). Finally, sections were mounted on gelatinized slides, air-dried and coverslipped with 30% glycerol in PBS.



30

Chapter 2

Analysis Ocular CtB injection. Co-localization of Alexa Fluor 555 labeled CtB terminals originating from the NTS and Alexa Fluor 488 labeled CtB terminals originating from the eye were examined in the SCN. Sections stained with fluorescent dyes were analyzed with the LSM 5 Pascal confocal microscope and the LSM software (Zeiss, Jena, Germany). Analysis SCN CtB injections. In order to visualize projections from the SCN, NTS sections from these brains were incubated with rabbit anti-CtB (Sigma–Aldrich Corp) at 4°C overnight. After rinsing, sections were incubated in biotinylated donkey-secondary antibody (Jackson Immunoresearch, West Grove, PO, USA; 1:400) for 1.5h and then in an avidin-biotin complex (Vector, Burlingame, CA, USA, 1:500) solution. The staining was performed with a solution of 0.025% diaminobenzidine (DAB), 10% NiNH4SO4 and 0.01% H2O2 (Sigma–Aldrich) in Tris-buffered saline (TBS, 0.01M, ph7.6), for 10 minutes. Sections were mounted on gelatinized slides, dried, dehydrated with graded solutions of ethanol, soaked in xylene, and finally coverslipped in Entellan embedding agent (Merck).

Fos immunoreactivity after increases in BP. We examined the influence of an increase in BP on the neuronal activity in the SCN using c-Fos as activity marker in 4 groups, each containing 7-8 rats. BP was increased by a peripheral vasoconstrictor (Metaraminol, Sigma-Aldrich; St. Louis, USA), acting as a selective agonist of alpha1-adrenoceptors located in arterioles, hence raising BP. Metaraminol was chosen as it does not pass the blood brain barrier and thus cannot directly affect neuronal activity but only indirectly via its action on the periphery (Cunningham et al., 1994b). Groups consisted of non-treated control animals, saline injected intact animals, metaraminol injected SHAM operated animals and metaraminol injected NTS lesioned animals. Subcutaneous 0.2ml metaraminol injections (100μg/kg) were performed twice, 10 min before and at zeitgeber time (ZT)12, to attain a 20-minute increase in BP. Two hours after the injections, animals were anesthetized and sacrificed by 4% paraformaldehyde perfusion at ZT14. Care was taken to keep the animals in complete darkness until sacrifice in order to avoid light disturbing the activity of SCN neurons. In separate experiments a dose-response curve had been determined and the used dose (0.2ml 100μg/kg metaraminol) induced a BP increase of 15-20 mmHg for 20 minutes. Fos immunohistochemistry. Serial sections were processed for Fos immunohistochemistry with rabbit anti c‐Fos antibody (1:4.000, Calbiochem) using the avidin–biotin–peroxidase procedure(Acosta-Galvan et al., 2011b) as mentioned in detail above. Tissues were processed in multiple runs whereby control and experimental tissues were always processed together to avoid the influence of slight differences in processing. Quantification and statistical analysis. Pictures were taken by using an Axioplan microscope (Zeiss, Jena, Germany) equipped with a digital color camera (Olympus DP25, Olympus, Japan). The SCN was manually outlined, the Fos-positive nuclear profiles were automatically detected by means of size and staining threshold detection using the same parameters for all experimental groups using Image J (NIH; Bethesda, USA). For each rat,



31


2

three sections were measured 90 μm apart (between bregma -0.90 to -1.20); the mean number of c-Fos positive nuclear profiles from these sections was calculated. All values are expressed as the mean ± SEM, and data were analyzed using analysis of variance (ANOVA). When significance was reached for the one-way ANOVA, Tukey multiple comparison post hoc test was used with statistical significance set at P < 0.05.

Surgery. NTS lesions. The surgical procedure for unilateral NTS lesions was as described for CtB injections. Unilateral lesions were made because in pilot studies they proved to decisively interrupt signal transduction to the SCN while bilateral NTS lesions have been shown to induce fulminant hypertension and limited survivability(Doba and Reis, 1973; Sved, 1986). Unilateral electrolytic lesions were made using a 27 gauge, Teflon coated needle with excoriated tip (0.25 mm). An electrical current of 0.3 mA was passed for 40sec to ensure lesioning of only a small part of the NTS; for sham operations no current was passed. Only small unilateral caudal NTS lesions were accepted. SCN lesions. A bilateral lesion of the SCN was carried out using above described procedure and coordinates but using electrodes 0.2mm in diameter, using an electrical current of 0.3mA for 40 seconds sufficient to eliminate the SCN bilaterally, but small enough to leave surrounding tissue intact. The following 3 weeks, locomotor activity was recorded to assess the effectiveness of the SCN lesion. Rats without LD rhythm (40 to 60% of their activity during the light period) were considered as SCN-lesioned animals (SCNX) and used for further study. After sacrifice, histological analysis was performed using staining for vasoactive intestinal peptide(Buijs et al., 1993a) to verify the lesion as complete and limited to the SCN. Only animals complying with mentioned criteria were included for analysis. Blood pressure recordings. Canulation. After obtaining a weight of 300g, animals were anesthetized and implanted with a 100mm silicone catheter (ID 0.020 inch; OD 0.037 inch; Dow Corning; Midland, USA) in the right jugular vein and in the left carotid artery as described earlier(Steffens, 1969). Arterial pressure recordings. Directly following canulation, BP recordings started and animals were kept under anesthesia. The left carotid artery cannula was connected to a pressure transducer (P23 XL; Grass Instruments, USA), coupled to a computerized data acquisition and analysis system (MP150, BIOPAC Systems, Inc.; Goleta, USA) recording the arterial pressure at 500Hz. Baseline was determined by observing hemodynamic stability for at least 30 min before measurements were started. Mean arterial blood pressure (MAP) was calculated using: MAP = [(2 x diastolic) + systolic]/ 3. Xylazine/ketamine anesthesia can have minor influence on BP response, however anesthesia was preferred over freely moving animals since pilot studies demonstrated great variation of BP responses following metaraminol, making analysis arduous. Metaraminol or saline was administered via the jugular vein catheter with consecutive injections given 5-10 min after MAP



32

Chapter 2

had returned to baseline values. Saline was used as a control injection to monitor MAP shifts due to volume change. Increasing doses of metaraminol determined the dose-response in a within-subject design. Injection volumes used for all solutions were 800μl/kg with concentrations metaraminol of 50, 100, 200 and 400mg/kg. For controls, MAP measurements started at ZT 2 (sleep phase) and as experimental group we used animals at ZT 14 (active phase), to assess possible differences in MAP response at different circadian time points. SCN lesioned animals were used to evaluate control of the SCN over MAP. Animals used at ZT14 had their eyes covered in order to prevent activation of the SCN by light. Each group consisted of 7 animals.

Statistical analysis. All MAP data were analyzed using ACQ knowledge software (BIOPAC Systems, Inc.; Goleta, USA). Variables assessed were 1) area under the curve (AUC) of MAP increase, taken from time of injection until return to baseline values, 2) change in MAP and 3) time taken for MAP to return to baseline values after injections. Error bars show the calculated SEM. We used one-way ANOVA comparing control saline injections between groups. For consecutive metaraminol injections a two-way ANOVA for repeated measurements was used analyzing the different BP data sets (Table 1). When signifi cance was reached for ANOVA the post hoc Bonferroni test was used for pairwise multiple comparisons and statistical signifi cance was set at *P < 0.05. (** P < 0.01, ***P < 0.001).

Table 1. Blood pressure analysis of outcome measures between experimental groups and interventions.

MAP: mean arterial pressure (mmHg), TtB: time to baseline (s), AUC: area under the curve (mmHg x s). Analysis: a one-way ANOVA was used comparing baseline MAP and saline injections between groups followed by the Tukey’s test if signifi cant. For consecutive metaraminol injections analysis consisted of a two-way repeated measures ANOVA followed by the Bonferroni test. Values are expressed as ±SEM (n = 7 for all groups). * P < 0.05 compared to ZT2. ** P < 0.01 compared to ZT2. *** P < 0.001 compared to ZT2

Dose MAP Δ MAP TtB AUCInjection B BaselineInjection Dose MAP Δ MAP TtB AUCZT 2 88.5 ±4.4 Saline inj 1.4±0.4 25±5 -65±36 Metaraminol inj 50μg 20.0±3.3 156±20 1455±358 100μg 27.0±2.3 192±28 2215±417 200μg 41.8±2.6 288±32 5513±693 400μg 60.0±2.7 386±19 9759±755ZT 14 80.2±3.2 Saline inj 1.7±0.4 44±15 15±38 Metaraminol inj 50μg 14.3±1.9 126±9 722±156 100μg 19.5±2.1 147±13 1102±214 200μg 35.2±2.6 215±13 2900±261 400μg 53.8±4.0 293±18* 6644±917SCNX 74.8±5.8 Saline inj 8.8±1.2*** 214±29*** 1215±364***Metaraminol inj 50μg 19.3±1.2 355±32*** 3119±754 100μg 26.8±2.3 417±18*** 6147±826* 200μg 37.8±2.6 499±27*** 9485±1264* 400μg 54.0±4.5 600±33*** 15254±2658**



33


2

ResultsA reciprocal NTS-SCN connection. To investigate from which potential areas involved in BP control the SCN might receive feedback, retrograde tracer injections of Cholera toxin B (CtB) were placed into the SCN. Unilateral injections resulted in a bilateral distribution of neurons in the NTS with an ipsilateral dominance. Especially injections in the ventral SCN resulted in small but reproducible numbers of retrogradely labeled neurons in the caudal NTS at the level of the obex, continuing up to the medial NTS at the level of the area postrema. The number of labeled neurons ranged from 3-11 per section (totaling 68-86 neurons throughout the NTS, n=3) depending on the level in the NTS and site of injection (Fig. 1c,d). To confirm that the retrogradely labeled neurons were indeed projecting to the SCN and not only to areas surrounding the SCN, injections were placed caudal in the NTS to visualize its input to the SCN area. CtB injections — being both a retrograde and anterograde tracer — in the caudal NTS resulted in a high density of fibers in several areas of the hypothalamus as previously reported(Ter Horst et al., 1989). In addition, we observed the presence of cell bodies dorsomedial in the SCN, implying that the SCN may also be able to project to the NTS area (Fig. 2a,c). The majority of the fibers were found ipsilateral to the injection site, although also contralateral projections were found in concordance with earlier reports showing crossover in NTS efferents(Ter Horst et al., 1989). In the hypothalamus, small and large diameter CtB labeled fibers arising from the NTS could be distinguished, while in the SCN only small diameter fibers were observed (Fig. 2a). The distribution of NTS derived fibers in the SCN was restricted to the ventral and lateral areas of the SCN. This is the same area where light input(Johnson et al., 1988) and input from the dorsomedial nucleus of the hypothalamus(Acosta-Galvan et al., 2011a) also enter the SCN. Fibers originating from the NTS were visible from the most rostral part of the SCN down to the caudal part where the density of NTS fibers was lowest. The combination of retinal tracing with tracing from the NTS revealed that NTS projections completely coincided with the input from the retina suggesting similar target neurons (Fig. 2b).

Identification of the NTS signal. Because numerous NTS efferent neurons involved in cardiovascular function are glutamatergic(Llewellyn-Smith et al., 2007) we stained CtB labeled terminals in the SCN for the glutamate transporter vGlut2, as marker of the neurotransmitter glutamate and for glutamate decarboxylase, as marker of the inhibitory neurotransmitter GABA. These analyses demonstrated that the majority of NTS terminals in the ventrolateral part of the SCN were glutamatergic and not GABA-ergic (Fig. 2c,d), showing the excitatory nature of this connection.



34

Chapter 2

Figure 2. Illustrates the interaction of the NTS with the SCN after a CtB injection into the NTS.

A) CtB (red) fibers are present in the ventro-lateral part of the SCN (arrows), together with cell bodies in the medial SCN. Bar, 50μm.

B) A magnification of the ventrolateral area of the SCN with retinal input (Green), and CtB labeled fibers from the NTS (red) show that

both terminals target the same structures in the SCN (arrows). Bar represents 20μm. C) Co-localization of vGlut (green) with CtB (red)

labeled neurons and fibers in the medial SCN. D) A higher magnification demonstrates the co-localization (yellow) of CtB labeled fibers

arising from the NTS with vGlut2. (arrow in C and D indicate the same structure). Bar represents 50μm in C and 15μm in D. Och: optic

chiasm (Indicated at the side of third ventricle), SCN: suprachiasmatic nucleus.



35


2

Signaling blood pressure information to the SCN. Given the glutamatergic NTS projections to the SCN, and that BP elevation activates a large population of glutamatergic NTS neurons, particularly in the caudal NTS (Weston et al., 2003c), we examined the influence of an increase in BP by an ɑ1-agonist (Metaraminol) on the neuronal activity in the SCN. Initially in pilot studies, we examined c-Fos reactivity 120 minutes after the induction of a transient hypertensive period early in the light period, at Zeitgeber Time 2 (ZT2). In the area of the SCN where the NTS projections terminate, a clear increase in c-Fos was found suggesting increased neuronal activity. However, the endogenous activity of the SCN is already high during the light period and thus did not permit an unambiguous demonstration of enhanced c-Fos activation following BP increase. Therefore we examined c-Fos induction in the SCN in the dark phase (ZT14), when the SCN shows low endogenous activity and little c-Fos expression. Metaraminol given at onset of the dark period resulted in a clear increase of c-Fos positive neurons in the SCN (119.5 ±15.6, n=7) compared to saline injected animals (54.8 ±9.2, n=8, P < 0.001), whereas non-injected animals barely showed any c-Fos (7.6 ±2.0, n=8) (Fig. 3a,b). The increase of c-Fos in saline injected animals suggests that the activation is associated with stress of the injection. The significantly higher c-Fos expression in the SCN following metaraminol administration, illustrates its substantial effect on blood pressure and consequent activation of the SCN. The unilateral lesioning of the caudal NTS (between Bregma -14.5 and -13.6; Fig. 4) resulted in a dramatic reduction of SCN activation after metaraminol injection (47.9 ±7.4, n=7, P < 0.001; Fig. 3) indicating that a unilateral lesion of the NTS was sufficient to considerably reduce BP information from reaching the SCN (Fig. 3c,d) and that integral functioning of the NTS is necessary to conduct a plenary cardiovascular signal to the brain. However, blood pressure recordings of such unilateral NTS lesioned animals showed that their response to an increase in blood pressure was comparable to controls. Nonetheless, strong diminishment of c-Fos activation in the contralateral NTS (Fig. 4) suggests the disruption of the integrity of the NTS in relaying BP information to the SCN as shown by the strong reduction in its activity (Fig. 3d).



36

Chapter 2

Figure 3. Cross-sections of the SCN showing the presence of activated neurons by means of c-Fos staining. A) Non-

treated control animal, B) Saline injected animal, C) SHAM operated, metaraminol injected animal and D) NTS lesioned, metaraminol

injected animal. Arrows in C indicate the high density of c-Fos in the ventrolateral part of the SCN in the area where NTS terminals

are present. Bar represents 75μm. E) Non-treated control animals showed a significantly lower amount of c-Fos as compared to saline

and metaraminol injected animals at ZT 14. Metaraminol injected animals showed a significantly increased amount of c-Fos compared

to metaraminol injected NTSX animals and saline injected animals (n=7-8). Analysis was by one-way ANOVA followed by Tukey´s test

(* P < 0.05, ** P<0.01, ***P<0.001). Results are expressed as ±SEM. Outlines show an approximation of the borders of the SCN. SCN:

suprachiasmatic nucleus, Och: optic chiasm, 3V: third ventricle.

Figure 4. C-Fos activation in the NTS and

DMV following s.c. metaraminol injection

at ZT 12.

A) An intact animal and an NTS lesioned animal

shown in B) with a representative lesion confined

to the NTS. A strong decrease of c-Fos was visible

in the NTS, also at the non lesioned site and even

in the area postrema, compared to intact animals

after metaraminol administration. Bregma – 14.05.

AP: area postrema, DMV: dorsal motor nucleus of

the vagus, NTS: nucleus tractus solitarius, XII:

hypoglossal nucleus, cc: central canal.



37


2

The involvement of the SCN in blood pressure regulation. In general, increased SCN neuronal activity is associated with light and the associated rest period in nocturnal rodents when BP is at its lowest(Meijer et al., 1998). The neuronal activation of the SCN by NTS input after hypertensive stimuli suggested the direct involvement of the SCN in a BP regulatory system. We thus examined the effect of an increasing dose of metaraminol on the MAP of anesthetized intact animals at two different times of the day/night cycle and in SCN-lesioned animals (Table 1). The MAP response at ZT2 and ZT14 after metaraminol injection differed with regard to the duration of the MAP increase, i.e., the time to bring MAP back to basal levels (Fig. 5). ZT2 (385.8 ±18.8 sec, n=7) started to differ from ZT14 (293.0 ±18.2 sec, n=7, P < 0.05) at the injection of 400μg/kg metaraminol, indicating the adaptive response to the increase in MAP was significantly stronger at ZT14. Since HR response did not significantly differ between groups, this could imply a greater centrally regulated plasticity of the cardiovascular system at ZT 14 as compared to ZT2. Lesioning the SCN severely affected the capacity to compensate for hypertensive stimuli (Fig. 6) illustrated by a significant increase in MAP even after saline injection, indicating that even the slight volume increase could not be immediately compensated in contrast with intact animals. Likewise, metaraminol resulted in a significantly greater MAP response in SCNX animals as reflected by the AUC (F(2,18)=18.91, P < 0.001) and duration (F(2,18)=67, P < 0.001) but not in the crest of MAP increase (Fig. 6); another indication for a change in the central ability to adapt to hypertensive stimuli, and not for the sensitivity to metaraminol. Basal MAP was not different between SCNX and control animals.

Figure 5. Representative blood pressure

responses to saline or metaraminol

injections. With saline injections (first grey

arrow) followed by consecutive metaraminol

injections (50, 100, 200 and 400μg/kg; Black

arrows) at ZT 2, ZT 14 and in SCNX animals.

Please note that saline injection induced an

increase in blood pressure in the SCNX animal

only. Bar represents 15min.



38

Chapter 2

Figure 6. SCNX animals have a

significantly increased blood pressure

response as compared to controls. A) Area

under the curve (AUC in mmHg x sec) after

saline or metaraminol injections in control

and SCNX animals. AUC of SCNX animals are

significantly higher compared to ZT 2 and 14.

B) Time in seconds for BP to return to baseline

values after saline or metaraminol injections

at ZT 2, ZT 14 and in SCNX animals (n=7 for

all groups). Analysis was by two-way repeated

measures ANOVA followed by Bonferroni

test (* P<0.05, ** P<0.01, *** P < 0.001 when

compared to ZT2). Results are expressed as

±SEM.



39


2

DiscussionThe present data provide evidence that the SCN receives direct projections from the cardiovascular-control area of the NTS, providing a neuroanatomical basis for the involvement of the SCN in the control of the blood pressure. Furthermore, the present data show that the SCN does not influence so much basal BP but rather determines the sensitivity of cardiovascular reactivity as previously suggested(Oosting et al., 1997; Scheer et al., 2010b). Consequently, our data show that the SCN is not merely a clock signaling time, but integrates cardiovascular feedback for an adequate hemodynamic regulation in harmony with the time of day. The present data also demonstrate that the SCN adapts its output based on sensory information relayed by the NTS. Therefore we conclude that, in addition to hypothalamic autonomic nuclei like the paraventricular nucleus receiving sensory cardiovascular feedback, the present study demonstrates that the SCN receives sensory cardiovascular information directly via the NTS. These results add to the accumulating evidence positioning the SCN as integral element in physiological control networks, including as recipient of feedback. In view of the many body functions that are timed by the SCN(Hastings et al., 2003a) and the fact that the NTS is the central relay in forwarding visceral sensory information to the brain, we suspect that the demonstrated pathway between the NTS and the SCN may provide, besides cardiovascular, also other types of visceral information to the SCN essential for homeostatic control. This is also supported by our recent finding that metabolic information may change the neuronal activity of the SCN via pathways that involve the NTS and intergeniculate leaflet(Saderi et al., 2013)

The SCN receives cardiovascular feedback through the NTS. Our present results demonstrate that the caudal NTS has excitatory glutamatergic projections to the SCN, resulting in an increase of SCN neuronal activity following hypertensive stimuli. This is consistent with previous work demonstrating increased activity of glutamatergic neurons in the caudal NTS after BP increases(Chan et al., 2000; Weston et al., 2003a; Weston et al., 2003b). We suggest it is through this NTS-SCN neuroanatomical pathway that cardiovascular feedback reaches the SCN, resulting in an adequate BP control pertaining to the time of day.

We cannot exclude that electrolytic lesioning of the NTS, as executed in the present study, to demonstrate the functionality of this pathway also damaged fibers of passage such as in the commissural NTS. Though trying to prevent this by using kainic acid lesions would bring other disadvantages as the size of such lesions is difficult to control resulting in other non desired side effects. Moreover, following the lesion its size is difficult to establish histologically. The surprising observation, that after a hypertensive stimulus both the NTS and SCN of unilateral NTS lesioned animals show a strong reduction in activity compared to controls, indicates that albeit small NTS lesions, the transmission of blood pressure information to the brain is greatly disrupted. This



40

Chapter 2

agrees with earlier studies showing that damage to the caudal part of the NTS can, in the short-term, dramatically affect the adaption of blood pressure to pressor stimuli(Sato et al., 1999; Colombari et al., 2002). However, this increased pressor response disappears over time, possibly due to neuronal reorganization within the medulla(Sato et al., 2003) explaining why our unilateral NTS lesioned animals do not show a changed pressor response like in controls. However, we cannot explain why the observed reduction of SCN activity in NTS lesioned animals had no acute effect on BP. Though it does follow our finding that the SCN is incorporated in a compliant feedback circuit regulating BP, it is possible this circuit is able to adapt through a form of neuronal restructuring. This has also been seen for example, in the recovery of temperature rhythmicity, over time, in SCN lesioned rats(Scheer et al 2005). Finally, the fact that sino-aortic denervation (SAD) results in a change in clock gene expression in the SCN(Li et al., 2007) and that SAD animals lose normal rhythmicity in blood pressure(Makino et al., 1997) indicates that disruption of NTS signaling interferes with the regulatory function of the SCN. Therefore we hypothesize that chronic disturbance of SCN activity could in the long-term lead to neuronal changes in the SCN, ultimately resulting in cardiovascular disease. Diminishment of SCN neurotransmitter staining as observed in the post mortem analysis of human hypertensive brains (Goncharuk, 2001) could support this hypothesis.

The SCN incorporated in a physiological feedback circuit. We establish that the area of baroreceptor input in the NTS emits projections to the SCN and targets the same area where also retinal fibers terminate in the SCN. Not surprisingly, in addition to receiving light input, the ventrolateral SCN is also associated with homeostatic and autonomic control(Nakagawa and Okumura, 2010). Neuronal activation of the SCN via these NTS projections by an increase in BP, results in a similar activation pattern as demonstrated with light(Aronin et al., 1990). Since SCN neuronal activity coincides with the inactive period in nocturnal rodents(Meijer et al., 1998), it is assumed that light induced activation of the SCN can be seen as a rest signal as it induces behavioral inactivity and a reduced heart rate, also established by light stimuli given during the active period(Scheer et al., 2005). In this study we establish a role for the SCN in regulating short-term BP variation according to time of day, as seen by a more effective cardiovascular control during the active phase as compared to the rest phase. In part, this may be explained by a change in blood vessel plasticity whereby increased rigidity of the cardiovascular system during the sleep period results in larger BP excursions following a hypertensive stimulus, as compared to controls. The observed variance in BP response amongst groups is not likely the result of divergent metaraminol metabolism since several studies have indicated that it is not rapidly degraded(Anton and Berk, 1977), nor does it pass the blood brain barrier. This is illustrated by the fact that metaraminol only induces a specific compensatory inactivation of vasopressin containing magocellular neurons of the supraoptic nucleus but not those containing oxytocin(Cunningham et al., 1994a).



41


2

We show that the SCN has an inhibitory effect on short-term BP regulation through our SCNX animal study. Here we demonstrate in agreement with earlier studies(Janssen et al., 1994) that an SCN lesion hardly changes basal blood pressure which also agrees with very small changes observed between day and night blood pressure when differences in activity are accounted for(Scheer et al., 2003). We establish a role for the SCN in regulating short-term BP variation according to time of day, as seen by more effective cardiovascular control during the active phase as compared to the rest phase. The fact that SCNX animals show even larger BP fluctuations indicates that the regulation of cardiovascular plasticity is a dynamic process whereby the SCN sets the tone. A similar role for the SCN has been observed in the control of corticosterone secretion whereby the SCN limits the corticosterone response after a stress stimulus and maintains this response within certain limits that vary between day and night; after an SCN lesion this corticosterone stress response is likewise significantly elevated(Buijs et al., 1993a). Therefore, we suggest that the differential control of short-term BP fluctuations by the SCN according to time of day, i.e., allowing a more flexible regulation to take place during the active period, ultimately could make the SCN responsible for a 24-hour BP rhythm. This conclusion is supported by studies demonstrating that SCNX animals lack 24h BP rhythms but show higher BP variability(Sano et al., 1995) and, as also presented here, do not exhibit a change in basal BP. Furthermore, recent findings demonstrate that VIPr2 -/- mice fail to show a circadian BP rhythm in constant conditions showing that an adequate SCN output is essential for regulation of 24h BP rhythmicity(Sheward et al., 2010). We do not know how the output of the SCN may moderate increases in BP; it might be via its projections to pre-autonomic neurons in the hypothalamus or possibly via its projections to the NTS itself, allowing it to alter baroreflex sensitivity(Scheer et al., 2010a; Shea et al., 2011b);therefore more research needs to be done to explore the plurality of this NTS signal and its exact effect within the SCN. Clinical implications. The prolonged hypertensive response in SCNX animals and animals in the sleep phase, suggests a greater plasticity of the cardiovascular system expressed by greater adaptability to strong BP fluctuations during activity periods. This is confirmed by recent data reporting that humans, in a constant routine protocol, have activity induced BP peaks which are high just prior to the early rest phase as compared to the early active phase(Shea et al., 2011a), suggesting a more effective adaptive BP response during the activity period. The present observation that the SCN is actively involved in BP regulation provides a possible explanation for the success of treating hypertensive patients focusing on the SCN, i.e., with chronotherapy or melatonin; especially effective in “non-dippers” (Scheer et al., 2004; Grossman et al., 2006) who show suppressed 24-hour BP variation(Pickering, 1990).

The loss of immunoreactivity in the SCN of the hypertensive human postmortem brain(Goncharuk et al., 2001) suggests that a functional SCN lesion has taken place; whether this is cause or consequence of hypertension still needs to be resolved. It



42

Chapter 2

is possible that, via a similar NTS-SCN pathway as demonstrated here, hypertension in humans chronically disrupts the activity of the SCN through perturbing feedback from the NTS, with the possible consequence that the SCN insufficiently prepares a hypertensive individual to cope with sudden BP fluctuations. This is supported by the fact that when hypertension progresses, baroreceptor sensitivity is disrupted(Moreira et al., 1992). On account of this loss of adequate autonomic control, short-term BP changes could aggravate under an insufficient baroreflex. Together with increased platelet aggregation early in the day(Ellis et al., 1991; Scheer et al., 2011) this might clarify why cardiovascular incidents are more frequent in the early activity period than at any other period during the circadian cycle(Zulch and Hossmann, 1967; Muller et al., 1985)

We demonstrate that the SCN receives cardiovascular feedback via the NTS emphasizing the importance of the SCN not only as master clock, but also as an integral element in the physiological regulation of BP. Since SCN output also synchronizes peripheral clock genes that have important regulatory functions at the level of organs involved in cardiovascular control, such as blood vessels, kidneys and adrenal(Doi et al., 2010a; Cheng et al., 2011b), it can be inferred that this synchrony between the cardiovascular system and the SCN is essential for body homeostasis; desynchronization between and/or within this system could ultimately result in the development of cardiovascular disease.

CONCLUSION



43


2



44

Chapter 2

ReferencesAcosta-Galvan G, Yi CX, Van D, V, Jhamandas JH, Panula P, Angeles-Castellanos M, Del Carmen BM, Escobar C, Buijs RM (2011)Interaction between hypothalamic dorsomedial nucleus and the suprachiasmatic nucleus determines intensity of food anticipatory behavior. Proc Natl Acad Sci U S A 108:5813-5818.

Anea CB, Zhang M, Stepp DW, Simkins GB, Reed G, Fulton DJ, Rudic RD (2009)Vascular Disease in Mice With A Dysfunctional Circadian Clock. Circulation.

Anton AH, Berk AI (1977)Distribution of metaraminol and its relation to norepinephrine. Eur J Pharmacol 44:161-167.

Aronin N, Sagar SM, Sharp FR, Schwartz WJ (1990)Light regulates expression of a fos-related protein in rat suprachiasmatic nuclei. Proc Natl Acad Sci USA 87:5959-5962.

Brugger P, Marktl W, Herold M (1995)Impaired nocturnal secretion of melatonin in coronary heart disease. Lancet 345:1408.

Buijs RM, Kalsbeek A (2001)Hypothalamic integration of central and peripheral clocks. Nat Rev Neurosci 2:521-526.

Buijs RM, Kalsbeek A, Van Der Woude TP, Van Heerikhuize JJ, Shinn S (1993a)Suprachiasmatic Nucleus Lesion Increases Corticosterone Secretion. Am J Physiol 264:R1186-R1192.

Buijs RM, Markman M, Nunes-Cardoso B, Hou YX, Shinn S (1993b)Projections of the suprachiasmatic nucleus to stress-related areas in the rat hypothalamus:A light and electronmicroscopic study. J Comp Neurol 335:42-54.

Chan RK, Peto CA, Sawchenko PE (2000)Fine structure and plasticity of barosensitive neurons in the nucleus of solitary tract. J Comp Neurol 422:338-351.

Cheng B, Anea CB, Yao L, Chen F, Patel V, Merloiu A, Pati P, Caldwell RW, Fulton DJ, Rudic RD (2011)Tissue-intrinsic dysfunction of circadian clock confers transplant arteriosclerosis. Proc Natl Acad Sci U S A 108:17147-17152.

Colombari E, Sato MA, Cravo SL, Bergamaschi CT, Campos RR, Jr., Lopes OU (2002)Role of the medulla oblongata in hypertension. Hypertension 2001 38:549-54.

Cunningham JT, Nissen R, Renaud LP (1994)Perinuclear zone and diagonal band lesions enhance angiotensin responses of rat supraoptic neurons. Am J Physiol 267:R916-R922.

Doba N, Reis DJ (1973)Acute fulminating neurogenic hypertension produced by brainstem lesions in the rat. Circ Res 32:584-593.



45


2

Doi M, Takahashi Y, Komatsu R, Yamazaki F, Yamada H, Haraguchi S, Emoto N, Okuno Y, Tsujimoto G, Kanematsu A, Ogawa O, Todo T, Tsutsui K, van der Horst GT, Okamura H (2010)Salt-sensitive hypertension in circadian clock-deficient Cry-null mice involves dysregulated adrenal Hsd3b6. Nat Med 16:67-74.

Ellis PM, Beeston R, Cooke RR, Mellsop G (1991)Circadian variation in platelet imipramine binding during the day in healthy subjects. Pharmacopsychiatry 24:76-80.

Gangwisch JE, Boden-Albala B, Buijs RM, Kreier F, Pickering TG, Rundle AG, Zammit GK, Malaspina D (2006)Short sleep duration as risk factor for hypertension: analysis of the NHANES I. Hypertension 47:1-7.

Goncharuk VD, Van Heerikhuize J, Dai JP, Swaab DF, Buijs RM (2001)Neuropeptide changes in the suprachiasmatic nucleus in primary hypertension indicate functional impairment of the biological clock. J Comp Neurol 431:320-330.

Goncharuk VD, Van Heerikhuize J, Swaab DF, Buijs RM (2002)Paraventricular nucleus of the human hypothalamus in primary hypertension: activation of corticotropin-releasing hormone neurons. J Comp Neurol 443:321-331.

Grossman E, Laudon M, Yalcin R, Zengil H, Peleg E, Sharabi Y, Kamari Y, Shen-Orr Z, Zisapel N (2006)Melatonin reduces night blood pressure in patients with nocturnal hypertension. Am J Med 119:898-902.

Gumz ML, Stow LR, Lynch IJ, Greenlee MM, Rudin A, Cain BD, Weaver DR, Wingo CS (2009)The circadian clock protein Period 1 regulates expression of the renal epithelial sodium channel in mice. Journal of Clinical Investigation 119:2423-2434.

Hastings MH, Reddy AB, Maywood ES (2003)A clockwork web: Circadian timing in brain and periphery, in health and disease. Nat Rev Neurosci 4:649-661.

Janssen BJA, Tyssen CM, Duindam H, Rietveld WJ (1994)Suprachiasmatic Lesions Eliminate 24-H Blood Pressure Variability in Rats. Physiol Behav 55:307-311.

Johnson RF, Morin LP, Moore RY (1988)Retinohypothalamic projections in the hamster and rat demonstrated using cholera toxin. Brain Res 462:301-312.

Li H, Sun NL, Wang J, Liu AJ, Su DF (2007)Circadian expression of clock genes and angiotensin II type 1 receptors in suprachiasmatic nuclei of sinoaortic-denervated rats. Acta Pharmacol Sin 28:484-492.

Llewellyn-Smith IJ, Martin CL, Fenwick NM, DiCarlo SE, Lujan HL, Schreihofer AM (2007)VGLUT1 and VGLUT2 innervation in autonomic regions of intact and transected rat spinal cord. J Comp Neurol 503:741-767.



46

Chapter 2

Makino M, Hayashi H, Takezawa H, Hirai M, Saito H, Ebihara S (1997)Circadian rhythms of cardiovascular functions are modulated by the baroreflex and the autonomic nervous system in the rat. Circulation 96:1667-1674.

Meijer JH, Watanabe K, Schaap J, Albus H, Dqtbri L (1998)Light responsiveness of the suprachiasmatic nucleus: long- term multiunit and single-unit recordings in freely moving rats. J Neurosci 18:9078-9087.

Moreira ED, Ida F, Oliveira VL, Krieger EM (1992)Early depression of the baroreceptor sensitivity during onset of hypertension. Hypertension 19:198-201.

Muller JE, Stone PH, Turi ZG (1985)Circadian variation in the frequency of onset of acute myocardial infarction. N Engl J Med 313:1315-1322.

Nakagawa H, Okumura N (2010)Coordinated regulation of circadian rhythms and homeostasis by the suprachiasmatic nucleus. Proc Jpn Acad Ser B Phys Biol Sci 86:391-409.

Okamura H, Doi M, Yamaguchi Y, Fustin JM (2011)Hypertension Due to Loss of Clock: Novel Insight From the Molecular Analysis of Cry1/Cry2-Deleted Mice. Curr Hypertens Rep.

Oosting J, StruijkerBoudier HAJ, Janssen BJA (1997)Autonomic control of ultradian and circadian rhythms of blood pressure, heart rate, and baroreflex sensitivity in spontaneously hypertensive rats. J Hypertension 15:401-410.

Peters RV, Zoeller RT, Hennessey AC, Stopa EG, Anderson G, Albers HE (1994)The Control of Circadian Rhythms and the Levels of Vasoactive Intestinal Peptide Messenger RNA in the Suprachiasmatic Nucleus Are Altered in Spontaneously Hypertensive Rats. Brain Res 639:217-227.

Pickering TG (1990)The clinical significance of diurnal blood pressure variations. Dippers and nondippers. Circulation 81:700-702.

Saderi N, Cazarez-Marquez F, Buijs FN, Salgado-Delgado RC, Guzman-Ruiz MA, Del Carmen BM, Escobar C, Buijs RM (2013)The NPY intergeniculate leaflet projections to the suprachiasmatic nucleus transmit metabolic conditions. Neuroscience 246:291-300.

Sano H, Hayashi H, Makino M, Takezawa H, Hirai M, Saito H, Ebihara S (1995)Effects of suprachiasmatic lesions on circadian rhythms of blood pressure, heart rate and locomotor activity in the rat. Jpn Circ J 59:565-573.

Sato MA, Menani JV, Lopes OU, Colombari E (1999)Commissural NTS lesions and cardiovascular responses in aortic baroreceptor-denervated rats. Hypertension 34:739-743.

Sato MA, Schoorlemmer GH, Menani JV, Lopes OU, Colombari E (2003)Recovery of high blood pressure after chronic lesions of the commissural NTS in SHR. Hypertension 42:713-718.

Scheer FA, Hu K, Evoniuk H, Kelly EE, Malhotra A, Hilton MF, Shea SA (2010)Impact of the human circadian system, exercise, and their interaction on cardiovascular function. Proc Natl Acad Sci U S A 107:20541-20546.



47


2

Scheer FA, Kalsbeek A, Buijs RM (2003)Cardiovascular control by the suprachiasmatic nucleus: neural and neuroendocrine mechanisms in human and rat. Biol Chem 384:697-709.

Scheer FA, Michelson AD, Frelinger AL, III, Evoniuk H, Kelly EE, McCarthy M, Doamekpor LA, Barnard MR, Shea SA (2011)The Human Endogenous Circadian System Causes Greatest Platelet Activation during the Biological Morning Independent of Behaviors. PLoS ONE 6:e24549.

Scheer FA, Pirovano C, van Someren EJ, Buijs RM (2005)Environmental light and suprachiasmatic nucleus interact in the regulation of body temperature. Neuroscience 132:465-477.

Scheer FA, van Montfrans GA, van Someren EJ, Mairuhu G, Buijs RM (2004)Daily nighttime melatonin reduces blood pressure in male patients with essential hypertension. Hypertension 43:192-197.

Shaw JA, Chin-Dusting JP, Kingwell BA, Dart AM (2001)Diurnal variation in endothelium-dependent vasodilatation is not apparent in coronary artery disease. Circulation 103:806-812.

Shea SA, Hilton MF, Hu K, Scheer FA (2011)Existence of an endogenous circadian blood pressure rhythm in humans that peaks in the evening. Circ Res 108:980-984.

Sheward WJ, Naylor E, Knowles-Barley S, Armstrong JD, Brooker GA, Seckl JR, Turek FW, Holmes MC, Zee PC, Harmar AJ (2010)Circadian control of mouse heart rate and blood pressure by the suprachiasmatic nuclei: behavioral effects are more significant than direct outputs. PLoS ONE 5:e9783.

Steffens AB (1969)A method for frequent sampling blood and continuous infusion of fluids in the rat without disturbing the animal. Physiol Behav 4:833-836.

Sved AF (1986)Peripheral pressor systems in hypertension caused by nucleus tractus solitarius lesions. Hypertension 8:742-747.

Ter Horst GJ, De Boer P, Luiten PGM, Van Willigen JD (1989)Ascending projections from the solitary tract nucleus to the hypothalamus. A phaseolus vulgaris lectin tracing study in the rat. ns 31:785-797.

Viswambharan H, Carvas JM, Antic V, Marecic A, Jud C, Zaugg CE, Ming XF, Montani JP, Albrecht U, Yang Z (2007)Mutation of the circadian clock gene Per2 alters vascular endothelial function. Circulation 115:2188-2195.

Westgate EJ, Cheng Y, Reilly DF, Price TS, Walisser JA, Bradfield CA, FitzGerald GA (2008)Genetic components of the circadian clock regulate thrombogenesis in vivo. Circulation 117:2087-2095.

Weston M, Wang H, Stornetta RL, Sevigny CP, Guyenet PG (2003)Fos expression by glutamatergic neurons of the solitary tract nucleus after phenylephrine-induced hypertension in rats. J Comp Neurol 460:525-541.

Zulch KJ, Hossmann V (1967)24-hour rhythm of human blood pressure. Ger Med Mon 12:513-518.



2

CHAPTER 3

Olanzapine-induced early cardiovascular effects are mediated by the biological clock and prevented by melatonin.

Romo-Nava FBuijs FNValdés-Tovar MBenítez-King GBasualdo MPerusquía MHeinze GEscobar CBuijs RM.

J Pineal Res. 62(4). (2017)



50

Chapter 3

AbstractSecond generation antipsychotics (SGA) are associated with adverse cardiometabolic side-effects contributing to premature mortality in patients. While mechanisms mediating these cardiometabolic side-effects remain poorly understood, three independent studies recently demonstrated that melatonin was protective against cardiometabolic risk in SGA-treated patients. Since one of the main target areas of circulating melatonin in the brain is the suprachiasmatic nucleus (SCN), we investigated SCN involvement in SGA-induced early cardiovascular effects in Wistar rats. We evaluated the acute effects of olanzapine and melatonin in the biological clock, paraventricular nucleus and autonomic nervous system using immunohistochemistry, invasive cardiovascular measurements and Western blot. Olanzapine induced c-Fos immunoreactivity in the SCN followed by the paraventricular nucleus and dorsal motor nucleus of the vagus indicating a potent induction of parasympathetic tone. The involvement of a SCN-parasympathetic neuronal pathway after olanzapine administration was further documented using Cholera Toxin B retrograde tracing and vasoactive intestinal peptide immunohistochemistry. Olanzapine-induced decrease in blood pressure and heart rate confirmed this. Melatonin abolished olanzapine-induced SCN c-Fos immunoreactivity, including the parasympathetic pathway and cardiovascular effects while brain areas associated with olanzapine beneficial effects including the striatum, ventral tegmental area and nucleus accumbens remained activated. In the SCN, olanzapine phosphorylated the GSK-3ẞ, a regulator of clock activity, which melatonin prevented. Bilateral lesions of the SCN prevented the effects of olanzapine on parasympathetic activity. Collectively, results demonstrate the SCN as a key region mediating the early effects of olanzapine on cardiovascular function, and show melatonin has opposing and potentially protective effects warranting additional investigation.



51

Olanzapine-induced effects are mediated by SCN

3

IntroductionSecond generation antipsychotics (SGA) induce severe adverse cardiometabolic effects that affect millions of patients and families by decreasing drug adherence or dramatically increasing their health burden with metabolic comorbidity (Lieberman et al. 2005). Olanzapine is a SGA effectively used to treat patients with mental disorders, but unfortunately induces adverse cardiometabolic effects including weight gain, fat mass, glucose, insulin, and lipid increases (Rummel-Kluge et al. 2010; Vidarsdottir et al. 2010; Vancampfort et al. 2013). Interestingly, in rats and humans, acute SGA treatment may induce hypotension (Markowitz 2002; Choure et al. 2014; Leung et al. 2014), while long-term SGA treatment is associated to increased blood pressure (McEvoy et al. 2007). In consequence, they have become an enormous health problem in a population in which the risk of metabolic abnormalities is 2 to 3 times greater than that of the general population(Vancampfort et al. 2013). These patients also suffer a premature death 11 to 20 years earlier, largely due to cardiovascular disease(Laursen et al. 2013; Westman et al. 2013).The SGA-induced cardiometabolic effects are also present in acute administration studies in healthy individuals, indicating that metabolism changes are independent of caloric intake and disease related factors(Vidarsdottir et al. 2010; Hahn et al. 2013). Even though intense research efforts during the past decade have focused on providing a plausible mechanism for their genesis and prevention, an integral explanation is lacking and the therapeutic options to prevent them are limited and urgently needed.Metabolism is influenced through central hypothalamic mechanisms that involve the biological clock located in the suprachiasmatic nucleus (SCN) and the autonomic nervous system (ANS) (Buijs and Kalsbeek 2001; Buijs et al. 2013; Takeda and Maemura 2016). Disturbances of these mechanisms have been associated to metabolic problems such as the metabolic syndrome (Buijs and Kalsbeek 2001; Kreier et al. 2003), which resembles SGA-induced cardiometabolic effects. In a recent study the pineal hormone melatonin, which signals darkness to the SCN depressing its activity(Liu et al. 1997), attenuated olanzapine-induced weight gain in rats (Raskind 2007). Hereafter in randomized controlled trial (RCT), we demonstrated that melatonin attenuates SGA induced cardiometabolic effects in patients, particularly those with bipolar disorder without affecting the psychopathological outcome (Romo-Nava et al. 2014). In two other RCT, melatonin mitigated olanzapine induced cardiometabolic effects in patients diagnosed with schizophrenia(Modabbernia et al. 2014) and bipolar disorder (Mostafavi et al. 2014).The SCN is strongly involved in metabolic and cardiovascular control (Buijs et al. 2013). Since one of the main targets of circulating melatonin in the brain is the SCN (Reppert et al. 1988, Liu et al. 1997), these basic and clinical results could suggest the involvement of central mechanisms in SGA-induced cardiometabolic effects. Therefore, we examined in a rat model the early effects of olanzapine on hypothalamic nuclei relevant for metabolic



52

Chapter 3

regulation and uncovered a hitherto unknown action of olanzapine on the biological clock resulting in a decrease in blood pressure; which was prevented by melatonin. These findings identify a novel SCN-centered mechanism for olanzapine cardiometabolic adverse effects and their prevention by melatonin without tampering the therapeutic effects.

Materials and MethodsEthical statement for animal experimentation. All experiments were carried out with the approval of the research ethics committee of the Institute of Biomedical Research at the Universidad Nacional Autonóma de México (UNAM) and were conducted in strict accordance with current legislation and technical specifications for production, care and use of laboratory animals (Norma Oficial Mexicana NOM- 062 -ZOO- 1999).

Immunohistochemistry for c-Fos. Male Wistar rats (200 – 250 g) were used to evaluate the effect in the brain and autonomic nervous system of acute administration of olanzapine (Zyprexa ® powder for solution, Lilly USA, LLC, Indianapolis, USA) and melatonin (Sigma- Aldrich product No. M5250, Saint Louis, MO 63103, USA). Animals were in light-dark cycles of 12h: 12h (Lights on at 07:00h, lights off at 19:00h) with ad libitum food and water. Rats received a single subcutaneous dose of olanzapine (2.5 mg/kg), olanzapine (2.5 mg/kg) + melatonin (2.5 mg), melatonin (2.5 mg) or saline (NaCl 0.9%) at ZT11 (one hour before dark onset) and were sacrificed at ZT14. Olanzapine and melatonin doses fall within the range used for previously published studies in rats (Dawe, Huff et al. 2001, Kitagawa, Ohta et al. 2012, Weston-Green, Huang et al. 2012). Olanzapine and melatonin were dissolved in a 20% ethanol and saline solution (final volume of administration: 0.5 mL). Saline and olanzapine only groups received the same amount of ethanol (Fig. S1). Animals were sacrificed 3 hours after drug administration (ZT14). To obtain the brains, animals were anesthetized with an overdose of intraperitoneal (i.p.) pentobarbital (210 mg/kg) and perfused with an intracardiac infusion of 250 ml saline solution (0.9% NaCl), followed by 200 ml 4% paraformaldehyde prepared in 0.1M phosphate buffer, pH 7.2. Brains and spinal cords were removed and placed in 4% paraformaldehyde for 24 hrs and subsequently cryo-preserved in 30% sucrose for 72 h. The brains were frozen and cut in 40 μm coronal plane slices and maintained in culture dishes with a 0.1M phosphate buffer, pH 7.2. The primary antibody for c-Fos (1:40,000; Calbiochem, #PC38, San Diego, CA, USA) used as a marker of neural activity, was incubated for 1 hr. at room temperature and 48 hours at 4 °C. After extensive washing, donkey anti-rabbit biotinylated secondary antibody (1:200, Jackson Immunoresearch, West Grove, PA, USA) was applied and incubated for 2 h. The avidinperoxidase complex (ABC 9:1000; Vectastain, Vector Laboratories, Burlingame, CA, USA) was applied and finally the reaction was visualized with diaminobenzidine in PBS (50 mg/100 mL, pH 7.2) combined with 0.003% peroxide and 0.01% nickel. The sections were mounted on gelatinized slides and cover slipped with Entellan® (EMD Millipore Corp., Billerica, MA, USA). Coronal sections of each side, in each nucleus or region studied



53


3

were selected using the following distance from bregma coordinates: SCN (-0.60mm); paraventricular nucleus (PVN; -1.72mm); dorsal motor nucleus of the vagus (DMV; -14.40mm); intermediolateral column (IML; T3); striatum (0.96mm); ventral tegmental area (-5.04mm); nucleus accumbens (0.96mm) (Paxinos and Watson 2007).

