c e n t r e introduction to bioinformatics · 2008. 2. 12. · • bioinformatics and molecular...
TRANSCRIPT
![Page 1: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/1.jpg)
Introduction to bioinformaticsLecture 2
Genes and Genomes
CENTR
FORINTEGRATIVE
BIOINFORMATICSVU
E
![Page 2: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/2.jpg)
Organisational• Course website:
http://ibi.vu.nl/teaching/mnw_2year/mnw2_2008.phpor click on http://ibi.vu.nl(>teaching >Introduction to Bioinformatics)
• Course book:• Bioinformatics and Molecular Evolution by Paul G.
Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN (Pbk) 1-4051-0683-2
• Essential Bioinformatics by Jin Xiong, Cambridge University Press, 2006, ISBN 0521840988
• Lots of information about Bioinformatics can be found on the web.
![Page 3: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/3.jpg)
.....acctc ctgtgcaaga acatgaaaca nctgtggttctcccagatgg gtcctgtccc aggtgcacct gcaggagtcgggcccaggac tggggaagcc tccagagctc aaaaccccacttggtgacac aactcacaca tgcccacggt gcccagagcccaaatcttgt gacacacctc ccccgtgccc acggtgcccagagcccaaat cttgtgacac acctccccca tgcccacggtgcccagagcc caaatcttgt gacacacctc ccccgtgcccccggtgccca gcacctgaac tcttgggagg accgtcagtcttcctcttcc ccccaaaacc caaggatacc cttatgatttcccggacccc tgaggtcacg tgcgtggtgg tggacgtgagccacgaagac ccnnnngtcc agttcaagtg gtacgtggacggcgtggagg tgcataatgc caagacaaag ctgcgggaggagcagtacaa cagcacgttc cgtgtggtca gcgtcctcaccgtcctgcac caggactggc tgaacggcaa ggagtacaagtgcaaggtct ccaacaaagc aaccaagtca gcctgacctgcctggtcaaa ggcttctacc ccagcgacat cgccgtggagtgggagagca atgggcagcc ggagaacaac tacaacaccacgcctcccat gctggactcc gacggctcct tcttcctctacagcaagctc accgtggaca agagcaggtg gcagcaggggaacatcttct catgctccgt gatgcatgag gctctgcacaaccgctacac gcagaagagc ctctc.....
DNA sequenceDNA sequence
![Page 4: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/4.jpg)
Genome sizeGenome sizeOrganism Number of base pairs
φX-174 virus 5,386
Epstein Bar Virus 172,282
Mycoplasma genitalium 580,000
Hemophilus Influenza 1.8 × 106
Yeast (S. Cerevisiae) 12.1 × 106
Human Human 3.2 3.2 ×××××××× 101099
Wheat 16 × 109
Lilium longiflorum 90 × 109
Salamander 100 × 109
Amoeba dubia 670 × 109
![Page 5: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/5.jpg)
Four DNA nucleotide building blocks
G-C is more strongly hydrogen-bonded than A-T
![Page 6: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/6.jpg)
A gene codes for a protein
�������
� �
� �
�� ����������
�� ��� ����
CCTGAGCCAACTATTGATGAA
PEPTIDE
CCUGAGCCAACUAUUGAUGAA
![Page 7: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/7.jpg)
������������ ���������������
���������� ��������������
��������������
������
������������ �������������� �������������������
���������� ���������������������
������������������������� �������������
���������������������������������������
�������������������������� �!"�������
![Page 8: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/8.jpg)
����������������������������#�������$�#��������%
q ���� ����������������������������������������������������������� ��������
q���� �������������������������������������������������������� ��������
q����� �������������������� ���������������!����������������������������������
q����� �����������������������������������������!������������������������������������������������
q"� ����������������������������������������!���������������������������������������
q#��������������$�����$�����$������ �����
![Page 9: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/9.jpg)
!�&�������'�(��������#�������%
q ������� �����������������������������������%#&�����!��������������
q � �������������������������
q ����� �!��������������������������������������������������
q ������������������������������ ������������� ������
q ���������������� ���������������������������������������������������������� $���������������������������
![Page 10: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/10.jpg)
�������� ���������� ������
![Page 11: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/11.jpg)
DNA makes RNA makes Protein
… yet another picture to appreciate the above statement
![Page 12: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/12.jpg)
Transcription Factors
mRNA transcription
TF binding site (open)
TF binding site (closed)
TATA
mRNA transcription
TF binding site (TFBS)
TATA
TF
Pol II
Transcription Factor (TF): protein that binds to DNA and to a polymerase (PolII)
Polymerase: complex protein that transcribes DNA into mRNA
Transcription factor –polymerase interaction sets off gene transcription…
… many TFBSs are possible upstream of a gene
