canadian boreal communities firesmart (cbcfs) project sitewildfire/2012/posters/nixon.pdf ·...

1
Wildfire professionals from around the world have been coming to the NWT to conduct research at our wildfire research site since the mid 1990s. Originally used for the International Crown Fire Modelling Experiment (ICFME) from 1997-2000, the location has continued to be used for research as the Canadian Boreal Communities FireSmart (CBCFS) project site. We would like to make the Wildfire community aware of activities and availability of the site and encourage researchers to make use of it. The research team, lead by GNWT ENR staff and FPInnovations, includes local fire crews and researchers who have come from government, institutional and private sectors from across Canada as well as over a dozen countries including the UK, USA, Russia, France & Japan. The knowledge and understanding of fire behaviour, firefighter safety, equipment and FireSmart principles gained by these researchers is shared with wildfire professionals all over the world. Most of the activity at the site occurs towards the end of June but researchers can be found onsite at any time of the year depending on their objectives. Canadian Boreal Communities FireSmart (CBCFS) Project site Getting involved G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G G Ge e e e e e e e e e e e e e e e e e e e e e e e e e et t t t t t t t t t t t t t t t t t t t t t t t t t t t tt t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t t ti i i i i i i i i i i i i i i i i i i i i i i i in n n n n n n n n n n n n n n n n n n n n n n n n n ng g g g g g g g g g g g g g g g g g g g g g g i i i i i i i i i i i i i i i i i i i i i in n n n n n n n n n n n n n n n n n n n n n n n n n n n n nv v v v v v v v v v v v v v v v v v v v v v v v v v v v v v vo o o o o o o o o o o o o o o o o o o ol l l l l l l l l l l l l l l l lv v v v v v v v v v v v v v v v v v v v v v v v v v ve e e e e e e e e e e e e e e e e e e e e e e e e e ed d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d d Activities on the site are coordinated by Ac Ac Ac Ac Ac Ac Ac Ac Ac Ac Ac c Ac Ac Acti ti i ti ti t ti ti ti ti ti ti t ti t ti i i t t t t vi vi vi vi i vi vi vi vi vi vi v v vi vi vi viti ti ti ti ti i t ti ti ti ti ti ti ti ti ti ti t t t t es es es es es es es es es es es es es s es s s es s e e e e o o o o o o o o o o o on n n n n n n n n n n n n n n n th th h th th h t t th th th th th th th th t t th t t the e e e e e e e e e e e e e e e e si si si si si si i si si si si si si i i s s s s s site te te te te te te te te te te te t t te te t te e te a a a a a a a a a a a a a a a a a are re re re re r re re re re e re re re e re e e re c c c c c c c c c c c c c c c c c coo oo oo oo oo oo oo oo oo oo o oord rd d rd rd d rd rd rd rd r r r rd d rd r in in in i in in in in in in in in i in n n in n n n nat at at at t at at at at at t at at at at t t at at at t t ted ed ed ed ed d ed ed ed ed ed e ed ed e e ed e b b b b b b b b b b b b b by y y y y y y y y y y y y y y y y Ac Ac A Ac Ac A Ac Ac Ac Ac Ac A Ac A A a GNWT project manager who works Ac A A Ac A Ac A Ac Ac c c Ac c cti ti ti t t ti i i i ti ti tivi