Neuronal tracer injection. In order to confirm that olanzapine’s effects involve the activation of a SCN-PVN-DMV neuronal pathway, the retrograde tracer Cholera toxin-B (CtB) was injected into the DMV to analyze co-localization with c-Fos in the PVN pre-autonomic neurons after olanzapine administration and the presence of VIP projections from the SCN to them.After anesthesia the rats were placed in a David Kopf stereotaxic frame with the head fixed at 45º. Dissection of the dura and arachnoid to expose the dorsal surface of the bone at the level of the area postrema was performed. The head of the rat was placed so that the micropipette was aligned perpendicularly to the medulla oblongata. CtB (50 μl, 0.5%) was injected, by means of a glass micropipette with a 0.02 μl tip, unilaterally into the dorsal vagal complex by pressure (10 mbar, for 5 seconds). Following 10 days of recovery, animals received the acute subcutaneous administration of olanzapine and were sacrificed following the aforestated procedure. Injection accuracy was confirmed by CtB immunostaining (Fig. S2).Immunohistochemistry in PVN coronal sections was performed with c-Fos as described above. Immunohistochemistry for vasoactive intestinal peptide (VIP) to observe SCN projections to the PVN pre-autonomic neurons was then performed sequentially incubating the primary antibody for (rabbit- VIP) in a 1:2000 dilution for 1 hour at room temperature and 24 hours at 4 °C. Secondary antibody, AB and visualization with DAB procedures were followed as previously described. On the same PVN sections, CtB immunohistochemistry was performed using polyclonal rabbit anti-CtB immunoglobulin (1:1000, Sigma-Aldrich; No. C3062) to visualize PVN neurons retrogradely filled from DMV CtB injections. After incubating 24 hrs at 4°C. Secondary antibody, AB and visualization with DAB procedures were followed as described above without nickel to obtain a brown-reddish stain.

Hemodynamic Measurements. Blood pressure and heart rate were measured in order to evaluate the functional relevance of the effect of olanzapine and melatonin on the parasympathetic nervous system. In order to evaluate the involvement of the SCN over the cardiovascular effects of olanzapine, we included a group of bilaterally SCN lesioned (SCNxx) animals and measured the immediate effects of olanzapine on blood pressure and heart rate.Blood pressure and heart rate measurements were made through a femoral artery catheter. Cannulation of the femoral artery was performed as described elsewhere (Jespersen, Knupp et al. 2012). In brief, rats were anesthetized with i.p. urethane (1.5 g/kg) diluted in 2 mL of saline solution (0.9% NaCl). Rats were placed in supine position and fur around the



54

Chapter 3

inguinal surgical region was shaved. A small (1-2 cm) incision along the natural angle of the leg was placed and femoral vein and artery exposed through blunt dissection. The femoral artery was separated from the vein, nerve and surrounding tissue and retractors placed to fully view the artery and vein. Folded sterile 4.0 silk was placed under the femoral artery and cut to obtain proximal and distal silk pieces. The distal silk piece was pulled caudally and the proximal piece cranially to allow hemostatic control of the artery. A small incision was made on the artery section between the silk pieces; fine tip forceps were inserted into the incision and used to allow the insertion of the catheter. The catheter was pushed into the artery and proximally fixed. The functionality of the catheter was checked and two hours after surgery, connected to a blood pressure transducer.

Bilateral lesion of the suprachiasmatic nucleus. The SCN lesion technique has been previously described (Buijs, Kalsbeek et al. 1993). In short, animals were anesthetized with I.P. ketamine/xylazine (90 mg and 10 mg/kg) and placed on a stereotaxic surgery frame (Model 900, David Kopf). Coordinates used to lesion the SCN were: 2.2mm posterior to bregma, 0.9mm ventral, and 0.2 mm lateral. Lesions were performed using epoxy-insulated insect pins (0.20mm) with excoriated tip. Direct electrical current for 30 seconds was applied bilaterally. Rats recovered from surgery for 2 weeks with successful lesions confirmed by actigraphic registration and SCN VIP immunostaining as described above (Fig. S3).

Hemodynamic registration. Blood pressure and heart rate measurements were recorded from the artery catheter by a pressure transducer (P23 XL, Grass Instrument, Quincy, MA, USA) connected to a MP150 Research System and the data were analyzed using AcqKnowledge software (Biopac Systems Inc., Goleta, CA, USA). For the purpose of this experiment, baseline tracings, as well as saline, olanzapine and melatonin were sequentially administered i.p. at the previously described doses to ensure quantifiable responses of hemodynamic parameters. Data was obtained from three experimental groups of animals, with minutes indicating the time data was recorded after drug administration (I.P.). Group 1 (olanzapine): Baseline values were obtained (10 min) followed by 0.5 ml saline (10 min) and a single olanzapine (0.5 mg/kg) injection (60 min). Group 2 (melatonin + olanzapine): Ensuing baseline recording (10 min), a 0.5 ml saline injection (10 min) was followed by a single melatonin (2.5 mg) I.P. injection (10min) and successively olanzapine i.p. was given (60 min). Group 3 (SCNxx animals + olanzapine): Baseline tracing (10 min) preceded 0.5 ml saline I.P. (10 min), followed by a single olanzapine I.P. injection (60 min).



55


3

Western blot. For Nocturnal (ZT11) drug administration for saline, olanzapine, olanzapine+melatonin and melatonin, the protocol was followed as described above (n=5 animals/experimental group). Animals were sacrificed at ZT14 by decapitation. The suprachiasmatic nucleus was immediately obtained, preserved in RIPA buffer with protease and phosphatase inhibitors and frozen at -72 ºC. Tissue was homogenized and total protein concentration was determined by Lowry’s assay (Lowry, Rosebrough et al. 1951). Equal amounts of protein were loaded into polyacrylamide gels and phosphorylated as well as total GSK-3ẞ were evaluated by Western blot. Glyceraldehyde-3-phosphate dehydrogenase GAPDH was also immunodetected as load control. In short, proteins were separated by one-dimensional SDS-PAGE in 10% polyacrylamide gels (Laemmli 1970) and transferred according to Towbin’s procedure (Towbin, Staehelin et al. 1979). Phosphorylated GSK-3ẞ (Ser9) was identified with an anti-phospho-GSK-3ẞ antibody (1:1300, Cell Signaling Technology Inc., #9336, Danvers, MA, USA) and a peroxidase-conjugated donkey anti-rabbit IgG (Jackson Immunoresearch, #711-005-152, West Grove, PO, USA) diluted 1:10,000. Detection was performed by chemiluminiscence(Alegria-Schaffer 2014). After mild stripping, total GSK-3ẞ and GAPDH were identified using antibodies for GSK-3ẞ (1:1400, Santa Cruz Biotech, #SC-9166, Dallas, Tx, USA) and GAPDH (1:20,000, EMD Millipore Corp., MAB374, Billerica, MA, USA). Respective peroxidase-conjugated secondary antibodies were: donkey anti-rabbit IgG (1:20,000, Jackson Immunoresearch, #711-005-152, West Grove, PO, USA) ) and goat anti-mouse IgG (1:100,000, Jackson Immunoresearch, # 205-005-108, West Grove, PO, USA). Samples from five independent experiments were obtained and Western blots were assayed by triplicate.Fluorogram images were obtained with a densitometer (GS-800, Bio-Rad, Hercules, CA, USA) and semi-quantitative amounts of phosphorylated GSK-3B, total GSK-3ẞ and GAPDH were estimated by densitometry with ImageJ software (Version 1.38X, NIH, Bethesda, MD, USA). Each fluorogram was analyzed in 8-Bit type .jpg picture formats. The plot lane tool in ImageJ was used to obtain integrated optical density (OD) values from immunoreactive bands for each experimental group.

Statistical Analysis. The number of c-Fos immunoreactive nuclei was calculated by semi-automatic quantification of the region of interest with ImageJ software (Version 1.38X, NIH, Bethesda, MD, USA) using at least two microphotographs (jpg format) of coronal sections of each side, in each nucleus or region studied. For between group comparisons (n=4 per group), we considered the average c-Fos immunoreactivity (IR) count for each region and analysis was conducted using ANOVA with Bonferroni´s post-hoc test for pair-wise comparisons accordingly. Blood pressure and heart rate analysis was performed using a data acquisition device with Acqknowledge software (model MP100, Biopac Systems, Goleta, CA, USA) and saved to a personal computer for offline analysis with the use of a Biopac System ECG 100C preamplifier. Ten-minute tracings of mean blood pressure values for baseline, saline,



56

Chapter 3

olanzapine or melatonin injections were obtained. Changes in mean baseline values for systolic, diastolic and mean arterial blood pressure were calculated for each tracing segment of ten minutes in each experimental group. Heart rate analysis was performed using maximum values in five 2-minute segments for each ten-minute tracing to clear noise from registrations; with the mean for each ten-minute tracing calculated using these values. Mean changes in heart rate, compared to baseline values, were then calculated for saline, olanzapine and/or melatonin injections. Repeated measures ANOVA Bonferroni´s post-hoc test was used for pair-wise comparisons at each time point (10-min segments).For Western blot analysis, densitometric analysis of the bands expressed as the optical density in A.U. of total GSK-3ẞ pGSK-3ẞ, GAPDH, and the ratio of pGSK-3ẞ to total pGSK-3ẞ (pGSK-3ẞ/ Total pGSK-3ẞ ratio) were used for between-group comparisons using One- way ANOVA. All statistical tests were two-tailed and considered significant at p level <0.05.

ResultsThe SCN is activated by olanzapine. With previous indirect indications that olanzapine may affect the biological clock (Vidarsdottir et al. 2009) and the glycogen synthase kinase- 3ẞ (GSK-3ẞ), which is a regulator of the clock’s activity (Iwahana et al. 2004) , we examined the effect of a single subcutaneous dose of olanzapine on brain activation. Olanzapine was administered to male Wistar rats (200-250grs) at the beginning of the active phase (night) and the brain obtained 3 hrs later, whereby c-Fos detection was used as a marker of neuronal activity. The acute peripheral administration of olanzapine induced in the SCN a fourfold increase in the number of c-Fos IR nuclei as compared to saline. The co-administration of olanzapine with melatonin, a hormone able to synchronize the clock by inhibiting its activity (Liu et al. 1997), prevented this effect (Fig. 1).



57


3

Figure 1. Olanzapine induces neuronal activation in the suprachiasmatic nucleus (SCN) and paraventricular nucleus

(PVN) that melatonin prevents. Panel with representative microphotographs of the SCN (top row) and PVN (bottom row) with

c -Fos immunoreactivity as a marker for neuronal activity. The left column shows rats treated with saline, followed by a column of

olanzapine (Olz), olanzapine + melatonin (Olz+Mel) and melatonin (Mel) treated rats. Bars represent the mean ± SEM of c-Fos IR nuclei

count in the SCN and the PVN. N=4 animals/group. One-way ANOVA analysis showed a significant between-group differences for SCN

(F = 21.27, df = 3, P < .0001) and PVN (F=16.80, df = 3, P < .0001); *** P < .0001, Bonferroni′s posthoc test for pair-wise comparisons

Scale bar is 100 μm.



58

Chapter 3

Olanzapine activates the parasympathetic autonomic axis which is prevented by melatonin. The acute administration of olanzapine also induced a significantly increased activation in the PVN and DMV, both output pathways from the SCN to the autonomic nervous system (ANS). Similar to the SCN, the co-administration of olanzapine with melatonin prevented this effect (Fig. 2). In the spinal cord olanzapine did not induce an activation of sympathetic motor neurons in the IML (Fig. 2). These results indicate that olanzapine selectively increases the activity of the parasympathetic and not the sympathetic branch of the ANS. Since the SCN directly signals to the PVN modulating its autonomic output (Buijs et al. 2003) and melatonin receptors are densely present in the SCN and not in the PVN or DMV (Reppert et al. 1988; Lacoste et al. 2015), these results suggest that olanzapine activates directly the SCN, which consequentially activates the PVN and DMV.

Figure 2. Olanzapine induces activation of the dorsal motor nucleus of the vagus (DMV) which is prevented by co-

administration of melatonin. Representative microphotographs of the DMV (top) and intermediolateral column (IML; bottom

row) with c-Fos immunoreactivity (IR). The left column demonstrates rats treated with saline, followed by a column of olanzapine,

olanzapine + melatonin and melatonin only treated rats; N=4 animals/group. Bars represent the mean ± SEM count of c-Fos IR nuclei

in the DMV and the IML. One-way ANOVA analysis showed a significant between-group difference for DMV c-Fos (F = 9.028, df = 3, P

< .0001). ** P < .001 and *** P < .0001; Bonferroni′s post- hoc test for pair-wise comparisons. Nucleus of the tractus solitarius (NTS).

Scale bar is 100 μm



59


3

Melatonin does not impair olanzapine induced activation in the ventral striatum pathway. As expected the administration of olanzapine also induced an activation of the nucleus accumbens, striatum and ventral tegmental area (VTA); brain areas associated with its therapeutic effect, that do not receive direct input from the SCN (Robertson and Fibiger 1996; Sebens et al. 1998). In contrast with our observation in the SCN, the co-administration of melatonin and olanzapine did not alter the activation pattern in the striatum and VTA as observed with olanzapine alone. Moreover, in the nucleus accumbens the co-administration of melatonin with olanzapine induced a significant increase in c-Fos activation as compared to the administration of olanzapine alone. These results confirm olanzapine induced activation of brain regions involved in its therapeutic action and etiology of psychiatric disorders for which it is prescribed (Robertson and Fibiger 1996; Sebens et al. 1998). Melatonin does not counteract this therapeutic action, and, as seen in the nucleus accumbens it may even potentiate its action (Fig. 3). This concurs with clinical observations that co-administration of melatonin with an SGA does not impair its beneficial effects and may even enhance them (Modabbernia et al. 2014; Mostafavi et al. 2014; Romo-Nava et al. 2014).Furthermore, olanzapine induced an activation of the nucleus of the tractus solitarius (NTS), which also receives input from sensory pathways indicating that olanzapine also exerts effects on peripheral organs. Melatonin did not prevent this activation (Fig. 2 and Fig. S4), supporting a central, rather than peripheral effect of melatonin to prevent the action of olanzapine over the SCN, PVN and DMV.



60

Chapter 3

Figure 3. Olanzapine induced activation of brain regions associated with its therapeutic effect, not prevented by

melatonin. Representative microphotographs of c-Fos immunoreactivity (IR) in the striatum (top), ventral tegmental area (VTA;

middle row) and nucleus accumbens (N. Acc; bottom). The left column represents rats treated with saline, followed by a column of rats

treated with olanzapine (Olz), olanzapine + melatonin (Olz+Mel) and melatonin only (Mel). N=4 animals/group. Bars represent mean ±

SEM count for c-Fos IR nuclei in the striatum, VTA and N. acc. Anterior commissure (AC). One-way ANOVA analysis showed significant

between-group differences for striatum (F=13.79, df = 3, P < .0001), VTA (F = 15.78, df = 3, P < .0001), and N.Acc.(F = 25.19, df = 3, P <

.0001. * P < .01; ** P < .001; *** P < .0001; Bonferroni′s post hoc test pair-wise comparisons. Scale bar is 100 μm.



61


3

Olanzapine activates the parasympathetic pathway via the SCN. The pattern of c-Fos activation in the PVN suggested that mainly autonomic neurons might be activated. In view of the activation of the NTS and DMV, we decided to place a retrograde tracer into the dorsal vagal complex and confirm activation of the retrogradely labeled neurons. CtB labeled neurons in the PVN showed a high coincidence with c-Fos when olanzapine was given and this response was higher in the autonomic and parvocellular PVN as compared to the magnocellular nuclei (Fig. S2 and Table S1). Some of these activated CtB labeled neurons showed input from SCN neurons as visualized by vasoactive intestinal peptide (VIP) immunohistochemical staining confirming a SCN-PVN-DMV neural pathway, activated by olanzapine.

Parasympathetic activity plays a key role in blood pressure regulation, adiposity and metabolic activity (Kreier et al. 2006). Acutely, olanzapine induces a potent increase of parasympathetic tone translated into a decrease in blood pressure and heart rate in rats (Leung, Pang et al. 2014) and postural hypotension in humans (Choure et al. 2014). Parasympathetic hyperactivation may contribute to the development of metabolic syndrome, obesity (Suzuki et al. 2014) or other SGA induced adverse metabolic effects. Our anatomical analysis shows that olanzapine activates the parasympathetic branch of the ANS, with melatonin vastly mitigating this effect. To evaluate the functional significance of this finding, we measured the acute effects of olanzapine and melatonin on blood pressure and heart rate; two variables influenced by autonomic function and modified by olanzapine (Choure et al. 2014; Leung et al. 2014). In agreement with the observed increase in activity of DMV neurons, olanzapine also induced a significant decrease in systolic, diastolic and mean arterial blood pressure (MAP), as well as in heart rate. The administration of melatonin, ten minutes before the injection of olanzapine, significantly attenuated its effect on systolic and diastolic pressure, MAP and heart rate (Fig. 4). Thus, olanzapine induces activation of the parasympathetic autonomic branch, decreasing blood pressure and heart rate; this is largely avoidable by giving melatonin. Next, and considering the high concentration of melatonin receptors in the SCN, and not in PVN or DMV (Weaver et al. 1993), we hypothesized that the cardiovascular side effects of olanzapine, readily prevented by melatonin, were due to the effect of olanzapine on the SCN. To evaluate the involvement of the SCN in the hemodynamic effects of olanzapine, we performed bilateral SCN lesions (SCNxx) and after two weeks of recovery, we tested the effects of olanzapine on blood pressure and heart rate. Administration of olanzapine to SCNxx animals resulted in decreased effect on heart rate and blood pressure, similar to that observed in intact animals treated with olanzapine + melatonin (Fig. 4). This observation confirms that olanzapine acts on the SCN to induce cardiovascular adverse effects and that these effects, associated with elevated comorbidity and mortality in SGA treated patients, can be prevented by inhibiting the SCN activity with melatonin administration (Raskind 2007; Modabbernia et al. 2014; Mostafavi et al. 2014; Romo-Nava et al. 2014).



62

Chapter 3

Figure 4. Blood pressure and heart rate measurements. Olanzapine induced a decrease in systolic (SBP), diastolic (DBP) and

mean arterial (MAP) blood pressure that was prevented by melatonin or a bilateral SCN lesion. Olanzapine also induced a decrease

in heart rate (HR) that was counteracted by SCNxx and melatonin. Olanzapine (Olz); Melatonin/Olz (Mel/Olz); SCN lesioned animals

injected with olanzapine (SCNxx). Hemodynamic parameters are reported in mean change from baseline. N=5 animals/group. Repeated

measures ANOVA showed significant treatment group x time interaction for Systolic (F = 3.216, df = 16, P < .0002), Diastolic (F = 9.561,

df = 16, P < .0001), MAP analysis (F = 9.164, df = 16, P < .0001) and Heart rate (F = 2.089, df = 16, P = .014). Bonferroni′s post hoc test for

pair-wise comparison; * P < .01 Olz vs. Mel/Olz; ** P < .01 Olz vs. SCNxx Olz; *** P < .01 Mel/Olz vs. SCNxx Olz.

Olanzapine induces GSK-3ẞ phosphorylation in the SCN which is prevented by melatonin. Consequently we investigated the intracellular mechanisms involved in the effects of olanzapine and melatonin in the SCN. Olanzapine has a wide spectrum of action and our results suggest that it could induce SCN neuronal activity via intracellular signaling cascades that converge with those of melatonin. Olanzapine induces phosphorylation of glycogen synthase kinase 3ẞ (GSK-3ẞ) and cAMP response element binding (CREB) protein via the Akt, Wnt and PKC pathways, which are linked to its antipsychotic therapeutic and metabolic effects (Girgis et al. 2008; Aubry et al. 2009; Lee et al. 2010; Pavan et al. 2010). Notably GSK-3ẞ is involved in SCN function, neurogenesis, neurotransmission and metabolic processes (Iitaka et al. 2005). Inhibition (phosphorylation) of GSK-3ẞ triggers the activation (phosphorylation) of the cAMP response element binding protein (CREB),



63


3

which in turn stimulates c-Fos transcription (Ginty et al. 1994, Grimes and Jope 2001). Interestingly, the phosphorylation of GSK-3ẞ shows a circadian pattern, which is lowest at night (Iitaka et al. 2005). In agreement with its action on the SCN whereby it reduces neuronal activity, melatonin decreases phosphorylation of GSK-3ẞ via Akt1 (Mao et al. 2012; Ge et al. 2013). Therefore, we evaluated the effects of olanzapine and melatonin on phosphorylated GSK-3ẞ levels in the SCN. Indeed, olanzapine induced an increase in phosphorylated GSK-3ẞ as compared to the control group and co-administration of melatonin reduced this effect. These findings provide a possible mechanism by which melatonin prevents the activation of SCN neurons by olanzapine (Fig. 5).

Figure 5. Olanzapine induces the phosphorylation of GSK-3ẞ in the SCN and this is prevented by melatonin.

Representative Western blots of phosphorylated GSK-3ẞ (pGSK-3ẞ) and total GSK-3ẞ in homogenates of the SCN. Glyceraldheyde-

3-phosphate dehydrogenase (GAPDH) was immunodetected as load control. (A) Neither total GSK-3ẞ nor GAPDH levels were different

between experimental groups (B and C). Densitometric analysis of the bands expressed as the ratio of the integrated optical density

(IOD) of pGSK- 3ẞ and total pGSK-3ẞ (pGSK-3ẞ/ Total pGSK-3ẞratio) was performed for between group comparisons. Olanzapine

increased pGSK-3ẞ/total pGSK-3ẞ ratio, which was reduced by melatonin (D). N = 5 animals/group. For: One-way ANOVA analysis

showed a significant between- group difference in pGSK-3ẞ/Total pGSK-3ẞ ratio (F = 15.19, df = 3, P <.0001). * P < .01; *** P < .0001;

Bonferroni′s post hoc test pairwise comparisons.



64

Chapter 3

DiscussionOur animal experiments show that: 1) olanzapine activates neurons in the SCN, PVN and DMV; 2) melatonin prevents these effects; 3) pre-autonomic neurons in the PVN activated by olanzapine, project to the DMV and receive input from the SCN; 4) olanzapine induces a decrease in blood pressure, prevented by melatonin; 5) the SCN is imperative to the cardiovascular side effects of olanzapine; 6) olanzapine induces inhibition of GSK-3ẞ in the SCN that is reduced by melatonin, providing a possible intracellular mechanism for the cardiovascular effects of olanzapine and melatonin. The biological clock selectively coordinates ANS balance to influence metabolism in different parts of the body, so alteration of this output may over time precipitate problems in metabolism such as the metabolic syndrome (Kreier, Yilmaz et al. 2003) Acute parasympathetic activation induces adiposity and an increase in plasmatic adiponectin (Suzuki et al. 2014). Such effects are also observed with short-term treatment with olanzapine (Togo et al. 2004). With time, the increased parasympathetic activity induced by olanzapine favors the appearance of cardiometabolic adverse effects like obesity, as well as lipid, insulin and glucose disturbances(Lieberman et al. 2005; Leucht et al. 2013; Vancampfort et al. 2013) similar to those observed in the metabolic syndrome; whereby in the long term a compensatory increased sympathetic cardiovascular tone is reported (Kreier et al. 2003; Lieberman et al. 2005). These dynamic adjustments in autonomic activity may explain the increased sympathetic tone, increased blood pressure and decreased levels of adiponectin found after chronic use of SGAs such as olanzapine (McEvoy et al. 2007; Bartoli et al. 2015). This might be a compensatory sympathetic effort of the ANS to counterbalance the chronic parasympathetic stimulus followed by the progressive appearance of metabolic disturbances induced by olanzapine. The immediate effect of melatonin, as we have demonstrated, prevents the increased parasympathetic output induced by olanzapine. Hereby melatonin may prevent short- and long-term (Raskind 2007; Modabbernia et al. 2014; Mostafavi et al. 2014; Romo-Nava et al. 2014) hypothalamic and ANS disturbances induced by olanzapine, attenuating its adverse cardiometabolic effects. Based on this evidence, we propose a new model with a SCN-centered mechanism that could help explain SGA induced cardiometabolic effects and the beneficial role of melatonin to prevent them (Fig. S5).



65


3

ConclusionThis study provides a new framework for the neuronal mechanisms involved in the cardiovascular and possibly other metabolic side effects of SGA and supports the rationale for the use of melatonin in a clinical setting to prevent them. Circulating melatonin may influence metabolic regulation through the SCN and could additionally have a direct peripheral action (Cipolla-Neto et al. 2014; Szewczyk-Golec et al. 2015). The SCN has already been shown to be linked to obesity and to metabolic syndrome, as well as hypertension. Our model could help to explain the role of the SCN and autonomic nervous system in early and chronic metabolic changes present in entities like obesity and the metabolic syndrome.Collectively, present results and previous clinical data warrant additional basic and clinical investigation to demonstrate the SCN as a key region mediating the effects of antipsychotics on other acute and chronic metabolic changes, and show whether melatonin has opposing and potentially protective long-term effects.



66

Chapter 3

ReferencesAlegria-Schaffer, A. (2014). “Western blotting using chemiluminescent substrates.” Methods Enzymol 541: 251-259.

Aubry, J. M., M. Schwald, E. Ballmann and F. Karege (2009). “Early effects of mood stabilizers on the Akt/GSK-3beta signaling pathway and on cell survival and proliferation.” Psychopharmacology (Berl) 205(3): 419-429.

Bartoli, F., A. Lax, C. Crocamo, M. Clerici and G. Carra (2015). “Plasma adiponectin levels in schizophrenia and role of second-generation antipsychotics: A meta-analysis.” Psychoneuroendocrinology 56: 179-189.

Buijs, R. M., C. Escobar and D. F. Swaab (2013). “The circadian system and the balance of the autonomic nervous system.” Handb Clin Neurol 117: 173-191.

Buijs, R. M. and A. Kalsbeek (2001). “Hypothalamic integration of central and peripheral clocks.” Nat Rev Neurosci 2(7): 521-526.

Buijs, R. M., A. Kalsbeek, T. P. van der Woude, J. J. van Heerikhuize and S. Shinn (1993). “Suprachiasmatic nucleus lesion increases corticosterone secretion.” Am J Physiol 264(6 Pt 2): R1186-1192.

Buijs, R. M., S. E. la Fleur, J. Wortel, C. Van Heyningen, L. Zuiddam, T. C. Mettenleiter, A. Kalsbeek, K. Nagai and A. Niijima (2003). “The suprachiasmatic nucleus balances sympathetic and parasympathetic output to peripheral organs through separate preautonomic neurons.” J Comp Neurol 464(1): 36-48.

Choure, B. K., D. Gosavi and S. Nanotkar (2014). “Comparative cardiovascular safety of risperidone and olanzapine, based on electrocardiographic parameters and blood pressure: a prospective open label observational study.” Indian J Pharmacol 46(5): 493-497.

Cipolla-Neto, J., F. G. Amaral, S. C. Afeche, D. X. Tan and R. J. Reiter (2014). “Melatonin, energy metabolism, and obesity: a review.” J Pineal Res 56(4): 371-381.

Dawe, G. S., K. D. Huff, J. L. Vandergriff, T. Sharp, M. J. O’Neill and K. Rasmussen (2001). “Olanzapine activates the rat locus coeruleus: in vivo electrophysiology and c-Fos immunoreactivity.” Biol Psychiatry 50(7): 510-520.

Ge, D., R. T. Dauchy, S. Liu, Q. Zhang, L. Mao, E. M. Dauchy, D. E. Blask, S. M. Hill, B. G. Rowan, G. C. Brainard, J. P. Hanifin, K. S. Cecil, Z. Xiong, L. Myers and Z. You (2013). “Insulin and IGF1 enhance IL-17-induced chemokine expression through a GSK3B-dependent mechanism: a new target for melatonin’s anti-inflammatory action.” J Pineal Res 55(4): 377-387.

Ginty, D. D., A. Bonni and M. E. Greenberg (1994). “Nerve growth factor activates a Ras-dependent protein kinase that stimulates c-fos transcription via phosphorylation of CREB.” Cell 77(5): 713-725.



67


3

Girgis, R. R., J. A. Javitch and J. A. Lieberman (2008). “Antipsychotic drug mechanisms: links between therapeutic effects, metabolic side effects and the insulin signaling pathway.” Molecular Psychiatry 13(13): 918-929.

Grimes, C. A. and R. S. Jope (2001). “CREB DNA binding activity is inhibited by glycogen synthase kinase-3 beta and facilitated by lithium.” J Neurochem 78(6): 1219-1232.

Hahn, M. K., T. M. Wolever, T. Arenovich, C. Teo, A. Giacca, V. Powell, L. Clarke, P. Fletcher, T. Cohn, R. S. McIntyre, S. Gomes, A. Chintoh and G. J. Remington (2013). “Acute effects of single-dose olanzapine on metabolic, endocrine, and inflammatory markers in healthy controls.” J Clin Psychopharmacol 33(6): 740-746.

Iitaka, C., K. Miyazaki, T. Akaike and N. Ishida (2005). “A role for glycogen synthase kinase-3beta in the mammalian circadian clock.” J Biol Chem 280(33): 29397-29402.

Iwahana, E., M. Akiyama, K. Miyakawa, A. Uchida, J. Kasahara, K. Fukunaga, T. Hamada and S. Shibata (2004). “Effect of lithium on the circadian rhythms of locomotor activity and glycogen synthase kinase-3 protein expression in the mouse suprachiasmatic nuclei.” Eur J Neurosci 19(8): 2281-2287.

Jespersen, B., L. Knupp and C. A. Northcott (2012). “Femoral arterial and venous catheterization for blood sampling, drug administration and conscious blood pressure and heart rate measurements.” J Vis Exp(59).Kitagawa, A., Y. Ohta and K. Ohashi (2012). “Melatonin improves metabolic syndrome induced by high fructose intake in rats.” J Pineal Res 52(4): 403-413.

Kreier, F., Y. S. Kap, T. C. Mettenleiter, C. van Heijningen, J. van der Vliet, A. Kalsbeek, H. P. Sauerwein, E. Fliers, J. A. Romijn and R. M. Buijs (2006). “Tracing from fat tissue, liver, and pancreas: a neuroanatomical framework for the role of the brain in type 2 diabetes.” Endocrinology 147(3): 1140-1147.

Kreier, F., A. Yilmaz, A. Kalsbeek, J. A. Romijn, H. P. Sauerwein, E. Fliers and R. M. Buijs (2003). “Hypothesis: shifting the equilibrium from activity to food leads to autonomic unbalance and the metabolic syndrome.” Diabetes 52(11): 2652-2656.

Lacoste, B., D. Angeloni, S. Dominguez-Lopez, S. Calderoni, A. Mauro, F. Fraschini, L. Descarries and G. Gobbi (2015). “Anatomical and cellular localization of melatonin MT1 and MT2 receptors in the adult rat brain.” J Pineal Res 58(4): 397-417.

Laemmli, U. K. (1970). “Cleavage of structural proteins during the assembly of the head of bacteriophage T4.” Nature 227(5259): 680-685.

Laursen, T. M., K. Wahlbeck, J. Hallgren, J. Westman, U. Osby, H. Alinaghizadeh, M. Gissler and M. Nordentoft (2013). “Life expectancy and death by diseases of the circulatory system in patients with bipolar disorder or schizophrenia in the Nordic countries.” PLoS One 8(6): e67133.



68

Chapter 3

Lee, J. G., H. Y. Cho, S. W. Park, M. K. Seo and Y. H. Kim (2010). “Effects of olanzapine on brain-derived neurotrophic factor gene promoter activity in SH-SY5Y neuroblastoma cells.” Prog Neuropsychopharmacol Biol Psychiatry 34(6): 1001-1006.

Leucht, S., A. Cipriani, L. Spineli, D. Mavridis, D. Orey, F. Richter, M. Samara, C. Barbui, R. R. Engel, J. R. Geddes, W. Kissling, M. P. Stapf, B. Lassig, G. Salanti and J. M. Davis (2013). “Comparative efficacy and tolerability of 15 antipsychotic drugs in schizophrenia: a multiple-treatments meta-analysis.” Lancet 382(9896): 951-962.

Leung, J. Y., C. C. Pang, R. M. Procyshyn and A. M. Barr (2014). “Cardiovascular effects of acute treatment with the antipsychotic drug olanzapine in rats.” Vascul Pharmacol 62(3): 143-149.

Lieberman, J. A., T. S. Stroup, J. P. McEvoy, M. S. Swartz, R. A. Rosenheck, D. O. Perkins, R. S. E. Keefe, S. M. Davis, C. E. Davis, B. D. Lebowitz, J. Severe and J. K. Hsiao (2005). “Effectiveness of Antipsychotic Drugs in Patients with Chronic Schizophrenia.” New England Journal of Medicine 353(12): 1209-1223.

Liu, C., D. R. Weaver, X. Jin, L. P. Shearman, R. L. Pieschl, V. K. Gribkoff and S. M. Reppert (1997). “Molecular dissection of two distinct actions of melatonin on the suprachiasmatic circadian clock.” Neuron 19(1): 91-102.

Lowry, O. H., N. J. Rosebrough, A. L. Farr and R. J. Randall (1951). “Protein measurement with the Folin phenol reagent.” J Biol Chem 193(1): 265-275.

Mao, L., R. T. Dauchy, D. E. Blask, L. M. Slakey, S. Xiang, L. Yuan, E. M. Dauchy, B. Shan, G. C. Brainard, J. P. Hanifin, T. Frasch, T. T. Duplessis and S. M. Hill (2012). “Circadian gating of epithelial-to-mesenchymal transition in breast cancer cells via melatonin-regulation of GSK3beta.” Mol Endocrinol 26(11): 1808-1820.

Markowitz, J. S., C. L. DeVane, D. W. Boulton, H. L. Liston and S. C. Risch (2002). “Hypotension and bradycardia in a healthy volunteer following a single 5 mg dose of olanzapine.” J Clin Pharmacol 42(1): 104-106.

McEvoy, J. P., J. A. Lieberman, D. O. Perkins, R. M. Hamer, H. Gu, A. Lazarus, D. Sweitzer, C. Olexy, P. Weiden and S. D. Strakowski (2007). “Efficacy and tolerability of olanzapine, quetiapine, and risperidone in the treatment of early psychosis: a randomized, double-blind 52-week comparison.” Am J Psychiatry 164(7): 1050-1060.

Modabbernia, A., P. Heidari, R. Soleimani, A. Sobhani, Z. A. Roshan, S. Taslimi, M. Ashrafi and M. J. Modabbernia (2014). “Melatonin for prevention of metabolic side-effects of olanzapine in patients with first-episode schizophrenia: randomized double-blind placebo-controlled study.” J Psychiatr Res 53: 133-140.

Mostafavi, A., M. Solhi, M. R. Mohammadi, M. Hamedi, M. Keshavarzi and S. Akhondzadeh (2014). “Melatonin decreases olanzapine induced metabolic side-effects in adolescents with bipolar disorder: a randomized double-blind placebo-controlled trial.” Acta Med Iran 52(10): 734-739.



69


3

Pavan, C., V. Vindigni, L. Michelotto, A. Rimessi, G. Abatangelo, R. Cortivo, P. Pinton and B. Zavan (2010). “Weight gain related to treatment with atypical antipsychotics is due to activation of PKC-beta.” Pharmacogenomics J 10(5): 408-417.Paxinos, G. and C. Watson (2007). The rat brain in stereotaxic coordinates. Amsterdam ; Boston ;, Academic Press/Elsevier.

Raskind, M. A. (2007). “Olanzapine-induced weight gain and increased visceral adiposity is blocked by melatonin replacement therapy in rats.” Neuropsychopharmacology 32(2): 284-288.

Reppert, S. M., D. R. Weaver, S. A. Rivkees and E. G. Stopa (1988). “Putative melatonin receptors in a human biological clock.” Science 242(4875): 78-81.

Robertson, G. S. and H. C. Fibiger (1996). “Effects of olanzapine on regional C-Fos expression in rat forebrain.” Neuropsychopharmacology 14(2): 105-110.

Romo-Nava, F., D. Alvarez-Icaza Gonzalez, A. Fresan-Orellana, R. Saracco Alvarez, C. Becerra-Palars, J. Moreno, M. P. Ontiveros Uribe, C. Berlanga, G. Heinze and R. M. Buijs (2014). “Melatonin attenuates antipsychotic metabolic effects: an eight-week randomized, double-blind, parallel-group, placebo-controlled clinical trial.” Bipolar Disord 16(4): 410-421.Rummel-Kluge, C., K. Komossa, S. Schwarz, H. Hunger, F. Schmid, C. A. Lobos, W. Kissling, J. M. Davis and S. Leucht (2010). “Head-to-head comparisons of metabolic side effects of second generation antipsychotics in the treatment of schizophrenia: a systematic review and meta-analysis.” Schizophr Res 123(2-3): 225-233.

Sebens, J. B., T. Koch, G. J. Ter Horst and J. Korf (1998). “Olanzapine-induced Fos expression in the rat forebrain; cross-tolerance with haloperidol and clozapine.” Eur J Pharmacol 353(1): 13-21.

Suzuki, Y., H. Shimizu, N. Ishizuka, N. Kubota, T. Kubota, A. Senoo, H. Kageyama, T. Osaka, S. Hirako, H. J. Kim, A. Matsumoto, S. Shioda, M. Mori, T. Kadowaki and S. Inoue (2014). “Vagal hyperactivity due to ventromedial hypothalamic lesions increases adiponectin production and release.” Diabetes 63(5): 1637-1648.

Szewczyk-Golec, K., A. Wozniak and R. J. Reiter (2015). “Inter-relationships of the chronobiotic, melatonin, with leptin and adiponectin: implications for obesity.” J Pineal Res 59(3): 277-291.

Takeda, N. and K. Maemura (2016). “Circadian clock and the onset of cardiovascular events.” Hypertens Res.

Togo, T., K. Kojima, M. Shoji, A. Kase, H. Uchikado, O. Katsuse, E. Iseki and K. Kosaka (2004). “Serum adiponectin concentrations during treatment with olanzapine or risperidone: a pilot study.” Int Clin Psychopharmacol 19(1): 37-40.

Towbin, H., T. Staehelin and J. Gordon (1979). “Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications.” Proc Natl Acad Sci U S A 76(9): 4350-4354.



70

Chapter 3

Vancampfort, D., K. Vansteelandt, C. U. Correll, A. J. Mitchell, A. De Herdt, P. Sienaert, M. Probst and M. De Hert (2013). “Metabolic syndrome and metabolic abnormalities in bipolar disorder: a meta-analysis of prevalence rates and moderators.” Am J Psychiatry 170(3): 265-274.

Vidarsdottir, S., J. E. de Leeuw van Weenen, M. Frolich, F. Roelfsema, J. A. Romijn and H. Pijl (2010). “Effects of olanzapine and haloperidol on the metabolic status of healthy men.” J Clin Endocrinol Metab 95(1): 118-125.

Vidarsdottir, S., F. Roelfsema, M. Frolich and H. Pijl (2009). “Olanzapine shifts the temporal relationship between the daily acrophase of serum prolactin and cortisol concentrations rhythm in healthy men.” Psychoneuroendocrinology 34(5): 705-712.

Weaver, D. R., J. H. Stehle, E. G. Stopa and S. M. Reppert (1993). “Melatonin receptors in human hypothalamus and pituitary: implications for circadian and reproductive responses to melatonin.” J Clin Endocrinol Metab 76(2): 295-301.

Westman, J., J. Hallgren, K. Wahlbeck, D. Erlinge, L. Alfredsson and U. Osby (2013). “Cardiovascular mortality in bipolar disorder: a population-based cohort study in Sweden.” BMJ Open 3(4).

Weston-Green, K., X. F. Huang and C. Deng (2012). “Alterations to melanocortinergic, GABAergic and cannabinoid neurotransmission associated with olanzapine-induced weight gain.” PLoS One 7(3): e33548.



71


3



72

Chapter 3

Supplementary Data

Figure S1. Experimental settings.

Figure S2. Olanzapine induces activation of pre-autonomic neurons in the PVN that receive input from the SCN and project to the DMV. A representative microphotograph shows co-localization of c-Fos (black nuclei)/CtB (red-brown cytoplasm) in the ventral parvocellular PVN (A). Representative microphotograph shows pre-autonomic neurons IR to c-Fos (black nuclei) in the ventral parvocellular PVN after olanzapine injection and retrogradely fi lled with CtB (red-brown cytoplasm) that receive VIP input (dark projections) from the SCN (B).Immunohistochemical confi rmation of CtB injection in the DMV complex 14 days after injection (C). Scale bar is 100μm.



73


3A B

Figure S3. Functional and histological confi rmation of bilateral SCN lesion. Actigraphic confi rmation for arrhythmicity

after SCN lesion (A). VIP immunohystochemical confi rmation of bilateral SCN lesion (B).

Figure S4. Melatonin does not modify olanzapine

induction of c-Fos in the nucleus of the tractus

solitarius (NTS). Bars represent the mean ± SEM

count for c-Fos IR nuclei in the NTS. For representative

microphotographs refer to Fig. 2. One-way ANOVA

(F=10.75, df=3, p<0.0001). Bonferroni´s post hoc test pair

wise comparisons; *p<0.01; *** p<0.0001.



74

Chapter 3

Figure S5. A hypothesis for SGA induced cardiometabolic effects and their prevention by melatonin. The SCN

prepares the body to function according to activity/rest periods by signaling via the PVN to the autonomic nervous system (ANS).

The ANS functions using two antagonistic branches; the sympathetic nervous system (fi ght, fright and fl ight), with motor neurons in

the intermediolateral column (IML); and the parasympathetic nervous system (PNS) (rest & digest), with outputs in the dorsal motor

nucleus of the vagus (DMV) 12,14,15. Olanzapine disrupts this balance by SCN activation at a time point in which it is normally

inactive and thus decreases the production of endogenous melatonin 17. Olanzapine could induce an increase in c-Fos by inactivating

the GSK-3ẞ and thus activating CREB; which facilitates c-Fos transcription 41-44. Melatonin counteracts this by GSK-3ẞ activation

and consequent CREB inhibition, which prevents c-Fos transcription 48-49.(A) An activated SCN by olanzapine signals to the pre-

autonomic neurons in the PVN and increases the parasympathetic activity via the DMV; inducing a decrease in blood pressure.(B) The

administration of melatonin prevents these effects by inhibiting the activation of the SCN (C). The autonomic effects of olanzapine

are time-dependent; acutely (gray vertical background rectangle) it induces parasympathetic activity, increasing adiponectin levels and

decreasing blood pressure 5,6,50. Chronically, olanzapine then favors weight increase and generates an autonomic countermeasure

resulting in the observed increased sympathetic activity, that results in blood pressure increase and decreased adiponectin levels

4,8,52.(D) The co-administration of melatonin would prevent this change acutely (gray vertical rectangle) and chronically mitigating

olanzapine-induced adverse cardiometabolic effects 18-20. (E) Arrows indicate activation; capped lines indicate inhibition; width and

font size indicate magnitude. In (A), (B) and (C) small squares illustrate circadian activity divided in day (white) and night (gray); Black

lines (endogenous melatonin); Green lines (exogenous melatonin + olanzapine); Blue lines (olanzapine). Black dots inside the schematic

nuclei illustrate neuronal activity according to c-Fos IR.



75


3

Table S1. Co-localization of c-Fos and CtB in the PVN.

* p<0.0001: Mean Parvocellular vs. Magnocellular Chi-square test.

Dose MAP Δ MAP TtB AUCInjection BPVN Region CtB c-Fos CtB & cFos (CtB & c-Fos)/CtB Mean(SD) Mean(SD) Mean(SD) %Ventral parvocellular 25.8(17.8) 23.0(5.1) 10.5 (6.4) 43.2Medial parvocellular 13.5 (10.2) 12.5 (1.9) 4.0 (2.7) 37.0Dorsal parvocellular 4.8 (4.1) 4.5 (3.5) 1.0 (0.8) 31.5Mean parvocellular 14.6 (9.8) 13.3 (0.4) 5.1 (3.0) 37.2 *Magnocellular 6.8 (7.8) 17.8 (17.4) 1.3 (2.8) 14.7



Chapter 4



CHAPTER 4

The NPY intergeniculate leaflet projections to the Suprachiasmatic nucleus transmit metabolic conditions.

Saderi NCazarez-Márquez FBuijs FNSalgado-Delgado RCGuzman-Ruiz MAdel Carmen Basualdo MEscobar CBuijs RM.

Neuroscience. 29;246:291-300. (2013)



78

Chapter 4

AbstractThe Intergeniculate leaflet (IGL) is classically known as the area of the Thalamic Lateral Geniculate Complex providing the suprachiasmatic nucleus (SCN) non-photic information. In the present study we investigated whether this information might be related to the metabolic state of the animal. The following groups of male Wistar rats were used for analysis of NPY and c-Fos in the IGL and SCN. 1. Fed ad libitum. 2. Fasted for 48 hours. 3. fasted for 48 hours followed by refeeding for 3 hours. 4. monosodium glutamate-lesioned and 48h-fasted. 5. Electrolytic lesion in the IGL and 48h-fasted. The results were quantified by optical densitometry. Neuronal tracers were injected in two brain areas that receive metabolic information from the periphery, the Arcuate Nucleus and Nucleus of the Tractus Solitarius to investigate whether there is an anatomical relationship with the IGL. Lesion studies showed the IGL, and not the ARC, as origin of most NPY projections to the SCN. Fasting induced important changes in the NPY expression in the IGL, coinciding with similar changes of NPY/GAD projections of the IGL to the SCN. These changes revealed that the IGL is involved in the transmission of metabolic information to the SCN. In fasted animals IGL lesion resulted in a significant increase of c-Fos in the SCN as compared to intact fasted animals demonstrating the inhibitory influence of the IGL to the SCN in fasting conditions. When the animal after fasting was refed, an increase of c-Fos in the SCN indicated a removal of this inhibitory input. Together these observations show that in addition to increased inhibitory IGL input during fasting, the negative metabolic condition also results in increased excitatory input to the SCN via other pathways. Consequently the present observations show that at least part of the non-photic input to the SCN, arising from the IGL contains information about metabolic conditions.