Nucleosomes (chromatin structures composed of histones) are structures round which DNA coils. This blocks access of TFs
![Page 13: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/13.jpg)
)��� ����������'����������
q %�������������'(�(((�) '*�(((��������������������������+�,-�������������
q �����������������������+�.�(((���
q ����������*!/�������������
q ���������������������+�'((���
q �����������������������+�'(((���
q .-������������������������������
q "��������������������������0���,���
![Page 14: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/14.jpg)
�*��'����������&�+��'���������
q %�����������1������������������2�$�����������������3� ���������������� ����� $�������� ����4��1���� ����5
q %��������������������������� �����������������6����7����+�'�8������ ������9:�����
q ;!���1������������������������������� ��
q %�������������������!� �� ��2����������1��!� �� �42��
q �������!� ��������������$�����������!�������
4��1��!� ��������������� ��$�3��������5! �������
�����������������������������
��������� �������� ����� �
![Page 15: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/15.jpg)
�����������#�������
q ������������������� ����
q <��������������������,��������
��������
��������
![Page 16: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/16.jpg)
�����������#���������,�
q ����������������*������ q ����� ���� �����������������!������=����!>���1�������
=���������>���1$�0:*,�
![Page 17: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/17.jpg)
�����������#����'����$�������
q ���������$����������
�����������$�
������������
�'6!��� �����������$�
������������
�'6!��� ��� ������ ���!
��������$����������
q �������������������
�!�!��!�*
ü ��?��� ������������@���?������������ �AB!���������
����'6 �������
ü ������� #�������������������*6!,6C�,6!*6���������*6!,6�
ü ����?��$�D$�>$�� @�����?��$�D$�>$�-
![Page 18: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/18.jpg)
)�%
��� ���
![Page 19: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/19.jpg)
)��������� �����$�������
q >!D����������������������������������!%���!E���������������������
q ,��������������������������������� �� �����������
q "���������������������������������D!>�����������������������������D>�������������������������������
������������� �$�����!��������������
![Page 20: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/20.jpg)
![Page 21: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/21.jpg)
TAA, TAG, TGA Stop Stop codons
CGT, CGC, CGA, CGG, AGA, AGGRArginine
AAA, AAGKLysine
GAT, GACDAspartic acid
GAA, GAGEGlutamic acid
CAT, CACHHistidine
AAT, AACNAsparagine
CAA, CAGQGlutamine
TGGWTryptophan
TAT, TACYTyrosine
TCT, TCC, TCA, TCG, AGT, AGCSSerine
ACT, ACC, ACA, ACGTThreonine
CCT, CCC, CCA, CCGPProline
GGT, GGC, GGA, GGG GGlycine
GCT, GCC, GCA, GCG AAlanine
TGT, TGCcCysteine
ATGM,
StartMethionine
TTT, TTCFPhenylalanine
GTT, GTC, GTA, GTGVValine
CTT, CTC, CTA, CTG, TTA, TTGLLeucine
ATT, ATC, ATA IIsoleucine
DNA codons
Single Letter Code
Amino Acid
![Page 22: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/22.jpg)
��������������������
q 4������������������������DF>��������������������F%����������������������������������������
q %���D>!�������������������������������� �������� ��������
q B��� DF>��������������������������������������� �!����� ��������� ������9'-
G�DF>�������������������������!���� �+'(-�
q A��������������
*(-�������������������������
,/-"�� ���!������������������
,.- ����������� ��#���� � �����
![Page 23: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/23.jpg)
.�������#�������*�������� ������
q H������������� ����� ����3>����������5�
q ������$����������$���������� ����������>����9�
q " ������
q <������������������������������������������
q �����������������
q ��������� ��������
q ��������������� ������������������������������
/01000
/1000,01000
![Page 24: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/24.jpg)
������� ��������,�
q D�����������>#%���� ��������������������������������������������
q >#%���������4>���% !���������������������������������������% �����
q %������������������������������������������$���������$������������������$��������$��������������������������������������������
q >#%�������������������������>�!���������������������������������������������$������$���������$����������������$�����������������$������1���
![Page 25: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/25.jpg)
������� ��������/�
q >#������>#%������,!������������������������*(.�� �������08.(��� �������������������>�! ��������
q ������������������<��������������������<���������������������������������������
%��������#*(.�������������������������
�������� ��������������%����������� �I�������
�����������������*(9������������������
������������%>������%%����������������
����������������������������������������>#%�������������������"��������0:::���
%����������2�������4�0�� �4������������0�4�������������� ������<������������&&����������������
![Page 26: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/26.jpg)
2��3����������������#�����
����������%
q E���1�������������������������������������$����������������������������������������������������������������������J������
q %���������������1���������������������������������������������������� ����$�� ����$������ ���4$���������������������������������
q �������������������$����������������������������������������$��������������������������������� �����
q %��������� ����������������������������������������������������������������������������������������������������������������������������������� �����%�������5��#B ���������
q I������$������������������������������������������� ���������������
![Page 27: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/27.jpg)
�'����#��������������������� �#�����'������
�������*��$��1��$��1�4$��
� ����*��$��1��$��1�4$��
)����$ ��������#���� ��1�����#�4$ ��
![Page 28: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/28.jpg)
��6����#��������(��
![Page 29: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/29.jpg)
7������'����������8�������������#�
#�����'���"
q %��������������K�������������������������������� �����������������
ü B ��������������������!�������
ü B ��������������������������������1���
��
��
��
��
�������� �������
������� �������
![Page 30: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/30.jpg)
������ ����#�����'���"
q % ����
��K���������������
������������������
���'�$'��#�#�'���"
)'�����#����#
q % ���4
��K���������������
���'�$'��#�#�'���"
2�����#��'��
q % ���L
������������������
2� �$'��#�#�'���"
2�������#��'�����
![Page 31: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/31.jpg)
)���#��������������� ������������#�
q ��������������� �������������
q ������������� ������������������������������������������������������� ��������������������������
q ��������������������� �����������1����������
q ����������������� ��������4!���$��������������������������!����
q ��������������������������
![Page 32: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/32.jpg)
����$���)���#��������������
q >����������
q %�����������������
q "����������
$��%�� ��!����
"�����M����������������0:::��$������ ��������&����%� 9$�.*8�! .*:
![Page 33: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/33.jpg)
����)���#��������������
q ��������1��� q >������������� �������
"�����>������=����� ���K���D��������$����#��������1���$�N��#���0::,��%B<�����=A�G���>���"������B�����G������ � ������
0/"����� "������ �"�������4�������'��������� ����
![Page 34: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/34.jpg)
/������������ �����*
����� ��$��������������
q "������ ��������������������������
q %������ ���������������
![Page 35: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/35.jpg)
/������������ �����*
�������$��������������
q "������ ����������������������0/"�
q %������ ��������������������������
Ban et al., Science 289 (905-920), 2000
![Page 36: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/36.jpg)
/������������ �����*�������������
q "������ ���������������!������������
q %������ ���������������!������������
![Page 37: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/37.jpg)
)��������������������%
q 4���!������������������7���
q E�!������������������������������7�
q ,�������������������������������1������������
![Page 38: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/38.jpg)
Three main principles
• DNA makes RNA makes Protein
• Structure more conserved than sequence
• Sequence Structure Function
![Page 39: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/39.jpg)
How to go from DNA to protein sequence
A piece of double stranded DNA:
5’ attcgttggcaaatcgcccctatccggc 3’3’ taagcaaccgtttagcggggataggccg 5’
DNA direction is from 5’ to 3’
![Page 40: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/40.jpg)
How to go from DNA to protein sequence
6-frame conceptual translation using the codon table:
5’ attcgttggcaaatcgcccctatccggc 3’
3’ taagcaaccgtttagcggggataggccg 5’
So, there are six possibilities to make a protein from an unknown piece of DNA, only one of which might be a natural protein
![Page 41: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/41.jpg)
Remark