v v vi v v vi vi i i v vi vi v vi i it ti t ti ti i ti i ti t ti i i ies es es es es e es s es es s o o o o o o o on n n n n n n n n n n n n n th th th t t th h th h th h h t the e e e e e e e si s s si i si i i i s si ite t te t te te e e t te te e a a a a a a a a a a a ar re r re r re re re e e re re e c c c c c c c c coo oo o o oo o o o oo oo oo ord rd r r rd rd rd d d d d di i in in in n n n n n in n in in in in n n n n na at at a at a a a a at a at t a at ated ed ed ed ed d d d ed ed d d d b b b b b b b b a a a a a a a a a a a a GN GN GN GN GN GN GN GN GN G G GN G G G G WT WT W W WT WT W WT W W W p p p p p p p p p p p p p pro ro ro o o o ro ro o o o o oje je je je e je e e je e je e e e e e e ect ct ct ct ct c ct ct c ct ct t t c c c c m m m m m m m m m m man an an an an an an a a an a a a a ag ag ag ag ag ag ag ag ag ag ag a a ag ager er e er er er er er e er e e e e e e w w w w w w w w w w who ho ho ho ho ho ho o o o o o o o w w w w w w w w w w w wor or or or or or or or o o or o o ks ks ks ks ks ks s s s ks ks ks ks ks s s a a a a a a a a a a a a a a a a GN GN GN GN GN GN GN GN GN GN GN N N N N N N GN G GNWT WT W W WT W WT W WT W W WT T T WT WT WT WT WT WT T T p p p p p p p p p p p p p pro ro ro ro ro ro r ro r r ro ro r o o o o r je je j je j je je je je je je j j j je je e ect ct t ct ct ct ct ct t ct ct ct ct ct t t t t ct ct t m m m m m m m m m m m m m man an an an an an an an an an n an an an a a a a ag ag ag ag ag ag ag ag ag ag ag g g ag ag a ager er er er er er er er er er r r r er r w w w w w w w w w w w w w w w w w w who h ho ho h ho ho ho ho ho ho ho ho o w w w w w w w w w w w w w wor or or or or or or r or or r or r or rks k ks ks k k ks ks ks ks ks k ks ks ks ks ks s s s with FPInnovations, researchers, local a a a a a a a a a a a a a a GN GN GN GN G GN GN GN N GN GN N N N NWT WT WT W WT T T WT WT W W WT T p p p p p p p p p ro r ro ro o o r r ro o o o o o je je je je e je je je e je ct ct ct c ct ct ct ct c ct t t m m m m m m m m m m m m m m man a a an a an n an n a a a a an n n nag ag ag a ag ag g g ag g ag a ag ag ag a a er e e er er er r r e e er r r w w w w w w w w who ho ho ho ho h ho o o h h h h ho o o o w w w w w w w wor o or o o or or o o or r r rks ks ks ks k ks k ks ks s k k ks k ks s wi wi wi wi wi w w wi wi wi w th th th th th th th t t t t F F F F F F F F FP PI P P P PI P PI PI PI P nn nn n n nn nn nn nn nn n ov ov ov ov ov ov ov ov ov ov ov ovat at at a at a at at at at at at t t t a io o io o o io o o io io o o o ons ns ns ns ns ns s ns ns ns s ns ns s s, , , , , , , , , , , re re e e re re e re re re e e e e e ese se se se se se se se se se se se e e se e e e ear a a ar a ar ar ar a ar a ch ch ch ch ch ch c ch h ch ch c c c c c c c er e e er er er er e e e er er er e e s, s, s, s, s, s, s, s, s s s, s, s, , s l l l loc oc oc oc oc oc oc oc oc oc oc oc c cal a al a a a a al a a a wi i wi wi wi i wi wi wi wi wi i wi w wi w w wi wi w th th th th th th th t t th th th h t th t t t F F F F F F F F F F F F F FPI PI PI P PI PI I PI PI PI P P P P nn n nn nn n nn nn nn nn n nn nn nn nn nn nnov ov ov ov ov ov ov v v v ov ov ov ov ov vat at at t t at at at at at at at at at t at at tio io io io io io i i io