79

NPY IGL projections to SCN transmit metabolic conditions

4

IntroductionThe Suprachiasmatic Nucleus (SCN) controls the phase of body physiology, mainly by imposing activity-resting cycles that are facilitated by time organized autonomic and hormonal changes (Buijs&Kalsbeek, 2001; Dibner et al, 2010). Several studies indicated that in order to execute a correct temporal organization of these behavioral and physiological functions the SCN needs to integrate the physiological state of the body (Hastings et al, 1997; Yannielli & Harrington, 2004). Several areas in the hypothalamus, forebrain and hindbrain up to the Raphe nuclei provide the SCN with “non-photic” information. Up till now very little is known about the functional meaning of this input, with exception of the input arising from the Intergeniculate Leaflet (IGL) Dorsal Raphe (DR) and Arcuate nucleus (ARC). While IGL and DR provide the SCN with information about activity (Janik & Mrososvsky, 1994, Kuroda et al, 1997) the ARC is proposed to provide the SCN metabolic information (Yi et al, 2006). On the basis of previous studies which demonstrated that phase advances induced by time and caloric feeding restriction are appreciably decreased in IGL-lesioned rats (Challet et al, 1996), we investigated whether in addition to the ARC, the IGL may also provide metabolic related information to the SCN. Our results showed that food deprivation up-regulates NPY expression in the IGL and increases NPY innervation density in the SCN. Lesion studies performed either in the ARC or in the IGL of fasted rats, attested that the NPY augmentation is dependent on IGL projections to the SCN. The increase in the number of c-Fos expressing cells in the SCN during refeeding suggests that food access removes a negative control on SCN neuronal activity and the concomitant decrease of NPY in the IGL suggests the direct involvement of the IGL in this process.

Materials and MethodsFood availability experiments (immunohistochemistry). Male Wistar rats, weighing 250-300g, were housed in a 12:12 light-dark cycle (light-on at 7:00 am) with free access to food and water, during one week previous to the beginning of the experimental procedures. Experiments were approved by the committee for ethical evaluation at the Universidad Nacional Autónoma de México, in strict accordance with the Mexican norms for animal handling, Norma Oficial Mexicana NOM-062-ZOO-1999.On the first day of the experiment, rats were randomly assigned to one of the following groups: 5 were fed ad libitum (CTR group); 5 were fasted for 48 hours (FST group) starting at ZT10; 5 were fasted for 48 hours starting at ZT7; then refed for 3 hours.All Animals were sacrificed at ZT10 of the third day of the experiment by intracardial perfusion with 4% paraformaldheyde (Sigma –Aldrich Corp., San Luis, MO, USA) in phosphate buffer (0.01M, ph7.6) preceded by deep anesthesia with an overdose of sodium pentobarbital (Sedalpharma, Pet’s Pharma, Mexico; 50mg/kg). Brains were dissected, post-fixed by immersion in 4% paraformaldheyde for 24h and cryoprotected in Phosphate Buffer



80

Chapter 4

Saline (PBS, 0.01M, ph7.6) containing 30% sucrose and 0.04% NaN3 until sectioning. The hypothalami were cut in sections of 40 μm, and each third section was used for immunohistochemical procedures. Sections of the SCN and the IGL were incubated with either rabbit-NPY (Buijs et al, 1989) or rabbit-c-Fos (Calbiochem, EMD Biosciences, INC. La Jolla, CA, USA antibodies). NPY and c-Fos antibodies diluted in Triphosphate Buffer Saline (TBS, 0.01M, ph7.6) added with 0.5% Triton X-100 (Sigma –Aldrich) and 0.25 % gelatin (Merck KGaA, Damstadt, Germany) 1:4000 and 1:10000, respectively. Sections were incubated at room temperature for 1h and then at 4°C overnight. After rinsing, sections were incubated in biotinylated donkey-anti rabbit secondary antibody (Jackson Immunoresearch, West Grove, PO, USA; 1:400) for 1.5h and then in an avidin-biotin complex (Vector, Burlingame, CA, USA, 1:500) solution. The final reaction was performed with a solution of 0.025% 3,3’-diaminobenzidine (DAB) and 0.01% H2O2 100 (Sigma–Aldrich) in TBS, for 10 minutes. For c-Fos staining, 10% NiNH4SO4 was also added to this solution. Sections were mounted on gelatinized slides, dried, dehydrated with graded solutions of ethanol, soaked in xylene, and finally cover slipped in Entellan embedding agent (Merck).

Food availability experiments (in situ hybridization). This part of the study followed an identical procedure to the protocol in 2.1. 12 Male Wistar rats, weighing 250-300g, were randomly divided in 3 groups: the control group was fed ad libitum for all the time of the experiments (CTR); the fasted group was food-deprived for 48h (FST); and the 3-hours re-fed group was fasted for 48h and then re-fed for 3 hours (3h-RF). Brains were dissected and postfixed in 4% paraformaldehyde in PBS for 12h at 4 °C, and this was followed by cryoprotection in 30% diethyl pyrocarbonate-treated sucrose in PBS at 4 °C. Brains were frozen and sectioned with a cryostat (16 μm). Sections were dried at room temperature for 2 h before overnight incubation at 65 °C in hybridization buffer [1 × diethyl pyrocarbonate-treated ‘salts’ (200 mmNaCl, 5 mm EDTA, 10 mmTris, pH 7.5, 5 mm NaH2PO4.2H2O, 5 mm Na2HPO4); 50% deionized formamide; 1 × Denhardts (RNase/DNase-free; Invitrogen Corporation, Carlsbad, CA, USA); 10% dextran sulphate (Sigma–Aldrich )] containing 400 ng/mL digoxigenin-labelled RNA probes purified in Sephadex G-50 columns. Sense and antisense probes were generated by linearization or excision of plasmids with appropriate enzymes, and purified using QIAquick PCR Purification Kit (QIAGEN Inc., Valencia, CA, USA). Primers were synthesized by Sigma: sense 5´ TATCCCTGCTCGTGTGTTTG 3´; antisense 5´ AGGCAGACTGGTTTCACAGG 3’.The hybridization solution consisted of 50% formamide, 2 × sodium phosphate, sodium chloride and EDTA (SSPE), 1 μg/μl bovine serum albumin (BSA), 1 μg/μl poly A, 2 μg/μl tRNA in diethyl pyrocarbonate (DEPC)-treated water). Following hybridization, sections were washed three times in wash solution (50% formamide, 1 × saline citrate, 0.1% Tween-20) at 65 °C and twice at room temperature in 1 × MABT (20 mM maleic acid, 30 mMNaCl, 0.1% Tween-20) before being incubated in blocking solution [1% blocking reagent (Roche Applied Science, Burgess Hill, UK)] and



81


4

then overnight in alkaline phosphatase-conjugated anti-digoxigenin antibody (1: 1500; Roche). BM purple AP substrate precipitating (Roche) with 1 mMLevamisole (Roche) was used for colorimetric detection at 37 °C for 8–20 h. Sections were mounted with Glycerol (Sigma).

Lesion studies. Bilateral electrolytic lesion was used to ablate the IGL in 8 rats. Before surgery, animals were anesthetized with a mix of Ketamine (Anesket, PiSA, Mexico, 6mg/Kg) and Xylazine (Procin, PiSA, Mexico; 2mg/Kg), and placed in a standard stereotaxic apparatus with the tooth bar set at -3.5 mm. The electrode was placed bilateral at coordinates: 45mm caudal to the bregma, 52mm lateral from the midline and 52mm deep from the brain surface. After 2 weeks of recovery from the surgery (during which food intake, body weight and locomotor activity were monitored), animals were fasted and sacrificed as in the food availability experiments, and the sections processed to evaluate NPY immunoreactivity in the SCN.Additionally monosodium glutamate (MSG; Sigma –Aldrich; 5mg/ml) was used to lesion the ARC of 10 newborn rats within 10 days of life. Considering the birth-day as Post-Natal day 0 (PN=0), pups were injected with MSG 2mg/Kg on PN-1 and on PN-3, and with MSG 4mg/Kg at PN-5, PN-7 and PN-9 postnatal days. Animals were housed in colony rooms under standard conditions, together with 4 vehicle (saline) injected control rats. After three months, animals were fasted for 48-h, sacrificed and SCN sections processed for NPY previously indicated.

Tracing studies. Projections to and from from the IGL. The antero and retrograde tracer Cholera Toxin B (CTB) 0.5% conjugated either with the Alexa Fluor-555or Alexa-488 fluorescent dyes (Molecular Probes, Eugene, OR, USA), was injected 0.01ul in the IGL of 10 rats with a micro syringe. The surgery methods and the coordinates of the injections were the same as reported for the IGL lesion. After 10 days of recovery, animals were sacrificed and sections of the IGL and SCN were incubated with rabbit NPY antibody followed by a secondary fluorescent antibody conjugated with Cy-2TM (Jackson Immunoresearch, West Grove, PO, USA). Four brains, in which the tracer was co-localized with NPY in the SCN, were considered to have received a correct injection. These brains were used to determine the presence of retrograde labeled cell bodies in the ARC and NTS as two main areas receiving metabolic information.IGL innervation from the ARC and the NTS. The anterograde tracer Phaseolus Vulgaris (PhaL) (Vector Elite) was unilaterally injected in the ARC of 15 rats by iontophoresis. The injections were performed using a glass micro electrode with a tip of 20um. Alternate current of 6.8μA was allowed to pass for 10 minutes. The stereotaxic coordinates for the ARC injection were: 3.3mm caudal from the bregma; 1.0mm lateral from the midline; 9.8mm deep from the surface of the brain, with an inclination of 4º degrees and the teeth bar set at -3.4mm. A week after the surgery, animals were perfused and the brains



82

Chapter 4

processed as in the previous experiment. A first DAB/peroxide immunohistochemisty with a rabbit anti-PhaL antibody (1:1000; Vector Elite) was performed to test the accuracy of the injection. 6 brains from PhaL–injected animals were considered to display the correct injection and used to analyze the projection from the ARC to the IGL. After anesthesia, rats were placed in a David Kopf stereotact with the head fixed at 45°. The dura and arachnoid membranes were dissected to expose the dorsal surface of the medulla at the level of the area postrema. The rat’s head was placed such that the micropipette aligned perpendicular to the medulla oblongata. Injections into the Nucleus Tractus Solitarius were made with 0.05μl, 1% Cholera toxin B (CTB) using a glass micropipette with a 20- to 40-μm tip diameter. Because, in contrast to CtB, fluorophore-labeled CTB cannot be applied by iontophoresis, we used pressure injection (10 mbar, 5 sec). Thus, fluorophore-conjugated CTB (with Alexa Fluor 555, Molecular Probes); CTB will be used in the text as the abbreviation of CTB-Alexa Fluor 555 for convenience. After 10 days of recovery, animals were sacrificed and precision of the injection confirmed by mean of an epifluorescence microscope. 5 of CTB- injected animals received a correct injection. In order to visualize projections from the area of the NTS, IGL sections from these brains were incubated with rabbit CTB (Sigma–Aldrich Corp) and the staining developed with 0.025% DAB, 0.01% H2O2 and 10% NiNH4SO4 in TBS. To enhance the intensity of the staining in fibers, before being immersed in the last solution, sections were treated with a solution of biotinilated tyramine for 1 h, followed by another hour of incubation with the avidin-biotin complex. Since NPY is a marker for the IGL, a sheep NPY (1:8000; Chemicon International) immuno staining was performed to help to localize CTB-containing projections to the IGL.

Histochemical analysis. Digital pictures of DAB/H2O2/NiNH4SO4and NPY mRNA stained sections were taken by using an Axioplan microscope (Zeiss, Jena, Germany) equipped with a digital color photocamera (Olympus DP25, Olympus, Japan). To quantify NPY and c-Fos, 8 sections from each brain were analyzed bilaterally, and the number of NPY and c-Fos positive cells and the optical density of the NPY in the SCN and the IGL were quantified with the program ImageJ. For optical density measurements the background was subtracted from the positive staining.Sections stained with fluorescent dyes were analyzed with the LSM 5 Pascal confocal microscope and the LSM software (Zeiss, Jena, Germany).Quantitative data are expressed as mean +/- the standard error from the mean (SEM). Results were analyzed with a one-way ANOVA followed by a Tukey multiple comparisons post hoc test. P-values of <0.05 were considered statistically significant.



83


4

ResultsEffect of food deprivation and re-feeding on NPY in the IGL. In the IGL both NPY-IR, indicated by integrated optical density, and the number of NPY-positive cells were increased after a period of 48-h of fasting with respect to control animals (for optical density: F(2,9)= 57.11, p<0.001; for NPY cells: F(2,9)=75.44, p<0.001) (fi g.1-A and B). After refeeding, the NPY optical density returned to basal levels, whereas the number of NPY positive cells showed a signifi cant decrease in comparison to both control (F(1,6) =7.82, p<0.05) and fasted (F(1,6) =22.08, p<0.05) groups. In addition, IGL NPY mRNA was up-regulated by food deprivation (F(1,4) =11.08, p<0.05), demonstrating an enhanced activity of NPY neurons in the IGL under anabolic conditions similar as occurs in the ARC (fi g. 2-A and B). The number of c-Fos positive cells in the IGL was also signifi cantly increased by fasting and 3h-refeeding (F(2,9) = 88.92., p<0.001as compared to the control) (fi g.3-A and B), however no c-Fos could be detected in IGL NPY neurons indicating that the increase of activity is in another set of IGL neurons(fi g.3-A).

Figure 1. Fasting increases NPY-IR in the IGL. Comparison of NPY immunoreactivity (IR) in the IGL of free fed, fasted and refed

rats. (A) Photomicrographs of the IGL in the different conditions. Scale bar = 200 μm. (B) Quantifi cation of NPY-IR as integrated

optical density (on the left) and number of positive cells (on the right). Both optical density (p=0.04) and number of NPY cells (p=0.035)

are increased after 48h of fasting. The number of NPY positive cells is signifi cantly decreased by refeeding (p=0.046).



84

Chapter 4

Figure 2. Fasting up regulates NPY-mRNA in the IGL. (A) Photomicrographs of the IGL of control and fasted rats (scale bar =

80 μm) and (B) quantifi cation integrate optical density of NPY mRNA showing that NPY expression is up-regulated by fasting (p=0.02).

Figure 3. Fasting activates IGL neurons. C-Fos (black nuclei), as NPY (brown cells), is increased in the IGL of fasted rats, as

indicated by (A) photomicrographs of the IGL (scale bar = 80 μm) and (B) quantifi cation of c-Fos-expressing cells (p=0.001).

Effect of food deprivation and re-feeding on the SCN. NPY positive fi bers were strongly increased in the vl-SCN of fasted rats in comparison to controls, this increase disappeared after refeeding(F(2,9)= 6.97, p=0.01) (fi g.4-A and B).In the SCN, c-Fos expression was not affected by fasting, but it was increased by re-feeding and by IGL lesion followed by fasting (F(3,10)= 73.03, p<0.001) (fi g.5). Importantly, changes in c-Fos activations were particularly appreciable in the vl-SCN, where c-Fos immunoreactivity was enhanced by re-feeding in intact animals and by fasting in IGL-lesioned animals (F(3,10)= 11.16, p= 0.001)



85


4

Figure 4. Fasting increases NPY-IR in the SCN. Comparison of NPY immunoreactivity (IR) in the SCN of free fed, fasted and refed

rats. (A) Photomicrographs of the SCN in the different conditions. Scale bar = 300 μm. (B) Quantifi cation of NPY-IR as integrate optical

density showing that NPY-IR is increased after 48h of fasting (p=0.035).

Figure 5 .Re-feeding induces cFos activation in the SCN in response to food availability. (A) Photomicrographs of the

SCN of free fed, fasted and refed rats. Scale bar = 200 μm. (B) Quantifi cation of c-Fos-IR indicates that the number of positive cells is

increased (p=0.026) by refeeding. Note that in the ventrolateral SCN (vl-SCN) c-Fos shows a slight tendency to decrease after a period

of fasting and it is signifi cantly increased by refeeding (p = 0.032).

NPY in the SCN arises from the IGL. In order to determine the origin of the NPY increase in the SCN of fasting rats, either the IGL or the ARC were lesioned and animals were food-deprived for 48-h. The comparison of NPY-IR in lesioned and fasted rats showed that NPY virtually disappeared in the SCN after IGL-lesion, while after ARC lesion the NPY increase after the period of fasting is not affected (F(2,7)= 44.53, p<0.001) fi g.6-A and B).The neuronal tracer CTB applied in the IGL to determine the nature of these projections, demonstrated that IGL-projection to the vl-SCN contain NPY and the intensity of the NPY staining was notably enhanced by fasting (fi g.7 and 8).



86

Chapter 4

Figure 6. Effect of IGL and ARC lesion on fasting-induced NPY increase in the ventrolateral SCN. (A) NPY-IR indicate

that ablation of the IGL virtually eliminates NPY projections to the SCN, even after a period of fasting, whereas ARC lesion does not

affect NPY response to food deprivation. Scale bar = 200 μm. (B) Quantifi cation of NPY optical density showing the strong decrease of

NPY-IR in fasted but IGL-lesioned rats (p= 0.0001).

Figure 8. NPY and GABA-IR in the SCN is decreased after re-feeding. Confocal laser scanning image of SNC of control, fasted

and refed animals, stained for NPY (green) and GAD-67 (GABA) (red), indicate that NPY is increased by fasting, whereas both NPY and

GABA are decreased after re-feeding. Scale bar = 70 μm.

Figure 7. Confocal laser scanning image of CTB (red)

containing IGL projections to the ventrolateral SCN,

showing that they contain NPY (green). The co-localization

between the tracer and NPY (yellow) attests the accuracy of CTB

injection in the IGL. Only such injections were used to evaluate

the areas where retrograde neurons appeared (see fi gure 9) Scale

bar = 200 μm.



87


4

The Nucleus Gracilis and NTS project to the IGL. Injection of the anterograde tracer PhaL into the ARC did not result in any occasion (n=5)in labeling of fi bers in the IGL while with the same successful ARC injections clear innervation of e.g. PVN, DMH and PVT was visible. Injections into the NTS, however, revealed clear innervation of the IGL area (fi g.9-A). Placement of the anterograde and retrograde tracer CTB into the IGL that revealed dense innervation of the SCN (Fig.7) confi rming the accuracy of the injections into the IGL area; showed few cell bodies within the NTS whereas most of the IGL projecting neurons were found in the Nucleus Gracilis (fi g.9-B).

Figure 9.The NTS and the Nucleus Gracilis project to the IGL.(A) Anterograde tracing from the Dorsovagal Area showed

CTB fi bers (red) apposing on NPY neurons (green) of the IGL. Scale bar = 25 μm. (B) Reproduction at higher magnifi cation of the area

included in the white square of the panel A. Scale bar = 17 μm. (C) Retrograde tracing from the IGL (see also fi gure 7) showed high

density of CTB – containing neurons in the Nucleus Gracilis (Gr) and in the Raphe Obscurus (ROb), and few positive neurons in the

Nucleus of the Tractus Solitarius (NTS) and Area Postrema (AP). Scale bar = 200 μm.



88

Chapter 4

DiscussionThe present study demonstrates that the metabolic condition induces important changes in the NPY expression in the IGL, coinciding with similar changes in the NPY projections of the IGL to the SCN. These changes revealed that the IGL is involved in the transmission of metabolic information to the SCN. In fasted animals lesioning the IGL resulted in a significant increase of c-Fos in the SCN as compared to intact fasted animals, demonstrating the inhibitory influence of the IGL to the SCN in fasting conditions. This inhibitory input also became visible after fasting when the animal was refed because then the increase of c-Fos revealed a removal of this inhibitory input. Together these observations show that in addition to the increased inhibitory IGL input during fasting, this negative metabolic condition also results in an increase of excitatory input to the SCN via other pathways. Consequently the present observations show that at least part of the non-photic input to the SCN, arising from the IGL contains information about the metabolic condition. NPY is one of the most widely expressed neuropeptides in the brain (Adrian et al, 1983;Gehlert et al, 1987, Chromwall & Zukiwska, 2004), the vast majority of the reports relates to the NPY involvement in energy homeostasis, whereas only a minor part is focused on NPY in relation with the synchronization of the SCN or on other functions (Soscia & Harrington, 2005; Harrington et al, 2007; Kim & Harrington, 2008). The present paper brings these observations together and demonstrated that the IGL transmits metabolic information to the SCN. It is very well possible that the transmission of this signal of negative metabolic condition to the SCN facilitates arousal as suggested by (Harrington ME, 1997, Allen & Morin, 2006).After all, a stronger inhibition of neuronal activity of the SCN during the day period would in theory result in an animal that is more prone to show behavioral activity since an active SCN promotes inactivity.

The IGL as a relay for metabolic information to the Suprachiasmatic Nucleus. In 2006 Yi et. al. showed that AgRP neurons of the ARC, which co-express NPY, project to the SCN. These cells are activated by ghrelin, a hormone released by the stomach in time of fasting, demonstrating a neuronal signal to the SCN driven by endocrine input to the ARC (Yi et al, 2006). Our present results show that, it is not the ARC but the IGL which is the main source of NPY innervation in the SCN suggesting that there are two modalities by which NPY neurons may inform the SCN about the metabolic status, one mediated by the ARC possibly by AgRP as neurotransmitter rather than by NPY and another one, anatomically dominant, via the IGL and both inhibitory to the SCN under fasting conditions. Since the IGL area is characterized by a dense net of vascular capillaries with a thin endothelium in contact with neuronal elements (Moore & Card, 1994), it has been proposed that a modified blood brain barrier exists in this area (Harrington ME, 1997). Although it is well known that the permeability of the blood brain barrier is increased at very low glucose



89


4

levels (Oztaşet al, 1985; Gulturk 2010), in literature there is no information that confirms that blood borne signals might have access to the IGL through the vascular endothelium. In addition our present results do not show any significant direct input to the IGL from the ARC or NTS, which are known to receive respectively endocrine or neural feedback from the periphery about satiety, energy supply and fat depot (Schwartz et al 2000). This warrants the question from where the IGL could receive its metabolic information. The IGL may receive metabolic information in a more indirect way via the Lateral Parabrachial Nucleus (PBN) in the midbrain (Horowitz et al, 2004) or from the Lateral Hypothalamus (LH) (Mintz et al, 2001). In addition the LH is also in reciprocal connection with the ARC, and neuropeptides expressed in these nuclei compete for the control of energy balance (Gao& Horvath, 2007). Recently, Pekala et al. showed that LH projections excite a subpopulation of orexin-sensitive IGL neurons, which include IGL NPY cells (Pekala et al, 2011). Thus, the PBN-LH-IGL axis appears to be a good candidate for the translation of the metabolic input arising from the NTS and ARC into an adaptive circadian response. The other possibility would be the direct projection from the NTS and from the nucleus Gracilis.

IGL receives projections from the Nucleus Gracilis. In addition to confirming the expected connection based on the anterograde tracing with the NTS, the retrograde tracing from the IGL showed the majority of retrogradely labeled neurons in the Nucleus Gracilis. The Nucleus Gracilis receives ascending fibers from the sensory layers of the dorsal horn that relay mainly visceral pain and inflammatory information as well as non-noxious stimuli such as the distension of abdominal viscera, temperature and baro reception (Newman PP, 1974; Simon & Schramm, 1984; Berkley &Hubscher, 1995; Al-Chaer 1996). In spite of this information the role of the Gracilis in integrating a wide range of the viscerosensory input with proprioceptive and muscular information, remains elusive (El-Chaer et al, 1997). The present study shows that neurons of the Nucleus Gracilis are projecting to the IGL, whether they indeed transmit visceral sensory information to the IGL remains to be determined. There are two studies that support the IGL sensitivity to somato sensory stimulation. First, electrical stimulation of the rat tail enhances the response of the Geniculate Complex to light input and increases serotonergic innervation (Davidowa & Albrecht, 1992). Second, binding sites for the sensory neuropeptide Calcitonin Gene Related Peptide (CGRP) are expressed in the Geniculate Complex (Skofitsch & Jacobowitz, 1985). It has been proposed that visceral information to the IGL might represent an arousal stimulus that participates to the modulation of circadian rhythms (Davidowa & Albrecht, 1992). The present results indicate that the metabolic condition might be a participating signal in this pathway. The observation of Kreier et al (2006) that the Gracilis receives sensory neuronal input from white adipose tissue suggests that possibly a shrinking energy supply might be part of the signals received by the Gracilis. The anterograde tracing in the IGL may not only be explained by the presence of a few retrogradely neurons in the NTS that project to the IGL, but also by the fact that the needle tract for the injection into the NTS passes through



90

Chapter 4

the Gracilis. Thus leakage of CTB into the Gracilis might also be partly responsible for the observed fibers. Hence the necessity to always demonstrate the presence of projections by the confirmation of cell bodies in the same area that gives rise to the projection.

Is food deprivation a non-photic stimulus? According to literature, a non-photic stimulus induces phase changes in SCN activity when applied during the subjective day (Mrosovsky 1988, Reebs&Mrosovsky 1989, Mead 1992, Maywood 1999, Yokota 2000, Maywood &Mrosovsky 2002) and interferes with the effects of light pulses given during the subjective night (Mrosovsky& Salmon, 1987, Ralph &Mrosovsky 1992, Mistelberger&Antle 1998). The effect of non-photic stimulation during the subjective day is mediated by NPY projection from the IGL, as suggested by a number of lesion and pharmacological studies performed over 20 years (Johnson et al, 1988; Janik & Mrosovsky, 1994; Wickland&Turek, 1994; Biello et al, 1994; Weber & Rea, 1997; Lall&Biello, 2002; Harrington &Schak, 2000) and finally demonstrated by Glass et al (2010). NPY antagonizes the retinal glutamatergic transmission, provoking a situation of conflict with light (Yannielli & Harrington 2001;Lall&Biello, 2003;Yannielli et al, 2004), suggesting an inhibitory role for NPY in the vl-SCN. According to the present set of data, together with the effect of time-caloric restriction of SCN activity (Challet et al, 1996), our results suggest that fasting provides a non-photic input to the SCN via the IGL in which the increased NPY activity may provide an increased inhibitory input to the IGL.

Re-feeding increases c-Fos in both the IGL and SCN. Consistently with a decrease in NPY-IR in the vl-SCN, we found an increase of c-Fos expression in the same area in re-fed animals in comparison to control and fasted groups. This demonstrates that in addition to fasting, refeeding is also an important signal for the SCN arising from the IGL. Consequently both fasting and feeding signals may contribute as non-photic signals the IGL message to the SCN. A significant augmentation of c-Fos activity also occurs in the IGL of the same rats, although it does not involve the NPY neurons. This suggests that another population of IGL neurons, different from NPY cells, receives information about satiety and inhibits NPY activity. Such intra-IGL inhibitory circuitry has been demonstrated by Glass et al in 2010. They showed that activation of the GABA IGL interneurons results in the suppression of NPY neuronal activity (Glass et al, 2010). The sequence of events that we described resembles the physiological changes that take place in the SCN during and after the dark-light transition, when an active well-fed animal turns into his rest phase. In fact, following light onset, the decrease of NPY levels in the SCN is accompanied by a progressive increase in c-Fos activation (Earnest et al, 1990; Schwartz et al, 1994). Thus under normal conditions these two mechanisms may support each other keeping the animal at rest. The present data show that fasting interferes with the normal NPY cycle in the SCN, by advancing and increasing the magnitude of the physiological NPY levels at ZT10. The relief from this inhibitory effect on the SCN caused



91


4

by re-feeding triggers the activation response as indicated by the c-Fos expressing cells. Hereby it is very important to stress that an IGL lesion, which eliminates NPY containing fibers in the SCN causes a significant increase in the c-Fos activity in the vl-SCN under fasting conditions. Intact animals do not show a change in c-Fos after fasting suggesting that in addition to the inhibitory input from the IGL also an activating input from other areas is present in the SCN. This excitatory input only becomes visible after IGL lesions. This confirms that indeed NPY has an inhibitory control on the vl-SCN resulting in an activation of the SCN after refeeding when the NPYergic tone is decreased. Recently we have obtained evidence that one of the structures that in addition to the retina provides direct excitatory input to the SCN is the NTS (Buijs et al submitted), together with the present observation, this points to the possibility that non-photic input to the SCN may also be excitatory.



92

Chapter 4

Figure 10. Schematic proposal of the metabolic and visceral feedback from the periphery to the SCN. The Vagus nerve

(X) conveys sensory metabolic information from the viscera to the sensory nuclei of the brainstem: the NTS and Gracilis (Gr) (see e.g.

Kreier et al, 2006), which in turn transmit this information to the IGL. Here we demonstrated that food deprivation stimulates NPY

expression in the IGL, and increases the inhibitory tone of NPY and GABA in the ventro lateral regions of the SCN. Additionally, signals

of a negative metabolic status are transmitted to the SCN by (NPY/)AgRP/GABA co-expressing neurons of the ARC (Yi et al, 2006).

ConclusionThe present results provide a first insight in how the body, of which its daily physiological changes are driven by the SCN, has the capacity to signal back to its central clock. Here we show for the first time that the activity of the IGL-SCN axis is importantly changed by the metabolic condition of an animal. Additionally we see that NPY and GABA have a prominent role in transmitting this information from the IGL to the SCN. Consequently the present results demonstrate that the SCN does not depend exclusively on the ARC to obtain information about the metabolic status, but that the IGL can also directly transmit metabolic information that it receives from NTS and Gracilis (see figure 10). This integration of metabolic information within the light receiving portion of the SCN may serve, to better prepare an individual for activity in the rest phase under fasting conditions (Acosta-Galvan et al, 2011), or it may ensure a rest under fed conditions. Other unexplored possibilities are that this feedback to the SCN is also used to adapt its output to the organs of the body in order to regulate the physiology not only according to the day night cycle but also to the energy status of the body. The extreme decrease in temperature under fasting conditions that does not occur in SCN lesioned animals (Liu et al, 2002; Scheer et al, 2005) could be an example of that.



93


4



94

Chapter 4

ReferencesAcosta-Galvan G, Yi CX, van der Vliet J, Jhamandas JH, Panula P, Angeles-Castellanos M, Del Carmen Basualdo M, Escobar C, Buijs RM.(2011) Interaction between hypothalamic dorsomedial nucleus and the suprachiasmatic nucleus determines intensity of food anticipatory behavior.ProcNatlAcadSci U S A. 108(14):5813-8

Adrian TE, Allen JM, Bloom SR, Ghatei MA, Rossor MN, Roberts GW, Crow TJ, Tatemoto K, Polak JM. (1983) Neuropeptide Y distribution in the human brain.Nature.306:584-6.

Al-Chaer ED, Lawand NB, Westlund KN, Willis WD. (1996) Pelvic visceral input into the nucleus gracilis is largely mediated by the postsynaptic dorsal column pathway.J Neurophysiol. 76:2675-90.

Al-Chaer ED, Westlund KN, Willis WD. (1997) Nucleus gracilis: an integrator for visceral and somatic information.J Neurophysiol. 78:521-7.

Berkley KJ, Hubscher CH. (1995) Are there separate central nervous system pathways for touch and pain?Nat Med. 1:766-73.

Biello SM, Janik D, Mrosovsky N. (1994) Neuropeptide Y and behaviorally induced phase shifts.Neuroscience. 62:273-9.

Buijs MR, Pool CW, Van Heerikhuize JJ, Sluiter AA, Van Der Sluis P, et al. (1989) Antibodies to small transmitter molecules and peptides: production and application of antibodies to dopamine, serotonin, GABA, vasopressin, vasoactive intestinal peptide, neuropeptide Y, somatostatin and substance P. Biomedical Research. 10:213–221.

Buijs RM, Kalsbeek A.(2001)Hypothalamic integration of central and peripheral clocks Nat Rev Neurosci.2:521-6.

Challet E, Pévet P, Malan A. (1996) Intergeniculate leaflet lesion and daily rhythms in food-restricted rats fed during daytime.NeurosciLett. 216:214-8.

Chronwall BM, Zukowska Z. (2004) Neuropeptide Y, ubiquitous and elusive.Peptides. 25:359-63.

Davidowa H, Albrecht D. Modulation of visually evoked responses in units of the ventral lateral geniculate nucleus of the rat by somatic stimuli.(1992) Behav Brain Res. 50:27-33.

Dibner C, Schibler U, Albrecht U. (2010) The mammalian circadian timing system: organization and coordination of central and peripheral clocks.Annu Rev Physiol. 72:517-49.

Earnest DJ, Iadarola M, Yeh HH, Olschowka JA. (1990) Photic regulation of c-fos expression in neural components governing the entrainment of circadian rhythms.Exp Neurol.109:353-61.

Gao Q, Horvath TL. (2008) Neuronal control of energy homeostasis.FEBS Lett. 582:132-41.

Gehlert DR, Chronwall BM, Schafer MP, O’Donohue TL. (1987) Localization of neuropeptide Y messenger ribonucleic acid in rat and mouse brain by in situ hybridization.Synapse. 1:25-31.

Glass JD, Guinn J, Kaur G, Francl JM.(2010) On the intrinsic regulation of neuropeptide Y release in the mammalian suprachiasmatic nucleus circadian clock.Eur J Neurosci.31:1117-26.



95


4

Gulturk S, Demirkazik A, Kosar I, Cetin A, Dökmetas HS, Demir T. (2010) Effect of exposure to 50 Hz magnetic field with or without insulin on blood-brain barrier permeability in streptozotocin-induced diabetic rats.Bioelectromagnetics.31:262-9.

Harrington ME. (1997) The ventral lateral geniculate nucleus and the intergeniculate leaflet: interrelated structures in the visual and circadian systems.NeurosciBiobehav Rev. 21:705-27.

Harrington ME, Schak KM. (2000) Neuropeptide Y phase advances the in vitro hamster circadian clock during the subjective day with no effect on phase during the subjective night.Can J PhysiolPharmacol. 78:87-92.

Harrington M, Molyneux P, Soscia S, Prabakar C, McKinley-Brewer J, Lall G. (2007) Behavioral and neurochemical sources of variability of circadian period and phase: studies of circadian rhythms of npy-/- mice.Am J PhysiolRegulIntegr Comp Physiol. 292:1306-14.

Hastings MH, Duffield GE, Ebling FJ, Kidd A, Maywood ES, Schurov I. (1997) Non-photic signalling in the suprachiasmatic nucleus.Biol Cell. 89:495-503.

Horowitz SS, Blanchard JH, Morin LP. (2004) Intergeniculate leaflet and ventral lateral geniculate nucleus afferent connections: An anatomical substrate for functional input from the vestibulo-visuomotor system. 474(2):227-45.

Janik D, Mrosovsky N. (1994) Intergeniculate leaflet lesions and behaviorally-induced shifts of circadian rhythms.Brain Res. 651, 174-82.

Johnson RF, Smale L, Moore RY, Morin LP.(1988) Lateral geniculate lesions block circadian phase-shift responses to a benzodiazepine. ProcNatlAcadSci U S A.85:5301-4.

Jhanwar-Uniyal M, Beck B, Burlet C, Leibowitz SF. (1990) Diurnal rhythm of neuropeptide Y-like immunoreactivity in the suprachiasmatic, arcuate and paraventricular nuclei and other hypothalamic sites.Brain Res. 536:331-4.

Liu S, Chen XM, Yoda T, Nagashima K, Fukuda Y, Kanosue K. (2002) Involvement of the suprachiasmatic nucleus in body temperature modulation by food deprivation in rats.Brain Res.929(1):26-36.

Kim HJ, Harrington ME. (2008) Neuropeptide Y-deficient mice show altered circadian response to simulated natural photoperiod.Brain Res. 1246:96-100.

Kreier F, Kap YS, Mettenleiter TC, Van Heijningen C, Van D, V, Kalsbeek A, Sauerwein HP, Fliers E, Romijn JA, and Buijs RM. (2006) Tracing from fat tissue, liver and pancreas: A neuroanatomical framework for the role of the brain in type 2 diabetes. Endocrinology 147:1140-1147.

Kuroda H, Fukushima M, Nakai M, Katayama T, Murakami N. (1997) Daily wheel running activity modifies the period of free-running rhythm in rats via intergeniculate leaflet.PhysiolBehav. 61:633-7.

Lall GS, Biello SM. (2002) Attenuation of phase shifts to light by activity or neuropeptide Y: a time course study.Brain Res. 957:109-16.



96

Chapter 4

Lall GS, Biello SM. (2003) Attenuation of circadian light induced phase advances and delays by neuropeptide Y and a neuropeptide Y Y1/Y5 receptor agonist.Neuroscience. 119:611-8.

Maywood ES, Mrosovsky N, Field MD, Hastings MH. (1999) Rapid down-regulation of mammalian period genes during behavioral resetting of the circadian clock.ProcNatlAcadSci U S A. 96:15211-6.

Mead S, Ebling FJ, Maywood ES, Humby T, Herbert J, Hastings MH. (1992) Anonphotic stimulus causes instantaneous phase advances of the light-entrainable circadian oscillator of the Syrian hamster but does not induce the expression of c-fos in the suprachiasmatic nuclei.J Neurosci. 12:2516-22.

Mintz EM, van den Pol AN, Casano AA, Albers HE.(2001) Distribution of hypocretin-(orexin) immunoreactivity in the central nervous system of Syrian hamsters (Mesocricetusauratus). J ChemNeuroanat.21(3):225-38.

Mistlberger RE, Antle MC. (1998) Behavioral inhibition of light-induced circadian phase resetting is phase and serotonin dependent.Brain Res. 786:31-8.

Moore RY, Card JP. (1994) Intergeniculate leaflet: an anatomically and functionally distinct subdivision of the lateral geniculate complex.J Comp Neurol. 344:403-30.

Morin LP, Allen CN. (2006) The circadian visual system, 2005.Brain Res Rev. 51:1-60.

Mrosovsky N, Salmon PA. (1987) A behavioural method for accelerating re-entrainment of rhythms to new light-dark cycles.Nature. 330:372-3.

Mrosovsky N. (1998) Phase response curves for social entrainment.J Comp Physiol A. 162: 35-46.

Mrosovsky N, Edelstein K, Hastings MH, Maywood ES.(2001) Cycle of period gene expression in a diurnal mammal (Spermophilustridecemlineatus): implications for nonphotic phase shifting.J Biol Rhythms.16:471-8.

Newman PP. (1974) Visceral afferent functions of the nervous system.MonogrPhysiol Soc. 25:1-273.

Norgren R. (1976) Taste pathways to hypothalamus and amygdala.J Comp Neurol. 166:17-30.

Oztaş B, Küçük M, Sandalci U. (1985) Effect of insulin-induced hypoglycemia on blood-brain barrier permeability.Exp Neurol. 87:129-36.

Pekala D, Blasiak T, Raastad M, Lewandowski MH. (2011) The influence of orexins on the firing rate and pattern of rat intergeniculate leaflet neurons--electrophysiological and immunohistological studies.Eur J Neurosci. 34:1406-18.

Ralph MR, Mrosovsky N. (1992)Behavioral inhibition of circadian responses to light.J Biol Rhythms. 7:353-9.

Reebs SG, Mrosovsky N. (1989) Effects of induced wheel running on the circadian activity rhythms of Syrian hamsters: entrainment and phase response curve.J Biol Rhythms. 4:39-48.

Saper CB, Loewy AD. (1980) Efferent connections of the parabrachial nucleus in the rat.Brain Res.197:291-317.

Scheer FA, Pirovano C, Van Someren EJ, Buijs RM(2005) Environmental light and suprachiasmatic nucleus interact in the regulation of body temperature. 132(2):465-77.



97


4

Schwartz WJ, Takeuchi J, Shannon W, Davis EM, Aronin N. (1994) Temporal regulation of light-induced Fos and Fos-like protein expression in the ventrolateral subdivision of the rat suprachiasmatic nucleus.Neuroscience. 58:573-83.

Simon OR, Schramm LP. (1984) The spinal course and medullary termination of myelinated renal afferents in the rat.Brain Res. 290:239-47.

Shinohara K, Tominaga K, Fukuhara C, Otori Y, Inouye SI. (1993) Processing of photic information within the intergeniculate leaflet of the lateral geniculate body: assessed by neuropeptide Y immunoreactivity in the suprachiasmatic nucleus of rats. Neuroscience. 56:813-22.

Skofitsch G, Jacobowitz DM. (1985) Autoradiographic distribution of 125I calcitonin gene-related peptide binding sites in the rat central nervous system. Peptides. 6:975-86.

Soscia SJ, Harrington ME. (2005) Neuropeptide Y does not reset the circadian clock in NPY Y2-/- mice.NeurosciLett. 373:175-8.

Weber ET, Rea MA. (1997) Neuropeptide Y blocks light-induced phase advances but not delays of the circadian activity rhythm in hamsters. NeurosciLett. 231:159-62.

Wickland C, Turek FW. (1994) Lesions of the thalamic intergeniculate leaflet block activity-induced phase shifts in the circadian activity rhythm of the golden hamster. Brain Res.660:293-300.

Wu Q, Boyle MP, Palmiter RD. (2009) Loss of GABAergic signaling by AgRP neurons to the parabrachial nucleus leads to starvation.137:1225-34.

Wu Q, Palmiter RD. (2011) GABAergic signaling by AgRP neurons prevents anorexia via a melanocortin-independent mechanism.Eur J Pharmacol. 660:21-7.

Wu Q, Clark MS, Palmiter RD.(2012) Deciphering a neuronal circuit that mediates appetite.Nature.483:594-7.

Yannielli PC, Harrington ME. (2001) The neuropeptide Y Y5 receptor mediates the blockade of “photic-like” NMDA-induced phase shifts in the golden hamster.J Neurosci. 21:5367-73.

Yannielli P, Harrington ME. (2004)Let there be “more” light: enhancement of light actions on the circadian system through non-photic pathways.ProgNeurobiol. 74:59-76.

Yannielli PC, Brewer JM, Harrington ME. (2004) Blockade of the NPY Y5 receptor potentiates circadian responses to light: complementary in vivo and in vitro studies.Eur J Neurosci. 19:891-7.

Yi CX, van der Vliet J, Dai J, Yin G, Ru L, Buijs RM. (2006) Ventromedialarcuate nucleus communicates peripheral metabolic information to the suprachiasmatic nucleus.Endocrinology. 147:283-94.

Yokota SI, Horikawa K, Akiyama M, Moriya T, Ebihara S, Komuro G, Ohta T, Shibata S. (2000) Inhibitory action of brotizolam on circadian and light-induced per1 and per2 expression in the hamster suprachiasmatic nucleus.Br J Pharmacol. 131:1739-47.



CHAPTER 5

Suprachiasmatic nucleus interaction with the Arcuate nucleus; Essential for organizing physiological rhythms.

Buijs FNGuzmán-Ruiz MLeón-Mercado LBasualdo MCEscobar CKalsbeek ABuijs RM.

Eneuro 4 (2). (2017)



100

Chapter 5

AbstractThe suprachiasmatic nucleus (SCN) is generally considered the master clock, independently driving all circadian rhythms. We recently demonstrated the SCN receives metabolic and cardiovascular feedback adeptly altering its neuronal activity. In the present study we show that micro-cuts effectively removing SCN-ARC interconnectivity in Wistar rats, result in a loss of rhythmicity in locomotor activity, corticosterone levels and body temperature in constant dark conditions. Elimination of these reciprocal connections did not affect SCN clock gene rhythmicity, but did cause the ARC to desynchronize. Moreover, unilateral SCN lesions with contralateral retrochiasmatic micro-cuts resulted in identical arrhythmicity, proving that for the expression of physiological rhythms this reciprocal SCN-ARC interaction is essential. The unaltered SCN c-Fos expression following glucose administration in disconnected animals as compared to a significant decrease in controls, demonstrates the importance of the ARC as metabolic modulator of SCN neuronal activity. Together, these results indicate that the SCN is more than an autonomous clock, and forms an essential component of a larger network controlling homeostasis. The present novel findings illustrate how an imbalance between SCN and ARC communication through circadian disruption could be involved in the etiology of metabolic disorders.



101

SCN interaction with ARC essential for physiological rhythms

5

IntroductionThe suprachiasmatic nucleus (SCN) receives light input through direct synaptic connections from the retina; these photic cues attune the SCN rhythm with the environment. The SCN neuronal network consists of ~20,000 tightly coupled neurons (Webb et al., 2009), with most neurons expressing their own endogenous rhythm through phasic clock gene expression (Reppert and Weaver, 2002). It is proposed that through multi phasic relationships between neuronal oscillators within the SCN, different physiological rhythms can be timed and entrained to follow circadian patterns (Quintero et al., 2003;Kriegsfeld et al., 2004). In view of existing interactions between different hypothalamic nuclei and the SCN, one could presume the SCN as element of the hypothalamus in a similar fashion, i.e., the SCN not only leading but taking part in a hypothalamic network of coupled oscillators generating circadian rhythmicity. Indeed, the SCN receives a myriad of non-photic input—arousal (Antle and Mistlberger, 2000), feeding behavior (Abe et al., 1989; Mendoza, 2007), locomotor activity (Edgar et al., 1991;Marchant and Mistlberger, 1995) immune function (O’Callaghan et al., 2012;Guerrero-Vargas et al., 2014), blood pressure (Peters et al., 1994;Buijs et al., 2014) and melatonin (Armstrong, 1989;Pitrosky et al., 1999)— that are all able to adjust and synchronize the SCN. The SCN is capable of receiving this feedback through its large array of reciprocal neuronal connections with, e.g., the arcuate nucleus (ARC) (Saeb-Parsy et al., 2000;Yi et al., 2006), intergeniculate leaflet (IGL) (Janik and Mrosovsky, 1994;Saderi et al., 2012), nucleus tractus solitarius (NTS) (Buijs et al., 2014), dorsal raphe (Shioiri et al., 1991) and dorsomedial hypothalamus (DMH) (Acosta-Galvan et al., 2011), allowing these nuclei to convey non-photic feedback to the SCN and thus adjusting circadian rhythmicity. Therefore it is enticing to propose the SCN is part of or central in a larger, complex neuronal network regulating circadian physiology and behavior. We thus hypothesized that generating and synchronizing physiological circadian rhythms depends on the integration of photic and non-photic feedback to the SCN through existing strong neuronal interconnectivity with other hypothalamic nuclei. In view of recent observations that lesions targeted at specific neuronal populations in the ARC resulted in deteriorated temperature, feeding and sleep rhythms (Li et al., 2012;Wiater et al., 2013), and the observations that the SCN induces a rhythm in the ARC(Herrera-Moro et al., 2016;Guzman-Ruiz et al., 2014), and the ARC influences the activity of the SCN(Yi et al., 2006), we hypothesized that ARC-SCN reciprocity is an essential feedback pathway for the SCN, adjusting its output and facilitating changes in its neural activity in response to physiological and behavioral activity. To test this hypothesis, we made retrochiasmatic knife cuts to isolate the ARC from the SCN, preventing their reciprocal communication; we measured specific physiological output, along with central and peripheral clock gene expression. Under constant dark conditions such an SCN-ARC dissection resulted in animals showing complete arrhythmicity in behavior, temperature



102

Chapter 5

and corticosterone secretion in spite of a rhythmic SCN and persistent rhythmic melatonin secretion. Unilateral SCN lesions combined with contralateral knife cuts provided identical outcomes. Immunohistochemistry and neuronal tracing confirmed successful disconnection of the SCN-ARC interaction. In addition, we demonstrated the IGL-SCN projections and SCN-subparaventricular zone (SPZ), paraventricular nucleus (PVN) and dorsomedial hypothalamic (DMH) projections to be unaffected by the knife cuts. In conclusion, the present results demonstrate the interaction between SCN and ARC to be crucial for the expression of select circadian rhythms and that the circadian network extends beyond the boundaries of the SCN.