• Identifying (annotating) human genes, i.e. finding what they are and what they do, is a difficult problem– First, the gene should be delineated on the genome
• Gene finding methods should be able to tell a gene region from anon-gene region
• Start, stop codons, further compositional differences
– Then, a putative function should be found for the gene located
![Page 42: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/42.jpg)
Dean, A. M. and G. B. Golding: Pacific Symposium on Bioinformatics 2000
Evolution and three-dimensional protein structure information
Isocitratedehydrogenase:
The distance fromthe active site(in yellow) determinesthe rate of evolution(red = fast evolution, blue = slow evolution)
![Page 43: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/43.jpg)
Genomic Data Sources
• DNA/protein sequence
• Expression (microarray)
• Proteome (xray, NMR,
mass spectrometry)
• Metabolome
• Physiome (spatial,
temporal)
Integrativebioinformatics
![Page 44: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/44.jpg)
Dinner discussion: Integrative Bioinformatics & Genomics VUDinner discussion: Integrative Bioinformatics & Genomics VU
metabolomemetabolome
proteomeproteome
genomegenome
transcriptometranscriptome
physiomephysiome
Genomic Data SourcesVertical Genomics
![Page 45: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/45.jpg)
DNA makes RNA makes Protein(reminder)
![Page 46: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/46.jpg)
DNA makes RNA makes Protein:Expression data
• More copies of mRNA for a gene leads to more protein
• mRNA can now be measured for all the genes in a cell at ones through microarraytechnology
• Can have 60,000 spots (genes) on a single gene chip
• Colour change gives intensity of gene expression (over- or under-expression)
![Page 47: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/47.jpg)
![Page 48: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/48.jpg)
Proteomics
• Elucidating all 3D structures of proteins in the cell
• This is also called Structural Genomics
• Finding out what these proteins do
• This is also called Functional Genomics
![Page 49: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/49.jpg)
![Page 50: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/50.jpg)
Protein-protein interaction networks
![Page 51: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/51.jpg)
Metabolic networks
Glycolysisand
Gluconeogenesis
Kegg database (Japan)
![Page 52: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/52.jpg)
High-throughput Biological Data
• Enormous amounts of biological data are being generated by high-throughput capabilities; even more are coming– genomic sequences
– arrayCGH (Comparative Genomic Hybridization) data, gene expression data
– mass spectrometry data
– protein-protein interaction data
– protein structures
– ......
![Page 53: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/53.jpg)
Protein structural data explosion
Protein Data Bank (PDB): 14500 Structures (6 March 2001)10900 x-ray crystallography, 1810 NMR, 278 theoretical models, others...
Bioinformatics databases grow exponentially…
![Page 54: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/54.jpg)
Dickerson’s formula: equivalent to Moore’s law
Dickerson predicted that the Protein Data Bank (PDB) of protein three-dimensional structures would grow, starting with the first protein in 1960, as indicated by the above exponential growth function. On 27 March 2001 there were 12,123 3D protein structures in the PDB: Dickerson’s formula predicts 12,066 (within 0.5% -- not a bad prediction)!
n = e0.19(y-1960)
with y the year.
![Page 55: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/55.jpg)
Sequence versus structural data• Structural genomics initiatives are now in
full swing and growth is still exponential.
• However, growth of sequence data is even more rapidly. There are now more than 600 completely sequenced genomes publicly available.
Increasing gap between structural and sequence data (“Mind the gap”)
![Page 56: C E N T R E Introduction to bioinformatics · 2008. 2. 12. · • Bioinformatics and Molecular Evolution by Paul G. Higgs and Teresa K. Attwood (Blackwell Publishing), 2005, ISBN](https://reader036.vdocument.in/reader036/viewer/2022071503/6122b084085f975d883e084d/html5/thumbnails/56.jpg)
Bioinformatics• Offers an ever more essential input to
– Molecular Biology– Pharmacology (drug design)– Agriculture– Biotechnology– Clinical medicine– Anthropology– Forensic science– Chemical industries (detergent industries, etc.)
This list is from a molecular biology textbook – so not a self-absorbed bioinformatician is saying this…