io o io i i ns n ns ns ns ns ns ns s ns ns ns ns s s s s s ns re r re re r r re re re e re re re e ese se se se se se se se se se se s se s s s ar ar ar ar ar ar r ar r r ar ar ar ar ar arch ch ch ch ch ch ch ch ch ch ch c c c c er er er er er er r r er r er er er r er r ers s s s s s s s s s s s s s s l l l l l l l loc oc oc oc oc oc oc oc oc oc o o oc c c c c o al al al al al al al al a a a a a a authorities and Regional and Territorial wi w w wi w wi i i w w w wi w wi it th t th th th h t th h h h h h F F F F F F FPI P PI P PI I P PI PInn nn n nn n nn n n nn nn n n n nn n n n n nov ov o o o ov ov ov ov o ovat a at at at a at t at at a a at t t io i io io o io o o o i io io o o ons ns ns ns ns ns ns s n n n n n , , , , , , re r r re e re e e e r r re e e e ese se se se se e se se se se se se ar ar a a ar a ar a a ar a a ar a ar r ch ch ch c ch ch h h ch ch c ch h h h h h er er e e er r er e er r r r s, s, s s, s, , s, s s, s, , , , l l l l l loc o oc oc oc c oc oc oc oc oc c cal a al a al a a al a a a a al al au au a au au au au au a a au a au uth th th th th h h th th t th th thor or or or or or or or or o or rit it it it t it t it t t t i it itie ie ie e ie ie ie e e e e e e e e i s s s s s s s s s s s s s s s s an an an a an an an an a an a a a an nd d d d d d d d d d d d d d Re Re Re Re Re Re Re Re Re e Re Re Re e e e e R R Re R gi gi gi g gi gi gi gi g gi gi i i on o on on on on on on on on o on nal al a al al a al a a al a a al l l al l a a a a a a a a a a a a a a a and nd nd nd nd nd nd nd nd nd nd nd n nd d T T T T T T T T T T T T Ter er er er er er er e er er er er er e e e ri ri ri r r ri ri ri ri ri ri r to to to to to to t to to to t to to t t ri ri i ri r ri ri ri r ri ri r al al al al al al al a al a a a a al l a a au au au a a au au a au au u u u u u au a a th th th th th th th th th h th th h th t t t t t or or or or or or or or or r r r r or orit it it it it it i it t t it it i it t t i it t t tie i ie ie ie ie i ie ie ie ie ie ies s s s s s s s s s s s s s s s an an an an an an an n an n an n a an n a a d d d d d d d d d d d d d Re Re Re Re Re Re R Re Re Re Re Re egi gi gi i gi gi gi i gi gi gi g g gi gi g g on on on on on on on on on on n n n n onal al al al al al al al al a a a a a a a a a a a a a a a a a a a and nd nd nd nd d nd nd d nd nd n nd d T T T T T T T T T T T T T T T Ter er er e er er er er e er r r r er r er er r e ri ri ri ri i ri ri i ri ri ri r ri ri i r r to to to to t t t to to to t to to to o t t ri ri ri ri ri i ri ri ri ri r r r ri i i r r al al al al al al l al al al a a a a a Fire Control. au au au au au au au a au u au au au au uth th th th th h h th h t th h h hor or o or o or o or or or r orit it it i i it it t t i it t tie i ie i ie e ie e i ie es s s s s s s s s s F Fi Fi F Fi F F F Fi F F F Fi i ire re re re r re re re e re re e e e e e r r C C C C C C C C C C C C C C C Con on on o on on o on on n on on n n n ntr tr tr tr tr tr tr tr t tr t t t tr r r ro o o o o o o o o o o Fi Fi Fi Fi Fi F Fi i F Fi Fi Fi Fi Fi i F F Fi i i i i i F re r re re r re r re r re e re re re re re re C C C C C C C C C C C C C Con on on on o on n on on on on on n ontr tr t tr tr tr tr tr tr t tr r r r r tr