Materials and MethodsAnimals and ethical approval. Experiments were performed on male Wistar rats (~250g) housed individually on a 12:12h LD cycle (lights on, 0700 h) in a controlled environment. Rats were given food and water ad libitum unless otherwise stated. Piezoelectric motion sensors underneath the cages monitored locomotor activity and temperature data was acquired using ibuttons (Maxim, San Jose, CA) surgically inserted into the abdominal cavity.

Surgery. All animals undergoing surgery were anesthetized with ketamine (50 mg/kg) and xylazine (2 mg/kg) (Pisa-Agropecuaria S.A. de C.V.; Atitalaqia, Mexico). Initial preliminary experiments were performed using bilateral thermic ARC lesions using two teflon coated electrodes 0.2 mm in diameter with excoriated tip. Animals were placed in a stereotactic frame (toothbar -4mm, arm 6°; coordinates: -2.0 from bregma; ± 1.2 lateral from midline; 8.2-8.6 mm below brain surface) and an electric current of 0.3mA was passed for 60 sec, sufficient to eliminate the ARC bilaterally.Medial, retrochiasmatic knife cuts (RC cut) were made using a small knife derived from two telescoped needles with a 45° angle, sharpened tip. RC cuts were intended to disrupt fibers of passage, without causing extensive damage to the neuronal populations in the Retrochiasmatic area. Animals were placed in a stereotactic frame (toothbar -4mm; knife placed perpendicular to midline, -1.1 mm from bregma), the knife was lowered ventrally until the sphenoid bone was reached (~8.2mm below brain surface) and turned 90° caudally, in duplex (Fig. 1a, c). In SHAM animals, the surgical procedure was identical but the knife lowered without gyrating.

To further investigate the phenotype resulting from the disrupted interaction between SCN and ARC, unilateral SCN lesions were made, jointly with a contralateral 90° knife cut (SCNXARCCut; Fig. 1b, d). Animals were subjected to the same experimental protocols as animals receiving retrochiasmatic knife cuts (RC cut). Finally, we performed a glial fibrillary acidic protein (GFAP) immuno staining to show the extent of glial scarring, thus assessing the magnitude of damage caused by placed knife cuts. This demonstrated only minor glial damage to adjacent areas in RC-cut operated animals (Fig. 1a, c and d).



103


5

In testing to what degree severing SCN-ARC efferents eliminate neuronal innervation of the SCN, we performed unilateral Cholera toxin B (CtB), ARC injections in animals with and without ipsilateral retrochiasmatic knife cut. CtB injections (Molecular Probes, Eugene, OR, USA) were made using the above coordinates for the ARC. With a glass micropipette (~30μm tip), 0.05μl 1% CtB was pressure injected (10 mbar, 5 sec) and the micropipette left in place for 5 minutes in order to minimize tracer leakage.

Figure 1. Representative sagittal and coronal sections of the hypothalamus illustrating the 45° angle knife cut and its effect

established through GFAP and VIP staining. A. Illustrates a sagittal GFAP stained section just lateral to the third ventricle with minimal

glial damage around the site of incision indicated by a black arrow. B. Unilateral SCN lesion in combination with a contralateral knife

cut with VIP staining showing the contralateral SCN intact. C. Shows GFAP staining of the most caudal reach of the knife isolating the

ARC from the SCN. D. Unilateral RC-cut isolating the ARC contralateral to the SCN lesion shown in B. E. Unilateral VIP innervation

of the DMH on the side of the RC- cut demonstrating effective unilateral innervation as compared to the loss of innervation on the

SCN- lesioned side (Left). Scale bar represents 100mm in A, 90mm in B, 250mm in C and D and 130mm in E. GFAP glial fi brillary acidic

protein, ARC arcuate nucleus, SCN suprachiasmatic nucleus, ME median eminence, DMH dorsomedial hypothalamic nucleus, 3V third

ventricle.



104

Chapter 5

Perioperative protocol. Prior to surgery, a 7 day LD/ 7 day DD baseline was acquired and unless stated otherwise all animals were kept under a 12h (06:00 lights on (300 Lux), 18:00 lights off) LD cycle. After surgery, a similar protocol was adhered to. Experimental (both RC cut and SCNXARCCut animals) and SHAM animals were allowed to recover and kept in L/D for 8-10 days, followed by 7 days of DD, during which activity and temperature recordings were made. Of all animals operated (n=49; RC-cut, SHAM and SCNxARCx animals) a total of 40 were included for further analysis. Only animals showing arrhythmic locomotor activity in DD through chi-square analysis and in which subsequent anatomical analysis demonstrated the knife cut to be placed medially, in the retrochiasmatic area, were included. In experiments performed during LD conditions, time is indicated as ZT (Zeitgeber Time), as the animals are entrained to light (Zeitgeber). Experiments performed in DD (constant dark conditions), time is indicated as CT (Circadian Time), indicating the animals endogenous rhythm of about 24 hours (circa dies) not entrained to external cues.

Blood sample collection. Blood was drawn (200 μl) from the tail at ZT and CT 0, 6, 12 and 18; centrifuged for 5 min at 5000 rpm and supernatant was frozen at 20°C, from which melatonin (IBL International; Hamburg, Germany) and corticosterone were assayed using an 125I RIA kit (MP Biomedicals; Orangeburg, NY, USA). Rats were placed in a towel during blood withdrawal to minimize handling stress and they were habituated daily for 5 days before blood withdrawal; care was taken to draw blood within 30 sec after taking the animal out of its home cage. Blood was sampled at CT/ZT 0 and 12 on the same day. At least two days later blood was sampled at 6 and 18.

Physiological rhythmicity following SCN-ARC axis disruption. The different groups of animals were treated as follows: Preliminary pilot experiments were performed using bilateral thermic ARC lesions (n=3). Thereafter, RC cut (n=16) and SHAM operated animals (n=18) were exposed to above-mentioned LD and DD conditions, during which locomotor activity and temperature were registered (n=7 for both RC cut and SHAM animals). The remaining animals (n=9 for RC-cut and n=11 for SHAM) were used for immunohistochemistry and in situ analysis. Following this initial registration period and in order to evaluate melatonin and corticosterone levels—two hormones reflecting direct influence of the SCN—blood samples were taken in LD at ZT 0, 6, 12 and 18 (n=5-7/ time point). Blood was drawn from the tail 2 days apart at 2 different time points per animal to minimize stress. One week later, blood was drawn from each animal for DD blood serum analysis following 36h of DD at CT0, 6, 12 and 18 (n=3-5/ time point). Then animals were sacrificed using an overdose of sodium pentobarbital (Sedal-Vet 65 mg/ml) livers were extracted, immediately put on dry ice and kept frozen at -80°C until further analysis, then animals were perfused transcardially with saline, followed by a freshly prepared 4% paraformaldehyde solution. Following perfusion fixation brains were removed and preserved for histological analysis and in situ hybridization (ISH), as stated below.



105


5

SCNXARCCut animals (n=6) underwent a similar protocol and likewise blood samples were taken at ZT0, 6, 12 and 18 (n=5-6/ time point). Due to technical issues we could record a full temperature registry of only 4 animals. Animals were sacrificed and their brains extracted for immunohistochemistry to verify the extent of the lesion and knife cut.

Testing the ARC-SCN interaction. To investigate the relevance of the feedback from the ARC to the SCN, we assessed if metabolic signaling to the ARC would differently affect SCN activity, depending on whether animals received feedback from the ARC or not, allowing us to demonstrate that the ARC directly alters SCN neuronal activity in response to metabolic signals. RC cut operated rats were fasted for 48 hours in LD (12h lights on/off) followed by 5ml of 3% oral glucose (0.05 gr glucose/kg) intake given in a separate water bottle at ZT2 and sacrificed two hours later (ZT4). In two other groups, SHAM operated (n=4-6) and RC-cut animals (n=4-6), animals were 48 h fasted or given ad libitum conditions. Prior to fasting, only animals receiving glucose were entrained to drink 3% glucose water during the light period at random time points during 5 days. All animals were sacrificed at ZT4. In brain sections of the differently treated animals the neuronal activity of the SCN and ARC was examined using c-Fos as activity marker.

Immunohistochemistry. Following sacrifice, brains were removed, post fixed for 24h, cryoprotected in 30% sucrose for 48-72h, frozen and cut in coronal sections of 35μm at –20°C. Free floating sections were processed for c-Fos (Rabbit polyclonal, 1:40,000; Calbiochem, Billerica, MA, USA), ɑ-MSH (Sheep, 1:10,000; Chemicon), AgRP (Goat, 1:4000; Chemicon), VIP (Rabbit, 1:2000; (Buijs et al., 1989), Per1 (1:2000, Santa Cruz; Dallas, TX, USA) and CtB (Rabbit, 1:2000; Sigma–Aldrich Corp., MO, USA) immunohistochemistry using a avidin–biotin–peroxidase procedure followed by 3,3’-diaminobenzidine (DAB) staining. SHAM and experimental tissues were always processed together to avoid confounding by slight differences in staining.

In situ hybridization. The primers were synthesized by Sigma-Aldrich with forward ‘5 ACCCCCTGCTATGTGTCTCA ‘3 and reverse ‘5 TCACTGGAGCCTGAAAGTGC ‘3 for Per1 with a base length of 569bp. The reverse primers were labeled in 5’ with T7 polymerase promoter. An antisense DIG-RNA label was obtained using 200ng purified PCR fragment for Per1, 2μL of DIG-RNA labeling mix (Roche; Basel Switzerland), 2 μL T7 RNA and polymerase (Roche), 2 μL 10X concentrated transcription buffer (Roche) and 40U RNaseOUT (Invitrogen; CA, USA), then supplemented with MilliQ diethyl pyrocarbonate (DEPC) water until 20μL. Following incubation the labeling efficiency of the DIG-labeling reaction was determined in a spot assay. The RNA dilutions were spotted on Nylon Membrane (Zeta probe, BioRad; CA, USA), incubated with anti-DIG POD (Roche) and developed with DAB. The RNA was compared to labeled control RNA (Roche).



106

Chapter 5

Following a short rinse in PBS, sections were fixed in 4% paraformaldehyde in PBS for 5 min and treated with H2O2 3% in PBS-DEPC for 30 min. Sections were washed three times for 5 min in PBS and incubated in 0.5 μg/mL proteinase K in PBS with triton X-100 0.1% for 10 min at room temperature followed by 10 min post-fixation in 4% paraformaldehyde in PBS. Following washing and incubation in hibridization mix overnight sections were rinsed and incubated with blocking solution 1% (Roche) in buffer 1 for 30 min in order to block nonspecific protein binding. Sections were washed and the signal was amplified with TSA plus biotin kit (Perkin Elmer) according to instructions. Finally, sections were incubated with Streptavidin HRP (Jackson Labs) 1:500 in buffer 1 for 30 min. Following 3 washes in buffer 1 the reaction was revealed with DAB-Nickel and sections were mounted with Entelan.

RT-qPCR. Total RNA was extracted from the liver using trizol reagent (life technologies) according to the manufacturer’s protocol. The concentration and RNA quality were confirmed with agarose gel . Total RNA (2500ng) from the liver was reverse transcribed to single strand cDNA using SuperScript III first-strand synthesis (Invitrogen) according to the manufacturer’s protocol. The cDNA samples were quantified in Nanodrop and diluted in RNase free water at 250ng/μl and stored at -20 °C. For absolute quantification we generated a standard calibration curve using hightly purified standards that had been carefully quantified as to the amount or copy number. A standard curve was derived from setting out the threshold cycle (CT) against the number of RNA copies. The corresponding curves and logarithmic regression formulas were generated to replace necessary data obtained experimentally. Amplification was performed as follows: 1μl of the 1st strand cDNA sample was mixed with 5μl SYBR select master mix (Applied biosystems), 2μl milliQ water, and 1μl primers mix 10mM (Sigma). A StepOne real-time PCR system (Applied biosystems) was used to amplify the genes from each liver sample in triplicate on a 48-well reaction plate using the following protocol: 10 min denaturation at 95 °C, 40 cycles of 15 s denaturation at 95 °C and 60 s annealing and extension at 60 °C. The sequences of primers used (designed by Sigma’s OligoArchitect program): Forward ‘5 ACATTCCTAACACAACCAA ‘3 and reverse ‘5 TGCTTGTCATCATCAGAG ‘3 for Per1; Forward ‘5 CCTACTCTGATAGTTCGTCTA ‘3 and reverse ‘5 ATCCTTGGTCGTTGTCTA ‘3 for Bmal1; Forward ‘5 GGAGACTATATTAGGCGTTA ‘3 and reverse ‘5 CCTTCTGGATACCTTCTG ‘3 for Cry1.

Quantification. Pictures were taken by using an Axioplan microscope (Zeiss, Jena, Germany) equipped with a digital color camera (Olympus DP25, Olympus, Japan). The SCN and ARC were manually outlined; the Fos-positive nuclear profiles were automatically detected by means of size and staining threshold detection. The same parameters were used for all experimental groups using Image J software (NIH; Bethesda, MA, USA). For



107


5

each rat, two to three sections were measured ~90 mm apart; the mean number of c-Fos-positive nuclear profiles from both SCN per section was calculated. ARC Per1-ir expression was quantified in the same manner. Demarcating the ARC neuroanatomical landmarks were used to draw a triangular form in accordance to the rat brain atlas (Paxinos and Watson), also determining the equivalent sections between animals. All c-Fos or Per-1-ir positive nuclei were counted in this area. For SCN Per1 in situ quantification, a manual outline of the SCN was made, the mean optic density for that area was determined and the background optic density just outside the SCN was subtracted. For each rat, three sections were taken ~90 mm apart. Only the sections with the highest Per1 expression were analyzed and compared.

Statistics. All data were normally distributed and are expressed in mean ±SE. Statistical comparisons were performed using GraphPad Prism (GraphPad software, San Diego, CA, U.S.). Data were analyzed using one-way ANOVA when appropriate. Analyzing SCN and ARC neuronal activity in different metabolic conditions a two-way ANOVA was used for factor group, i.e., SHAM vs. RC-cut (two levels) and factor metabolic condition, i.e., ad libitum, fasting and glucose (3 levels). This was followed by a Tukey’s multi-comparison post-hoc test. P<0.05 was deemed significant. Chi-squared (X2) locomotor activity analysis was performed using SPAD9 (a program linked to our activity monitoring system). A repeated measures ANOVA was used for temperature and clock gene analysis with the factor group, i.e., SHAM vs. RC-cut (two levels) and time as a factor of repeated measures (23 levels for temperature and 4 levels for clock genes). For corticosterone and melatonin the factor group, i.e., SHAM vs. RC-cut vs. SCNxARCx (three levels) was also set against time as a factor of repeated measures (4 levels). For the RM-ANOVA, p < 0.05 was considered statistically significant. If a significant effect was reached, linear harmonic regression analysis was performed to determine circadian rhythmicity (see details on statistical analysis table 2). CircWave v. 1.4 software (Oster et al., 2006) was used employing an F-test to validate rhythmicity with an assumed period of 24 h and a threshold value of 0.05 for ɑ. For data visualization purposes where a significant rhythm in expression was detected, data were fitted with a sine wave function using GraphPad software.



108

Chapter 5

Table 1. Statistical table

RM-ANOVA: Repeated measures ANOVA (One-way or two-way). 2ANOVA: Two-way ANOVA

F-test: Linear Harmonic regression analysis

Dose MAP Δ MAP TtB AUCInjection BFigure Panel Distribution Test P value

2 Ca Normal distribution RM-ANOVA F47, 288=8.01909, F-test P<0.0001 C a Normal distribution RM-ANOVA F47, 288=4.7408, F-test P<0.0001 Cb Normal distribution RM-ANOVA F47, 288=4.492, F-test P<0.0001 Cb Normal distribution RM-ANOVA F47, 288=1.195, P=0.19253 Aa Normal distribution RM-ANOVA F3, 21=25.45, P<0.0001 Aa Normal distribution RM-ANOVA F3, 22=1.707, P=0.1947 Aa Normal distribution RM-ANOVA F3, 17=1.048, P=0.3967 Ab Normal distribution RM-ANOVA F3, 16=15.47, P<0.0001 Ab Normal distribution RM-ANOVA F3, 19=7.219, P=0.002 Ab Normal distribution RM-ANOVA F3, 11=26.38, P<0.0001 Ac Normal distribution RM-ANOVA F3, 13=21.04, P<0.0001 Ac Normal distribution RM-ANOVA F3, 12=4.665, P=0.0223 Ca Normal distribution RM-ANOVA F3, 16=0.9766, P=0.4283 F3, 16=15.23, P<0.0001 F1, 16=4.188, P=0.0575 F-test P=0.0099/ P=0.0123 Cb Normal distribution RM-ANOVA F3, 16=11.14, P=0.0003 F3, 16=11.80, P=0.0003 F1, 10= 6.136, P=0.0248 F-test P=0.01305 / P=0.21784 A Normal distribution RM-ANOVA F3, 8=4.43, P=0.0410/ F3, 10=8.53, P=0.0041 F-test P=0.0254/ P=0.0038 B Normal distribution RM-ANOVA F3, 8=21.93, P=0.0003/ F3, 10=2.56, P=0.1134 F-test P=0.0043/ P=0.268 C Normal distribution RM-ANOVA F3, 8=8.009, P=0.0086/ F3, 10=2.373, P=0.1316 F-test P= 0.0023/ P=0.13725 Ca Normal distribution 2ANOVA F2, 25=3.489, P=0.0461 F2, 25=9.341, P=0.0009 F1, 25=93.09, P<0.00015 Cb Normal distribution 2ANOVA F2, 25=15.59, P<0.0001 F2, 25=2.838, P=0.0775 F1, 25=3.6, P=0.0694



109


5

ResultsSCN-ARC axis disruption causes arrhythmicity in constant dark conditions. Animals kept in DD following bilateral ARC lesions demonstrated a clear loss of rhythm in locomotor activity (data not shown). Since these animals maintained a perfect rhythm under LD conditions we hypothesized that in the absence of light, the SCN requires an additional synchronizing stimulus from the ARC to drive its output. To investigate this hypothesis, coronal retrochiasmatic knife cuts (RC cuts) were made, leaving both ARC and SCN intact but severing their direct neuronal connections. Chi-squared periodogram analysis of locomotor activity in light-dark (LD 12h lights on/off, 7 days, n=7), showed a significant diurnal rhythm in both SHAM and RC-cut animals, however in constant darkness (DD, 7 days, n=7) all RC-cut animals were rendered arrhythmic (Fig. 2, Table 2). When RC cuts just missed the medial, most ventral part of the retrochiasmatic area, various phenotypes of rhythmicity could be observed during DD. Only animals showing arrhythmic locomotor activity in DD and in which subsequent anatomical analysis demonstrated the knife cut to be placed medially, in the retrochiasmatic area, were included for further analysis.

Temperature analysis showed a robust diurnal rhythm in LD in SHAM operated (RM-ANOVA, F47, 288=8.01909, P<0.0001; F-test, P<0.0001) and RC-cut animals (F47, 288=4.7408, P<0.0001; F-test, P<0.0001). However in DD RC-cut animals failed to demonstrate a significant difference between time points (F47, 288=1.195, P=0.1925) as compared to SHAM animals (F47, 288=4.492, P<0.0001; F-test, P<0.0001, Fig. 2c, Table 2). Thus the pronounced rhythm seen during LD conditions, in contrast to the absent rhythms in DD, raises the question whether all functional SCN output was disrupted in DD and rescued in LD. Therefore, two to three weeks after surgery, corticosterone and melatonin levels were analyzed from tail blood samples at ZT0, 6, 12 and 18. Surprisingly, in spite of their rhythmic temperature and locomotor activity in LD, animals with an SCN-ARC RC cut showed no significant variation among different time points in corticosterone levels during LD (RM-ANOVA, F3, 22=1.707, P=0.1947), contrary to SHAM (F3, 21=25.45, P<0.0001; Fig. 3a) with a peak at ZT 12 (P<0.0001). However, the same animals did express a significant effect of time in melatonin levels (F3, 19=7.219, P=0.002) similar to SHAM (F3, 16=15.47, P<0.0001, Fig. 3a) with a peak at ZT18 (P=0.0025). Blood samples collected 36h following DD at CT0, 6, 12 and 18 demonstrated that melatonin, in spite of absent temperature and activity rhythms, continued to be rhythmic in DD in both SHAM (F3, 13=21.04, P<0.0001) and RC-cut animals (F3, 12=4.665, P=0.022; Fig. 3a) with a peak at CT18 (P=0.0221). Considering that corticosterone was significantly arrhythmic in LD, duplicate measurements in DD were not regarded as additive. These observations demonstrate that, although the majority of the determined physiological rhythms were absent in DD conditions, melatonin secretion occurs independent of the SCN-ARC interaction. Furthermore, the present results show that corticosterone rhythm, known to depend on the integrity of the SCN, also depends on the integrity of SCN-ARC communication.



110

Chapter 5

Table 2. Analysis of activity and temperature rhythms in SHAM, RC cut and SCNXARCCut animals during light-dark (LD) and

constant dark (DD) conditions. Rhythm in locomotor activity was assessed (X2 analysis) for 7 days in LD and DD. Temperature rhythm

was analyzed (harmonic regression) using batched data from 3 days of LD and the fi nal 3 days of DD. Values indicate mean ±SE. Dash (-)

indicates no signifi cant rhythm found. § only 1 (rhythmic) animal so no statistics could be performed. * P<0.05, ** P<0.01, *** P<0.001,

between group analysis. # P<0.05, within group analysis compared to LD.

Figure 2. Arrhythmic locomotor activity and temperature observed in DD following retrochiasmatic knife cuts (RC cut). A.

Representative actograms of a SHAM operated animal left and an RC-cut animal on the right, in LD and DD conditions (shading

indicates lights off). Following RC cuts, animals recovered in LD and showed normal diurnal rhythmicity, subsequent DD conditions

rendered all RC-cut animals arrhythmic. B. X2 periodogram analysis of LD and DD periods of SHAM (left) and RC cut (right) animals.

The slanted line in the periodogram indicates P=0.01. C. For RC-cut animals temperature was arrhythmic in DD. Note the strong

temperature decrease in RC-cut animals between ZT0 – ZT2 in reaction to light during LD. The graph is a double plot of temperature

data in SHAM and RC-cut animals in LD (left) and DD (right). Each value represents 7 animals (mean ±SE). Only where a signifi cant

rhythm in expression was detected, data were fi tted with a sine wave function (P<0.05, F-test).

Figure 2. Arrhythmic locomotor activity and temperature observed in DD following retrochiasmatic knife cuts (RC cut).

Dose MAP Δ MAP TtB AUCInjection B

LD DD Control RC cut SCNXARCCut Control RC cut SCNXARCCut17.23±0.4 16.6±0.55 15.93±0.38 17.88±0.63 - -1.79±0.15 1.68±0.22 1.42±0.12 1.36±0.07# - -0.5 0.45 0.5 0.42 0.05 0.127/7 7/7 6/6 7/7 0/7 0/637.43±0.04 37.66±0.06* 37.77±0.05** 37.43±0.04 37.63±0.0.07 37.79±0.02**16.9±0.36 16.95±0.56 16.06±0.42 17.99±0.29 19.42§ -0.49±0.032 0.38±0.04 0.33±0.03 0.42±0.04 0.31§ -0.67 0.59 0.54 0.59 0.14 0.237/7 7/7 4/4 7/7 1/7 0/4

Activity - Acrophase (ZT/CT) Amplitude R2 No. rhythmicTemperature - Mean (°C)

Acrophase (ZT/CT) Amplitude R2 No. rhythmic



111


5

Figure 3. In RC cut animals corticosterone rhythm was lost while melatonin remained intact similar to SCN rhythmicity. Rhythm of

ARC Per1 expression was attenuated, demonstrating SCN-ARC desynchronization. A. Corticosterone levels showed a signifi cant peak

at ZT12 in SHAM but not RC cut or SCNXARCCut animals, indicating loss of rhythmicity. Melatonin maintained its rhythm in LD

and DD in both SHAM and experimental animals. Data represents N=5-7, and N=4-6 for the SCNXARCCut group (mean ±SE). * P<0.05

(SHAM), + P<0.05 (Experimental), ANOVA analysis. B. Representative photomicrographs of SCN Per1 mRNA expression (above) and

ARC Per1-ir (below) in SHAM and RC-cut animals. Scale bar = 90mm. 3V third ventricle, ON Optic nerve, ME Median eminence. C.

Per1 mRNA analysis of the SCN demonstrates signifi cant circadian rhythmicity in RC cut (P<0.05) and in SHAM animals (P<0.01). The

ARC failed to show a signifi cant rhythm in RC-cut animals (P>0.05) as compared to SHAM. The higher point at CT 6 suggests a phase

advance, however an F-test failed to show a signifi cant circadian rhythm. Data represents N=3-4 with a double-plot of CT0 at CT24.

Only where a signifi cant rhythm in expression was detected, data were fi tted with a sine wave function (P<0.05, F-test).

Figure 3. In RC cut animals corticosterone rhythm was lost while melatonin remained intact similar to SCN rhythmicity. Rhythm of



112

Chapter 5

Interaction between the SCN and ARC is essential for rhythmicity. To confirm that only the interaction between the SCN and ARC was essential for rhythmicity and the observed arrhythmicity was not simply caused by damage to the retrochiasmatic area, we made unilateral electrolytic SCN lesions in combination with contralateral 90° retrochiasmatic knife cuts. Thus maintaining the ARC, the unilateral SCN and unilateral retrochiasmatic area intact, while also the unilateral afferents and efferents of ARC and retrochiasmatic area were not disrupted, the reciprocal communication between SCN and ARC was still effectively removed (Fig. 1b, d). Contrary to unilateral SCN or mediobasal hypothalamus lesions—shown to be ineffective in changing rhythmicity (Gerkema et al., 1990)—our unilateral SCN-lesion combined with contralateral ARC-isolation (SCNXARCCut) animals were behaviorally arrhythmic in DD as was temperature (Table 2). As with RC-cut animals, SCNXARCCut animals showed arrhythmic corticosterone (F3, 17=1.048, P=0.3967) but rhythmic melatonin levels in LD (F3, 11=26.38, P<0.0001; Fig. 3a) according to ANOVA analysis. This confirmed that the observed arrhythmicity in RC cut animals was indeed due to elimination of SCN-ARC intercommunication.

The SCN remains rhythmic following SCN-ARC deafferentation. Observing the circadian disruption of RC-cut animals in DD, we hypothesized that either 1. Specific SCN output is altered, with the SCN depending on synchronized concomitant ARC output for adequate regulation of physiological function; or 2. The robustness of SCN rhythmicity is affected, resulting in diminished clock function and circadian control, only revealed during constant dark conditions. We analyzed SCN Per1 expression in DD conditions through in situ hybridization with animals sacrificed 36h after lights off at CT0, 6, 12 and 18. RC-cut animals showed a slightly higher expression of Per1 at all time points, but with equal amplitude of Per1 expression as compared to SHAM animals (RM-ANOVA, F3, 16=0.9766, P=0.4283, Fig. 3c). Also, a preserved Per1 circadian rhythmicity in both SHAM (F3, 16=15.23, P<0.0001; F-test, P=0.0099) and RC-cut animals (F-test, P=0.0123) was found. This demonstrates SCN rhythmicity is not significantly affected by SCN-ARC axis disruption. Next, we hypothesized that the rhythmic SCN, together with rhythmic melatonin levels, implies an intact autonomic control over peripheral clock gene rhythmicity, though to some extent other physiological processes like corticosterone rhythm and food intake also have their impact on peripheral clock-gene rhythmicity. We measured clock gene expression in the liver of SHAM and experimental animals using RT-qPCR. Per1 showed a clear circadian oscillation in both SHAM (RM-ANOVA, F3, 8=4.43, P=0.0410; F-test, P=0.0254) and RC-cut animals (F3, 10=8.53, P=0.0041; F-test, P=0.0038). However, Bmal1 failed to show an effect of time (F3, 10=2.56, P=0.1134; F-test, P=0.268) in experimental animals as compared to SHAMs (F3, 8=21.93, P=0.0003; F-test, P=0.0043); likewise, Cry1 expression in experimental animals showed no effect of time, nor circadian rhythmicity (F3, 10=2.373, P=0.1316; F-test, P=0.1372) unlike in SHAMs (F3, 8=8.009, P=0.0086; F-test, P=0.0023; Fig. 4).



113


5

Figure 4. Peripheral liver clock genes in experimental animals show contrasting changes in rhythmicity as compared to SHAM

animals. Per1 gene expression in experimental animals showed no signifi cant changes in rhythmicity (P<0.01) as compared to SHAM

(P<0.05), contrary to Bmal1 (P=0.268) and Cry1 (P=0.137) failing to demonstrate rhythmicity as compared to SHAM animals (P<0.05).

Each value represents three to four animals (mean ± SE). CT24 is a double-plot of CT0. Solid squares indicate RC-cut animals and open

circles SHAM animals. Only where a signifi cant rhythm in expression was detected, data were fi tted with a sine wave function (P<0.05,

F-test).

The SCN and ARC desynchronize. Under normal conditions Per1 expression in the ARC shows a diurnal rhythm in vivo (Shieh et al., 2005) with a peak around ZT18. To investigate whether the known rhythm of Per1 protein in the ARC would depend on neuronal interaction with the SCN we also investigated Per1 protein expression in the ARC after SCN deafferentation through RC cuts. This showed a signifi cant difference between SHAM and RC-cut animals (RM-ANOVA, F1, 10= 6.136, P=0.0248), a signifi cant effect of time (F3, 16=11.14, P=0.0003) but also a signifi cantly different time trend in ARC per1 expression between SHAM en RC-cut animals (F3, 16=11.80, P=0.0003). Testing for circadian rhythmicity revealed that SHAM animals showed a clear rhythm (F-test, P=0.01305) with peak expression around CT23 (22.98 ± 0.73), however, in experimental animals Per1 failed to express circadian rhythmicity in the ARC (F-test, P=0.2178; Fig. 3c). Together with the preserved circadian Per1 expression in the SCN this indicates a signifi cant desynchrony between SCN and ARC in RC-cut animals as compared to SHAM animals.

RC cuts reveal altered metabolic SCN-ARC communication. In order to investigate whether ARC-SCN metabolic communication, was impaired by the RC cuts, we subjected animals to a protocol of fasting followed by a brief glucose stimulus. Two-way ANOVA analysis of c-Fos expression in the SCN revealed a signifi cantly different reaction to treatment (AdLib, fasting and glucose) between SHAM en RC-cut animals (F2, 25=3.489, P=0.0461, Fig. 5). SHAM animals drinking 5ml of a 3% glucose solution following 48 hours of fasting showed a strong decrease in c-Fos expression in the SCN (P<0.01) as compared to ad libitum conditions. Conversely, RC-cut animals showed no signifi cant change in c-Fos expression in the SCN (P>0.05, Fig. 5). Also, merely fasting, known to result in a moderate decrease



114

Chapter 5

of c-Fos in the ventral SCN (Saderi et al., 2013) did not result in any change in the RC-cut animals. Furthermore, a comparison of SHAM and RC-cut animals showed a significantly elevated SCN c-Fos expression in RC-cut animals in all conditions as compared to SHAM animals. Also in the ARC, c-Fos expression in reaction to AdLib, Fasting or glucose was significantly different in RC-cut animals as compared to SHAM animals (F2, 25=15.59, P<0.0001). In reaction to the glucose stimulus, the ARC in SHAM animals showed a significant increase in c-Fos (P<0.01) as compared to ad libitum conditions, while RC-cut animals, again, demonstrated no significant difference between conditions (P=0.0775). Thus, SHAM animals showed a decrease in SCN c-Fos activity that coincided with an increase of c-Fos in the ARC. This reciprocal influence is clearly lost in RC-cut animals, which showed no significant change in c-Fos expression in the SCN or ARC between different conditions.Figure 5. C-Fos staining of the SCN and ARC showing significant changes in Fos expression following glucose intake in SHAM animals, whereas experimental animals show no significant alterations in Fos expression. A. Representative photomicrographs of SCN c-Fos expression in SHAM en RC cut animals in ad libitum, fasting or fasting and glucose intake. B. ARC c-Fos expression in SHAM en RC cut animals during above stated conditions. C. Bar charts of c-Fos quantification in the SCN and ARC of SHAM en RC-cut animals. All animals were sacrificed at ZT4 following ad libitum, 48 h of fasting or fasting followed by 5ml 3% glucose intake 2 h prior to sacrifice. Each value in C represents three to four animals (mean ± SE). Scale bar = 70mm. * significant between group difference. + significant within group difference. */+ P<0.05, **/++ P<0.01, ***/+++ P<0.001 (ANOVA analysis).

Deafferentation of SCN-ARC neuronal connections does not damage their efferents to other brain areas. Since for most of our observations we used knife cuts in the retrochiasmatic area, we investigated whether this might have also severed other connections between the SCN and its target areas, other than the ARC. Also, we established whether knife cuts removed ARC output to efferent brain areas, especially dorsal and rostral of the cut. Immunohistochemical staining for VIP, recognized as one of the major output systems of the SCN (Takahashi, 1989), revealed that, except for its projections to the ARC, VIP innervation to the subparaventricular zone (SPZ), PVN and DMH remained unaffected (Fig. 6a, b, c). VIP innervation of the ARC and the area between the median eminence and ARC, present in SHAMs, disappeared in RC-cut animals (Fig. 6d, e). No statitical analysis was performed on the extent of loss or preservation of innervation since results were binary. Also NPY staining in the SCN reflecting input from the IGL (Fig. 6f) was not affected by RC cuts. Through unilateral ARC CtB injections in animals with ipsilateral RC cuts, we confirmed the loss of SCN connections with the ARC as compared to controls (data not shown).



115


5

Analysis of ARC-specifi c output by means of AgRP staining showed a normal distribution of AgRP in RC-cut animals in main ARC target areas, i.e., the POA, PVN, VMH and DMH; suggesting normal ARC output unimpaired by the retrochiasmatic knife cut (Fig. 7). Assessing the completeness of SCN denervation from ARC efferents, AgRP staining showed a clear attenuation of SCN innervation in RC-cut animals compared to SHAMs (Fig. 8). Together with the unilateral SCN lesion and contralateral knife cut, these anatomical analyses demonstrate that reciprocal connections between the SCN and ARC are affected by our micro-cuts, but other SCN and ARC efferents remain intact.

Figure 6. RC cuts do not affect main SCN output other than the ARC. A. Clear VIP innervation of the DMH and B. PVN in RC-cut

animals. C. Also VIP staining to the SPZ and retrochiasmatic area dorsal to the knife cut is still intact in RC-cut animals. D. Staining of

VIP afferents in the ARC, clearly visible in SHAM animals, disappear following RC cut (E). F. Likewise, NPY SCN staining, shown to be

predominantly IGL derived, is not damaged by RC cuts. Pictures A, B, C, E and F are from RC animals, only D shows staining in an intact

animal. Scale bar = 130mm in A and F, 175mm in B, 250mm in C, 70mm in D and E.



116

Chapter 5

Figure 7. ARC specifi c AgRP staining shows intact innervation of A. the PVN, B. MnPO, C. AVPV and D. DMH, not affected by the

knife cuts. Scale bar = 175mm in A-C and 215mm in D. All photomicrographs are from RC-cut animals. 3V third ventricle, ON optic

nerve.

Figure 8. RC cuts strongly temper ARC innervation of the SCN as illustrated by diminished of ARC specifi c AgRP staining.

Representative photomicrographs of AgRP staining showing intact innervation of A. the SCN in a SHAM animal. B. Shows an SCN of

an RC-cut animal with strongly reduced AgRP innervation. Bottom pictures are magnifi cations of outlined boxes in A and B showing

clear fi bers in the SCN of control animals not seen in RC-cut animals. Scale bar = 70mm in A and B, and 15mm in the magnifi cations

below. 3V third ventricle, ON optic nerve.



117


5

DiscussionMost physiological processes have well-defined circadian rhythms. The present study challenges the still prevalent view that these rhythms are driven solely by the SCN. We demonstrate that generation of specific physiological and behavioral circadian rhythms greatly depend on functional interaction between the SCN and ARC. RC cuts, effectively eliminating reciprocal communication between the SCN and ARC, resulted in a complete loss of rhythm in corticosterone secretion, whereas during constant dark conditions also locomotor activity and body temperature rhythms were completely lost. These findings are in agreement with prior studies demonstrating a role for the mediobasal hypothalamus in facilitating circadian rhythmicity (Gerkema et al., 1990) and consistent with observed loss of rhythm in adrenal corticosterone levels following knife cuts posterior to the SCN (Moore and Eichler, 1972). In the present study we show that the reciprocal connectivity between SCN and ARC (Saeb-Parsy et al., 2000;Yi et al., 2006) is essential to synchronize hormonal and behavioral rhythms.

Interaction between SCN and ARC is essential for generating rhythms. The striking observation that corticosterone rhythmicity was lost in RC-cut animals during LD conditions suggests a crucial role for the ARC in generating this rhythm jointly with the SCN. A recent observation that glucocorticoid receptors in the ARC are essential for the circadian variation in the negative feedback of circulating corticosterone on its own release (Leon et al, 2017) supports this observation. Locomotor activity—rhythmic in LD—was completely arrhythmic in DD. One could argue that considering locomotor activity is rhythmic in LD conditions, for maintaining this rhythm in DD interaction between SCN and ARC is essential. On the other hand, there is the suggestion that the observed behavioral phenotype in LD is not truly rhythmic but rather shows diurnal variance due to the “masking” effect of light (Redlin and Mrosovsky, 1999). In view of the effect of locomotor activity on temperature, the rhythmic locomotor activity in LD in RC-cut animals may also be responsible for the observed rhythmic temperature in LD, while lost in DD. The present results show that for maintaining rhythmicity in DD, interaction between SCN and ARC is essential. The SCN receives numerous types of non-photic feedback signals capable of altering the phase of the clock. Activity can synchronize and phase-shift the SCN (Yamazaki et al., 1998;Schaap and Meijer, 2001), SCN clock genes can be synchronized to food in LL conditions (Lamont et al., 2005) while extra-SCN areas can influence the phase of SCN clock gene, Per1 (Vansteensel et al., 2003). Considering this, we hypothesized that severed SCN-ARC connections resulting in diminished non-photic, metabolic feedback from the ARC to SCN (Yi et al., 2006) as well as aberrant rhythms in behavior, temperature and corticosterone could lead to suppression of SCN rhythmicity. Yet, SCN rhythmicity measured by Per1 expression remained unaltered in RC-cut animals. This observation



118

Chapter 5

suggests that—in the short term—the SCN is able to maintain its own autonomous rhythm in clock gene expression and that in order to drive physiological functions, it depends on its interaction with the ARC. The observation that SCN-lesioned animals receiving SCN transplants from donor animals regain circadian rhythmicity, suggests that they do not require ARC interconnectivity. However, it has been shown that diffusible substances from the transplanted SCN into the third ventricle also restore locomotor activity rhythms (Silver et al., 1996) Since the ARC, as a circumventricular organ, takes up substances from the third ventricle, it could be an effective target for SCN derived diffusible substances.

Further assessing hypothalamic output through peripheral clock gene rhythmicity, we found liver Per1 expression of experimental animals to be similar to SHAM animals. However, no rhythm could be detected in liver Bmal1 and Cry1 clock gene expression. This anomaly could be explained by the fact that while there is no rhythm in corticosterone, activity, temperature and possibly food intake (Li et al., 2012), the persistent rhythm in melatonin could have its effect on liver Per 1 expression (Houdek et al., 2016).

Circadian rhythms depend on synchronous SCN and ARC output. A recent study has demonstrated that SCN driven activity of ARC aMSH neurons is essential for diurnal temperature control (Guzman-Ruiz et al., 2015). Moreover the study demonstrated that synchronized release of SCN derived vasopressin, and ARC derived aMSH in the medial preoptic area is essential for the physiological dawn temperature decrease in rats. According to our present observation of an altered ARC Per1 rhythm in RC-cut animals, disclosing a desynchronous state of the ARC from the SCN, should indeed lead to a loss in temperature rhythm. The necessity of ARC and SCN synchrony is also consistent with data showing the ARC is essential for the regulation of activity and feeding. Lesions targeted at specific neuronal populations in the ARC resulted in deteriorated activity, temperature and feeding rhythms (Li et al., 2012;Coppari et al., 2005). Our results indicate, it is not the ARC lesions per se, but an altered phase relationship between the SCN and ARC leading to desynchronized SCN-ARC output with a deleterious effect on physiological function. As such, the observation that RC-cut animals maintain a normal melatonin rhythm in LD and DD conditions affirms that melatonin is solely dependent on SCN activity (Pevet, 2014), while rhythms in locomotor activity, temperature and corticosterone levels are also dependent on regulation by the ARC and thus arguably affected by changes in metabolism.

Technical considerations. Making knife cuts inevitably causes collateral damage and while keeping this to a minimum (as shown in figure 1 and 6) we cannot exclude consequential damage to neurons and pathways to and from other areas, perchance contributing to observed rhythmic aberrations. Retrochiasmatic lesions for example, have been shown to reduce pineal melatonin content (Ribeiro Barbosa et al., 1999), however in the present



119


5

study the rhythm in melatonin secretion was not altered and animals with knife cuts placed out of midline, still transecting the retrochiasmatic area, did not express any change in rhythmicity. The Subparaventricular zone (SPZ), located above the area of the knife cut, is a target of neural projections from the SCN (Watts et al., 1987) and functions as a possible relay for the SCN (Cipolla-Neto et al., 1988) suggesting that a loss of SPZ input could be responsible for observed change in rhythmicity. This however, seems unlikely for two reasons; first, we show the SCN projections to the PVN, SPZ and DMH are still intact (Fig. 6). Second, other studies demonstrated that horizontal knife cuts eliminating SCN input to the SPZ reduced the LH surge in female rats but did not reduce the rhythmicity of locomotor activity, nor in constant conditions (Watts et al., 1989), indicating that the SCN projections to the SPZ are not essential for rhythm in locomotor activity. Realizing that knife cuts could also sever unforeseen projections we investigated SCN and ARC projections to and from other hypothalamic areas. The presence of NPY input from the IGL to the SCN was unaffected and also ARC and SCN output to other areas was not notably altered. Still the possible disruption of other SCN or ARC afferents could be considered a limitation of the knife cut technique, restricting a conclusion about the SCN-ARC interaction. Thus, to reduce this possibility we performed a unilateral SCN lesion with a contralateral knife cut. Unilateral SCN lesions alone allow an animal to maintain its circadian rhythm (Gerkema et al., 1990;Guzman-Ruiz et al., 2014). Hence, to ensure our observations were the result of severed interaction between the SCN and ARC and not due to damage of the retrochiasmatic area or other hypothalamic projections to the SCN and ARC, we combined unilateral SCN lesions with a contralateral knife cut, leaving the unilateral SCN, unilateral retrochiasmatic area and complete ARC intact. With this experiment, again preventing reciprocal communication between SCN and ARC, we demonstrate equal aberrations of physiological rhythms as seen following a complete RC cut. In combination with demonstrated intact SCN (VIP) and ARC (AgRP) efferents to other hypothalamic target areas, we show it is the eliminated SCN-ARC communication responsible for observed loss of rhythmicity in physiological outputs and not damage to other hypothalamic nuclei or circuits. Since we investigated the nature of SCN-ARC interaction consisting of various, unknown, neuronal populations, a Cre recombinase animal study would not be appropriate for this specific purpose. However it could prove applicable in future research, investigating the character of involved individual neuronal populations and their function in SCN-ARC interaction.

The SCN and ARC depend on interaction to modulate their activity in response to metabolic cues. The rhythmic SCN Per1 expression together with an intact melatonin rhythm demonstrates preserved SCN rhythmicity. However, RC-cut animals responded to metabolic cues not only with an altered neuronal activation of the ARC but also of the SCN, illustrating that for proper function both the ARC and SCN depend on their interconnectivity through the SCN-ARC axis. This is consistent with observations that



120

Chapter 5

altered metabolic conditions of an animal change the activity of the ARC and that of the SCN simultaneously (Yi et al., 2008;Saderi et al., 2013). Moreover, recent findings show that the SCN readily modulates glucose sensing in the ARC in a time dependent manner (Chao et al., 2016) and light not only directly changes the neuronal activity of the SCN but also that of the ARC (Guzman-Ruiz et al., 2014) further confirming the significance of the SCN-ARC axis. ConclusionThe present results provide evidence that SCN-ARC interaction serves to synchronize SCN and ARC output, essential for organizing physiological functions. This confirms the idea, also previously suggested (Webb et al., 2009;Hu et al., 2012; Buijs et al., 2016) that the SCN functions inside a larger circadian network of tightly linked oscillatory feedback circuits whose integral function is essential for regulating physiological and behavioral functions. Long-term desynchronization within this circadian network due to changes in dietary habits, chronic jetlag or shift work is known to contribute to pathology associated with “modern lifestyle”, such as hypertension, obesity, diabetes and cancer (Leproult et al., 2014;Scheer et al., 2010;Kettner et al., 2016). We therefore propose that ill-timed food intake and altered metabolic signals are able to alter normal ARC activity patterns, as such changing its synchronization with the SCN and as a consequence disrupting associated behavioral and hormonal patterns. Thus faulty network connections or erroneous feedback may reshape the circadian system to a new equilibrium, leading to physiological impairment and pathology.



121


5



122

Chapter 5

ReferencesAbe H, Kida M, Tsuji K, Mano T (1989) Feeding cycles entrain circadian rhythms of locomotor activity in CS mice but not in C57BL/6J mice. Physiol Behav 45:397-401.

Acosta-Galvan G, Yi CX, Van D, V, Jhamandas JH, Panula P, Angeles-Castellanos M, Del Carmen BM, Escobar C, Buijs RM (2011) Interaction between hypothalamic dorsomedial nucleus and the suprachiasmatic nucleus determines intensity of food anticipatory behavior. Proc Natl Acad Sci U S A 108:5813-5818.

Antle MC, Mistlberger RE (2000) Circadian clock resetting by sleep deprivation without exercise in the Syrian hamster. J Neurosci 20:9326-9332.

Armstrong SM (1989) Melatonin and circadian control in mammals. Experientia 45:932-938.

Buijs FN, Cazarez F, Basualdo MC, Scheer FA, Perusquia M, Centurion D, Buijs RM (2014) The suprachiasmatic nucleus is part of a neural feedback circuit adapting blood pressure response. Neuroscience 266:197-207.

Buijs FN, Leon-Mercado L, Guzman-Ruiz M, Guerrero-Vargas NN, Romo-Nava F, Buijs RM (2016) The Circadian System: A Regulatory Feedback Network of Periphery and Brain. Physiology (Bethesda ) 31:170-181.

Buijs RM, Pool CW, Van Heerikhuize JJ, Sluiter AA, Van Der Sluis PJ, Ramkema M, Van Der Woude TP, Van Der Beek E (1989) Antibodies to small transmitter molecules and peptides: production and application of antibodies to dopamine, serotonin, GABA, vasopressin, vasoactive intestinal polypeptide, neuropeptide Y, somatostatin and substance. Biomed Res 10:213-221.

Chao DH, Leon-Mercado L, Foppen E, Guzman-Ruiz M, Basualdo MC, Escobar C, Buijs RM (2016) The Suprachiasmatic nucleus modulates the sensitivity of Arcuate nucleus to hypoglycemia in the male rat. Endocrinology.

Cipolla-Neto J, Afeche SC, Menna-Barreto L, Marques N, Benedito-Silva AA, Fortunato G, Recine EG, Schott C (1988) Lack of similarity between the effect of lesions of the suprachiasmatic nucleus and subparaventricular hypothalamic zone on behavioral circadian rhythms. Braz J Med Biol Res 21:653-654.

Coppari R, Ichinose M, Lee CE, Pullen AE, Kenny CD, McGovern RA, Tang V, Liu SM, Ludwig T, Chua SC, Jr., Lowell BB, Elmquist JK (2005) The hypothalamic arcuate nucleus: a key site for mediating leptin’s effects on glucose homeostasis and locomotor activity. Cell Metab 1:63-72.

Edgar DM, Kilduff TS, Martin CE, Dement WC (1991) Influence of running wheel activity on free-running sleep/wake and drinking circadian rhythms in mice. Physiol Behav 50:373-378.

Gerkema MP, Groos GA, Daan S (1990) Differential elimination of circadian and ultradian rhythmicity by hypothalamic lesions in the common vole, Microtus arvalis. J Biol Rhythms 5:81-95.



123


5

Guerrero-Vargas NN, Salgado-Delgado R, Basualdo MD, Garcia J, Guzman-Ruiz M, Carrero JC, Escobar C, Buijs RM (2014) Reciprocal interaction between the suprachiasmatic nucleus and the immune system tunes down the inflammatory response to lipopolysaccharide. J Neuroimmunol10.

Guzman-Ruiz M, Saderi N, Cazarez-Marquez F, Guerrero-Vargas NN, Basualdo MC, Acosta-Galvan G, Buijs RM (2014) The suprachiasmatic nucleus changes the daily activity of the arcuate nucleus alpha-MSH neurons in male rats. Endocrinology 155:525-535.

Guzman-Ruiz MA, Ramirez-Corona A, Guerrero-Vargas NN, Sabath E, Ramirez-Plascencia OD, Fuentes-Romero R, Leon-Mercado LA, Basualdo SM, Escobar C, Buijs RM (2015) Role of the Suprachiasmatic and Arcuate Nuclei in Diurnal Temperature Regulation in the Rat. J Neurosci 35:15419-15429.

Herrera-Moro CD, Leon-Mercado L, Foppen E, Guzman-Ruiz M, Basualdo MC, Escobar C, Buijs RM (2016) The Suprachiasmatic Nucleus Modulates the Sensitivity of Arcuate Nucleus to Hypoglycemia in the Male Rat. Endocrinology 157:3439-3451.

Houdek P, Novakova M, Polidarova L, Sladek M, Sumova A (2016) Melatonin is a redundant entraining signal in the rat circadian system. Horm Behav 83:1-5.

Hu K, Meijer JH, Shea SA, Vanderleest HT, Pittman-Polletta B, Houben T, van Oosterhout F, Deboer T, Scheer FA (2012) Fractal Patterns of Neural Activity Exist within the Suprachiasmatic Nucleus and Require Extrinsic Network Interactions. PLoS ONE 7:e48927.

Janik D, Mrosovsky N (1994) Intergeniculate leaflet lesions and behaviorally-induced shifts of circadian rhythms. Brain Res 651:174-182.

Kettner NM, Voicu H, Finegold MJ, Coarfa C, Sreekumar A, Putluri N, Katchy CA, Lee C, Moore DD, Fu L (2016) Circadian Homeostasis of Liver Metabolism Suppresses Hepatocarcinogenesis. Cancer Cell 30:909-924.

Kriegsfeld LJ, Lesauter J, Silver R (2004) Targeted microlesions reveal novel organization of the hamster suprachiasmatic nucleus. J Neurosci 24:2449-2457.

Lamont EW, Diaz LR, Barry-Shaw J, Stewart J, Amir S (2005) Daily restricted feeding rescues a rhythm of period2 expression in the arrhythmic suprachiasmatic nucleus. Neuroscience 132:245-248.

Leproult R, Holmback U, Van Cauter E (2014) Circadian misalignment augments markers of insulin resistance and inflammation, independently of sleep loss. Diabetes.

Li AJ, Wiater MF, Oostrom MT, Smith BR, Wang Q, Dinh TT, Roberts BL, Jansen HT, Ritter S (2012) Leptin-sensitive neurons in the arcuate nuclei contribute to endogenous feeding rhythms. Am J Physiol Regul Integr Comp Physiol 302:R1313-R1326.

Marchant EG, Mistlberger RE (1995) Morphine phase-shifts circadian rhythms in mice: Role of behavioural activation. Neuroreport 7:209-212.



124

Chapter 5

Mendoza J (2007) Circadian clocks: setting time by food. J Neuroendocrinol 19:127-137.

Moore RY, Eichler VB (1972) Loss of a circadian adrenal corticosterone rhythm following suprachiasmatic lesions in the rat. Brain Res 42:201-206.

O’Callaghan EK, Anderson ST, Moynagh PN, Coogan AN (2012) Long-lasting effects of sepsis on circadian rhythms in the mouse. PLoS ONE 7:e47087.

Oster H, Damerow S, Hut RA, Eichele G (2006) Transcriptional profiling in the adrenal gland reveals circadian regulation of hormone biosynthesis genes and nucleosome assembly genes. J Biol Rhythms 21:350-361.

Peters RV, Zoeller RT, Hennessey AC, Stopa EG, Anderson G, Albers HE (1994) The Control of Circadian Rhythms and the Levels of Vasoactive Intestinal Peptide Messenger RNA in the Suprachiasmatic Nucleus Are Altered in Spontaneously Hypertensive Rats. Brain Res 639:217-227.

Pevet P (2014) The internal time-giver role of melatonin. A key for our health. Rev Neurol (Paris) 170:646-652.

Pitrosky B, Kirsch R, Malan A, Mocaer E, Pevet P (1999) Organization of rat circadian rhythms during daily infusion of melatonin or S20098, a melatonin agonist. Am J Physiol 277:R812-R828.

Quintero JE, Kuhlman SJ, Mcmahon DG (2003) The biological clock nucleus: a multiphasic oscillator network regulated by light. J Neurosci 23:8070-8076.

Redlin U, Mrosovsky N (1999) Masking of locomotor activity in hamsters. J Comp Physiol A 184:429-437.

Reppert SM, Weaver DR (2002) Coordination of circadian timing in mammals. Nature 418:935-941.

Ribeiro Barbosa ER, Skorupa AL, Cipolla Neto J, Canteras NS (1999) Projections of the basal retrochiasmatic area: a neural site involved in the photic control of pineal metabolism. Brain Res 839:35-40.

Saderi N, Cazarez-Marquez F, Buijs FN, Salgado-Delgado RC, Guzman-Ruiz MA, Del Carmen BM, Escobar C, Buijs RM (2013) The NPY intergeniculate leaflet projections to the suprachiasmatic nucleus transmit metabolic conditions. Neuroscience 246:291-300.

Saderi N, Salgado-Delgado R, Avendano-Pradel R, Basualdo MC, Ferri GL, Chavez-Macias L, Roblera JE, Escobar C, Buijs RM (2012) NPY and VGF Immunoreactivity Increased in the Arcuate Nucleus, but Decreased in the Nucleus of the Tractus Solitarius, of Type-II Diabetic Patients. PLoS ONE 7:e40070.

Saeb-Parsy K, Lombardelli S, Khan FZ, McDowall K, Au-Yong IT, Dyball RE (2000) Neural connections of hypothalamic neuroendocrine nuclei in the rat. J Neuroendocrinol 12:635-648.



125


5

Schaap J, Meijer JH (2001) Opposing effects of behavioural activity and light on neurons of the suprachiasmatic nucleus. Eur J Neurosci 2001 13:1955-162.

Scheer FA, Hu K, Evoniuk H, Kelly EE, Malhotra A, Hilton MF, Shea SA (2010) Impact of the human circadian system, exercise, and their interaction on cardiovascular function. Proc Natl Acad Sci U S A 107:20541-20546.

Shieh KR, Yang SC, Lu XY, Akil H, Watson SJ (2005) Diurnal rhythmic expression of the rhythm-related genes, rPeriod1, rPeriod2, and rClock, in the rat brain. J Biomed Sci 12:209-217.

Shioiri T, Takahashi K, Yamada N, Takahashi S (1991) Motor activity correlates negatively with free-running period, while positively with serotonin contents in SCN in free-running rats. Physiol Behav 49:779-786.

Silver R, Lesauter J, Tresco PA, Lehman MN (1996) A diffusible coupling signal from the transplanted suprachiasmatic nucleus controlling circadian locomotor rhythms. Nature 382:810-813.

Vansteensel MJ, Yamazaki S, Albus H, Deboer T, Block GD, Meijer JH (2003) Dissociation between Circadian Per1 and Neuronal and Behavioral Rhythms Following a Shifted Environmental Cycle. Curr Biol 13:1538-1542.

Watts AG, Sheward WJ, Whale D, Fink G (1989) The effects of knife cuts in the sub-paraventricular zone of the female rat hypothalamus on oestrogen-induced diurnal surges of plasma prolactin and LH, and circadian wheel-running activity. J Endocr 122:593-604.

Watts AG, Swanson LW, Sanchez-Watts G (1987) Efferent projections of the Suprachiasmatic nucleus: I. Studies using anterograde transport of Phaseolus vulgaris leucoagglutinin in the rat. J Comp Neurol 258:204-229.

Webb AB, Angelo N, Huettner JE, Herzog ED (2009) Intrinsic, nondeterministic circadian rhythm generation in identified mammalian neurons. Proc Natl Acad Sci U S A 106:16493-16498.

Wiater MF, Li AJ, Dinh TT, Jansen HT, Ritter S (2013) Leptin-sensitive neurons in the arcuate nucleus integrate activity and temperature circadian rhythms and anticipatory responses to food restriction. Am J Physiol Regul Integr Comp Physiol 305:R949-R960.

Yamazaki S, Kerbeshian MC, Hocker CG, Block GD, Menaker M (1998) Rhythmic properties of the hamster suprachiasmatic nucleus in vivo. J Neurosci 18:10709-10723.

Yi CX, Challet E, Pevet P, Kalsbeek A, Escobar C, Buijs RM (2008) A circulating ghrelin mimetic attenuates light-induced phase delay of mice and light-induced Fos expression in the suprachiasmatic nucleus of rats. Eur J Neurosci 27:1965-1972.

Yi CX, Van D, V, Dai J, Yin G, Ru L, Buijs RM (2006) Ventromedial arcuate nucleus communicates peripheral metabolic information to the suprachiasmatic nucleus. Endocrinology 147:283-294.



CHAPTER 6

The Suprachiasmatic nucleus is part of a Kisspeptin feedback network involving the anterior ventral part of the third ventricle and Arcuate nucleus.

Buijs FNSoto-Tinoco EBasualdo MCKalsbeek ABuijs RM.

To be submitted



128

Chapter 6

AbstractThe suprachiasmatic nucleus (SCN) plays an essential role in the timing of reproduction. This is based on absent reproductive cycles in female rats after lesioning the SCN, on the strict circadian pattern of ovulation in rodents, and on the connections of the SCN with gonadotropin releasing hormone (GnRH) neurons as well as with Kisspeptin (Kiss) neurons, both receiving input from SCN vasoactive intestinal peptide neurons (VIP) or vasopressin (AVP) neurons, respectively. These SCN projections are thought to be important for timing the LH peak. On the basis of previous findings that the RF-amide related peptide-3 (RFRP-3) neurons of the dorsomedial nucleus of the hypothalamus (DMH), known to inhibit the luteinizing hormone (LH) surge, were found to project to the SCN, we investigated the presence of Kiss innervation in the rat SCN. We observed small caliber Kiss fibers forming a dense network in the ventral SCN, targeting the same VIP neuronal area as where RFRP-3 fibers terminate. Surprisingly, in female as well as in male animals the intensity of this SCN-Kiss innervation varied with a higher fiber density in the morning as compared to the end of day. Interestingly, in spite of major opposite changes in immunoreactivity of Kiss neurons in the anterior ventral part of the third ventricle (AVPV) and arcuate nucleus (ARC) following ovariectomy, SCN-Kiss fiber density was not influenced by ovariectomy or estrogen treatment. Retrograde tracing experiments demonstrated that Kiss neurons innervating the SCN were present both in the AVPV and ARC. The present observations put the SCN at the center of a reciprocal network involved in timing of the LH surge.



129

SCN part of Kisspeptin feedback network

6

Introduction Female reproduction in mammals requires careful synchronization of a series of physiological and behavioral events in order to assure that conception takes place at the right moment in time. Therefore, it is not surprising that more and more evidence is building up showing that the biological clock has a pivotal role in the timing of reproduction, including that of humans (Kerdelhué et al. 2002). For example, in order to induce ovulation in rat, elevated levels of circulating estradiol (Norman, Blake, and Sawyer 1973; Legan and Karsch 1975) have to coincide with a suprachiasmatic nucleus (SCN) driven luteinizing hormone (LH) peak at the end of the day (Brown-Grant and Raisman 1977; Samson and McCann 1979). Numerous SCN projections are candidate to be responsible for associating and synchronizing reproductive behavior with reproductive physiology. For instance, SCN neurons containing vasoactive intestinal peptide (VIP) terminate on Gonadotrophin releasing hormone (GnRH) neurons in the rat preoptic area (POA) (Van Der Beek et al. 1997), thus providing a temporal niche for the LH surge (Christian and Moenter 2008). Moreover, infusion of arginine vasopressin (AVP) in the anterior ventral part of the third ventricle (AVPV) in SCN lesioned animals was able to induce an LH surge (Palm et al. 1999) proving the importance of AVP in regulating the LH peak. Later, it was shown that the presence of Kisspeptin (Kiss) neurons in this area receiving AVP input from the SCN was associated with this effect (Williams et al. 2011). Kiss is a neuropeptide essential for reproductive function as Kiss inactivating mutations cause abnormal sexual maturation and infertility in human due to hypogonadism (de Roux et al. 2003; Seminara et al. 2003)which results in the impairment of pubertal maturation and of reproductive function. In the absence of pituitary or hypothalamic anatomical lesions and of anosmia (Kallmann syndrome. Kiss expressing neurons are predominantly found in the AVPV, the preoptic periventricular nucleus (PeN), the arcuate nucleus (ARC) (Gottsch et al. 2004; Desroziers et al. 2010)which bind to a G protein-coupled receptor known as GPR54. Mutations or targeted disruptions in the GPR54 gene cause hypogonadotropic hypogonadism in humans and mice, suggesting that kisspeptin signaling may be important for the regulation of gonadotropin secretion. To examine the effects of kisspeptin-54 (metastin and sparsely in extra-hypothalamic areas (Cravo et al. 2011; Kim et al. 2011). In the ARC Kiss neurons are also known as KNDy neurons because they co-express kisspeptin, neurokinin B, dynorphin, and glutamate amongst others (Lehman, Coolen, and Goodman 2010). Within the central nervous system, Kiss has a pivotal role in the regulation of reproductive functions through its projections to GnRH neurons in the POA inducing the LH surge and ovulation (Gu and Simerly 1997; Simonian, Spratt, and Herbison 1999; de Roux et al. 2003; Seminara et al. 2003; Kauffman, Clifton, and Steiner 2007)mediating hormonal feedback on gonadotropin secretion. The results of anterograde transport experiments indicate that the AVPV sends ascending projections to the ventral part of the lateral septal nucleus, the parastrial nucleus, and



130

Chapter 6

the region adjacent to the vascular organ of the lamina terminalis (OVLT. The majority of GnRH neurons express kisspeptin-1 receptors (Kiss1r), suggesting that Kiss is able to directly modify the activity of these cells (Irwig et al. 2004). Indeed injections of Kiss in the POA results in activation of GnRH neurons followed by an LH peak (Matsui et al. 2004; Patterson et al. 2006). Moreover, Kiss1r knockout animals lack GnRH release and Kiss injections do not produce an LH peak in these animals (Messager et al. 2005)we investigate the possible central mode of action of GPR54 and kisspeptin ligand. First, we show that GPR54 transcripts are colocalized with gonadotropin-releasing hormone (GnRH confirming the importance of Kiss for the LH surge. The vast majority of Kiss neurons in the AVPV and ARC express sex steroid receptors, namely estrogen receptor ɑ (ERɑ). Kiss expression in both nuclei is estrogen-dependent with estrogen being stimulatory in the AVPV and inhibitory in the ARC (Smith et al. 2005; Smith 2008; Clarkson et al. 2009). Since electrolytic lesions restricted to the AVPV result in an impaired estrous cycle and are able to block an exogenous estrogen induced LH peak (Wiegand, Terasawa, and Bridson 1978; Wiegand et al. 1980)here designated as the medial preoptic nucleus (MPN, the AVPV-GnRH Kiss pathway is thought to be essential for positive feedback on the reproductive axis. On the other hand, studies also support a role for Kiss neurons in the ARC in regulating the reproductive cycle; e.g. a negative energy balance suppresses Kiss expression in the ARC and is associated with an inhibition of the reproductive cycle (Roa 2013). Considering the timing of the LH surge, the SCN is involved in the positive arm of the reproductive cycle with AVP neurons projecting to Kiss neurons in the AVPV indirectly stimulating GnRH release and the LH peak (Vida et al. 2010; Williams et al. 2011). Furthermore, VIP neurons show direct projections to GnRH neurons and exert an excitatory effect dependent on estrogen levels and time of day (Van der Beek et al. 1997; Christian and Moenter 2008). Interestingly, the SCN is also involved in adapting negative feedback from the reproductive cycle. SCN VIP neurons project to RFRP-3 neurons in the dorsomedial hypothalamus (DMH) (Gibson et al. 2008), which are associated with a tonic inhibition of LH secretion (Henningsen et al. 2017). Moreover, melatonin, which is regulated by SCN activity, feeds back onto RFRP-3 neurons enabling a seasonal organization of fertility and breeding (Ubuka et al. 2012; Henningsen, Gauer, and Simonneaux 2016)and mammals including humans. The identified avian and mammalian GnIH peptides universally possess an LPXRFamide (X = L or Q. The SCN not only provides input to the reproductive network, it also receives input from it. For instance, DMH RFRP-3 neurons receive SCN innervation but also have projections to the ventral part of the SCN (Acosta-Galvan et al. 2011)the biological clock. Consequently, a food-entrained oscillator has been proposed to be responsible for meal time estimation. Recent studies suggested the dorsomedial hypothalamus (DMH indicating the negative arm of a feedback circuit between the LH surge and the SCN. In the present study we hypothesized that similar to DMH RFRP-3 neurons, Kiss



131


6

neurons form a feedback circuit with the SCN. Analyzing Kiss immunoreactivity in the anterior hypothalamus with an antibody with a high capacity to stain Kiss fibers (Oakley, Clifton, and Steiner 2009), we observed a dense Kiss immuno-positive innervation of the ventrolateral SCN showing diurnal variation with a higher staining intensity of Kiss fibers in the SCN in the morning, whereas late in the day Kiss fiber density was strongly diminished. We show that both Kiss neurons in the AVPV and ARC contribute to this SCN projection, with both nuclei showing an estrogen dependent temporal organization of staining intensity and mRNA synthesis. These observations provide evidence for the incorporation of the SCN in a neuronal feedback circuit within the reproductive system.

Materials and MethodsAnimals and ethical approval. Experiments were performed on male and female Wistar rats (~250g) individually housed in a temperature and humidity controlled environment under a 12:12 h LD cycle (lights on, 0700 h). Rats were given food and water ad libitum. All animal experiments were performed following approval from the Committee for Ethical Evaluation at the Institute for Biomedical Research, Universidad Nacional Autónoma de México, in accordance with Mexican (Norma Oficial Mexicana, NOM-062-ZOO-1999) and ASPA guidelines for animal handling.

Surgery. All animals undergoing surgery were anesthetized with ketamine (50 mg/kg) and xylazine (2 mg/kg) (Pisa-Agropecuaria S.A. de C.V.; Atitalaquia Hgo., Mexico).

SCN CtB injections. In testing our hypothesis that the SCN receives direct innervation from the AVPV and ARC, we performed unilateral Cholera toxin B (CtB) injections in the SCN. Cholera toxin B (CtB) iontophoretic injections (Molecular Probes, Eugene, OR, USA) were made using alternate current 10 sec on 10 sec off, 7uA 30-50V via 15 microns tip diameter glass micropipette, placed unilaterally into the SCN. Thirteen female rats received anesthesia, and were mounted in a stereotact (David Kopf Instruments; Tujunga, USA) using coordinates for SCN injections as described before (Buijs et al., 2014). In short, the animal was placed in the stereotact with tooth bar at -3.4mm and the point of the micropipette placed 0.05mm anterior; 0.09mm lateral from Bregma and 8.6mm ventral from the dura, under an angle of 4°. Animals were allowed to recover for 7-10 days to allow sufficient time for retrograde transport to all cell bodies with terminals inside the injection site. Five of these animals were used for further analysis as injections showed minimal leakage along the injection tract and injections were positioned completely inside the SCN as determined by CtB immunohistochemistry.

OVX. To avoid interference from fluctuating estradiol blood levels over the estrous cycle during experiments, ovariectomy was performed on forty-two female rats. A 2 cm long peritoneal incision was made; the two ovaries were reached and removed by cutting the



132

Chapter 6

oviduct. Surgical silk (Atramat MR) was used for stitches. For SHAM, 20 animals received a silastic tube (Dow Corning SILASTIC Brand 0.24” ID) of 20mm long was cut, filled with sesame oil, sealed with medical grade adhesive and placed subcutaneously in the dorsal thoracic area.

OVXE. Following ovariectomy, twenty-two animals received a silastic tube (Dow Corning SILASTIC Brand 0.24” ID) of 20mm filled with a solution of 180 μg E2-estradiol/mL sesame oil (E2; SIGMA E1024-1G) and sealed with medical grade adhesive, which was implanted subcutaneously in the dorsal thoracic area. This regimen has been shown to produce hormone serum levels that are within the physiological range for at least four weeks (Ström, Theodorsson, and Theodorsson 2008). All animals recovered from the surgery for at least 2 weeks in LD. All following experiments were performed on ZT2 or ZT11. At time of sacrifice just prior to perfusion, blood (200μl) was taken and centrifuged for 5 min at 5000 rpm after which supernatant was frozen at 20°C. Estradiol was measured by ELISA (SE120084; Sigma-Aldrich, MO, USA) according to the manufacturer’s protocol.

Immunohistochemistry. Under an overdose of sodium pentobarbital (Sedal-Vet 65 mg/mL) male (n=3) and female rats (n=8-10 per time point, per group) were perfused transcardially with 0.9% saline followed by 4% paraformaldehyde in 0.1M Phosphate buffered saline (PBS; pH 7.5) (Buijs et al. 1993). Following sacrifice, brains were removed, post fixed for 24h, cryoprotected in 30% sucrose for 48-72h, frozen and cut in coronal sections of 30μm at –20°C. Free floating sections were processed for Kisspeptin (Rabbit AB9754, 1:500; EMD Millipore, Billerica, MA, USA), VIP (Rabbit, 1:2000; (R. Buijs et al. 1989) , AVP (Rabbit, 1:1000 made in house), CtB (Goat, 1:2000; Sigma–Aldrich Corp., MO, USA) immunohistochemistry using the avidin–biotin–peroxidase procedure followed by 3,3’-diaminobenzidine (DAB) staining (Acosta-Galvan et al. 2011)the biological clock. Consequently, a food-entrained oscillator has been proposed to be responsible for meal time estimation. Recent studies suggested the dorsomedial hypothalamus (DMH. The Kisspeptin anti-body has proven efficacy for Kiss specific staining not showing cross-reactions with other peptides (True et al. 2013; Beale et al. 2014; Hu et al. 2015)raising the possibility that CART plays a role in reproductive inhibition during negative metabolic conditions. The current study characterized CART’s regulatory influence on GnRH and kisspeptin (Kiss1.

Analysis SCN CtB injections. In order to visualize projections from the SCN, brain sections were incubated with goat anti-CtB (Sigma–Aldrich) at 4°C overnight. After rinsing, sections were incubated in biotinylated donkey-secondary antibody (Jackson Immunoresearch, West Grove, PO, USA; 1:400) for 1.5h and then put in an avidin-biotin complex (Vector, Burlingame, CA, USA, 1:500) solution. Staining was performed in a solution of 0.025% diaminobenzidine (DAB), 10% NiNH4SO4 and 0.01% H2O2 (Sigma–Aldrich) in Tris-buffered saline (TBS, 0.01M, ph7.6), for 10 minutes. Sections were mounted on gelatinized



133


6

slides, dried, dehydrated with graded solutions of ethanol, soaked in xylene, and finally coverslipped with an Entellan embedding agent (Merck).

In situ hybridization. In situ hybridization (ISH) was carried out as described earlier (Buijs et al. 2017). In short.Primers. The primers were synthesized by Sigma Aldrich: Forward CAGCTGCTAGCACAGCG and Reverse GGGCAGTGTGTTCATCCTGA. The reverse primers were labeled in 5’ with T7 polymerase promoter. An antisense DIG-RNA label was obtained using 200ng purified PCR fragment for Kiss, 2μL of DIG-RNA labeling mix (Roche; Basel Switzerland), 2 μL T7 RNA and polymerase (Roche), 2 μL 10X concentrated transcription buffer (Roche) and 40U RNaseOUT (Invitrogen; CA, USA), then supplemented with MilliQ diethyl pyrocarbonate (DEPC) water until 20μL. Following 2h 37°C incubation, 1μl RNA polymerase was added for enhanced labeling and incubated for 1h at 37°C. We added 2μl of 0.2M EDTA pH 8.0, 2.5μl 4M LiCl, 75μl pre-chilled (-20°C) 100% ethanol and incubated overnight at -20 °C. Tubes were centrifuged 30 minutes (14.000rpm, 4 °C), supernatant removed and washed with 50μl pre-chilled 70% ethanol then centrifuged 10 minutes (14.000rpm, 4 °C). Supernatant was removed, the tube put on ice to dry for 10 minutes and resuspended in 100μl autoclaved milliQ DEPC water. The labeling efficiency of the DIG-labeling reaction was determined in a spot assay. The RNA dilutions were spotted on Nylon Membrane (Zeta probe, BioRad; CA, USA), incubated with anti-DIG POD (Roche) and developed with DAB. The RNA was compared to labelled control RNA (Roche).In situ hybridization. Following a short rinse in PBS, sections were fixed in 4% paraformaldehyde in PBS for 5 min and treated with H2O2 3% in PBS-DEPC for 30 min. Sections were washed three times for 5 min in PBS and incubated in PBS-DEPC 0.1% for 30 min at room temperature followed by 10 min post-fixation in 4% paraformaldehyde in PBS. Sections were washed 3 times for 5 min in PBS, rinsed with MilliQ DEPC water and incubated 10 min at room temperature with 0.25% acetic anhydride in 0.1M triethanolamine/ Milli Q DEPC water. After washed 3 times, free floating sections were incubated in hybridization solution (4X SSC, 50% deionized formamide, 1X Denhardts solution) for 2h at 63°C. The RNA probe (400 ng/ml) in hybridization solution was denatured for 5 min at 85°C and put on ice for 5 min. Sections were submerged in hybridization mix and incubated overnight at 63°C in a moist hybridization oven. They were subsequently rinsed in 5X SSC at room temperature and washed in 5X SSC (50% formamide) for 30 min, 2X SSC (50% formamide) for 20 min, 0.2X SSC (50% formamide) for 20 min at 63°C, 0.2X SSC for 5 min at room temperature, 5 min in buffer 1 (100 ml Tris HCl 1M pH 7.4, 30 ml NaCl 5M and 870 ml milliQ water with DEPC) and incubated with blocking solution 1% (Roche) in buffer 1 for 30 min in order to block nonspecific protein binding. Sections were washed for 5 min in buffer 1 and incubated with anti-DIG-POD (Roche) 1:1000 in buffer 1 for 2h, then washed 3 times in buffer 1 for 5 min and the signal was amplified with TSA plus biotin kit (Perkin Elmer) according to instructions. Finally, sections were incubated



134

Chapter 6

with Streptavidin HRP (Jackson Labs) 1:500 in buffer 1 for 30 min. Following 3 washes in buffer 1 the reaction was revealed with DAB-Nickel and sections were mounted with Entelan as described above.

Quantification. Kiss. Pictures of the stained sections were taken using an Axioplan microscope (Zeiss, Jena, Germany) equipped with an Infinity2-2 digital color camera (Lumenera; Ottawa ON, Canada). From each brain, three sections ~90 mm apart (between bregma -0.90 to -1.20) were taken and the ventrolateral and dorsomedial part of the SCN were bilaterally outlined and analyzed. The mean optic density of Kiss fibers in the SCN for both areas were quantified using ImageJ software (NIH; Bethesda, MA, USA), with the background subtracted from the positive staining. For the AVPV, three sections ~60 mm apart (between bregma 0.12 to -0.12) were taken and bilaterally outlined manually. For the ARC three sections ~150 mm apart (between bregma -2.20 to -2.70) were taken and bilaterally outlined manually. For both nuclei the mean optic density of Kiss fibers were quantified using ImageJ software, with the background subtracted from the positive staining.Kiss mRNA. The AVPV and ARC were manually outlined as described above; the Kiss mRNA-positive cells were automatically detected by means of size and staining threshold detection, using ImageJ software. Further processing was done as stated above. The total number Kiss positive cells were counted using ImageJ software.

Statistics. All data were normally distributed and are expressed in mean ±SE. Statistical comparisons were performed using Prism 6 (GraphPad software, San Diego, CA, U.S.). Data were analyzed using two-way ANOVA with Bonferroni post-hoc test when appropriate. P<0.05 was considered significant. Analyzing mRNA and IHC staining a two-way ANOVA was used for factor group, i.e., OVX vs. OVXE (two levels) and factor time, i.e., ZT2 and ZT11 (2 levels). This was followed by a Bonferroni multi-comparison post-hoc test. P<0.05 was considered significant.



135


6

ResultsThe ventrolateral SCN receives elaborate Kiss innervation. We observed the presence of an elaborate network of very thin Kiss fi bers in the SCN of male rats (Fig. 1A) and a similar presence of Kiss fi bers in female rats (Fig. 1B). Both males and females showed the same distribution with nearly all Kiss innervation located in the ventrolateral area of the SCN, suggesting possible interaction with VIP neurons. Kiss fi bers inside the SCN were of very small caliber with the presence of only a few larger caliber fi bers.

Figure 1. Kisspeptin projections show a specifi c distribution in the SCN with near to all innervation located in the

ventrolateral area of the SCN in both males and females. (A) Representative photomicrograph of the left SCN of a male Wistar

rat showing immunohistochemical staining for Kisspeptin. (B) Shows a representative photomicrograph of the left SCN of a female

Wistar rat demonstrating a similar distribution of the Kisspeptin staining as with males.

SCN Kiss fi bers contact VIP neurons but not AVP neurons. The ventrolateral area of the SCN is known to be involved in receiving both retinal and non-photic input (Herzog and Schwartz 2002; Buijs et al. 2016)temperature-compensated circadian clocks have been localized to discrete sites within the nervous systems of a number of organisms. In mammals, the master circadian pacemaker is the bilaterally paired suprachiasmatic nucleus (SCN and it contains the majority of VIP expressing neurons (Shinohara et al. 1993; Nakagawa and Okumura 2010). Hence we investigated whether Kisspeptin fi bers located in the ventrolateral SCN were contacting VIP neurons. Double labeling of Kiss and VIP immunoreactivity demonstrated Kiss fi bers in close apposition to VIP neurons in the ventrolateral part of the SCN (Fig. 2). We did not fi nd any clear appositions to AVP neurons. This is in agreement with the observation that the dorsomedial part of the SCN shows only sparse Kiss innervation.



136

Chapter 6

Figure 2. Kisspeptin projections oppose VIP neurons in the ventrolateral part of the SCN but do not oppose AVP

neurons. Immunofl uorescence staining of SCN sections show Kisspeptin (Red), VIP (Green) and AVP (Turquoise) with Kiss fi bers

forming direct apposition with VIP but not AVP neurons in the ventrolateral part of the SCN (vlSCN). (A) A photomicrograph of the

SCN with VIP neurons visible in the ventrolateral part of the SCN in green and AVP neurons in the dorsomedial SCN in turquoise. The

square outlined in A represents the magnifi cation shown in B. (B) Magnifi cation of the vlSCN with white arrows illustrating Kiss fi bers

(Red) apposing VIP neurons (Green).

Kisspeptin neurons of the AVPV and ARC project to the SCN. To assess the origin of the Kiss neuronal input to the SCN, the anterograde and retrograde tracer Cholera toxin B (CtB) was injected into the SCN of 13 female Wistar rats by iontophoresis. In animals where CtB injections were successfully placed within the anatomical borders of the SCN (n=5), we observed retrogradely traced cell bodies in hypothalamic areas known to contain Kiss neurons, i.e., the PeN, AVPV and ARC. Interestingly, especially with injections placed in the ventrolateral part of the SCN we observed co-localization of CtB with Kiss cell bodies in both the AVPV and ARC (Fig. 3). In contrast, injections placed in the dorsal medial part of the SCN hardly demonstrated any co-localization of CtB with Kiss neurons in AVPV or ARC in agreement with the lack of Kiss innervation in the dorsal SCN. Unilateral SCN CtB injections predominantly resulted in ipsilateral presence of cell bodies in the AVPV and ARC (Fig. 3). Besides CtB stained cell bodies, also CtB stained fi bers were detected in the AVPV and ARC, confi rming previously demonstrated SCN projections to both nuclei (Saeb-Parsy et al. 2000; Gerhold, Horvath, and Freeman 2001; Vida et al. 2010; Williams et al. 2011; Buijs et al. 2017).



137


6

Figure 3. Kisspeptin neurons of the ARC and anterior ventral part of the AVPV project to the SCN. Retrograde tracing

following SCN CtB injections (Red), demonstrating ipsilateral colocalisation with Kisspeptin neurons (Green) shown in sections of

both the ARC and the AVPV. (A) Representative photomicrographs of the ARC and (B) AVPV, demonstrating numerous Kiss neurons

co-localizing with CtB (Yellow). This was especially notable when the injection was placed in the ventral part of the SCN. 3V, third

ventricle.

The SCN demonstrates a diurnal variation in Kiss fi ber density. In rodents, the expression of Kiss mRNA in the AVPV under the infl uence of estrogen, peaks around ZT11, coinciding with the LH surge, and shows a trough around ZT2. Ovariectomized (OVX) animals not receiving estrogen do not show such rhythmicity. However, not all studies were able to see a signifi cant rhythm in AVPV Kiss mRNA expression under high estrogen conditions (Smith et al. 2006; Maeda et al. 2007; Robertson, Clifton, de la Iglesia, et al. 2009; B. L. Smarr, Morris, and De La Iglesia 2012). Based on these past observations we investigated whether the observed Kiss innervation in the SCN could show a diurnal variation at these two time points. Indeed Kiss innervation of the SCN shows differences through time with a denser Kiss innervation at ZT2 as compared to ZT11 (Fig. 4). OVX animals show low Kiss mRNA expression in the AVPV and high expression in the ARC while OVX+estrogen (OVXE) animals show a reverse pattern (Smith et al. 2006). This shift in pattern is thought to be associated with the differential role of the AVPV and ARC conveying the positive and negative feedback effects of sex steroids, although it might not be as straightforward (Helena et al. 2015). We investigated whether the variation in Estrogen dependent Kiss immunoreactivity would be refl ected in Kiss innervation density of the SCN, thus providing an indication where this diurnal variation in Kiss innervation might come from. Surprisingly no change in Kiss innervation density could be observed regardless of the animal being either OVX or OVXE. Two-way ANOVA analyses demonstrated no signifi cant interaction (F1, 29=0.6068, P=0.4423) or effect of group (F1, 29=0.2618, P=0.6128), showing that SCN Kiss fi ber density did not vary due to the estrogen treatment protocol. Yet, notwithstanding the Estrogen treatment, statistical



138

Chapter 6

analysis did show a signifi cant effect of time (F1, 29=12.39, P=0.0014) with Bonferroni post-hoc analysis indicating a signifi cantly higher fi ber density at ZT2 as compared to ZT11 in OVX animals (P=0.0086) with OVXE animals missing signifi cance (P=0.1139; Fig. 4).

Figure 4. The SCN demonstrates a diurnal variation in Kiss fi ber density. (A) Analysis of SCN sections showing Kisspeptin

immunoreactivity demonstrated that the ventrolateral part of the SCN has higher fi ber density at ZT2 as compared to ZT11 in OVX

animals (P=0.0086) with a trend for higher ZT2 fi ber density in OVXE animals but missing signifi cance (P=0.1139) according to 2-way

ANOVA Bonferroni post-hoc analysis. Data shown is mean ± SEM. (B) Representative photomicrographs of SCN sections showing

Kisspeptin immunoreactivity in OVX and OVXE animals at ZT2 and ZT11.

The AVPV and ARC demonstrate a diurnal variation in Kiss-ir but not in Kiss-mRNA expression. We next examined whether this diurnal variation in SCN-Kiss fi ber density could be related to fl uctuations between synthesis and storage/release of Kiss in the AVPV and ARC. Hereto we compared Kiss mRNA and IHC staining of AVPV and ARC sections in OVX and OVXE animals. For the AVPV, analysis of the number of kiss mRNA positive cells showed a signifi cant effect of group (ANOVA, F1, 24=85.83, P<0.0001) with a lower Kiss expression in OVX as compared to OVXE animals. We found no signifi cant interaction (F1, 24=2.541, P=0.124) nor a signifi cant effect of time (F1, 24=0.9054, P=0.3508), indicating no signifi cant difference in OVX or OVXE animals between the ZT2 or ZT11 time points (Fig. 5A,B). This was confi rmed by Bonferroni post-hoc analysis in OVX (P=0.99) and OVXE (P=0.1478). However, previously there have been reports of signifi cant higher Kiss synthesis at ZT11 (Smith et al. 2006; Robertson, Clifton, de la Iglesia, et al. 2009) suggesting that in OVXE animals indeed the AVPV could have a peak in Kiss mRNA synthesis at ZT11. Looking at Kiss-ir staining intensity in the AVPV and analyzing the optic density of Kiss-ir in OVX/OVXE animals at ZT2 and ZT11 showed a signifi cant interaction (ANOVA, F1, 21=6.173; P=0.0215), as well as a signifi cant effect of group (F1, 21=27.43;



139


6

P<0.0001) and time (F1, 21=18.20; P=0.0003). Bonferroni post hoc analysis did not show a difference in Kiss-ir staining between ZT2 and ZT11 in OVX animals (P=0.5255) but did show a significantly higher optic density at ZT2 as compared to ZT11 in OVXE animals (P<0.001; Fig. 6A,B). When comparing the high ZT2 Kiss-ir staining with low ZT2 mRNA synthesis, as shown in previous reports (Smith et al. 2006; Robertson, Clifton, de la Iglesia, et al. 2009), this could indicate a higher peptide storage/release at ZT2 in the AVPV only in OVXE animals. This diurnal variation in Kiss signaling is only apparent under high estrogen levels in OVXE animals suggesting it to be estrogen dependent.

Figure 5. The AVPV and ARC demonstrate a diurnal rhythm in mRNA expression. (A) Bar graphs showing relative levels

of Kisspeptin mRNA in the AVPV. A trend towards a peak at ZT11 can be seen in the AVPV of OVXE animals (P=0.1478; 2-way ANOVA

Bonferroni post-hoc analysis). Data shown is mean ± SEM. (B) Representative photomicrographs of AVPV sections showing Kisspeptin

mRNA expression in OVX and OVXE animals at ZT2 and ZT11. (C) Bar graphs showing relative levels of Kisspeptin mRNA in the ARC. In

the ARC, mRNA expression showed no variation between ZT2 and ZT11 in OVX (P=0.2776) or OVXE (P=0.99) animals according to 2-way

ANOVA Bonferroni post-hoc analysis. (D) Representative photomicrographs of ARC sections showing Kisspeptin immunoreactivity in

OVX and OVXE animals at ZT2 and ZT11. Data shown is mean ± SEM.

For the ARC, analysis of the number of Kiss mRNA positive cells showed a significant effect of group (ANOVA, F1, 30=231.3, P<0.0001) demonstrating a higher Kiss expression in OVX as compared to OVXE animals for both time points. There was no significant interaction (F1, 30=0.1639, P=0.2103), nor a significant effect of time (F1, 30=0.2020, P=0.1656; Fig. 5C,D) indicating no significant difference between time-points as was confirmed by Bonferroni post-hoc analysis (OVX, P=0.2776; OVXE, P=0.99). The lower mRNA levels in OVXE animals implies an overall reduced Kiss synthesis in the ARC during high estrogen conditions as compared to low estrogen levels in OVX animals.



140

Chapter 6

Looking at the optic density of Kiss-ir in the ARC, we saw a significant effect of group (ANOVA, F1, 29=61.59; P<0.0001), interaction (F1, 29=14.23; P=0.0007) and of time (F1, 29=6.228; P=0.0185). Bonferroni post-hoc analysis showed a significant peak in Kiss-ir at ZT2 in OVX animals (P=0.0008), but not in OVXE animals (P=0.6334; Fig. 6C,D). Again, this could indicate a higher peptide storage at ZT2 in the ARC only in OVX animals. Thus, only in OVX animals the ARC demonstrates high ZT2 Kiss-ir staining and in OVXE animals only the AVPV shows high Kiss-ir staining at ZT2 in the AVPV in the ARC. Together with the demonstrated Kiss projections from both the AVPV and ARC to the SCN and the diurnal variation in Kiss-ir intensity in the SCN with higher levels at ZT2 in both OVX and OVXE animals suggests an ARC dominant Kiss activity in the SCN at ZT2 in OVX animals and an AVPV dominant Kiss activity in the SCN in OVXE animals at the same time point.

Figure 6. The AVPV and ARC demonstrate a diurnal rhythm in Kiss immunoreactivity. (A) Bar graphs showing optic

density analysis of Kiss immunoreactivity demonstrate a peak in staining intensity at ZT2 in the AVPV of OVXE animals (P<0.0001), but

not in OVX animals (P>0.05), according to 2-way ANOVA Bonferroni post-hoc analysis. Data shown is mean ± SEM. (B) Representative

photomicrographs of the AVPV at ZT2 and ZT11 in OVX and OVXE animals showing Kiss staining intensity. (C) Bar graphs showing

optic density analysis of Kiss immunoreactivity in sections of the ARC. The ARC demonstrated a peak at ZT2 in OVX animals (P=0.0008)

not seen in OVXE (P=0.6334) according to 2-way ANOVA Bonferroni post-hoc analysis. Data shown is mean ± SEM. (D) Representative

photomicrographs of the ARC at ZT2 and ZT11 in OVX and OVXE animals showing Kiss staining intensity.



141


6

DiscussionFor long it has been known that the SCN is essential for the generation and timing of the LH surge in rodents (Brown-Grant and Raisman 1977; Samson and McCann 1979). More recently it was demonstrated that SCN vasopressin neurons project to AVPV Kiss neurons relaying a circadian signal enabling a timed estrogen dependent LH surge (Williams et al. 2011). The present findings show that not only does the SCN mediate circadian signals to different hypothalamic nuclei timing the reproductive cycle, but the SCN also receives signals from AVPV and ARC Kiss efferents.For the first time, we provide evidence of the existence of temporal feedback circuits between Kiss expressing neurons in the AVPV and ARC and the SCN. We demonstrate that, in both male and female Wistar rats, the SCN receives elaborate innervation from Kiss fibers targeting predominantly the ventrolateral SCN. Through retrograde CtB-tracer injections into the SCN we find that Kiss cell bodies in both the AVPV and ARC of female rats project to the SCN. Our observations show that in spite of major opposing changes in Kiss-ir intensity in the ARC and AVPV after OVX or OVXE, the diurnal pattern of SCN innervation seems to remain balanced towards a higher staining density at ZT2 as compared to ZT11, though missing significance in OVXE animals. This could indicate that the majority of the Kiss feedback comes from the ARC since it also lacks a significant difference between ZT2 and ZT11 values in OVXE animals. The importance of these observations is that in addition to the confirmed circadian input of SCN vasopressin neurons to Kiss neurons in Wistar rats, these Kiss neurons appear to return a diurnal signal to SCN VIP neurons. The temporal constancy of this feedback seems to be vital, as it is independent of estrogen levels in the animal. The observation that male and female rats show a similar distribution of Kiss innervation suggests the presence of a general, non-sex-dependent function of Kisspeptin in the SCN. Neurons in the vlSCN are best known for receiving light input and to convey this synchronizing photic cue to the rest of the SCN, with VIP being critical in maintaining an autonomous rhythm and thus critical for the circadian drive of physiological functions (Shinohara et al. 1993; Harmar 2003; An et al. 2013; Hughes, Guilding, and Piggins 2011)by enzyme immunoassay, daily and circadian patterns of the concentrations of three peptides, which are located in the ventrolateral subdivision of the suprachiasmatic nucleus (SCN. VIP neurons are also target of peripheral cues adjusting SCN rhythmicity to environmental cycles (Aton et al. 2005; Vosko et al. 2007; Nakagawa and Okumura 2010; An et al. 2011)synchrony between neurons, or both. We found that Vip(-/-. The presently found Kiss projections to the vlSCN could provide a novel feedback pathway for the circadian regulation of reproduction and functions that are associated with metabolic control (Hussain et al 2015).



142

Chapter 6

Kisspeptin shows diurnal oscillations in the AVPV, ARC and SCN. In rodents, the expression of Kiss mRNA in the AVPV peaks at approximately ZT11 together with the end of the LH surge, though this peak in Kiss mRNA is subtle at best (Smith et al. 2006; Maeda et al. 2007; Robertson, Clifton, de la Iglesia, et al. 2009; Smarr, Morris, and De La Iglesia 2012). In the AVPV, the daily peak of clock gene Per1 expression runs in tandem with Kiss mRNA expression (Smarr, Gile, and de la Iglesia 2013). This circadian rhythm is likely driven by the SCN since AVP efferents directly appose Kiss neurons in the AVPV in hamsters and mice (Vida et al. 2010; Williams et al. 2011). This could clarify the circuit through which SCN AVP release peaks together with c-fos activity in the AVPV just before the LH surge and subsequent ovulation (Kalsbeek et al. 1995; Robertson, Clifton, De La Iglesia, et al. 2009). Together with our observation that SCN projecting Kiss efferents appose VIP but not AVP neurons, dismisses the existence of a “simple” feedback circuit. Through immunohistochemistry and in situ hybridization we find diurnal variation in the storage/release and synthesis of Kiss in the AVPV and ARC. This variance with high Kiss-ir staining at ZT2 in the AVPV and ARC, of OVXE and OVX animals respectively, coincides with diurnal variation in Kiss-ir we observed in the SCN of OVX and OVXE animals. These findings, together with data found in literature on the temporal synthesis of Kiss with a peak at ZT11 (Smith et al. 2006; Maeda et al. 2007; Robertson, Clifton, de la Iglesia, et al. 2009; B. L. Smarr, Morris, and De La Iglesia 2012) suggest that Kiss accumulates in cell bodies and fibers at ZT2 while it is released at around ZT11 in the target areas of the Kiss neurons (Williams et al. 2011). However, there are multiple mechanisms regulating Kiss-ir intensity in the ARC (Lehman, Hileman, and Goodman 2013) and two time-points are arguably insufficient for interpreting changes based on immunohistochemistry thus further investigation is needed. It is surprising that in spite of the enormous changes in Kiss synthesis in AVPV and ARC under the influence of estrogen, the diurnal variation of innervation density in the SCN remains stable and independent of estrogen levels. Considering the fact that the SCN only sparsely expresses estrogen receptors with specifically VIP neurons expressing none (Vida et al. 2008), a possible mechanism through which the SCN can receive positive and negative estrogen feedback is via its Kiss innervation shown in this present study. This would imply that the SCN receives distinct Kiss input from the AVPV and ARC whereby differences in co-transmitters released from these Kiss expressing terminals either from AVPV or ARC might transmit a differential signal. For example, it is known that the majority of ARC Kiss neurons uniquely co-localize Dynorphin and Neurokinin B (Lehman, Coolen, and Goodman 2010; True et al. 2011; Weems et al. 2016) KNDy neurons are capable of transmitting both stimulatory (Kisspeptin and Neurokinin B) and inhibitory (Dynorphin) signals (Lehman, Coolen, and Goodman 2010; Helena et al. 2015), distinguishing KissARC signaling from KissAVPV stimuli. KNDy neurons are also likely involved in relaying nutritional status and stress on the reproductive system (Lehman, Coolen, and Goodman 2010) . We show that the SCN



143


6

is an important feedback target for both KissAVPV and KNDy neurons. Furthermore, Kiss mediated sex steroid feedback on SCN neuronal activity could explain why estrogen has an effect on the circadian rhythm of activity in free running animals (Morin, Fitzgerald, and Zucker 1977; Albers 1981). On the day of estrous, hamsters and rats show a phase advance in locomotor activity (Moline and Albers 1988) and running-wheel activity is increased on the day of estrous by the effects of estrogen on the AVPV (Ogawa et al. 2003)little is known about the separate roles of two types of estrogen receptors, ERalpha and ERbeta, both of which are expressed in mPOA neurons. In the present study the effects of continuous estrogen treatment on running wheel activity were examined in male and female mice specifically lacking either the ERalpha (alphaERKO. Similarly, it is well established that the absence of estrogen importantly alters rhythmic behavior and physiology (Thomas and Armstrong 1989). Ovariectomy increases and, by extension, peripheral sex steroids decrease the coupling between the control of body temperature rhythms and sleep (Li and Satinoff 1996). The different responses of the AVPV and ARC to estrogen and their diurnal varying input to the SCN might allow the SCN to adjust its output accordingly, without having to receive direct sex steroid input. A possible role for KissAVPV feedback to the SCN could be to synchronize ovulation with the temporal cycle of reproductive behavior. Kiss projections could serve to stimulate VIP-containing neurons that form appositions with GnRH neurons in the POA (van der Beek et al. 1997). Hereby, VIP can stimulate GnRH neurons, which are dependent on both estrogen, time of day and Kisspeptin input (Christian and Moenter 2008). VIP neurons have reciprocal connections with RFRP-3 neurons in the DMH (Gibson et al. 2008; Acosta-Galvan et al. 2011)the biological clock. Consequently, a food-entrained oscillator has been proposed to be responsible for meal time estimation. Recent studies suggested the dorsomedial hypothalamus (DMH, we demonstrate that similar to RFRP-3 neurons Kiss shows projections to the ventral part of the SCN where they appose VIP neurons innervation. This indicates a complex role for the SCN and VIP in regulating the circadian-timed preovulatory LH surge under the influence of inhibitory and excitatory sex-steroid feedback. The ARC is the hypothalamic metabolic integration center and fulfills an important role in the metabolic control of reproduction (Hill, Elmquist, and Elias 2008; Popa, Clifton, and Steiner 2008). As such, fasting has been shown to induce a pronounced decrease in estrogen (Otukonyoung 2000) and thus a stronger Kiss signal from the ARC. Hence we suggest that the ARC, while under the influence of fluctuating estrogen levels, could relay an integrated metabolic and estrogen signal to the SCN. We find KissARC neurons project to the SCN but it has also been demonstrated that KissARC neurons project to KissAVPV neurons where they have direct synaptic apposition to GnRH terminals (True et al. 2011; Goodman et al. 2013; Yip et al. 2015)such as kisspeptin (Kiss1. We show that next to the AVPV, the SCN is a possible target through which the ARC is able to the affect, and possibly reduce the LH surge thus suppressing ovulation in negative



144

Chapter 6

energy balance conditions (Matsuzaki et al. 2011)which is the product of the kiss1 gene and its receptor kiss1r, have emerged as the essential gatekeepers of reproduction. The present study used gonadally intact female rats to evaluate fasting-induced suppression of the KiSS-1 system of anteroventral periventricular nucleus (AVPV. Similarly, we previously demonstrated the importance of a synchronized interaction between the SCN and multiple hypothalamic nuclei. For temperature rhythmicity, we demonstrated in rats that for an adequate temperature decrease at dawn, SCN AVP output needs to coincide with temporal ɑ-MSH ARC output in the MnPO (Guzmán-Ruiz et al. 2015)daily changes in body temperature (Tb. In addition we have shown that the ARC-SCN interaction is essential for the organization of multiple physiological rhythms (Buijs et al 2017). The demonstrated KissARC and KissAVPV input to the SCN offers an interesting illustration of how the circadian system is dependent on different neuronal inputs to time physiological functions associated with reproduction.

ConclusionIt has long been known that the SCN is essential for the temporal organization of reproduction but more recently a pivotal role for Kisspeptin in the regulation of reproduction has emerged (Williams and Kriegsfeld 2012; Simonneaux and Bahougne 2015)estradiol-sensitive neural circuits that converge to optimally drive hypothalamo-pituitary-gonadal (HPG. Still much remains to be uncovered about the exact role of the SCN and that of Kisspeptin in the timing of the reproductive cycle. Here we demonstrate the existence of a temporally organized Kiss feedback pathway from both the AVPV and ARC to the SCN. This feedback circuit possibly mediates reproductive and metabolic feedback whereby both peak and trough estrogen levels are incorporated. This adds to the growing evidence that the SCN is an integral part of a hypothalamic multi-oscillatory network synchronized through different feedback pathways. We show the AVPV-SCN-ARC Kisspeptin systems are additional feedback circuits to be considered, adding to the complexity of circadian regulation of physiology and reproductive function.



145


6



146

Chapter 6

ReferencesAcosta-Galvan, Guadalupe, Chun-Xia Yi, Jan van der Vliet, Jack H Jhamandas, Pertti Panula, Manuel Angeles-Castellanos, María Del Carmen Basualdo, Carolina Escobar, and Ruud M Buijs. 2011. “Interaction between Hypothalamic Dorsomedial Nucleus and the Suprachiasmatic Nucleus Determines Intensity of Food Anticipatory Behavior.” Proceedings of the National Academy of Sciences of the United States of America 108 (14). National Academy of Sciences: 5813–18. doi:10.1073/pnas.1015551108.

Albers, H E. 1981. “Gonadal Hormones Organize and Modulate the Circadian System of the Rat.” The American Journal of Physiology 241 (1): R62-6. http://www.ncbi.nlm.nih.gov/pubmed/7246802.

An, S, R Harang, K Meeker, D Granados-Fuentes, C A Tsai, C Mazuski, J Kim, F J Doyle 3rd, L R Petzold, and E D Herzog. 2013. “A Neuropeptide Speeds Circadian Entrainment by Reducing Intercellular Synchrony.” Proc Natl Acad Sci U S A 110 (46): E4355-61. doi:10.1073/pnas.1307088110.

An, Sungwon, Robert P Irwin, Charles N Allen, Connie Tsai, and Erik D Herzog. 2011. “Vasoactive Intestinal Polypeptide Requires Parallel Changes in Adenylate Cyclase and Phospholipase C to Entrain Circadian Rhythms to a Predictable Phase.” Journal of Neurophysiology 105 (5): 2289–96. doi:10.1152/jn.00966.2010.

Aton, Sara J., Christopher S. Colwell, Anthony J. Harmar, James Waschek, and Erik D. Herzog. 2005. “Vasoactive Intestinal Polypeptide Mediates Circadian Rhythmicity and Synchrony in Mammalian Clock Neurons.” Nature Neuroscience 8 (4): 476–83. doi:10.1038/nn1419.

Beale, K.E., J.S. Kinsey-Jones, J.V. Gardiner, E.K. Harrison, E.L. Thompson, M.H. Hu, M.L. Sleeth, et al. 2014. “The Physiological Role of Arcuate Kisspeptin Neurons in the Control of Reproductive Function in Female Rats.” Endocrinology 155 (3): 1091–98. doi:10.1210/en.2013-1544.

Brown-Grant, K, and G Raisman. 1977. “Abnormalities in Reproductive Function Associated with the Destruction of the Suprachiasmatic Nuclei in Female Rats.” Proceedings of the Royal Society of London. Series B, Biological Sciences 198 (1132): 279–96. http://www.ncbi.nlm.nih.gov/pubmed/19755.

Buijs, Frederik N, Mara Guzmán-Ruiz, Luis León-Mercado, Mari Carmen Basualdo, Carolina Escobar, Andries Kalsbeek, and Ruud M Buijs. 2017. “Suprachiasmatic Nucleus Interaction with the Arcuate Nucleus; Essential for Organizing Physiological Rhythms.” Eneuro 4 (2). doi:10.1523/ENEURO.0028-17.2017.

Buijs, Frederik N, Luis León-Mercado, Mara Guzmán-Ruiz, Natali N Guerrero-Vargas, Francisco Romo-Nava, and Ruud M Buijs. 2016. “The Circadian System: A Regulatory Feedback Network of Periphery and Brain.” Physiology (Bethesda, Md.) 31 (3): 170–81. doi:10.1152/physiol.00037.2015.

Buijs, R M, a Kalsbeek, T P van der Woude, J J van Heerikhuize, and S Shinn. 1993. “Suprachiasmatic Nucleus Lesion Increases Corticosterone Secretion.” The American Journal of Physiology 264 (6 Pt 2): R1186–92.



147


6

Buijs, RM, C. W. Pool, J J van Heerikhuize, A. A. Sluiter, P.J. van der Sluis, M Ramkema, T P van der Woude, and E. M. Van Der Beek. 1989. “Antibodies to Small Transmitter Molecules and Peptides: Production and Applicatin of Antibodies to Dopamine, Serotonin, GABA, Vasopressin, Vasoactive Intestinal Peptide, Neuropeptide Y, Somatostatin and Substance P.” BioMed Research International 10 (Supplement 3): 213–21.

Christian, Catherine A, and Suzanne M Moenter. 2008. “Vasoactive Intestinal Polypeptide Can Excite Gonadotropin-Releasing Hormone Neurons in a Manner Dependent on Estradiol and Gated by Time of Day.” Endocrinology 149 (6): 3130–36. doi:10.1210/en.2007-1098.

Clarkson, Jenny, Wah Chin Boon, Evan R. Simpson, and Allan E. Herbison. 2009. “Postnatal Development of an Estradiol-Kisspeptin Positive Feedback Mechanism Implicated in Puberty Onset.” Endocrinology 150 (7): 3214–20. doi:10.1210/en.2008-1733.

Cravo, R M, L O Margatho, S Osborne-Lawrence, J Donato Jr., S Atkin, A L Bookout, S Rovinsky, et al. 2011. “Characterization of Kiss1 Neurons Using Transgenic Mouse Models.” Neuroscience 173: 37–56. doi:10.1016/j.neuroscience.2010.11.022.

de Roux, Nicolas, Emmanuelle Genin, Jean-Claude Carel, Fumihiko Matsuda, Jean-Louis Chaussain, and Edwin Milgrom. 2003. “Hypogonadotropic Hypogonadism Due to Loss of Function of the KiSS1-Derived Peptide Receptor GPR54.” Proc. Natl. Acad. Sci. U.S.A. 100: 10972–76. doi:10.1073/pnas.1834399100.

Desroziers, E., J. Mikkelsen, V. Simonneaux, M. Keller, Y. Tillet, A. Caraty, and I. Franceschini. 2010. “Mapping of Kisspeptin Fibres in the Brain of the Pro-Oestrous Rat.” Journal of Neuroendocrinology 22 (10): 1101–12. doi:10.1111/j.1365-2826.2010.02053.x.

Gerhold, Lynnette M., Tamas L. Horvath, and Marc E. Freeman. 2001. “Vasoactive Intestinal Peptide Fibers Innervate Neuroendocrine Dopaminergic Neurons.” Brain Research 919 (1): 48–56. doi:10.1016/S0006-8993(01)02993-6.

Gibson, Erin M, Stephanie A Humber, Sachi Jain, Wilbur P Williams, Sheng Zhao, George E Bentley, Kazuyoshi Tsutsui, and Lance J Kriegsfeld. 2008. “Alterations in RFamide-Related Peptide Expression Are Coordinated with the Preovulatory Luteinizing Hormone Surge.” Endocrinology 149 (10): 4958–69. doi:10.1210/en.2008-0316.

Goodman, Robert L, Stanley M Hileman, Casey C Nestor, Katrina L Porter, John M Connors, Steve L Hardy, Robert P Millar, Maria Cernea, Lique M Coolen, and Michael N Lehman. 2013. “Kisspeptin, Neurokinin B, and Dynorphin Act in the Arcuate Nucleus to Control Activity of the GnRH Pulse Generator in Ewes.” Endocrinology 154 (11): 4259–69. doi:10.1210/en.2013-1331.

Gottsch, M. L., M. J. Cunningham, J. T. Smith, S. M. Popa, B. V. Acohido, W. F. Crowley, S. Seminara, D. K. Clifton, and R. A. Steiner. 2004. “A Role for Kisspeptins in the Regulation of Gonadotropin Secretion in the Mouse.” Endocrinology 145 (9): 4073–77. doi:10.1210/en.2004-0431.



148

Chapter 6

Gu, G B, and R B Simerly. 1997. “Projections of the Sexually Dimorphic Anteroventral Periventricular Nucleus in the Female Rat.” The Journal of Comparative Neurology 384 (1): 142–64. http://www.ncbi.nlm.nih.gov/pubmed/9214545.

Guzmán-Ruiz, Mara Alaide, Arlen Ramirez-Corona, Natali Nadia Guerrero-Vargas, Elizabeth Sabath, Oscar Daniel Ramirez-Plascencia, Rebecca Fuentes-Romero, Luis Abel León-Mercado, MariCarmen Basualdo Sigales, Carolina Escobar, and Ruud Marinus Buijs. 2015. “Role of the Suprachiasmatic and Arcuate Nuclei in Diurnal Temperature Regulation in the Rat.” The Journal of Neuroscience : The Official Journal of the Society for Neuroscience 35 (46): 15419–29. doi:10.1523/JNEUROSCI.1449-15.2015.

Harmar, a J. 2003. “An Essential Role for Peptidergic Signalling in the Control of Circadian Rhythms in the Suprachiasmatic Nuclei.” Journal of Neuroendocrinology 15 (4): 335–38. http://www.ncbi.nlm.nih.gov/pubmed/12622830.

Helena, Cleyde V, Natalia Toporikova, Bruna Kalil, Andrea M Stathopoulos, Veronika V Pogrebna, Ruither O Carolino, Janete A Anselmo-Franci, and Richard Bertram. 2015. “KNDy Neurons Modulate the Magnitude of the Steroid-Induced Luteinizing Hormone Surges in Ovariectomized Rats.” Endocrinology 156 (11): 4200–4213. doi:10.1210/en.2015-1070.

Henningsen, Jo B, Caroline Ancel, Jens D Mikkelsen, François Gauer, and Valérie Simonneaux. 2017. “Roles of RFRP-3 in the Daily and Seasonal Regulation of Reproductive Activity in Female Syrian Hamsters.” Endocrinology 158 (3): 652–63. doi:10.1210/en.2016-1689.

Henningsen, Jo B, François Gauer, and Valérie Simonneaux. 2016. “RFRP Neurons - The Doorway to Understanding Seasonal Reproduction in Mammals.” Frontiers in Endocrinology 7 (May): 36. doi:10.3389/fendo.2016.00036.

Herzog, Erik D, and William J Schwartz. 2002. “A Neural Clockwork for Encoding Circadian Time.” Journal of Applied Physiology (Bethesda, Md. : 1985) 92 (1): 401–8. doi:10.1152/japplphysiol.00836.2001.

Hill, Jennifer W, Joel K Elmquist, and Carol F Elias. 2008. “Hypothalamic Pathways Linking Energy Balance and Reproduction.” American Journal of Physiology. Endocrinology and Metabolism 294 (5): E827–32. doi:10.1152/ajpendo.00670.2007.

Hu, M. H., X. F. Li, B. McCausland, S. Y. Li, R. Gresham, J. S. Kinsey-Jones, J. V. Gardiner, et al. 2015. “Relative Importance of the Arcuate and Anteroventral Periventricular Kisspeptin Neurons in Control of Puberty and Reproductive Function in Female Rats.” Endocrinology 156 (7): 2619–31. doi:10.1210/en.2014-1655.

Hughes, Alun T L, Clare Guilding, and Hugh D. Piggins. 2011. “Neuropeptide Signaling Differentially Affects Phase Maintenance and Rhythm Generation in SCN and Extra-SCN Circadian Oscillators.” PLoS ONE 6 (4). doi:10.1371/journal.pone.0018926.

Irwig, Michael S., Gregory S. Fraley, Jeremy T. Smith, Blake V. Acohido, Simina M. Popa, Matthew J. Cunningham, Michelle L. Gottsch, et al. 2004. “Kisspeptin Activation of Gonadotropin Releasing



149


6

Hormone Neurons and Regulation of KiSS-1 MRNA in the Male Rat.” Neuroendocrinology 80 (4). Karger Publishers: 264–72. doi:10.1159/000083140.

Kalsbeek, A., R.M. Buijs, M. Engelmann, C.T. Wotjak, and R. Landgraf. 1995. “In Vivo Measurement of a Diurnal Variation in Vasopressin Release in the Rat Suprachiasmatic Nucleus.” Brain Research 682 (1–2): 75–82. doi:10.1016/0006-8993(95)00324-J.

Kauffman, Alexander S., Donald K. Clifton, and Robert A. Steiner. 2007. “Emerging Ideas about Kisspeptin- GPR54 Signaling in the Neuroendocrine Regulation of Reproduction.” Trends in Neurosciences 30 (10): 504–11. doi:10.1016/j.tins.2007.08.001.

Kerdelhué, Bernard, Ssmuel Brown, Véronique Lenoir, John T Queenan, Georgeanna Seegar Jones, Robert Scholler, and Howard W Jones. 2002. “Timing of Initiation of the Preovulatory Luteinizing Hormone Surge and Its Relationship with the Circadian Cortisol Rhythm in the Human.” Neuroendocrinology 75 (3): 158–63. doi:48233.

Kim, Joshua, Sheila J Semaan, Donald K Clifton, Robert A Steiner, Sangeeta Dhamija, and Alexander S Kauffman. 2011. “Regulation of Kiss1 Expression by Sex Steroids in the Amygdala of the Rat and Mouse.” Endocrinology 152 (5): 2020–30. doi:10.1210/en.2010-1498.

Legan, SJ, and FJ Karsch. 1975. “A Daily Signal for the LH Surge in the Rat.” Endocrinology 96 (1): 57–62. doi:10.1210/endo-96-1-57.

Lehman, Michael N, Lique M Coolen, and Robert L Goodman. 2010. “Minireview: Kisspeptin/Neurokinin B/Dynorphin (KNDy) Cells of the Arcuate Nucleus: A Central Node in the Control of Gonadotropin-Releasing Hormone Secretion.” Endocrinology 151 (8). The Endocrine Society: 3479–89. doi:10.1210/en.2010-0022.

Lehman, Michael N, Stanley M Hileman, and Robert L Goodman. 2013. “Neuroanatomy of the Kisspeptin Signaling System in Mammals: Comparative and Developmental Aspects.” Advances in Experimental Medicine and Biology 784: 27–62. doi:10.1007/978-1-4614-6199-9_3.

Li, H, and E Satinoff. 1996. “Body Temperature and Sleep in Intact and Ovariectomized Female Rats.” The American Journal of Physiology 271 (6 Pt 2): R1753-8. http://www.ncbi.nlm.nih.gov/pubmed/8997379.

Maeda, Kei Ichiro, Sachika Adachi, Kinji Inoue, Satoshi Ohkura, and Hiroko Tsukamura. 2007. “Metastin/Kisspeptin and Control of Estrous Cycle in Rats.” Reviews in Endocrine and Metabolic Disorders 8 (1): 21–29. doi:10.1007/s11154-007-9032-6.

Matsui, Hisanori, Yoshihiro Takatsu, Satoshi Kumano, Hirokazu Matsumoto, and Tetsuya Ohtaki. 2004. “Peripheral Administration of Metastin Induces Marked Gonadotropin Release and Ovulation in the Rat.” Biochemical and Biophysical Research Communications 320 (2): 383–88. doi:10.1016/j.bbrc.2004.05.185.



150

Chapter 6

Matsuzaki, Toshiya, Takeshi Iwasa, Riyo Kinouchi, Shinobu Yoshida, Masahiro Murakami, Ganbat Gereltsetseg, Satoshi Yamamoto, Akira Kuwahara, Toshiyuki Yasui, and Minoru Irahara. 2011. “Fasting Reduces the Kiss1 MRNA Levels in the Caudal Hypothalamus of Gonadally Intact Adult Female Rats.” Endocrine Journal 58 (11): 1003–12. doi:10.1507/endocrj.

Messager, Sophie, Emmanouella E Chatzidaki, Dan Ma, Alan G Hendrick, Dirk Zahn, John Dixon, Rosemary R Thresher, et al. 2005. “Kisspeptin Directly Stimulates Gonadotropin-Releasing Hormone Release via G Protein-Coupled Receptor 54.” Proceedings of the National Academy of Sciences of the United States of America 102 (5): 1761–66. doi:10.1073/pnas.0409330102.

Moline, Margaret L., and H.Elliott Albers. 1988. “Response of Circadian Locomotor Activity and the Proestrous Luteinizing Hormone Surge to Phase Shifts of the Light-Dark Cycle in the Hamster.” Physiology & Behavior 43 (4). Elsevier: 435–40. doi:10.1016/0031-9384(88)90116-3.

Morin, L P, K M Fitzgerald, and I Zucker. 1977. “Estradiol Shortens the Period of Hamster Circadian Rhythms.” Science (New York, N.Y.) 196 (4287): 305–7. http://www.ncbi.nlm.nih.gov/pubmed/557840.

Nakagawa, Hachiro, and Nobuaki Okumura. 2010. “Coordinated Regulation of Circadian Rhythms and Homeostasis by the Suprachiasmatic Nucleus.” Proceedings of the Japan Academy. Series B, Physical and Biological Sciences 86 (4): 391–409. doi:10.2183/pjab.86.391.

Norman, R L, C A Blake, and C H Sawyer. 1973. “Estrogen-Dependent 24-Hour Periodicity in Pituitary LH Release in the Female Hamster.” Endocrinology 93 (4): 965–70. doi:10.1210/endo-93-4-965.

Oakley, Amy E., Donald K. Clifton, and Robert A. Steiner. 2009. “Kisspeptin Signaling in the Brain.” Endocrine Reviews 30 (6): 713–43. doi:10.1210/er.2009-0005.

Ogawa, Sonoko, Johnny Chan, Jan-Ake Gustafsson, Kenneth S Korach, and Donald W Pfaff. 2003. “Estrogen Increases Locomotor Activity in Mice through Estrogen Receptor Alpha: Specificity for the Type of Activity.” Endocrinology 144 (1): 230–39. doi:10.1210/en.2002-220519.

Palm, I. F., E. M. Van Der Beek, V. M. Wiegant, R. M. Buijs, and A. Kalsbeek. 1999. “Vasopressin Induces a Luteinizing Hormone Surge in Ovariectomized, Estradiol-Treated Rats with Lesions of the Suprachiasmatic Nucleus.” Neuroscience 93 (2): 659–66. doi:10.1016/S0306-4522(99)00106-2.

Patterson, M., K. G. Murphy, E. L. Thompson, S. Patel, M. A. Ghatei, and S. R. Bloom. 2006. “Administration of Kisspeptin-54 into Discrete Regions of the Hypothalamus Potently Increases Plasma Luteinising Hormone and Testosterone in Male Adult Rats.” Journal of Neuroendocrinology 18 (5): 349–54. doi:10.1111/j.1365-2826.2006.01420.x.

Popa, Simina M., Donald K. Clifton, and Robert A. Steiner. 2008. “The Role of Kisspeptins and GPR54 in the Neuroendocrine Regulation of Reproduction.” Annual Review of Physiology 70 (1): 213–38. doi:10.1146/annurev.physiol.70.113006.100540.



151


6

Roa, Juan. 2013. “Role of GnRH Neurons and Their Neuronal Afferents as Key Integrators between Food Intake Regulatory Signals and the Control of Reproduction.” International Journal of Endocrinology 2013. doi:10.1155/2013/518046.

Robertson, Jessica L., Donald K. Clifton, Horacio O. De La Iglesia, Robert A. Steiner, and Alexander S. Kauffman. 2009. “Circadian Regulation of Kiss1 Neurons: Implications for Timing the Preovulatory Gonadotropin-Releasing Hormone/Luteinizing Hormone Surge.” Endocrinology 150 (8): 3664–71. doi:10.1210/en.2009-0247.

Robertson, Jessica L, Donald K Clifton, Horacio O de la Iglesia, Robert A Steiner, and Alexander S Kauffman. 2009. “Circadian Regulation of Kiss1 Neurons: Implications for Timing the Preovulatory Gonadotropin-Releasing Hormone/Luteinizing Hormone Surge.” Endocrinology 150 (8): 3664–71. doi:10.1210/en.2009-0247.

Saeb-Parsy, K., S. Lombardelli, F. Z. Khan, K. McDowall, I. T H Au-Yong, and R. E J Dyball. 2000. “Neural Connections of Hypothalamic Neuroendocrine Nuclei in the Rat.” Journal of Neuroendocrinology 12 (7): 635–48. doi:10.1046/j.1365-2826.2000.00503.x.

Samson, W K, and S M McCann. 1979. “Effects of Suprachiasmatic Nucleus Lesions on Hypothalamic LH-Releasing Hormone (LHRH) Content and Gonadotropin Secretion in the Ovariectomized (OVX) Female Rat.” Brain Research Bulletin 4 (6): 783–88. http://www.ncbi.nlm.nih.gov/pubmed/393365.

Seminara, Stephanie B., Sophie Messager, Emmanouella E. Chatzidaki, Rosemary R. Thresher, James S. Acierno, Jenna K. Shagoury, Yousef Bo-Abbas, et al. 2003. “The GPR54 Gene as a Regulator of Puberty.” New England Journal of Medicine 349 (17): 1614–27. doi:10.1056/NEJMoa035322.

Shinohara, K, K Tominaga, Y Isobe, and S T Inouye. 1993. “Photic Regulation of Peptides Located in the Ventrolateral Subdivision of the Suprachiasmatic Nucleus of the Rat: Daily Variations of Vasoactive Intestinal Polypeptide, Gastrin-Releasing Peptide, and Neuropeptide Y.” The Journal of Neuroscience : The Official Journal of the Society for Neuroscience 13 (2): 793–800. http://www.ncbi.nlm.nih.gov/pubmed/8426236.

Simonian, S X, D P Spratt, and A E Herbison. 1999. “Identification and Characterization of Estrogen Receptor Alpha-Containing Neurons Projecting to the Vicinity of the Gonadotropin-Releasing Hormone Perikarya in the Rostral Preoptic Area of the Rat.” The Journal of Comparative Neurology 411 (2): 346–58. http://www.ncbi.nlm.nih.gov/pubmed/10404258.

Simonneaux, Valérie, and Thibault Bahougne. 2015. “A Multi-Oscillatory Circadian System Times Female Reproduction.” Frontiers in Endocrinology 6 (OCT): 1–15. doi:10.3389/fendo.2015.00157.

Smarr, Benjamin L., Emma Morris, and Horacio O. De La Iglesia. 2012. “The Dorsomedial Suprachiasmatic Nucleus Times Circadian Expression of Kiss1 and the Luteinizing Hormone Surge.” Endocrinology 153 (6): 2839–50. doi:10.1210/en.2011-1857.

Smarr, BL, JJ Gile, and HO de la Iglesia. 2013. “Oestrogen-Independent Circadian Clock Gene Expression in the Anteroventral Periventricular Nucleus in Female Rats: Possible Role as an



152

Chapter 6

Integrator for Circadian and Ovarian Signals Timing the Luteinising Hormone Surge.” Journal of Neuroendocrinology 25 (12): 1273–79. doi:10.1111/jne.12104.

Smith, Jeremy T. 2008. “Kisspeptin Signalling in the Brain: Steroid Regulation in the Rodent and Ewe.” Brain Research Reviews 57 (2): 288–98. doi:10.1016/j.brainresrev.2007.04.002.

Smith, Jeremy T., Simina M. Popa, Donald K. Clifton, Gloria E. Hoffman, and Robert A. Steiner. 2006. “Kiss1 Neurons in the Forebrain as Central Processors for Generating the Preovulatory Luteinizing Hormone Surge.” The Journal of Neuroscience 26 (25): 6687–94. doi:10.1523/JNEUROSCI.1618-06.2006.

Smith, Jeremy T, Matthew J Cunningham, Emilie F Rissman, Donald K Clifton, and Robert A Steiner. 2005. “Regulation of Kiss1 Gene Expression in the Brain of the Female Mouse.” Endocrinology 146 (9): 3686–92. doi:10.1210/en.2005-0488.

Ström, Jakob O, Elvar Theodorsson, and Annette Theodorsson. 2008. “Order of Magnitude Differences between Methods for Maintaining Physiological 17beta-Oestradiol Concentrations in Ovariectomized Rats.” Scandinavian Journal of Clinical and Laboratory Investigation 68 (8): 814–22. doi:10.1080/00365510802409703.

Thomas, E M, and S M Armstrong. 1989. “Effect of Ovariectomy and Estradiol on Unity of Female Rat Circadian Rhythms.” The American Journal of Physiology 257 (5 Pt 2): R1241-50. http://www.ncbi.nlm.nih.gov/pubmed/2589549.

True, Cadence, Melissa Kirigiti, Philippe Ciofi, Kevin L Grove, and M Susan Smith. 2011. “Characterisation of Arcuate Nucleus Kisspeptin/Neurokinin B Neuronal Projections and Regulation during Lactation in the Rat.” Journal of Neuroendocrinology 23 (1): 52–64. doi:10.1111/j.1365-2826.2010.02076.x.

True, Cadence, Saurabh Verma, Kevin L Grove, and M Susan Smith. 2013. “Cocaine- and Amphetamine-Regulated Transcript Is a Potent Stimulator of GnRH and Kisspeptin Cells and May Contribute to Negative Energy Balance-Induced Reproductive Inhibition in Females.” Endocrinology 154 (8): 2821–32. doi:10.1210/en.2013-1156.

Ubuka, Takayoshi, You Lee Son, Yasuko Tobari, and Kazuyoshi Tsutsui. 2012. “Gonadotropin-Inhibitory Hormone Action in the Brain and Pituitary.” Frontiers in Endocrinology 3: 148. doi:10.3389/fendo.2012.00148.

Van der Beek, E M, T L Horvath, V M Wiegant, R Van den Hurk, and R M Buijs. 1997. “Evidence for a Direct Neuronal Pathway from the Suprachiasmatic Nucleus to the Gonadotropin-Releasing Hormone System: Combined Tracing and Light and Electron Microscopic Immunocytochemical Studies.” The Journal of Comparative Neurology 384 (4): 569–79. http://www.ncbi.nlm.nih.gov/pubmed/9259490.

van der Beek, E M, V M Wiegant, H J van Oudheusden, H A van der Donk, R van den Hurk, and R M Buijs. 1997. “Synaptic Contacts between Gonadotropin-Releasing Hormone-Containing Fibers and Neurons in the Suprachiasmatic Nucleus and Perichiasmatic Area: An Anatomical Substrate for Feedback Regulation?” Brain Research 755 (1): 101–11. http://www.ncbi.nlm.nih.gov/pubmed/9163545.



153


6

Van Der Beek, Eline M., Tamas L. Horvath, Victor M. Wiegant, Rob Den Van Hurk, and Ruud M. Buijs. 1997. “Evidence for a Direct Neuronal Pathway from the Suprachiasmatic Nucleus to the Gonadotropin-Releasing Hormone System: Combined Tracing and Light and Electron Microscopic Immunocytochemical Studies.” Journal of Comparative Neurology 384 (4): 569–79. doi:10.1002/(SICI)1096-9861(19970811)384:4<569::AID-CNE6>3.0.CO;2-0.

Vida, B., L. Deli, E. Hrabovszky, T. Kalamatianos, A. Caraty, C. W. Coen, Z. Liposits, and I. Kall?? 2010. “Evidence for Suprachiasmatic Vasopressin Neurones Innervating Kisspeptin Neurones in the Rostral Periventricular Area of the Mouse Brain: Regulation by Oestrogen.” Journal of Neuroendocrinology 22 (9): 1032–39. doi:10.1111/j.1365-2826.2010.02045.x.

Vida, B, E Hrabovszky, T Kalamatianos, C W Coen, Z Liposits, and I Kalló. 2008. “Oestrogen Receptor Alpha and Beta Immunoreactive Cells in the Suprachiasmatic Nucleus of Mice: Distribution, Sex Differences and Regulation by Gonadal Hormones.” Journal of Neuroendocrinology 20 (11): 1270–77. doi:10.1111/j.1365-2826.2008.01787.x.

Vosko, A M, A Schroeder, D H Loh, and C S Colwell. 2007. “Vasoactive Intestinal Peptide and the Mammalian Circadian System.” General and Comparative Endocrinology 152 (2–3): 165–75. doi:10.1016/j.ygcen.2007.04.018.

Weems, Peyton W., Christine F. Witty, Marcel Amstalden, Lique M. Coolen, Robert L. Goodman, and Michael N. Lehman. 2016. “ɑ-Opioid Receptor Is Colocalized in GnRH and KNDy Cells in the Female Ovine and Rat Brain.” Endocrinology 157 (6): 2367–79. doi:10.1210/en.2015-1763.

Wiegand, S J, E Terasawa, and W E Bridson. 1978. “Persistent Estrus and Blockade of Progesterone-Induced LH Release Follows Lesions Which Do Not Damage the Suprachiasmatic Nucleus.” Endocrinology 102 (5): 1645–48. doi:10.1210/endo-102-5-1645.

Wiegand, S J, E Terasawa, W E Bridson, and R W Goy. 1980. “Effects of Discrete Lesions of Preoptic and Suprachiasmatic Structures in the Female Rat. Alterations in the Feedback Regulation of Gonadotropin Secretion.” Neuroendocrinology 31 (2): 147–57. http://www.ncbi.nlm.nih.gov/pubmed/6771669.

Williams, Wilbur P., Stephan G. Jarjisian, Jens D. Mikkelsen, and Lance J. Kriegsfeld. 2011. “Circadian Control of Kisspeptin and a Gated GNRH Response Mediate the Preovulatory Luteinizing Hormone Surge.” Endocrinology 152 (2): 595–606. doi:10.1210/en.2010-0943.

Williams, Wilbur P., and Lance J. Kriegsfeld. 2012. “Circadian Control of Neuroendocrine Circuits Regulating Female Reproductive Function.” Frontiers in Endocrinology 3 (MAY): 1–14. doi:10.3389/fendo.2012.00060.

Yip, Siew Hoong, Ulrich Boehm, Allan E. Herbison, and Rebecca E. Campbell. 2015. “Conditional Viral Tract Tracing Delineates the Projections of the Distinct Kisspeptin Neuron Populations to Gonadotropin-Releasing Hormone (GnRH) Neurons in the Mouse.” Endocrinology 156 (7): 2582–94. doi:10.1210/en.2015-1131.



CHAPTER 7 - GENERAL DISCUSSION

Based upon: The circadian system: A regulatory feedback network of periphery and brain.

Buijs FNLeón-Mercado LGuzmán-Ruiz MGuerrero-Vargas NNRomo-Nava FBuijs RM.

Physiology (Bethesda). 31(3):170-81. (2016)



156

Chapter 7

AbstractCircadian rhythms are generated by the autonomous circadian master clock in the suprachiasmatic nucleus (SCN) and by clock genes that are present in all tissues of the body. The SCN times these peripheral clocks, as well as behavioral and physiological processes. Recent studies show that frequent violations of conditions set by our biological clock, as a consequence of shift work, jet lag, sleep deprivation or simply eating at the wrong time of the day, may have deleterious effects on health. This infringement, also known as circadian desynchronization, is associated with chronic diseases like diabetes, hypertension, cancer and psychiatric disorders. In this discussion we will evaluate the main hypothesis of this thesis: “The SCN is not solely an autonomous master clock imposing its rhythm onto the periphery, but depends on peripheral feedback in order to effectively regulate physiological functions”. We relate our present results to recent evidence showing that the SCN depends on peripheral feedback to fine-tune its output and adjust physiological processes to the requirements of the moment. This feedback can vary from neuronal or hormonal signals from the liver to, as we show, changes in blood pressure. Desynchronization between the SCN, light input and peripheral signals, potentially renders the circadian network dysfunctional, resulting in a breakdown of many physiological functions that are coordinated by the SCN. This disrupts core clock rhythms in the periphery and disorganizes cellular processes normally driven by the synchrony between behavior and peripheral signals, and neuronal and humoral output of the hypothalamus. Consequently this thesis proposes that the loss of synchrony between the different elements of this circadian network during shiftwork and (social) jet lag is the reason for the occurrence of many health problems.



157

General Discussion

7

From circadian synchronization and balance to divergence and diseaseSynchronizing the cardiovascular systemCardiovascular incidents follow a daily rhythm that has its highest incidence early in the activity period (Muller and others, 1985) suggesting the involvement of the circadian system in cardiovascular pathology. Recent studies have also emphasized a role for peripheral clock genes in cellular processes associated with blood pressure (BP) control. Within the adrenal, absence of cry has been associated with hyperaldosteronism and hypertension (Doi and others, 2010). In the kidney, the absence of per1 was associated with the deregulation of renal epithelial sodium channels (Gumz and others, 2009). Other clock genes have been implicated in vascular endothelial function (Viswambharan and others, 2007; Cheng and others, 2011) or in thrombogenesis (Westgate and others, 2008) with potential relevance for humans (Scheer and others, 2011). Still, the prevention of vascular pathology is dependent on the integrity and rhythmicity of the circadian system as a whole and not the mere consequence of bmal1 deficiency or clock mutation alone (Gibbs and others, 2014). Chronic changes in the SCN have been observed in both hypertensive humans and rats (Peters and others, 1994; Goncharuk and others, 2001) showing a link between an altered circadian system and disease. In chapter two we demonstrated the importance of the SCN not only as an autonomous clock, but also as an integration site in the physiological circuits regulating BP as is illustrated by the observation that the SCN receives cardiovascular feedback via the nucleus tractus solitarius (NTS). We showed that glutamatergic NTS projections to the SCN terminate in the ventrolateral part of the SCN, where light information also enters and BP elevations not only induced increased neuronal activity as measured by c-Fos in the NTS but also in the SCN. Lesioning the caudal NTS in turn prevented this activation. The increase of SCN neuronal activity by hypertensive stimuli suggested involvement of the SCN in counteracting BP elevations. As such we proved that the SCN is incorporated in a neuronal feedback circuit arising from the NTS, modulating cardiovascular reactivity. It also suggests that untimely changes in BP, which may occur in shift work, jet lag or prolonged activity at night, potentially disturbs the functionality of the SCN via this novel cardiovascular-NTS-SCN feedback pathway.A mouse model of induced cardiac hypertrophy is illustrative for the involvement of the SCN in cardiovascular regulation and development of disease. Forced desynchronization through shortened light-dark cycles significantly increased cardiac pathology as compared to synchronized animals. Restoration of the natural daily rhythmicity, thus resynchronizing the SCN and periphery, fully reversed this pathophysiology (Martino and others, 2007). This suggests that circadian desynchrony can greatly contribute to the progression of organ dysfunction and development of disease, while restoration of circadian rhythmicity potently reverses pathology. In recent years chrono-pharmacology has thus developed into a potentially effective way of treating cardiovascular disease associated with circadian desynchronization; e.g. the treatment of “non-dipper”



158

Chapter 7

hypertensive patients is more effective when the therapeutic window of anti-hypertensive drugs is aimed to match the physiological trough in blood pressure (Hermida and others, 2008). In addition, evening administration of low-dose aspirin significantly reduces morning platelet reactivity and thus the risk of thrombo-embolic events, which peak early in the morning (Bonten and others, 2015). Interestingly, repetitive night-time melatonin administration, known to amplify the rhythm of melatonin secretion via an action on the SCN (Bothorel and others, 2002), substantially reduces blood pressure in hypertensive patients (Scheer and others, 2004). In conclusion, it can be proposed that synchrony between the cardiovascular system and the SCN, through our demonstrated cardiovascular-NTS-SCN feedback pathway, is essential for homeostasis, whereas desynchronization within this system could ultimately result in the development of cardiovascular disease.

Circadian dysfunction in psychiatric disorders and their treatmentPeople suffering from depression, bipolar disorder (Novakova and others, 2014), anxiety or schizophrenia (Wulff and others, 2010) exhibit fatigue, changes in sleep, appetite and body weight and circadian desynchronization. Patients exhibit dampened temperature rhythms (Avery and others, 1999), altered cortisol levels —itself a predictor for the course of illness— (Vreeburg and others, 2013) and melatonin secretion (Lewy and others, 2006). Other visible features of chronic circadian desynchronization associated with psychiatric disorders are metabolic syndrome, obesity, diabetes, hypertension and dyslipidemia (Vancampfort and others, 2015), all contributing to premature death occurring up to 10 years earlier as compared to the general population. Clinically depressed individuals exhibit clock gene dysregulation in specific brain areas, abnormal phasing of clock gene expression and potentially disrupted phase relationships between individual circadian genes, suggesting a desynchronization within the circadian network (Li and others, 2013) This is supported by the observation that multiple simultaneous chronotherapeutic interventions aimed at synchronizing the circadian system, using bright light therapy and advancing the sleep phase, are an effective treatment for sustained improvement in severely depressed patients (Wu et al. 2009)which acts within 24-48 hours in 40%-60% of depressed patients. Conventional antidepressants usually require 2-8 weeks to meet response criteria. The delay, which may prolong suffering and increase suicidal risk, underlines the urgency of alternative treatment strategies. This study evaluates the combined efficacy of three established circadian-related treatments (SD, bright light [BL]. Interestingly, many pharmacological agents for the treatment of psychiatric disorders, i.e., olanzapine and quetiapine, have large cardiovascular and metabolic side effects that are under-diagnosed and undertreated (Steylen and others, 2013). Synchronizing the circadian system by administration of nightly melatonin, significantly decreases drug-induced proneness to obesity and blood pressure alterations (Romo-Nava and others, 2014). As such, in chapter three we demonstrated the SCN



159

General Discussion

7

as a key nucleus mediating the early effects of olanzapine on cardiovascular function. Second generation antipsychotics are associated with adverse cardio metabolic side effects contributing to premature mortality in patients. While mechanisms mediating these cardiometabolic side effects remain poorly understood, three independent studies (Romo-Nava, 2014; Modabbernia, 2014; Mostafavi, 2014) demonstrated that melatonin was protective against cardio-metabolic risk in patients receiving antipsychotics. We demonstrated that melatonin has an opposing and potentially protective effects on cardiovascular disease associated with olanzapine use. This finding re-affirms an important role of melatonin in synchronizing the circadian system and prevention of cardiovascular and metabolic pathology, also in relation to adverse effects associated with antipsychotic drugs.

Metabolic information: multiple sources and multiple integration sites.An optimal metabolic state is of such importance that almost all physiological systems react to metabolic cues. Since the availability of food supply is evolutionary closely linked to the activity period, the biological clock —in interaction with the hypothalamus— plays an essential role in timing adequate circadian metabolic control. This only recently has become clear by experiments showing that the SCN receives strong feedback of peripheral metabolic signals. For example, the liver is capable of sending a starvation signal by fibroblast growth factor-21 (FGF21) secretion into the circulation, directly reaching SCN receptors. This induces a decrease of systemic insulin, an increase of corticosterone levels, an inhibition of growth and a change in locomotor activity and reproduction (Bookout and others, 2013). Besides this direct metabolic feedback at the level of the SCN, in chapter four and five we discussed the intergeniculate leaflet (IGL) and arcuate nucleus (ARC) respectively as important relays in transmitting metabolic feedback to the SCN. The ARC is the main metabolic integration center of the hypothalamus. For example, leptin, secreted by adipose tissue, may target the SCN via the ARC since ablation of leptin receptor expressing neurons in the ARC leads to the disruption of the circadian rhythm in food intake (Li and others, 2012). Similarly, deletion of ROCK1, a key kinase in the signaling of leptin, leads to severe diminishment of spontaneous daily locomotor activity, suggesting an essential role for metabolic feedback to the ARC in maintaining circadian rhythmicity (Li and others, 2012; Huang and others, 2012). Moreover, circadian control of body temperature is dependent on concurring arginine vasopressin (AVP) and ɑ-melanocyte-stimulating hormone (a-MSH) signaling from SCN and ARC to the medial preoptic area (MnPO), orchestrating a time-dependent temperature decrease (Guzman-Ruiz and others, 2015). This illustrates the need for the SCN to synchronize via metabolic cues in order to obtain adequate control of physiology. These metabolic cues are also potentially important for rhythmicity as illustrated by observations that metabolic signals originating from the ARC (Yi and others, 2008), lateral hypothalamus (LH) (Belle and others, 2014) or IGL are capable of changing the activity of the ventrolateral area of the SCN.



160

Chapter 7

Proving the latter, in chapter four, we show that the IGL–SCN axis is also importantly changed by the metabolic condition of an animal and that NPY and gamma-aminobutyric acid (GABA) have a prominent role in transmitting this metabolic information. As such we prove that the SCN does not depend exclusively on the ARC or NTS to obtain information about the metabolic status, but that the IGL can also transmit metabolic information that it receives from NTS and the nucleus gracilis. This integration of metabolic information within the ventrolateral area of the SCN, associated with synchronizing the rhythm of SCN activity, could provide a pathway for the synchronizing effect of food on the SCN. This, for example, was shown in hypocaloric food restricted animals whereby, in contrast to normocaloric fed animals, feeding cues were able to alter SCN clock gene oscillations (Mendoza and others, 2005). In vivo lesioning studies have demonstrated the importance of the network properties of the mediobasal hypothalamus in maintaining circadian rhythmicity (Gerkema and others, 1990), thus confirming early studies showing loss of activity rhythms due to knife cuts posterior to the SCN (Moore and Eichler, 1972). Altogether this argues for a system where the SCN, coupled to other hypothalamic nuclei (and peripheral organs), forms a network of oscillators, essential for maintaining circadian rhythmicity. This may explain why long-term desynchronous metabolic feedback has a deleterious effect on the circadian system and on health. In rodents, high fat diet or food intake during the rest phase desynchronizes and dampens clock gene rhythmicity (Damiola and others, 2000), leading to obesity, insulin resistance (Dibner and Schibler, 2015) and cardiovascular disease (Paschos and FitzGerald, 2010). Interestingly, when feeding mice high-fat diet (HFD) in a time restricted manner they were protected from obesity, hyperinsulinemia, hepatic steatosis, and inflammation as compared to their ad libitum counterparts, while consuming an equivalent amount of calories (Hatori et al. 2012)animals fed a high-fat diet (HFD. These observations provide a link as to why these diseases, including cancer, have an increased incidence in shift workers (Davis and others, 2001; Knutsson and Kempe, 2014). Another example can be found in humans with night-eating syndrome, where high caloric intake during the resting phase disrupts the normal circadian pattern and results in an increased tendency to develop obesity (Howell and Schenck, 2009). For a detailed review of metabolic desynchronization and consequential health effects, see (Gamble and others, 2013). Since behavior and SCN clock genes can also be synchronized to food (Lamont and others, 2005; Mendoza and others, 2005), food may have a protective effect on desynchrony. This is shown in a rat model of shift work, whereby restricting food intake to the normal activity period while working in the rest period induces a significantly lower weight gain and increased insulin sensitivity as compared to ad libitum feeding shift worker animals (Salgado-Delgado and others, 2010). This shows that the hypothalamic circadian system, with the SCN at its core, is a complex reciprocally connected network that organizes metabolic homeostasis of the body and is capable of being (de)synchronized through peripheral signals (Figure 1). In the next paragraphs we will give some examples of how SCN driven physiological rhythms are not driven in isolation but depend on each other in order to become fully rhythmic.



161

General Discussion

7

Figure 1. Feedback networks of the circadian system. Our hypothesis on the functioning of the circadian system consists of

multiple interconnected feedback loops regulating physiology. Illustrated are three interconnected feedback loops: hypothalamus,

brain stem/spinal cord, and periphery, within which, of course, are many other feedback loops on cellular, tissue, and organ level.

1) Within the hypothalamus, the suprachiasmatic nucleus (SCN) sends timing signals to several target areas including the medial

preoptic area (MnPO) for temperature regulation and reproduction; paraventricular nucleus (PVN) for hormone release and autonomic

output; dorsomedial nucleus of the hypothalamus (DMH) as hypothalamic integration center; arcuate nucleus (ARC) as center for

sensory metabolic information. All these nuclei are interconnected and the SCN receives direct feedback from all but the PVN. 2) The

brain stem/spinal cord feedback loop receives direct and indirect temporal information through the rostral ventral lateral medulla

(RVLM), nucleus tractus solitarius (NTS), area postrema (AP), and the sensory layers lamina I–IV (I–IV) of the spinal cord. These nuclei

function as integration centers for peripheral and central signals and are responsible for autonomic physiological refl exes transmitted

to the dorsal motor nucleus of the vagus (DMV) and intermediolateral column (IML) that serve as autonomic output nuclei. 3) The

periphery receives temporal signals from the hypothalamus via autonomic output of the parasympathetic motor neurons in the DMV

and via sympathetic motoneurons in the IML. In addition, circadian signals are also transmitted via hormones such as melatonin and

corticosterone or by nutrients like glucose. The red ovals represent structures that receive autonomic sensory feedback such as the

area postrema (AP), NTS, and the sensory layers lamina I–IV (I–IV) of the spinal cord; or hormonal and metabolic feedback from the

circulation such as the AP, ARC, and SCN. Moreover, peripheral organs may communicate with each other via a circuit consisting of

autonomic sensory signaling to the AP, NTS, and I-IV of the spinal cord followed by refl ex automatic adjustment of autonomic output.

Any disturbance or desynchrony between and within these circuits could, in time, potentially lead to pathology and disease.



162

Chapter 7

Temperature: Circadian and metabolic influencesAhead of the active phase, core body temperature (Tb) starts to increase, independent of locomotor activity, while Tb drops just prior to activity cessation in the resting phase (Refinetti and Menaker, 1992; Scheer and others, 2005). The central role of the SCN in the metabolic and temperature regulating network becomes clear when noting that SCN lesions prevent not only temporal Tb rhythmicity but also fasting-induced Tb decrease (Liu and others, 2002). The fasting-induced decrease in body temperature is preceded by a drop in metabolic rate hinting at a significant role for the ARC in this regulatory system. In fact, numerous hypothalamic nuclei, i.e., dorsomedial hypothalamus (DMH), ventromedial hypothalamus (VMH), ARC and MnPO with the SCN at its core, are all jointly involved in temperature control (Morrison and Nakamura, 2011), revealing a complex temperature-regulating network. On the basis of observed interactions between the SCN and ARC (Saeb-Parsy and Dyball, 2003; Guzman-Ruiz and others, 2014) it was shown that the Tb rhythm depends on an interplay between temporal signals from the SCN and metabolic signals arising from the ARC (Guzman-Ruiz and others, 2015). Not only is an SCN driven rhythm of ARC neurons essential for this, it also requires a synchronized release of SCN vasopressin and ARC ɑ-MSH neurotransmitters in the MnPO, to organize diurnal temperature decreases in rats. Lesions of specific ARC neuronal populations critically modify circadian patterns in food intake and locomotor activity (Coppari and others, 2005; Wiater and others, 2011; Li and others, 2012; Huang et al 2013) Further exploring this notion, in chapter five we showed that the SCN-ARC axis serves to synchronize SCN and ARC output and that circadian rhythms in activity, temperature and corticosterone are lost in constant dark conditions when this SCN-ARC axis is disrupted. We also demonstrate that metabolic feedback to the SCN is significantly altered when SCN-ARC interconnectivity is cut causing an altered neuronal activation of the ARC but also of the SCN. This confirms the previously suggested idea (Webb et al., 2009; Hu et al., 2012; Buijs et al., 2016), that the SCN functions inside a larger circadian network of tightly linked oscillatory feedback circuits whose integral function is essential for regulating physiologic and behavioral functions. Long-term desynchronization within this circadian network due to changes in dietary habits, chronic jetlag, or shift work is known to contribute to pathology associated with “modern lifestyle,” such as hypertension, obesity, diabetes, and cancer (Scheer et al., 2010; Leproult et al., 2014; Kettner et al., 2016). We therefore propose that ill-timed food intake and altered metabolic signals are able to alter normal ARC activity patterns, as such changing its synchronization with the SCN and as consequence disrupting associated behavioral and hormonal patterns. Thus, faulty network connections or erroneous feedback may reshape the circadian system to a new equilibrium, leading to physiologic impairment and pathology.



163

General Discussion

7

The hypothalamic-pituitary-adrenal axis and the preparation for activity and foodThe hypothalamic-pituitary-adrenal (HPA) axis is under strong control of the SCN. SCN induced release of vasopressin in the beginning of the sleep phase has a strong inhibitory influence on the secretion of ACTH and corticosterone (Kalsbeek and others, 1996) whereas diminishing this inhibitory input towards the beginning of the active period induces the diurnal peak in corticosterone preparing the animals for activity onset. Interestingly, crepuscular animals, active at dusk and dawn, have two SCN driven peaks of corticosterone (Kalsbeek and others, 2008). Closely associated with, but not driven by corticosterone, is the peak of circulating glucose. Corticosterone signaling to the ARC reduces hepatic insulin sensitivity (Yi and others, 2012), creating a perfect harmony between the corticosterone and glucose peaks, whose rhythms are synchronized by the SCN. This observation might be relevant in explaining why such strong metabolic alterations are observed in hypercortisolism. The same is seen in stress disorders or in chronic jet-lag/shift work mimicking the effects of chronic stress, causing increased glucocorticoid production which is correlated with developing diabetes and obesity (Kolbe, Dumbell, and Oster 2015).

Locomotor activity fine-tunes SCN rhythmicityLocomotor activity, closely associated with arousal, has an effect on SCN neuronal activity and synchronization of the circadian system, although at a much lower intensity than light. Nevertheless, activity has been shown to directly inhibit the neuronal firing in the SCN, especially during the subjective day (Yamazaki and others, 1998; Schaap and Meijer, 2001). Thus activity may be a potential (de)synchronizer of the circadian system. The synchronizing property is seen in daily forced locomotor activity in constant darkness (DD): when the forced activity is halted, free running rhythms run closer to 24-h than the prior basal free running rhythm, even in mice that lack VIP receptor type 2 (VPAC2R) (Hughes and Piggins, 2012). VIP and its receptor, VPAC2R, are important for synchronizing the SCN. As such animals lacking VPAC2R show changed circadian rhythms and impaired synchronization to light cues. This suggests a form of synchronization occurring following daily forced locomotor activity. Activity may also feed back on areas outside the SCN, for example, the Raphe nucleus is known to be important for the synchronization of SCN neuronal activity through its serotonin projections, i.e., by desensitizing the SCN to light (Van de Kar and Lorens, 1979; Malek and others, 2007). The SCN and hypothalamus take turns to synchronize the Raphe nucleus through locomotor activity and corticosterone; they both target and induce rhythmicity in serotonin synthesis (Malek and others, 2007). This is significant because it illustrates how the SCN receives feedback related to its own output and is able to synchronize through locomotor activity and corticosterone release, serotonin synthesis. Another example is melatonin secretion, driven by the SCN at night, it also enforces the night signal through melatonin receptors in the SCN (Reppert, 1997; van den Top et al. 2001; Bothorel and others, 2002). These examples illustrate how important amplification of the proper circadian rhythms can be for maintaining or restoring adequate physiological function.



164

Chapter 7

Synchronizing the immune systemThe circadian system has a strong influence on the immune system, e.g., mortality is greater when bacterial endotoxin, LPS (lipopolysaccharide), is given to rodents during the night, a time that coincides with increased pro-inflammatory cytokine production after LPS (Marpegan and others, 2005). It is suggested that the SCN is incorporated into a regulatory circuit between the immune system and the brain, as shown by the activation of the SCN following an inflammatory stimulus. Ablation of the SCN amplifies the innate immune response several fold, suggesting an inhibitory influence of the SCN (Guerrero-Vargas and others, 2014). Clock genes in immune cells also play an important role in the immune response (Silver and others, 2012), further emphasizing the role of the circadian system. Cytokine interferon-a, used in cancer treatment, has a strong disruptive effect on locomotor activity and body temperature as well as on clock gene expression in the SCN. These adverse effects are for a large part prevented by changing the time of administration (Ohdo and others, 2001), emphasizing the strong interaction between circadian regulation and the immune system. Circadian desynchronization induced by shift work in rats is associated with an enhanced inflammatory response that was prevented by synchronizing food with the normal feeding time (Guerrero-Vargas and others, 2015). For that reason, therapies limiting food intake to the normal activity period may help to balance the immune response and may prevent development of inflammatory diseases. Since the discovery of oscillatory clock gene expression in tumors, chrono-pharmacological cancer treatment—finding the optimal times for drug administration based on circadian variation in drug pharmacokinetics, efficacy and tolerance—has received much attention, and has given promising results. Studies show that chrono-chemotherapy improved therapeutic outcome and survival for numerous types of cancer in humans (Innominato and others, 2014).

Aligning the reproductive systemThe SCN is essential for integrating and synchronizing all neuroendocrine signals involved in initiating a well-timed GnRH–LH surge (Smarr and others, 2012). Several studies have shown the importance of SCN signaling, through VIP (Van Der Beek and others, 1997; Sun and others, 2012) directed to GnRH neurons, or vasopressin (Palm and others, 1999), in interaction with the Kisspeptin system (Smarr and others, 2012), for accurately timing the LH surge. However, reproduction does not solely depend on a correctly functioning SCN: without peripheral signals, i.e. about the metabolic state of the body, a reproductive cycle cannot be completed. A liver-neuroendocrine signaling pathway has recently been described through which FGF21, a fasting-induced hepatokine, acts through the SCN, suppressing the vasopressin-kisspeptin signaling cascade and thereby inhibiting ovulation during starvation (Owen and others, 2013). Other fasting-elicited hormonal changes, such as low leptin levels, also prevent a successful cycle (Bellefontaine and others, 2014). These examples show that not only circadian timing but also synchronized metabolic and



165

General Discussion

7

physiological feedback is essential for a successful reproductive cycle. In chapter six we demonstrated the importance of reciprocal interaction between the SCN, the inhibitory RFamide-related peptide-3 (RFRP-3) neurons (the mammalian ortholog of gonadotropin-inhibitory hormone), the stimulatory Kisspeptin neurons in the AVPV and the Kisspeptin neurons in the ARC (that are probably both stimulatory and inhibitory) for a successful LH surge. This indicates the presence of another integrated feedback/feedforward circuits acting in synchrony for the adequate timing of physiological events.

Conclusions In this thesis we have argued that, with the SCN at its center, the circadian system forms a coupled multi-oscillatory system, wherein each participating nucleus receives a multitude of signals, providing this information into the system, thus fine-tuning circadian rhythmicity. The oscillatory organization of this system is maintained through the core rhythm of the SCN that, through hormonal, neuronal or behavioral signals, fine-tunes bodily functions to the activity or resting period. The autonomous rhythm of the SCN is augmented and fortified through cerebral and peripheral feedback, making the circadian system more robust and less prone to environmental variations. However, as a consequence long-term perturbations through drug use, untimely light exposure or disorderly behavior will induce peripheral signaling capable of disrupting this harmony, rendering an individual more in disbalance and therefore susceptible to disease. The SCN not only functions as a sophisticated timing mechanism but is integrated in multiple oscillatory feedback circuits involved in the regulation of physiological and behavioral functions. The proneness of oscillatory networks to desynchronization has recently been analyzed through a mathematical model of the evolution of feedback networks in bacteria, fungi and drosophila (Noman and others, 2015). The robustness of a network was demonstrated to be dependent on the number of interconnections and the number of regulators per connection, with an increasing number of interconnections and regulators associated with an increase in robustness. This is also illustrative for the circadian systems functioning, e.g., by the molecular feedback loops controlling clock genes rhythmicity inside individual SCN neurons. In turn, these weakly rhythmic individual neurons (Herzog and Schwartz, 2002) function inside larger coupled network, making up the SCN, driving a common rhythm and regulating its circadian output. Considering the studies presented and/or reviewed in this thesis, the SCN is in turn incorporated in a larger hypothalamic network of oscillators integrating peripheral signals. Finally, behavior and external stimuli like food intake or drug (ab)use also have their place in the feedback circuitry of the organism, adjusting adequate circadian functions (Figure 2). The multiple intertwined feedback loops of the circadian system makes it robust and capable of withstanding brief erroneous feedback, but months or years of conflicting feedback, ill-timed behavior or chronic jetlag/shift work, will increase susceptibility to pathology and disease.



166

Chapter 7

Figure 2. Proposed organization of synchrony in the circadian system. Whether an organism is in equilibrium depends on

whether the multitude of circadian rhythms expressed are in synchrony or oppose each other. A synchronized and healthy situation

is depicted on the left where light synchronizes the activity and rhythm of the SCN. The SCN transmits this rhythm via the autonomic

nervous system (ANS), hormone secretion, and behavior to the body, thus synchronizing the periphery and adjusting the physiology

according to time of day (red arrow). In turn, the periphery sends feedback to the brain via metabolites, hormones, and autonomic

sensory pathways (green arrow). The periphery, through release of hormones and metabolites and in concert with autonomic signaling,

also affects locomotor activity and foraging behavior (green arrow). Behavior, through locomotor activity or eating behavior, feeds

back to the periphery and the brain (blue arrows), amplifying circadian rhythmicity and synchrony. When, as depicted on the right,

the light-dark cycle, behavior, and peripheral signals do not align with that of the SCN or the hypothalamus (broken arrows), the

deleterious feedback interferes with the circadian system equilibrium, which in the long term could potentially lead to desynchrony

and development of disease. Chronotherapy in the form of circadian-timed drug administration or synchronizing sleeping/eating

behavior with the light-dark cycle (orange arrow) can augment circadian system resynchronization, potentially reversing pathology

and reducing disease.



167

General Discussion

7

Future directionsThe main goal of the present thesis was to establish the significance of a circadian feedback network with the SCN at its core. We have tried to reveal feedback loops incorporating the SCN and demonstrate its ability to affect SCN activity resulting in altered physiological regulation. The complex nature of our proposed circadian network suggests that it will take time before the full complexity of the circadian system will be understood. We and others (Brandstaetter, 2004), suggest that a holistic approach will be crucial in filling in the many gaps in our knowledge of the circadian system. Many current developments in (molecular) chronobiology, such as in vitro analysis, conditional knock-out animals and optogenetics are doubtlessly invaluable and indispensable in present chronobiology research. However, considering the complexity of the circadian network, caution should be exercised in extrapolating conclusions from in vitro analysis into in vivo models. For example, in spite of in vitro data suggesting the direct production of NAMPT via CLOCK/BMAL1 (Ramsey and others, 2009) it has been observed that in animals eating during the light period, NAD+ and NAMPT, together with certain metabolic genes, do not follow the inversion of rhythm in core clock genes like CLOCK/BMAL1 (Salgado-Delgado and others, 2013). These observations indicate that in vivo, alternative essential molecular relationships prevail, likely driven by other components of the circadian system, such as melatonin or corticosterone. Testing isolated brain areas in vitro, or selectively activating small populations of neurons in vivo through optogenetics, gives insight into an isolated stimulus response, but fails to give a full picture as to how systemic physiological processes are truly regulated. Basic physiological experimentation and research is thus still very important for an understanding of physiological functions of the organism as a whole.

When we increase our understanding the complexity of physiological function and the entwinement of the circadian system with body functions, we will better be able to understand the adaptive changes taking place when deleterious feedback results in pathophysiological conditions and disease. As discussed, ultimately this understanding will help us to uncover new therapeutic strategies for e.g. cancer, obesity, cardiovascular disease and dementia.

Important progress has been made in understanding the impact of chronotherapy, especially in cancer (Ballesta et al. 2017). However, chronotherapy in clinical trials or in the hospital setting is still highly underused (Selfridge et al. 2016)physiological, and behavioral processes that oscillate in a 24-h cycle and can be entrained by external cues. Circadian clock molecules are responsible for the expression of regulatory components that modulate, among others, the cell’s metabolism and energy consumption. In clinical practice, the regulation of clock mechanisms is relevant to biotransformation of therapeutics. Accordingly, xenobiotic metabolism and detoxification, the two processes that directly influence drug effectiveness and toxicity, are direct manifestations of the



168

Chapter 7

daily oscillations of the cellular and biochemical processes taking place within the gastrointestinal, hepatic/biliary, and renal/urologic systems. Consequently, the impact of circadian timing should be factored in when developing therapeutic regimens aimed at achieving maximum efficacy, minimum toxicity, and decreased adverse effects in a patient. However, and despite a strong mechanistic foundation, only 0.16 % of ongoing clinical trials worldwide exploit the concept of ‘time-of-day’ administration to develop safer and more effective therapies. In this article, we (1. A more broad application of circadian timing should be made in developing new therapeutic strategies with a focus on maximizing efficacy, reducing toxicity, and decreasing adverse effects in patients. The future will be bright when chronotherapy is integrated in the development of more effective treatment paradigms.



169

General Discussion

7



170

Chapter 7

ReferencesAhima RS, Prabakaran D, Mantzoros C, Qu D, Lowell B, Maratos-Flier E, Flier JS. 1996. Role of leptin in the neuroendocrine response to fasting. Nature 382(6588):250-2.

Albus H, Vansteensel MJ, Michel S, Block GD, Meijer JH. 2005. A GABAergic Mechanism Is Necessary for Coupling Dissociable Ventral and Dorsal Regional Oscillators within the Circadian Clock. Curr Biol 15(10):886-93.

An S, Harang R, Meeker K, Granados-Fuentes D, Tsai CA, Mazuski C, Kim J, Doyle FJ, III, Petzold LR, Herzog ED. 2013. A neuropeptide speeds circadian entrainment by reducing intercellular synchrony. Proc Natl Acad Sci U S A 110(46):E4355-E4361.

Avery DH, Shah SH, Eder DN, Wildschiodtz G. 1999. Nocturnal sweating and temperature in depression. Acta Psychiatr Scand 100(4):295-301.

Ballesta, Annabelle, Pasquale F. Innominato, Robert Dallmann, David A. Rand, and Francis A. Lévi. 2017. Systems Chronotherapeutics. Edited by Stephanie W. Watts. Pharmacological Reviews 69 (2): 161–99. doi:10.1124/pr.116.013441.

Balsalobre A, Brown SA, Marcacci L, Tronche F, Kellendonk C, Reichardt HM, Schutz G, Schibler U. 2000. Resetting of circadian time in peripheral tissues by glucocorticoid signaling. Science 289:2344-7.

Belle MD, Hughes AT, Bechtold DA, Cunningham P, Pierucci M, Burdakov D, Piggins HD. 2014. Acute suppressive and long-term phase modulation actions of orexin on the Mammalian circadian clock. J Neurosci 34(10):3607-21.

Bellefontaine N, Chachlaki K, Parkash J, Vanacker C, Colledge W, d’Anglemont dT, X, Garthwaite J, Bouret SG, Prevot V. 2014. Leptin-dependent neuronal NO signaling in the preoptic hypothalamus facilitates reproduction. J Clin Invest 124(8):3678.

Bonten TN, Snoep JD, Assendelft WJ, Zwaginga JJ, Eikenboom J, Huisman MV, Rosendaal FR, van der Bom JG. 2015. Time-dependent effects of aspirin on blood pressure and morning platelet reactivity: a randomized cross-over trial. Hypertension 65(4):743-50.

Bookout AL, de Groot MH, Owen BM, Lee S, Gautron L, Lawrence HL, Ding X, Elmquist JK, Takahashi JS, Mangelsdorf DJ, Kliewer SA. 2013. FGF21 regulates metabolism and circadian behavior by acting on the nervous system. Nat Med 19(9):1147-52.

Bothorel B, Barassin S, Saboureau M, Perreau S, Vivien-Roels B, Malan A, Pevet P. 2002. In the rat, exogenous melatonin increases the amplitude of pineal melatonin secretion by a direct action on the circadian clock. Eur J Neurosci 16(6):1090-8.

Brandstaetter R. 2004. Circadian lessons from peripheral clocks: is the time of the mammalian pacemaker up? Proc Natl Acad Sci U S A 101(16):5699-700.



171

General Discussion

7

Brown SA, Zumbrunn G, Fleury-Olela F, Preitner N, Schibler U. 2002. Rhythms of mammalian body temperature can sustain peripheral circadian clocks. Curr Biol 12(18):1574-83.

Buijs FN, Cazarez F, Basualdo MC, Scheer FA, Perusquia M, Centurion D, Buijs RM. 2014. The suprachiasmatic nucleus is part of a neural feedback circuit adapting blood pressure response. Neuroscience 266:197-207.

Buijs RM, Escobar C, Swaab DF. 2013. The circadian system and the balance of the autonomic nervous system. Handb Clin Neurol 117:173-91.

Buijs RM, Kalsbeek A. 2001. Hypothalamic integration of central and peripheral clocks. Nat Rev Neurosci 2:521-6.

Buijs RM, Scheer FA, Kreier F, Yi C, Bos N, Goncharuk VD, Kalsbeek A. 2006. Chapter 20: Organization of circadian functions: interaction with the body. Prog Brain Res 153:341-60.

Cailotto C, La Fleur SE, Van Heijningen C, Wortel J, Kalsbeek A, Feenstra M, Pevet P, Buijs RM. 2005. The suprachiasmatic nucleus controls the daily variation of plasma glucose via the autonomic output to the liver: are the clock genes involved? Eur J Neurosci 22(10):2531-40.

Chen M, Gavrilova O, Zhao WQ, Nguyen A, Lorenzo J, Shen L, Nackers L, Pack S, Jou W, Weinstein LS. 2005. Increased glucose tolerance and reduced adiposity in the absence of fasting hypoglycemia in mice with liver-specific G(s)alpha deficiency. J Clin Invest 115:3217-27.

Cheng B, Anea CB, Yao L, Chen F, Patel V, Merloiu A, Pati P, Caldwell RW, Fulton DJ, Rudic RD. 2011. Tissue-intrinsic dysfunction of circadian clock confers transplant arteriosclerosis. Proc Natl Acad Sci U S A 108(41):17147-52.

Cheng MY, Bullock CM, Li C, Lee AG, Bermak JC, Belluzzi J, Weaver DR, Leslie FM, Zhou QY. 2002. Prokineticin 2 transmits the behavioural circadian rhythm of the suprachiasmatic nucleus. Nature 417(6887):405-10.

Colwell CS. 2011. Linking neural activity and molecular oscillations in the SCN. Nat Rev Neurosci 12:553-69.

Coppari R, Ichinose M, Lee CE, Pullen AE, Kenny CD, McGovern RA, Tang V, Liu SM, Ludwig T, Chua SC, Jr., Lowell BB, Elmquist JK (2005) The hypothalamic arcuate nucleus: a key site for mediating leptin’s effects on glucose homeostasis and locomotor activity. Cell Metab 1:63-72.

Damiola F, Le Minh N, Preitner N, Kornmann B, Fleury-Olela F, Schibler U. 2000. Restricted feeding uncouples circadian oscillators in peripheral tissues from the central pacemaker in the suprachiasmatic nucleus. Genes Dev 14(23):2950-61.

Davis S, Mirick DK, Stevens RG. 2001. Night shift work, light at night, and risk of breast cancer. J Natl Cancer Inst 93(20):1557-62.



172

Chapter 7

Dibner C, Schibler U. 2015. Circadian timing of metabolism in animal models and humans. J Intern Med 277(5):513-27.

Doi M, Takahashi Y, Komatsu R, Yamazaki F, Yamada H, Haraguchi S, Emoto N, Okuno Y, Tsujimoto G, Kanematsu A, Ogawa O, Todo T, Tsutsui K, van der Horst GT, Okamura H. 2010. Salt-sensitive hypertension in circadian clock-deficient Cry-null mice involves dysregulated adrenal Hsd3b6. Nat Med 16(1):67-74.

Farajnia S, Michel S, Deboer T, Vanderleest HT, Houben T, Rohling JH, Ramkisoensing A, Yasenkov R, Meijer JH. 2012. Evidence for neuronal desynchrony in the aged suprachiasmatic nucleus clock. J Neurosci 32(17):5891-9.

Gamble KL, Resuehr D, Johnson CH. 2013. Shift work and circadian dysregulation of reproduction. Front Endocrinol (Lausanne) 4:92. doi: 10.3389/fendo.2013.00092. eCollection@2013.:92.

Gerkema MP, Groos GA, Daan S. 1990. Differential elimination of circadian and ultradian rhythmicity by hypothalamic lesions in the common vole, Microtus arvalis. J Biol Rhythms 5:81-95.

Gibbs J, Ince L, Matthews L, Mei J, Bell T, Yang N, Saer B, Begley N, Poolman T, Pariollaud M, Farrow S, DeMayo F, Hussell T, Worthen GS, Ray D, Loudon A. 2014. An epithelial circadian clock controls pulmonary inflammation and glucocorticoid action. Nat Med 20:919-26.

Gluck EF, Stephens N, Swoap SJ. 2006. Peripheral ghrelin deepens torpor bouts in mice through the arcuate nucleus neuropeptide Y signaling pathway. Am J Physiol Regul Integr Comp Physiol 291(5):R1303-R1309.

Goncharuk VD, Van Heerikhuize J, Dai JP, Swaab DF, Buijs RM. 2001. Neuropeptide changes in the suprachiasmatic nucleus in primary hypertension indicate functional impairment of the biological clock. J Comp Neurol 431:320-30.

Granados-Fuentes D, Tseng A, Herzog ED. 2006. A circadian clock in the olfactory bulb controls olfactory responsivity. J Neurosci 26(47):12219-25.

Guerrero-Vargas NN, Guzman-Ruiz M, Fuentes R, Garcia J, Salgado-Delgado R, Basualdo MD, Escobar C, Markus RP, Buijs RM. 2015. Shift Work in Rats Results in Increased Inflammatory Response after Lipopolysaccharide Administration: A Role for Food Consumption. J Biol Rhythms 30:318-30.

Guerrero-Vargas NN, Salgado-Delgado R, Basualdo MC, Garcia J, Guzman-Ruiz M, Carrero JC, Escobar C, Buijs RM. 2014. Reciprocal interaction between the suprachiasmatic nucleus and the immune system tunes down the inflammatory response to lipopolysaccharide. J Neuroimmunol 273(1-2):22-30.

Guilding C, Hughes AT, Brown TM, Namvar S, Piggins HD. 2009. A riot of rhythms: neuronal and glial circadian oscillators in the mediobasal hypothalamus. Mol Brain 2:28. doi: 10.1186/1756-6606-2-28.:28-2.



173

General Discussion

7

Gumz ML, Stow LR, Lynch IJ, Greenlee MM, Rudin A, Cain BD, Weaver DR, Wingo CS. 2009. The circadian clock protein Period 1 regulates expression of the renal epithelial sodium channel in mice. Journal of Clinical Investigation 119(8):2423-34.

Guo H, Brewer JM, Champhekar A, Harris RB, Bittman EL. 2005. Differential control of peripheral circadian rhythms by suprachiasmatic-dependent neural signals. Proc Natl Acad Sci U S A 102(8):3111-6.

Guzman-Ruiz M, Saderi N, Cazarez-Marquez F, Guerrero-Vargas NN, Basualdo MC, Acosta-Galvan G, Buijs RM. 2014. The suprachiasmatic nucleus changes the daily activity of the arcuate nucleus alpha-MSH neurons in male rats. Endocrinology 155(2):525-35.

Guzman-Ruiz MA, Ramirez-Corona A, Guerrero-Vargas NN, Sabath E, Ramirez-Placencia O, Fuentes-Romero JA, Leon-Mercado L, Basualdo MC, Buijs RM. 2015. The Suprachiasmatic and Arcuate nucleus orchestrate the diurnal temperature decrease in the rat. 35 ed. p 15419-29.

Harmar AJ, Marston HM, Shen S, Spratt C, West KM, Sheward WJ, Morrison CF, Dorin JR, Piggins HD, Reubi JC, Kelly JS, Maywood ES, Hastings MH. 2002. The VPAC(2) Receptor Is Essential for Circadian Function in the Mouse Suprachiasmatic Nuclei. Cell 109(4):497-508.

Hastings MH, Brancaccio M, Maywood ES. 2013. Circadian Pacemaking in Cells and Circuits of the Suprachiasmatic Nucleus. J Neuroendocrinol 26:2-10.

Hatori, Megumi, Christopher Vollmers, Amir Zarrinpar, Luciano DiTacchio, Eric A. Bushong, Shubhroz Gill, Mathias Leblanc, et al. 2012. Time-Restricted Feeding without Reducing Caloric Intake Prevents Metabolic Diseases in Mice Fed a High-Fat Diet. Cell Metabolism 15 (6): 848–60. doi:10.1016/j.cmet.2012.04.019.

Hermida RC, Ayala DE, Fernandez JR, Calvo C. 2008. Chronotherapy improves blood pressure control and reverts the nondipper pattern in patients with resistant hypertension. Hypertension 51(1):69-76.

Herzog ED, Schwartz WJ. 2002. A neural clockwork for encoding circadian time. J Appl Physiol (1985 ) 92(1):401-8.

Hirao A, Tahara Y, Kimura I, Shibata S. 2009. A balanced diet is necessary for proper entrainment signals of the mouse liver clock. PLoS ONE 4(9):e6909.

Howell MJ, Schenck CH. 2009. Treatment of nocturnal eating disorders. Curr Treat Options Neurol 11(5):333-9.

Huang H, Kong D, Byun KH, Ye C, Koda S, Lee DH, Oh BC, Lee SW, Lee B, Zabolotny JM, Kim MS, Bjorbaek C, Lowell BB, Kim YB. 2012. Rho-kinase regulates energy balance by targeting hypothalamic leptin receptor signaling. Nat Neurosci 15(10):1391-8.

Hughes AT, Piggins HD. 2012. Feedback actions of locomotor activity to the circadian clock. Prog Brain Res 199:305-36.



174

Chapter 7

Innominato PF, Roche VP, Palesh OG, Ulusakarya A, Spiegel D, Levi FA. 2014. The circadian timing system in clinical oncology. Ann Med 46(4):191-207.

Ishida A, Mutoh T, Ueyama T, Bando H, Masubuchi S, Nakahara D, Tsujimoto G, Okamura H. 2005. Light activates the adrenal gland: Timing of gene expression and glucocorticoid release. Cell Metab 2(5):297-307.

Kalsbeek A, Buijs RM. 2002. Output pathways of the mammalian suprachiasmatic nucleus: coding circadian time by transmitter selection and specific targeting. Cell Tissue Res 309(1):109-18.

Kalsbeek A, Vanheerikhuize JJ, Wortel J, Buijs RM. 1996. A diurnal rhythm of stimulatory input to the hypothalamo- pituitary-adrenal system as revealed by timed intrahypothalamic administration of the vasopressin V-1 antagonist. J Neurosci 16:5555-65.

Kalsbeek A, Verhagen LA, Schalij I, Foppen E, Saboureau M, Bothorel B, Buijs RM, Pevet P. 2008. Opposite actions of hypothalamic vasopressin on circadian corticosterone rhythm in nocturnal versus diurnal species. Eur J Neurosci 27(4):818-27.

Knutsson A, Kempe A. 2014. Shift work and diabetes - A systematic review. Chronobiol Int:1-6.

Kolbe I, Dumbell R, Oster H. 2015. Circadian Clocks and the Interaction between Stress Axis and Adipose Function. Int J Endocrinol 2015:693204. doi: 10.1155/2015/693204. Epub@2015 Apr 27.:693204.

Kreier F, Kap YS, Mettenleiter TC, Van Heijningen C, Van der Vliet J, Kalsbeek A, Sauerwein HP, Fliers E, Romijn JA, Buijs RM. 2005. Tracing from fat tissue, liver and pancreas: A neuroanatomical framework for the role of the brain in type 2 diabetes. end 147:1140-7.

Lamia KA, Storch KF, Weitz CJ. 2008. Physiological significance of a peripheral tissue circadian clock. Proc Natl Acad Sci U S A 105(39):15172-7.

Lamont EW, Diaz LR, Barry-Shaw J, Stewart J, Amir S. 2005. Daily restricted feeding rescues a rhythm of period2 expression in the arrhythmic suprachiasmatic nucleus. Neuroscience 132(2):245-8.

Lee IT, Chang AS, Manandhar M, Shan Y, Fan J, Izumo M, Ikeda Y, Motoike T, Dixon S, Seinfeld JE, Takahashi JS, Yanagisawa M. 2015. Neuromedin s-producing neurons act as essential pacemakers in the suprachiasmatic nucleus to couple clock neurons and dictate circadian rhythms. Neuron 85(5):1086-102.

Lewy AJ, Lefler BJ, Emens JS, Bauer VK. 2006. The circadian basis of winter depression. Proc Natl Acad Sci U S A 103:7414-9.

Li AJ, Wiater MF, Oostrom MT, Smith BR, Wang Q, Dinh TT, Roberts BL, Jansen HT, Ritter S. 2012. Leptin-sensitive neurons in the arcuate nuclei contribute to endogenous feeding rhythms. Am J Physiol Regul Integr Comp Physiol 302:R1313-R1326.



175

General Discussion

7

Li JZ, Bunney BG, Meng F, Hagenauer MH, Walsh DM, Vawter MP, Evans SJ, Choudary PV, Cartagena P, Barchas JD, Schatzberg AF, Jones EG, Myers RM, Watson SJ, Jr., Akil H, Bunney WE. 2013. Circadian patterns of gene expression in the human brain and disruption in major depressive disorder. Proc Natl Acad Sci U S A 110(24):9950-5.

Liu S, Chen XM, Yoda T, Nagashima K, Fukuda Y, Kanosue K. 2002. Involvement of the suprachiasmatic nucleus in body temperature modulation by food deprivation in rats. Brain Res 929(1):26-36.

Lowrey PL, Takahashi JS. 2000. GENETICS OF THE MAMMALIAN CIRCADIAN SYSTEM: Photic Entrainment, Circadian Pacemaker Mechanisms, and Posttranslational Regulation. Annu Rev Genet 2000;34:533-562 34:533-62.

Malek ZS, Sage D, Pevet P, Raison S. 2007. Daily rhythm of tryptophan hydroxylase-2 messenger ribonucleic acid within raphe neurons is induced by corticoid daily surge and modulated by enhanced locomotor activity. Endocrinology 148(11):5165-72.

Marpegan L, Bekinschtein TA, Costas MA, Golombek DA. 2005. Circadian responses to endotoxin treatment in mice. J Neuroimmunol 160(1-2):102-9.

Martino TA, Tata N, Belsham DD, Chalmers J, Straume M, Lee P, Pribiag H, Khaper N, Liu PP, Dawood F, Backx PH, Ralph MR, Sole MJ. 2007. Disturbed diurnal rhythm alters gene expression and exacerbates cardiovascular disease with rescue by resynchronization. Hypertension 49(5):1104-13.

Matsuo T, Yamaguchi S, Mitsui S, Emi A, Shimoda F, Okamura H. 2003. Control mechanism of the circadian clock for timing of cell division in vivo. Science 302(5643):255-9.

Meijer JH, Schaap J, Watanabe K, Albus H. 1997. Multiunit activity recordings in the suprachiasmatic nuclei: in vivo versus in vitro models. Brain Res 753:322-7.

Meijer JH, Watanabe K, Schaap J, Albus H, Dqtbri L. 1998. Light responsiveness of the suprachiasmatic nucleus: long- term multiunit and single-unit recordings in freely moving rats. J Neurosci 18:9078-87.

Mendoza J, Graff C, Dardente H, Pevet P, Challet E. 2005. Feeding cues alter clock gene oscillations and photic responses in the suprachiasmatic nuclei of mice exposed to a light/dark cycle. J Neurosci 25(6):1514-22.

Mendoza J, Pevet P, Challet E. 2008. High-fat feeding alters the clock synchronization to light. J Physiol 586(Pt 24):5901-10.

Modabbernia A, Heidari P, Soleimani R, Sobhani A, Roshan ZA, Taslimi S, Ashrafi M, Modabbernia MJ. Melatonin for prevention of metabolic side-effects of olanzapine in patients with first-episode schizophrenia: Randomized double-blind placebo- controlled study. J Psychiatr Res. 2014;53:133‐140.

Mohawk JA, Green CB, Takahashi JS. 2012. Central and Peripheral Circadian Clocks in Mammals. Annu Rev Neurosci 35:445-62.



176

Chapter 7

Moore RY, Eichler VB. 1972. Loss of a circadian adrenal corticosterone rhythm following suprachiasmatic lesions in the rat. Brain Res 42:201-6.

Morrison SF, Nakamura K. 2011. Central neural pathways for thermoregulation. Front Biosci 16:74-104.:74-104.

Mostafavi A, Solhi M, Mohammadi MR, Hamedi M, Keshavarzi M, Akhondzadeh S. Melatonin decreases olanzapine induced metabolic side-effects in adolescents with bipolar disorder: A randomized double-blind placebo-controlled trial. Acta Med Iran. 2014;52:734‐739.

Muller JE, Stone PH, Turi ZG. 1985. Circadian variation in the frequency of onset of acute myocardial infarction. N Engl J Med 313:1315-22.

Noman N, Monjo T, Moscato P, Iba H. 2015. Evolving robust gene regulatory networks. PLoS ONE 10(1):e0116258.

Novakova M, Prasko J, Latalova K, Sladek M, Sumova A. 2014. The circadian system of patients with bipolar disorder differs in episodes of mania and depression. Bipolar Disord 17:303-14.

Ohdo S, Koyanagi S, Suyama H, Higuchi S, Aramaki H. 2001. Changing the dosing schedule minimizes the disruptive effects of interferon on clock function. Nat Med 7(3):356-60.

Oster H, Damerow S, Kiessling S, Jakubcakova V, Abraham D, Tian J, Hoffmann MW, Eichele G. 2006. The circadian rhythm of glucocorticoids is regulated by a gating mechanism residing in the adrenal cortical clock. Cell Metab 4(2):163-73.

Owen BM, Bookout AL, Ding X, Lin VY, Atkin SD, Gautron L, Kliewer SA, Mangelsdorf DJ. 2013. FGF21 contributes to neuroendocrine control of female reproduction. Nat Med 19(9):1153-6.

Palm IF, Van Der Beek EM, Wiegant VM, Buijs RM, Kalsbeek A. 1999. Vasopressin induces a luteinizing hormone surge in ovariectomized, estradiol-treated rats with lesions of the suprachiasmatic nucleus. ns 93:659-66.

Partch CL, Green CB, Takahashi JS. 2014. Molecular architecture of the mammalian circadian clock. Trends Cell Biol 24(2):90-9.

Paschos GK, FitzGerald GA. 2010. Circadian clocks and vascular function. Circ Res 106:833-41.

Paschos GK, Ibrahim S, Song WL, Kunieda T, Grant G, Reyes TM, Bradfield CA, Vaughan CH, Eiden M, Masoodi M, Griffin JL, Wang F, Lawson JA, FitzGerald GA. 2012. Obesity in mice with adipocyte-specific deletion of clock component Arntl. Nat Med 18:1768-77.

Perreau-Lenz S, Kalsbeek A, Pevet P, Buijs RM. 2004. Glutamatergic clock output stimulates melatonin synthesis at night. Eur J Neurosci 19(2):318-24.

Peters RV, Zoeller RT, Hennessey AC, Stopa EG, Anderson G, Albers HE. 1994. The Control of Circadian



177

General Discussion

7

Rhythms and the Levels of Vasoactive Intestinal Peptide Messenger RNA in the Suprachiasmatic Nucleus Are Altered in Spontaneously Hypertensive Rats. Brain Res 639:217-27.

Ramsey KM, Yoshino J, Brace CS, Abrassart D, Kobayashi Y, Marcheva B, Hong HK, Chong JL, Buhr ED, Lee C, Takahashi JS, Imai SI, Bass J. 2009. Circadian Clock Feedback Cycle Through NAMPT-Mediated NAD+ Biosynthesis. Science 324:651-4.

Refinetti R, Menaker M. 1992. The Circadian Rhythm of Body Temperature. Physiol Behav 51:613-37.

Reppert SM. 1997. Melatonin receptors: molecular biology of a new family of G protein-coupled receptors. J Biol Rhythms 12:528-31.

Reppert SM, Weaver DR. 2002. Coordination of circadian timing in mammals. Nature 418(6901):935-41.

Romijn HJ, Sluiter AA, Pool CW, Wortel J, Buijs RM. 1997. Evidence from confocal fluorescence microscopy for a dense, reciprocal innervation between AVP-, somatostatin-, VIP/ PHI-, GRP-, and VIP/PHI/GRP-immunoreactive neurons in the rat suprachiasmatic nucleus. Eur J Neurosci 9:2613-23.

Romo-Nava F, Alvarez-Icaza GD, Fresan-Orellana A, Saracco AR, Becerra-Palars C, Moreno J, Ontiveros Uribe MP, Berlanga C, Heinze G, Buijs RM. 2014. Melatonin attenuates antipsychotic metabolic effects: an eight-week randomized, double-blind, parallel-group, placebo-controlled clinical trial. Bipolar Disord 16(4):410-21.

Sabath E, Salgado-Delgado R, Guerrero-Vargas NN, Guzman-Ruiz MA, Del Carmen BM, Escobar C, Buijs RM. 2014. Food entrains clock genes but not metabolic genes in the liver of suprachiasmatic nucleus lesioned rats. FEBS Lett 588:3104-10.

Saderi N, Cazarez-Marquez F, Buijs FN, Salgado-Delgado RC, Guzman-Ruiz MA, Del Carmen BM, Escobar C, Buijs RM. 2013. The NPY intergeniculate leaflet projections to the suprachiasmatic nucleus transmit metabolic conditions. Neuroscience 246:291-300.

Saeb-Parsy K, Dyball RE. 2003. Defined cell groups in the rat suprachiasmatic nucleus have different day/night rhythms of single-unit activity in vivo. J Biol Rhythms 18(1):26-42.

Salgado-Delgado R, Angeles-Castellanos M, Saderi N, Buijs RM, Escobar C. 2010. Food intake during the normal activity phase prevents obesity and circadian desynchrony in a rat model of night work. Endocrinology 151(3):1019-29.

Salgado-Delgado RC, Saderi N, Basualdo MC, Guerrero-Vargas NN, Escobar C, Buijs RM. 2013. Shift Work or Food Intake during the Rest Phase Promotes Metabolic Disruption and Desynchrony of Liver Genes in Male Rats. PLoS ONE 8(4):e60052.

Schaap J, Meijer JH. 2001. Opposing effects of behavioural activity and light on neurons of the suprachiasmatic nucleus. Eur J Neurosci 2001 May;13(10):1955-62 13:1955-162.



178

Chapter 7

Scheer FA, Michelson AD, Frelinger AL, III, Evoniuk H, Kelly EE, McCarthy M, Doamekpor LA, Barnard MR, Shea SA. 2011. The Human Endogenous Circadian System Causes Greatest Platelet Activation during the Biological Morning Independent of Behaviors. PLoS ONE 6(9):e24549.

Scheer FA, Pirovano C, van Someren EJ, Buijs RM. 2005. Environmental light and suprachiasmatic nucleus interact in the regulation of body temperature. Neuroscience 132(2):465-77.

Scheer FA, van Montfrans GA, van Someren EJ, Mairuhu G, Buijs RM. 2004. Daily nighttime melatonin reduces blood pressure in male patients with essential hypertension. Hypertension 43(2):192-7.

Schwartz MW, Sipols AJ, Marks JL, Sanacora G, White JD, Scheurink A, Kahn SE, Baskin DG, Woods SC, Figlewicz DP, Porte D. 1992. Inhibition of hypothalamic neuropeptide Y gene expression by insulin. end 130:3608-16.

Selfridge, Julia M, Tetsuya Gotoh, Samuel Schiffhauer, JingJing Liu, Philip E Stauffer, Andrew Li, Daniel G S Capelluto, and Carla V Finkielstein. 2016. Chronotherapy: Intuitive, Sound, Founded…But Not Broadly Applied. Drugs 76 (16). Springer: 1507–21. doi:10.1007/s40265-016-0646-4.

Shinohara K, Tominaga K, Isobe Y, Inouye ST. 1993. Photic regulation of peptides located in the ventrolateral subdivision of the suprachiasmatic nucleus of the rat: daily variations of vasoactive intestinal polypeptide, gastrin-releasing peptide, and neuropeptide Y. J Neurosci 13(2):793-800.

Silva JE. 2006. Thermogenic mechanisms and their hormonal regulation. Physiol Rev 86(2):435-64.

Silver AC, Arjona A, Walker WE, Fikrig E. 2012. The Circadian Clock Controls Toll-like Receptor 9-Mediated Innate and Adaptive Immunity. Immunity 36:251-61.

Slotten HA, Krekling S, Sicard B, Pevet P. 2002. Daily infusion of melatonin entrains circadian activity rhythms in the diurnal rodent Arvicanthis ansorgei. Behav Brain Res 133(1):11-9.

Smarr BL, Morris E, de La Iglesia HO. 2012. The Dorsomedial Suprachiasmatic Nucleus Times Circadian Expression of Kiss1 and the Luteinizing Hormone Surge. Endocrinology 153:2839-50.

Steylen PM, van der Heijden FM, Kok HD, Sijben NA, Verhoeven WM. 2013. Cardiometabolic comorbidity in antipsychotic treated patients: need for systematic evaluation and treatment. Int J Psychiatry Clin Pract 17(2):125-30.

Su Y, Foppen E, Zhang Z, Fliers E, Kalsbeek A. 2015. Effects of 6-meals-a-day feeding and 6-meals-a-day feeding combined with adrenalectomy on daily gene expression rhythms in rat epididymal white adipose tissue. Genes Cells:10.

Sun Y, Shu J, Kyei K, Neal-Perry GS. 2012. Intracerebroventricular infusion of vasoactive intestinal Peptide rescues the luteinizing hormone surge in middle-aged female rats. Front Endocrinol (Lausanne) doi: 10.3389.



179

General Discussion

7

Terazono H, Mutoh T, Yamaguchi S, Kobayashi M, Akiyama M, Udo R, Ohdo S, Okamura H, Shibata S. 2003. Adrenergic regulation of clock gene expression in mouse liver. Proc Natl Acad Sci U S A 100(11):6795-800.

Tosini G, Menaker M. 1996. Circadian rhythms in cultured mammalian retina. Science 272:419-21.

Van de Kar LD, Lorens SA. 1979. Differential serotonergic innervation of individual hypothalamic nuclei and other forebrain regions by the dorsal and median midbrain raphe nuclei. Brain Res 162(1):45-54.

van den Top, M, R M Buijs, J M Ruijter, P Delagrange, D Spanswick, and M L Hermes. 2001. Melatonin Generates an Outward Potassium Current in Rat Suprachiasmatic Nucleus Neurones in Vitro Independent of Their Circadian Rhythm. Neuroscience 107 (1): 99–108.

Van Der Beek EM, Horvath TL, Wiegant VM, Van Den Hurk R, Buijs RM. 1997. Evidence for a direct neuronal pathway from the suprachiasmatic nucleus to the gonadotropin-releasing hormone system: combined tracing and light and electron microscopic immunocytochemical studies. J Comp Neurol 384:569-79.

van Oosterhout F, Lucassen EA, Houben T, Vanderleest HT, Antle MC, Meijer JH. 2012. Amplitude of the SCN Clock Enhanced by the Behavioral Activity Rhythm. PLoS ONE 7(6):e39693.

Vancampfort D, De Hert M, Stubbs B, Ward PB, Rosenbaum S, Soundy A, Probst M. 2015. Negative symptoms are associated with lower autonomous motivation towards physical activity in people with schizophrenia. Compr Psychiatry 56:128-32.

Viswambharan H, Carvas JM, Antic V, Marecic A, Jud C, Zaugg CE, Ming XF, Montani JP, Albrecht U, Yang Z. 2007. Mutation of the circadian clock gene Per2 alters vascular endothelial function. Circulation 115(16):2188-95.

Vreeburg SA, Hoogendijk WJ, DeRijk RH, van Dyck R, Smit JH, Zitman FG, Penninx BW. 2013. Salivary cortisol levels and the 2-year course of depressive and anxiety disorders. Psychoneuroendocrinology 38(9):1494-502.

Webb AB, Angelo N, Huettner JE, Herzog ED. 2009. Intrinsic, nondeterministic circadian rhythm generation in identified mammalian neurons. Proc Natl Acad Sci U S A 106(38):16493-8.

Westgate EJ, Cheng Y, Reilly DF, Price TS, Walisser JA, Bradfield CA, FitzGerald GA. 2008. Genetic components of the circadian clock regulate thrombogenesis in vivo. Circulation 117(16):2087-95.

Wiater MF, Mukherjee S, Li AJ, Dinh TT, Rooney EM, Simasko SM, Ritter S. 2011. Circadian Integration of Sleep/Wake and Feeding Requires NPY-Receptor Expressing Neurons in the Mediobasal Hypothalamus. Am J Physiol Regul Integr Comp Physiol 301:R1569-R1581.



180

Chapter 7

Wu, Joseph C., John R. Kelsoe, Carol Schachat, Blynn G. Bunney, Anna DeModena, Shahrokh Golshan, J. Christian Gillin, Steven G. Potkin, and William E. Bunney. 2009. Rapid and Sustained Antidepressant Response with Sleep Deprivation and Chronotherapy in Bipolar Disorder. Biological Psychiatry 66 (3): 298–301.

Wulff K, Gatti S, Wettstein JG, Foster RG. 2010. Sleep and circadian rhythm disruption in psychiatric and neurodegenerative disease. Nat Rev Neurosci 11:589-99.Yamaguchi Y, Suzuki T, Mizoro Y, Kori H, Okada K, Chen Y, Fustin JM, Yamazaki F, Mizuguchi N, Zhang J, Dong X, Tsujimoto G, Okuno Y, Doi M, Okamura H. 2013. Mice genetically deficient in vasopressin V1a and V1b receptors are resistant to jet lag. Science 342(6154):85-90.

Yamazaki S, Kerbeshian MC, Hocker CG, Block GD, Menaker M. 1998. Rhythmic properties of the hamster suprachiasmatic nucleus in vivo. J Neurosci 18(24):10709-23.

Yi CX, Challet E, Pevet P, Kalsbeek A, Escobar C, Buijs RM. 2008. A circulating ghrelin mimetic attenuates light-induced phase delay of mice and light-induced Fos expression in the suprachiasmatic nucleus of rats. Eur J Neurosci 27(8):1965-72.

Yi CX, Foppen E, Abplanalp W, Gao Y, Alkemade A, La Fleur SE, Serlie MJ, Fliers E, Buijs RM, Tschop MH, Kalsbeek A. 2012. Glucocorticoid signaling in the arcuate nucleus modulates hepatic insulin sensitivity. Diabetes 61(2):339-45.



181

General Discussion

7



Appendices

Summary SamenvattingAuthor Affilitations Publications Portfolio Acknowledgments



184

Appendices

SummaryIn this thesis we investigate and discuss the role of the suprachiasmatic nucleus (SCN) as part of a circadian network, integrating peripheral feedback in order to effectively regulate day-night fluctuations in the physiological functions of the body.

The earth revolves around the sun, bringing us seasons, while it rotates on its axis once every 24 hours giving all organisms on earth exposure to alternating cycles of light and darkness and environmental changes. In mammals, a central autonomous pacemaker, located in the hypothalamic suprachiasmatic nucleus (SCN), drives rhythmic behavioral, neuroendocrine and autonomic output, providing a daily organization of physiology. The endogenous nature of the neuronal activity generated in the SCN ensures that behavioral and physiological rhythms are maintained even in constant dark conditions (DD). The SCN is located above the optic chiasm (i.e., suprachiasmatic) through which it receives photic (light) information, which synchronizes the ~24-hour (i.e., circadian) rhythm generated by the molecular SCN clock to the exact 24-hour of the environment. This circadian timing mechanism allows organisms to anticipate day-night changes in the environment, best preparing the physiology for upcoming challenges.

In chapter one we introduce the molecular organization of SCN activity and explain how clock genes, found in almost all cell types in brain and body, are involved in maintaining the autonomous rhythm of the SCN and the rhythmicity of our organs. SCN neurotransmitters are essential in coordinating this rhythmicity among different cells within the SCN but also to relay circadian cues to different nuclei in the hypothalamus, and thus to the brain and periphery (the body). We discuss numerous conducted experiments illustrating the importance of the SCN in organizing circadian rhythmicity in organisms and the importance of the SCN as an integrator of peripheral feedback essential for regulating and adapting the daily oscillations in physiology. Furthermore, light is not the sole input or only synchronizer of the SCN as it also receives feedback from hormones, other brain nuclei and behavioral activity amongst others. In this thesis we investigated the possibility whether the SCN could be part of a large network of oscillators all functioning within a series of feedback loops maintaining the organism in synchrony with its environment.

In chapter two we investigated how the SCN is incorporated in such a neuronal feedback circuit arising from the nucleus tractus solitarius (NTS), modulating cardiovascular reactivity. The NTS is known to be the medullar integration center of visceral information including blood pressure (BP). We provide evidence of the importance of the SCN as an integration site in physiological circuits regulating BP. In Wistar rats we showed that the SCN receives cardiovascular feedback via the NTS. Glutamate is one of the neurotransmitters involved in the NTS-SCN neural pathway, with projections terminating in the ventrolateral



185

part of the SCN, where light information also enters the SCN. We demonstrated, using the immediate early gene c-Fos as an activity marker, that the activity of the SCN is changed directly following blood pressure changes in the periphery. This provided evidence for a direct neuronal feedback pathway from the NTS to the SCN, transmitting blood pressure information. We also showed that there is an active involvement of the SCN in short-term blood pressure regulation. As such, we provided evidence that the SCN is incorporated in a neuronal feedback circuit arising from the NTS, modulating cardiovascular reactivity.

In chapter three, we investigated blood pressure regulation under the influence of antipsychotic drugs that induce broad cardiometabolic side effects. Second-generation antipsychotics (SGA) are associated with adverse cardiometabolic side effects contributing to premature mortality in patients and non-compliance. While mechanisms mediating these cardiometabolic side effects remain poorly understood, three independent studies recently demonstrated that melatonin was protective against cardio-metabolic risk in SGA-treated patients. We showed Olanzapine induces c-Fos immunoreactivity in the SCN with consecutive activation of the paraventricular nucleus (PVN) and dorsal motor nucleus of the vagus (DMV), indicating a potent induction of parasympathetic tone. Through cholera toxin B subunit (CtB) tracing we proved the existence of an SCN-parasympathetic neuronal pathway further illustrated by demonstrating a direct olanzapine-induced decrease in blood pressure and heart rate. Bilateral lesions of the SCN prevented the effects of olanzapine on parasympathetic activity. Likewise, melatonin abolished this olanzapine-induced SCN-parasympathetic pathway activation as well as its cardiovascular effects while brain areas associated with the beneficial effects of olanzapine, including the striatum, ventral tegmental area, and nucleus accumbens, remained activated. This is important as increased parasympathetic activity induced by olanzapine favors the appearance of cardiometabolic adverse effects like obesity, as well as lipid, insulin and glucose disturbances. In conclusion these results demonstrated the SCN is a key nucleus mediating the early side effects of olanzapine on cardiovascular function and showed melatonin has an opposing and potentially protective effect in olanzapine use. Chapter two and three therefore illustrate that in addition to receiving information on BP excursions through its direct connections with the NTS, the SCN is also able to modify BP changes, altering its output dependent on the peripheral feedback it receives; as we showed e.g. by melatonin.

From cardiovascular regulation we shifted our focus to the importance of metabolic feedback. Seeing the influence of cardiometabolic changes on the SCN and considering early reports that metabolic changes influence neuropeptide Y (NPY) concentrations in the SCN we investigated the intergeniculate leaflet (IGL) which is classically known as the area of the thalamic lateral geniculate complex providing the SCN with non-photic information via its NPY innervation. In chapter four we therefore investigated whether

Summary



186

Appendices

this non-photic input might also be related to the metabolic state of the animal. Using male Wistar rats in different metabolic states (refed, fasted, ad libitum), including a fasted monosodium glutamate-arcuate-lesioned and an IGL lesioned group we showed that it is the IGL, and not the ARC, that is at the origin of most NPY projections to the SCN and that the IGL responds to metabolic conditions. Fasting induces important changes in the NPY expression in the IGL, coinciding with similar changes of NPY/gamma-aminobutyric acid (GABA) projections of the IGL to the SCN. Consequently we demonstrated the SCN does not depend exclusively on the ARC or NTS to obtain information about the metabolic status of the body, but that the IGL can also transmit metabolic information that it receives from NTS and the Nucleus Gracilis. This integration of metabolic information in the SCN may serve to adapt its output to the periphery in order to regulate the physiology not only according to the day-night cycle but also to the energy status of the body.

Further investigating metabolic feedback to the SCN and the position of the SCN in the hypothalamic circadian network we investigated the function of SCN-ARC interconnectivity in chapter five. The ARC is known as the hypothalamic structure receiving metabolic information from the periphery and transmits information on e.g. food intake, temperature and reproductive changes to different hypothalamic centers. We showed the involvement of the SCN in this feedback circuit by demonstrating that fasting alters SCN activity. The importance of the ARC was demonstrated by placing knife cuts—between the SCN and ARC, so disrupting their connectivity—preventing this activity change in the SCN and thus illustrating the importance of ARC metabolic feedback to the SCN. Surprisingly, this interruption of SCN-ARC communication also resulted in a loss of rhythm in locomotor activity, temperature and corticosterone secretion in constant dark conditions. It did not affect SCN clock gene rhythmicity but caused the ARC to desynchronize its activity from the rhythm of the SCN. Moreover, when placing unilateral SCN lesions and contralateral knife cuts this resulted in the same arrhythmicity of physiology, indicating that it is indeed the reciprocal connections synchronizing the ARC with the SCN and that interaction between SCN and ARC is essential for the expression of circadian physiological rhythms. Moreover, following glucose administration in fasted animals, a decreased SCN c-Fos staining was observed in control animals, while the knife cut prevented all changes in SCN activity, demonstrating the importance of the ARC as metabolic modulator of SCN neuronal activity. This confirms that the SCN functions as part of a larger circadian network of tightly linked oscillatory feedback circuits whose integral function is essential for regulating physiological and behavioral functions.

Finally, to further illustrate the functioning of the SCN inside a larger tightly coupled circadian network, we investigated the organization of reproductive feedback to the SCN in chapter six. There we investigated the role of different hypothalamic areas including the ARC, the anteroventral periventricular nucleus (AVPV) and SCN in the



187

complex regulation of the reproductive cycle. In this chapter we demonstrated neuronal feedback received by the SCN through Kisspeptin (Kiss) neurons, known as a stimulating factor for gonadotropin-releasing hormone (GnRH) release. We showed that Kiss neurons, mainly expressed in the AVPV and ARC, project to the ventral part of the SCN where they form close apposition with vasoactive intestinal peptide (VIP) neurons. Interestingly, projections from Arg-Phe-NH2 related peptide-3 or RFamide-related peptide-3 (RFRP-3) neurons (an inhibitory factor in GnRH release) in the dorsomedial hypothalamic nucleus also form close apposition with VIP neurons in the SCN. We showed that: 1) Kiss feedback to the SCN originates from both the AVPV and ARC, 2) Kiss expresses a diurnal variation in the SCN and 3) Kiss terminates on VIP neurons in the ventral part of the SCN. Interestingly, VIP neurons receiving direct retinal input have been proven critical in maintaining SCN synchrony. This indicates a role for Kisspeptin and RFRP-3 signaling to the SCN, whereby their influence may provide a basis for the optimal conditions under which the LH surge and consequential ovulation can take place synchronizing behavior and the estrous cycle. Herein, we argue, the SCN may form part of a Kisspeptin feedback network to adequately time the reproductive cycle in accordance with seasonal, diurnal and metabolic environmental changes.

In chapter seven we draw several conclusions from the presented chapters and we examine possible implications of our findings for the clinic. We argue that long-term deleterious feedback to the SCN, e.g. by untimely food intake or activity, causes circadian desynchronization, which is associated with chronic diseases such as diabetes, hypertension, cancer, and psychiatric disorders. We examine evidence that these diseases might stem from the SCN, where desynchronized peripheral feedback disrupts/modifies its output. We conclude that these multiple intertwined feedback loops of the circadian system make it robust and adaptable, capable of withstanding brief erroneous feedback. However, months or years of conflicting feedback, ill-timed behavior or chronic jetlag/shift work, will increase an individuals’ susceptibility to pathology and disease.Further investigation and insight in the complexity of the day-night organization of physiological functions and all the ramifications of the circadian system, will be necessary to better understand the functional changes taking place in adverse conditions and pathogenesis. A more broad application of circadian timing principles when developing new therapeutic strategies should also be made. This will likely maximize efficacy, reduce toxicity, and decrease the adverse effects patients experience from drugs during their treatment.

Summary



188

Appendices

Nederlandse Samenvatting

In dit proefschrift onderzoeken en bespreken wij de rol van de suprachiasmatische kern (SCN) die, als onderdeel van een circadiaan netwerk, perifere feedback integreert om zo dag-nacht fluctuaties in de fysiologische functies van het lichaam effectief te reguleren.

De aarde draait om de zon, wat ons seizoenen brengt, terwijl hij tevens iedere 24 uur om zijn as draait. Hierdoor worden alle organismen op aarde blootgesteld aan wisselende cycli van licht en duisternis en de daarmee samenhangende veranderingen in de omgeving. Bij zoogdieren stimuleert een centrale autonome pacemaker, gelegen in de hypothalamische SCN, ritmisch gedrag met samenhangende neuro-endocrine en autonome output, en voorziet zo in een dagelijkse, 24-uurs organisatie van de fysiologie. De endogene aard van de neuronale activiteit die gegenereerd wordt in de SCN zorgt ervoor dat gedrags- en fysiologische ritmes worden gehandhaafd, zelfs in constant donker (DD). De SCN bevindt zich net boven het optisch chiasma (suprachiasmatisch) waardoor het direct fotische (licht) informatie van de retina ontvangt. Dit omgevingslicht, wat een exact 24-uurs ritme heeft, synchroniseert de SCN die middels zijn moleculaire SCN-klok een ~24-uurs of circadiaan ritme aanhoudt met de buitenwereld. Dit circadiane timingmechanisme stelt organismen in staat om te anticiperen op dag-nachtveranderingen die optreden in de omgeving, waarbij de fysiologie wordt voorbereid op aankomende slaap of activiteits periode.

In hoofdstuk één introduceren wij de moleculaire organisatie van SCN-activiteit en leggen wij uit hoe klokgenen, die in bijna alle celtypen van de hersenen en het lichaam voorkomen, betrokken zijn bij het handhaven van het autonome ritme van de SCN en het ritme van onze organen. SCN-neurotransmitters zijn essentieel in het coördineren van het ritme tussen de verschillende cellen binnen de SCN, maar ook om circadiane signalen door te geven aan verschillende kernen in de hypothalamus en daarbij aan de hersenen en de periferie (het lichaam). Wij bespreken talrijke uitgevoerde experimenten die het belang illustreren van de SCN voor het organiseren van circadiane ritmes. Hierbij is feedback vanuit de periferie essentieel is voor het reguleren en aanpassen van dagelijkse oscillaties in de SCN en in de fysiologie. Licht is daarbij niet de enige input of synchroniserend signaal van de SCN maar de SCN ontvangt ook feedback van onder meer hormonen, andere hersenkernen en organen. In dit proefschrift onderzochten wij de mogelijkheid of de SCN deel uitmaakt van een groter netwerk van oscillatoren die allemaal functioneren binnen een reeks feedbackcircuits die het organisme met zijn omgeving synchroniseert.

In hoofdstuk twee hebben wij onderzocht hoe de SCN is ingebouwd in een dergelijk neuronaal feedbackcircuit dat middels de nucleus tractus solitarius (NTS) cardiovasculaire veranderingen reguleert. De NTS, gelokaliseerd in de medulla, staat bekend als het integratiecentrum van viscerale informatie waaronder bloeddruk (BP). Wij toonden



189


het belang aan van de SCN als een integratieplaats van fysiologische circuits die BP reguleren. In Wistar ratten lieten wij zien dat de SCN cardiovasculaire feedback ontvangt via de NTS. Glutamaat is een van de neurotransmitters die betrokken is bij deze NTS-SCN neuronale verbinding. De NTS projecties eindigen in het ventrolaterale deel van de SCN waar ook lichtinformatie de SCN binnenkomt. Met behulp van de transcriptiefactor voor snelle genexpressie c-Fos als een neuronale activiteit marker, toonden wij aan dat de activiteit van de SCN direct veranderd na bloeddrukveranderingen in de periferie. Dit leverde bewijs voor een directe neuronale feedbackroute van de NTS naar de SCN die bloeddrukinformatie verzendt. Bovendien lieten wij zien dat er actieve betrokkenheid is van de SCN bij de regulering van de korte termijn bloeddruk fluctuaties. Zodoende hebben wij bewijs geleverd dat de SCN is opgenomen in een neuronaal feedbackcircuit dat voortkomt uit de NTS en cardiovasculaire reactiviteit moduleert.

In hoofdstuk drie onderzochten wij bloeddrukregulatie onder invloed van antipsychotica die brede cardiometabole bijwerkingen veroorzaken. Tweede generatie antipsychotica (SGA) zijn geassocieerd met cardiometabole bijwerkingen die bijdragen aan vroegtijdige sterfte bij patiënten en therapieontrouw. Hoewel mechanismen die deze cardiometabole bijwerkingen mediëren nog steeds slecht worden begrepen, hebben drie onafhankelijke onderzoeken onlangs aangetoond dat melatonine beschermt tegen de cardiometabole bijwerkingen die zijn geassocieerd met SGA behandelde patiënten. Wij toonden aan dat olanzapine de immunoreactiviteit van c-Fos in de SCN induceert met daaropvolgende activatie van de paraventriculaire kern (PVN) en de dorsale motorische kern van de vagus (DMV), wat wijst op een verhoging van de parasympathische tonus. Door middel van de choleratoxine B (CtB) tracer hebben wij het bestaan aangetoond van een SCN-parasympathisch neuronaal circuit. Het bestaan van dit circuit werd ondersteund door het aantonen van een directe door olanzapine geïnduceerde verlaging van de bloeddruk en hartslag. Bilaterale laesies van de SCN voorkwamen de effecten van olanzapine op de parasympathische activiteit. Op gelijke wijze zorgde melatonine ervoor dat deze olanzapine geïnduceerde activatie van het SCN-parasympathische neuronale circuit achterwege bleef. Opvallend genoeg bleven hersengebieden die geassocieerd zijn met de gunstige effecten van olanzapine, waaronder het striatum, het ventrale tegmentale gebied en de nucleus accumbens, geactiveerd. Dit is belangrijk omdat de door olanzapine geïnduceerde verhoogde parasympathische activiteit geassocieerd is met ontstaan van cardiometabole pathologie zoals obesitas, alsook lipiden-, insuline- en glucosestoornissen. Samengevat toonden deze resultaten aan dat de SCN een kern is dat de vroege bijwerkingen van olanzapine op de cardiovasculaire functie medieert en dat melatonine een tegengesteld en potentieel beschermend effect heeft op het ontstaan van de bijwerkingen geassocieerd met het gebruik van olanzapine.Hoofdstuk twee en drie illustreren niet alleen dat de SCN informatie over BP-excursies via zijn directe verbindingen met de NTS ontvangt, maar dat de SCN ook in staat is BP



190

Appendices

veranderingen op te vangen door zijn output aan te passen afhankelijk van de perifere feedback.Van cardiovasculaire regulatie verlegden wij ons focus naar het belang van het ontvangen van metabole feedback. Gezien de invloed van cardiometabole veranderingen op de SCN en rekening houdend met studies die hebben aangetoond dat metabole veranderingen de neuropeptide Y (NPY) concentraties in de SCN beïnvloeden, hebben wij de intergeniculate leaflet (IGL) onderzocht. De IGL staat erom bekend dat het de SCN van non-fotische informatie voorziet via zijn NPY projecties. In hoofdstuk vier hebben wij daarom onderzocht of deze niet-fotische input ook gerelateerd kan zijn aan de metabole status van het dier. Wij onderzochten mannelijke Wistar ratten in verschillende metabole condities (gevoed na vasten, nuchter, ad libitum) en een groep gevaste dieren met monosodiumglutamaat en IGL-laesies. Hierbij lieten wij zien dat het de IGL en niet de ARC is, die de oorsprong vormt van de meerderheid van de NPY projecties naar de SCN en dat de IGL reageert op veranderende metabole condities. Vasten induceert belangrijke veranderingen in de NPY-expressie in de IGL die samenvallen met vergelijkbare veranderingen van NPY en gamma-aminoboterzuur (GABA) projecties van de IGL naar de SCN. Daarbij hebben wij aangetoond dat de SCN niet uitsluitend afhankelijk is van de ARC of NTS voor het verkrijgen van informatie over de metabole staat van het lichaam, maar dat ook de IGL metabole informatie verzendt die deze informatie op zijn beurt van de NTS en Nucleus Gracilis ontvangt. Deze integratie van metabole informatie in de SCN kan dienen om de output van de SCN aan te passen aan veranderende omstandigheden. Dit om de fysiologie niet alleen te reguleren volgens een dag-nacht ritme, maar ook afhankelijk van de energiestatus van het lichaam.

Om de metabole feedback naar de SCN en de positie van de SCN in het hypothalame circadiane netwerk verder te onderzoeken, hebben wij in hoofdstuk vijf de functie van de SCN-ARC-interconnectiviteit onderzocht. De ARC staat bekend als dè hypothalame structuur die metabole informatie ontvangt van de periferie en informatie doorstuurt naar verschillende hypothalame kernen over bijvoorbeeld voedselinname, temperatuur en reproductieve veranderingen. Wij lieten de betrokkenheid van de SCN zien in dit feedbackcircuit door aan te tonen dat vasten de SCN-activiteit verandert. Wij toonden vervolgens het belang van de ARC hierin aan door micro-messneden te plaatsen tussen de SCN en ARC. Dit verstoort de directe connectiviteit tussen de twee kernen waardoor de eerder aangetoonde veranderingen in SCN activiteit na vasten werden voorkomen. Verrassend resulteerde deze onderbreking van SCN-ARC-communicatie ook in een verlies van ritme in motorische activiteit, temperatuur en corticosteron secretie in constant donker omstandigheden. Het had echter geen invloed op de ritmiciteit van SCN-klokgenen maar zorgde ervoor dat de activiteit van de ARC zich desynchroniseerde met die van de SCN. Bovendien resulteerde het plaatsen van unilaterale SCN-laesies en contralaterale messneden in diezelfde aritmie van de fysiologie. Dit gaf aan dat het inderdaad de



191


reciproque SCN-ARC verbindingen zijn die de ARC synchroniseren met de SCN en dat die interactie tussen SCN en ARC essentieel is voor de expressie van circadiane fysiologische ritmes. Bovendien werd na glucosetoediening in nuchtere dieren een afgenomen SCN c-Fos-kleuring waargenomen in vergelijking met controledieren. Een messnede tussen SCN en ARC voorkwam deze verandering in SCN-activiteit, hetgeen het belang aantoont van de ARC als metabole modulator van SCN-neuronale activiteit. Dit bevestigt tevens dat de SCN functioneert als onderdeel van een groter circadiaans netwerk van nauw verbonden oscillerende feedbackcircuits waarvan de integrale functie essentieel is voor het reguleren van de fysiologie en gedrag.

Tenslotte, om de werking van de SCN binnen een groter, nauw gekoppeld, circadiaans netwerk verder te illustreren, hebben wij de organisatie van reproductieve feedback op de SCN in hoofdstuk zes onderzocht. We bekeken de rol van verschillende hypothalame gebieden, waaronder de ARC, de anteroventrale periventriculaire nucleus (AVPV) en de SCN in de complexe regulatie van de reproductieve cyclus. Wij demonstreerden dat de SCN neuronale feedback ontvangt van Kisspeptin (Kiss) neuronen; bekend als een stimulerende factor voor de afgifte van gonadotropin-releasing hormone (GnRH). Wij lieten zien dat Kiss neuronen, die zich voornamelijk in de AVPV en ARC bevinden, naar het ventrale deel van de SCN projecteren waar ze contact maken met vasoactive intestinal peptide (VIP) neuronen. Interessant is dat projecties van Arg-Phe-NH2 related peptide-3 of RFamide-related peptide-3 (RFRP-3) neuronen (een remmende factor in GnRH-afgifte) in de dorsomedial hypothalamic nucleus ook soortgelijke contacten vormen met VIP-neuronen in de SCN. Wij toonden aan dat: 1) Kiss feedback naar de SCN afkomstig is van zowel de AVPV als de ARC, 2) Kiss expressie een dagelijkse fluctuatie in de SCN laat zien en 3) Kiss eindigt op VIP-neuronen in het ventrale deel van de SCN. Interessant is dat VIP-neuronen die directe retinale input ontvangen, van cruciaal belang zijn gebleken om de SCN gesynchroniseerd te houden. Dit duidt er op dat de invloed van Kisspeptine en RFRP-3 op de SCN een basis kan vormen voor de specifieke omstandigheden waaronder de LH-piek en de daaruit voortvloeiende ovulatie kan plaatsvinden, gesynchroniseerd met gedrag. Hierin, zo stellen wij, kan de SCN deel uitmaken van een Kisspeptin-feedbacknetwerk om de reproductieve cyclus adequaat te timen in overeenstemming met seizoensgebonden, dagelijkse en metabole veranderingen van de omgeving.

In hoofdstuk zeven trekken wij een aantal conclusies uit de gevonden resultaten in de verschillende hoofdstukken en tonen wij aan hoe onze bevindingen mogelijke implicaties hebben voor de kliniek. Wij stellen dat schadelijke feedback naar de SCN op de lange termijn, bijvoorbeeld bij activiteit of inname van voedsel buiten de door de SCN aangegeven momenten, circadiane desynchronisatie veroorzaakt wat geassocieerd is met het ontstaan van chronische aandoeningen zoals diabetes, hypertensie, kanker en psychiatrische stoornissen. Dit leidt tot de hypothese dat deze ziekten veroorzaakt kunnen worden



192

Appendices

door een disbalans tussen de signalen van de SCN, en de gedesynchroniseerde perifere feedback welke de output van de SCN verstoort/aanpast.Wij concluderen dat onder normale omstandigheden deze in elkaar verweven feedbackcircuits het circadiane systeem robuust en aanpasbaar maakt, in staat om kortdurende verstoringen goed te weerstaan. Echter, maanden of jaren van tegenstrijdige feedback, slecht getimed gedrag of chronische jetlag / ploegendiensten zullen voor individuen de kans op het ontwikkelen van pathologie en ziekte vergroten.Verder onderzoek en inzicht naar de complexiteit van de dag-nacht, waak-slaap, organisatie van fysiologische functies en alle vertakkingen van het circadiane systeem zullen noodzakelijk zijn om de functionele veranderingen die plaatsvinden gedurende ongunstige omstandigheden en tijdens pathogenese beter te begrijpen. Het is noodzakelijk dat er een bredere toepassing van circadiane timing bij het ontwikkelen van nieuwe therapeutische strategieën wordt gemaakt. Dit zal waarschijnlijk de werkzaamheid van geneesmiddelen kunnen maximaliseren en de toxiciteit en bijwerkingen kunnen verminderen die patiënten ervaren tijdens hun behandeling.



193

Author Affiliations

Author Affiliations

MariCarmen BasualdoLaboratory of Hypothalamic Integration Mechanism, Instituto de Investigaciones Biomedicas, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, Mexico

Gloria Benítez-KingLaboratorio de Neurofarmacología, Subdirección de Investigaciones Clínicas, Instituto Nacional de Psiquiatría Ramón de la Fuente Muñiz, Mexico city, DF, Mexico

Frederik N BuijsLaboratory of Hypothalamic Integration Mechanism, Instituto de Investigaciones Biomedicas, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, MexicoNetherlands Institute for Neuroscience, an Institute of the Royal Netherlands Academy of Arts and Sciences, Amsterdam, The Netherlands

Ruud M BuijsLaboratory of Hypothalamic Integration Mechanism, Instituto de Investigaciones Biomedicas, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, Mexico

Fernando Cazarez-MárquezLaboratory of Hypothalamic Integration Mechanism, Instituto de Investigaciones Biomedicas, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, Mexico

David CenturionDepartment Farmacobiologia, CINVESTAV, Mexico city, DF, Mexico

Carolina EscobarDepartamento de Anatomia, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, Mexico

Nathalie Guerrero-VargasLaboratory of Hypothalamic Integration Mechanism, Instituto de Investigaciones Biomedicas, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, MexicoDepartamento de Anatomia, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, Mexico

Mara A Guzmán-RuizLaboratory of Hypothalamic Integration Mechanism, Instituto de Investigaciones Biomedicas, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, Mexico



194

Appendices

Departamento de Anatomia, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, Mexico

Gerhard HeinzeDepartamento de Psiquiatría y Salud Mental, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, Mexico

Andries KalsbeekNetherlands Institute for Neuroscience, an Institute of the Royal Netherlands Academy of Arts and Sciences, Amsterdam, The Netherlands

Luis León-MercadoLaboratory of Hypothalamic Integration Mechanism, Instituto de Investigaciones Biomedicas, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, Mexico

Mercedes PerusquíaEndocrinology of Reproduction Laboratory, Instituto de Investigaciones Biomedicas, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, Mexico

Francisco Romo-NavaLaboratory of Hypothalamic Integration Mechanism, Instituto de Investigaciones Biomedicas, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, MexicoDepartamento de Psiquiatría y Salud Mental, Facultad de Medicina, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, MexicoDepartment of Psychiatry and Behavioral Neuroscience, Division of Bipolar Disorder Research, University of Cincinnati, Cincinnati, Ohio

Nadia SaderiLaboratory of Hypothalamic Integration Mechanism, Instituto de Investigaciones Biomedicas, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, Mexico Laboratorio de Biologı a Celular y Fisiologia, Facultad de Ciencias, Universidad Autonoma de San Luis Potosi, San Luis Potosı (SLP), Mexico

Roberto C Salgado-DelgadoLaboratory of Hypothalamic Integration Mechanism, Instituto de Investigaciones Biomedicas, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, MexicoLaboratorio de Biologı a Celular y Fisiologia, Facultad de Ciencias, Universidad Autonoma de San Luis Potosi, San Luis Potosı (SLP), Mexico



195

Author Affiliations

Frank AJL ScheerDivision of Sleep Medicine, Brigham and Women’s Hospital, and Harvard Medical School, Boston, MA, United States

Eva Soto-TinocoLaboratory of Hypothalamic Integration Mechanism, Instituto de Investigaciones Biomedicas, Universidad Nacional Autónoma de México (UNAM), Mexico city, DF, Mexico

Marcela Valdés-TovarLaboratorio de Neurofarmacología, Subdirección de Investigaciones Clínicas, Instituto Nacional de Psiquiatría Ramón de la Fuente Muñiz, Mexico city, DF, Mexico



196

Appendices

List of Publications

1. The NPY intergeniculate leaflet projections to the Suprachiasmatic nucleus transmit metabolic conditions. Saderi N, Cazarez-Márquez F, Buijs FN, Salgado-Delgado RC, Guzman-Ruiz MA, del Carmen Basualdo M, Escobar C, Buijs RM. Neuroscience. 29;246:291-300. (2013)

2. The Suprachiasmatic nucleus is part of a neural feedback circuit adapting blood pressure response. Buijs FN, Cazarez F, Basualdo MC, Scheer FA, Perusquía M, Centurion D, Buijs RM. Neuroscience. 25;266:197-207. (2014)

3. The circadian system: A regulatory feedback network of periphery and brain. Buijs FN, León-Mercado L, Guzmán-Ruiz M, Guerrero-Vargas NN, Romo- Nava F, Buijs RM. Physiology (Bethesda). 31(3):170-81. (2016)

4. Suprachiasmatic nucleus interaction with the Arcuate nucleus; Essential for organizing physiological rhythms. Buijs FN, Guzmán-Ruiz M, León- Mercado L, Basualdo MC, Escobar C, Kalsbeek A, Buijs RM. Eneuro 4 (2). (2017)

5. Olanzapine-induced early cardiovascular effects are mediated by the biological clock and prevented by melatonin. Romo-Nava F, Buijs FN, Valdés-Tovar M, Benítez-King G, Basualdo M, Perusquía M, Heinze G, Escobar C, Buijs RM. J Pineal Res. 62(4). (2017)

6. The Suprachiasmatic nucleus is part of a Kisspeptin feedback network involving the anterior ventral part of the third ventricle and Arcuate nucleus. Buijs FN, Soto-Tinoco E, Basualdo MC, Kalsbeek A, Buijs RM. To be submitted

Outside thesis

7. A role for VGF in the hypothalamic Arcuate and Paraventricular nuclei in the control of energy homeostasis. Saderi N, Buijs FN, Salgado-Delgado R, Merkenstein M, Basualdo MC, Ferri GL, Escobar C, Buijs RM. Neuroscience. 8;265:184-95. (2014)

8. Neuropeptide changes in the Suprachiasmatic nucleus are associated with the development of hypertension. Yilmaz A, Buijs FN, Kalsbeek A, Buijs RM. Submitted



197

Portfolio

Portfolio

Frederik Nicolaas BuijsPhD period: February 2013 - January 2019Promotores: Prof. dr. A. Kalsbeek and Prof. dr. D. F. Swaab

Courses

2013 Animal Surgery, Facultad de Medicina, UNAM2013 Introduction in experimental Sciences, Facultad de Medicina, UNAM2013 Biostatistics, Instituto de Investigaciones Biomedicas, UNAM2013 Introduction in Neurosciences, Facultad de Medicina, UNAM2013 Chronobiology in mammals, Instituto de Investigaciones Biomedicas, UNAM2014 Neurochemistry, Facultad de Medicina, UNAM2014 Comparative Endocrinology, Instituto de Investigaciones Biomedicas, UNAM2014 Neuroscience of the body, Instituto de Investigaciones Biomedicas, UNAM

SeminarsWeekly department seminars

Presentations

14-18 June 2014 Big Sky, Montana, United states of America Poster presentation: Interaction between the arcuate nucleus and suprachiasmatic nucleus is essential for activity, temperature and corticosterone circadian rhythmicity SRBR, Society for Research on Biological Rhythms conference

12-17 June 2011 Lucca, Italy Poster presentation: The suprachiasmatic nucleus is involved in blood pressure regulation Chronobiology, Gordon Research Conference

5-9 May 2011 Puebla, Mexico Poster presentation: The suprachiasmatic nucleus is involved in blood pressure regulation III World Congress of Chronobiology

TeachingStudent coaching/mentor scientific research projects – Medical/Psychology bachelor students



198

Appendices

Acknowledgments

The last, but not least important part of my thesis. My acknowledgements to all that have made this thesis possible, as it is not a solitary endeavor. Without the support of many, I would only have achieved little.

I cannot start my acknowledgments without naming Inez Bausch. She has always been a joyful little ray of sunlight in our family and she was like a little big sister to me. Inez, you will always have a special place in my heart.

Pappa, I owe you all my thanks for your tireless support which enabled me to realize this thesis. First of all, you have been my scientific mentor. I greatly enjoyed our afternoon walks in the botanic garden where we had discussions on life but also many brainstorm sessions thinking of different hypothesis’ for surprising experimental outcomes ever molding our vision on how the circadian system is organized. I have very much enjoyed building my thesis one experiment at a time; developing my scientific understanding, my analytical skills and learning to solve the most challenging puzzles. You were always there to guide me in the right direction.Secondly you were there as my father. I feel lucky that I have been able to experience working side by side with my dad. Working closely together on something that, I see, brings you so much joy. It was an opportunity many do not get. Without your flexibility, endless positivity and perseverance I might not have made it to the finish line. We came from far. We have had a difficult period where we spoke little. You initiated the opportunity for me to come to Mexico, for us to work together on this big project. It opened up the way for us to resolve our differences. Pap, thank you for this unique experience and great adventure that we completed together. I am happy I decided to take the leap across the ocean creating a warm memory I will forever cherish.

Mamma. Without you I would literally not have been here, nor where I find myself today. You have always been there for me, giving me words of wisdom, holding up the mirror so I could reflect, challenging my views but most of all, taking time to listen. Mam, I hold dear the special bond we have. The trips we have made, the museums and concerts we visit together. You helped view things in a different light and have always forced me see the other side of the coin. While this is not always easy, it has given me an open mind. Something I have come to depend on while maneuvering through life. But this open mind has also enabled me to maneuver through hypotheses’, thinking of new experiments or trying to solve complicated puzzles on brain feedback circuits. Thank you for the endless support during the ups and down I experienced while making this thesis. We have been through a difficult time as a family, though in each other we found strength and support, and it brought us closer together. For this I am grateful.



199

Acknowledgments

Hannah and Dorthe, my two older sisters. What would I have done without you? I feel so blessed having two older sisters who I could always count on. My thesis has been a scientific journey but also an emotional journey for many reasons. You have laughed with me, cried with me, struggled with me and been angry with me. I was in Mexico but you were never far away. With you I never feel alone, no matter where I am I know there is always someone looking over my shoulder, someone who I can always call.. Hannah and Dorthe, thank you for your faith in a good ending, your positivity and your never-ending support for me and my work.

Many many thanks to my friends in Amsterdam whom I have neglected for two and a half years while living in Mexico. You welcomed me with open arms when I came back as if I had never left. That is true friendship.Thijs, you are both the small devil on my shoulder and the angel watching over me. You were there to distract me when I was down and……….when I had to work. You supported me when times got tough and I spent nights/ weekends/ vacations working on my thesis. You never stopped reminding me of my strengths, when I was focusing on my weaknesses. Without you this project would have remained a life’s work. Thank you for being there and being my friend, I hold it dear.Ernst and Stephan, my paranymphs, my personal consultants, my best friends. Stephan, you were there to coach me when things seemed insurmountable. From the strong friendship we have built up the past 15 years, you know me all too well. It is through this understanding that you could really help me. You highly required help with my time management, organizational skills and tireless pushing for me to finish my damn thesis already. I would play my part by repeating it was almost done. Thank you for those many last pushes and giving me the opportunity to now actually be able to thank you for helping me cross the finish line.Ernst, you gave me great support and advice as an excellent planner. We talked so much about how I could better organize my work, I believe you just might have caused some permanent alterations to my hardwiring. You persuaded me back to work, pushed me when I needed pushing and never stopped believing in me. I missed a difficult moment in your life when I was in Mexico, it was not easy being so far away. You had to make an important choice in your career and you chose for family and friendship, something that has also helped us remain close. I value what we have built up… You and Stephan both made invaluable contributions to my work and without you two I could not have finished this once in a lifetime project. Thank you for being my best friends and my advisors.Bart, I cherish our deep conversations and our superficial ones, our hilarious moments and our never to forget time at Europaplein. This is where we really got to know each other’s inner child and respect one another as adult. You saw me embark on this wild adventure and have piloted me through the rough seas I encountered on the way. You have been there through the length of my endeavor, no matter how tough it got. Thank you for



200

Appendices

being there as my best friend, without you I could not have pulled this off. Tammo, roommate, friend for life. We have had quite a rollercoaster ride together in the past two years, but we pulled each other through the both fun and hard times. I enjoy our nights philosophizing about important issues and trivial subjects, women, work, sales tactics, writing books, women, friendship, sports, women…. Thank you for being there, your endless support and uplifting personality.Jan, I love those moments where our worlds meet and amplify each other. Thank you for the great time I had with you at Roelof Hart. I truly value the friendship that has arisen from it. Tommie, little Buddha, thank you for your wisdom and being there for me. Remember, I will always be there for the journey of your own as well. Thanks to you, my friends I have not named, I have not forgotten you. To my colleagues at the OLVG, UMC (Dane, thank you for the insightful nightly discussions) and AMC, thank you. I look back at great moments.

Hillechien, you have been blessed with seeing me finish this thesis but missing most of the struggles, frustration and late hours spent finishing this thing. You now bear the fruit of me having time, so we can embark on a brand-new adventure, together exploring every corner of the world. I cannot wait…

A great mention and thank you for all my friends in Mexico who have welcomed me with open arms when first arriving to Mexico. You made me feel right at home and have made my time in Mexico an unforgettable experience.A special thanks to you MariCarmen. You have helped me tremendously with the technical aspects of my research. Your special gift and talent made it all seem easy, until I tried it myself. Without you I would not have had anything to write about. Muchas gracias por tu tiempo y tu paciencia. Likewise, many many thanks to my co-authors, colleagues and friends from the UNAM Biomedicas lab. My respect for your work ethic, always helping hand and openness in making Mexico City my second home. Eva, Nathalie, Mara and Luis, thank you. Fernando, amigo, hermano, mi tutor en Español/Chilango y science liaison. You taught me discipline and perseverance. Without you, getting up at 6 AM every morning, go running and head for the lab would not have been possible. A la chamba! Thank you for accompanying me during the weekend and evening lab sessions and for chela’s when we needed them.Daniel y Patrick, gracias por estar mis hermanos Mexicanos. You guys welcomed me in your family and made me feel I truly had two brothers on the other side of the ocean. Thank you for taking me in and showing me how great it is to be a Chilango.



201

Acknowledgments

Dear Prof. Swaab and Prof. Kalsbeek. Dick and Dries, thank you for being my promotores, my advisors, for leading me through the process of creating this thesis. And above all….for your patience. You have had to guide me while I was in Mexico, which was not always easy. After that, I took on a full-time position at the OLVG trying to juggle my job and my PhD at the same time. This delayed my progress considerably, but you did not lose hope. Through much patience, asking good critical questions and valuable advice you have allowed me to bring this thesis to a good ending. It has been a great journey and a valuable learning experience. Thank you for your trust and willingness to embark on this journey together.

Dear Prof. van Dijk, Prof. la Fleur, Prof. Fliers, Prof. Meijer, dr. van Montfrans and dr. Yi. Thank you for being willing to be part of my thesis committee. I hope you have enjoyed reading my thesis and will likewise enjoy my defense.


526835-L-os-Buijs526835-L-os-Buijs526835-L-os-Buijs526835-L-os-Buijs Processed on: 6-12-2018Processed on: 6-12-2018Processed on: 6-12-2018Processed on: 6-12-2018

The Circadian System: A Regulatory Feedback Network of

Periphery and Brain

Uitnodiging

Voor het bijwonen van de openbare verdediging van het proefschrift

The Circadian System: A Regulatory Feedback Network of Periphery

and Brain

Donderdag 17 Januari 2019 om 12oo uur

AgnietenkapelUniversiteit van AmsterdamOudezijds Voorburgwal 231

Amsterdam

Aansluitend bent u van harte uitgenodigd

voor de receptie bijde Brakke Grond

Nes 43 Amsterdam

ParanimfenErnst Moorman

[email protected] Vermeulen

[email protected]

Cadeau tipIk ben aan het sparen

voor een mooi kunstwerkHier zou u eventueel aan

bij kunnen dragen

The C

ircadian System

: A R

egulatory Feedback Netw

ork of Periphery and B

rain Frederik Buijs Frederik Buijs

uitnodiging · buijs fn, guzmán-ruiz m, león-mercado l, basualdo mc, escobar c, kalsbeek a, buijs...

Documents