tr tr tro o o o o o o o o o o n n n n nd d d d an an a a a an an n a a a an an n n n l l l l l l l l l l l. . . . . . . . . . . . . . l l l l l l l l l l l F F Fi F Fi i F Fi Fi Fi i The majority of the research is Th h h h h h h Th Th Th h h he e e e e e e e e e e e e e e e e e e ma m ma ma ma ma ma m ma ma ma ma ma ma a a a ajo jo j jo jo j jo jo jo jo jo jo j j jori i ri ri ri ri ri r ri ri r i i r r ty ty t ty ty ty ty ty t ty ty t ty ty ty y ty ty t t t t o o o o o o o o o o o of f f f f f f f f f f f f f f f th th th th th th th th t th t t t t th th t th t t t t e e e e e e e e e e e e e e e e e re re r re re r re re re re re re r re e re re e ese se se se se se se se se se se se s s se e sear ar ar ar ar ar ar r r ar ar ar ar r a ar a a a ch ch ch h ch ch c ch ch c ch ch ch c c c i i i i i i i i i i i i i is s s s s s s s s s s s s s s s s s Th T T Th Th h T Th Th T T T T T T T T T conducted by FPInnovations, however Th Th Th Th Th Th T Th h h he e e e e e e e e e e e e ma m ma ma ma ma ma a ma a a m ma m m ma a ajo jo jo j jo jo jo o j jo jo ri ri r ri i r r ri i ity t ty t ty y ty t ty t ty t o o o o o o o o o o of f f f f f f f th th th h h th th h t t t th h h h h h h h e e e e e e e e e e e e e re r re re re e e e r r re se se s se s se se e se se se ar a a a ar ar ar ar a ar a a ar r r rch ch ch c ch h ch h c c c ch h h h i i i i i i i is s s s s s s s s s s s co co co o co co o co co co co c c c c c c co o ond nd d d nd nd nd nd nd nd nd d duc uc uc uc uc uc uc uc c c uc uc uc c cte te te te e te te te te te te e e e t te e ed d d d d d d d d d by by by by y by by by by by b F F F F F F F F F FPI PI PI I P P P PI PInn nn nn nn n nn n n nn nnov ov ov ov ov ov ov ov ov ov ov ov o at a at t at a at at at at at at at tio io io io o o o o o o o ons ns ns ns ns ns s s s ns s ns s s s, , , , , , , , , , , , , , ho ho ho ho ho o ho ho ho ho owe we we we we we we we we we w we we we e e e e e e eve ve ve ve ve ve ve v ve ve v v ve v ve ve v ve ve ve er r r r r r r r r r r r r r r co co co co co co co co co co co c c nd nd nd nd nd nd nd nd nd nd n n nd d n uc uc c uc uc c uc u uc uc uc uc uc c c c cte te te t t te te te te t te te te t t t t t d d d d d d d d d d d d d by by by by b by by by by by by y y y y y y b by F F F F F F F F F F F F F F F FPI P PI PI PI PI PI P PI P P PI I P nn nn nn nn nn nn nn nn n nn n n nn n n nnov ov ov ov ov ov ov ov v ov v v v ov v v ov o at at at t at at at at t at at at at at at atio io io io io io io i io o o ons ns ns ns ns ns ns n ns n ns ns ns ns s ns ho ho ho h ho ho ho ho ho ho ho ho h how w w w w w w w w w w w w w w other researchers are encouraged to co co co co co co co co o ond nd nd nd nd n nd nd nd d nd nd n n nd d duc uc uc uc u uc uc uc uc u uc c cte te te t te te t te te ed d d d d d d d d d d d by b by by by by b by y b b b by by y F F F F F F F F F FPI P PI PI PI I I PI PI I Inn nn nn nn nn nn nn n nn n n n nn n nov o ov ov ov ov v v ovat at at a a at at a a at at at a a a io io io io o o i io ons n n ns n ns ns s ns s ns ns n n , , , , , , , , h ho h ho h ho ho ho ho ho ho h h howe we w we w we we we e e w w weve ve ve ve v v ve ve e ve er r r r r r r r r ot ot ot ot ot ot o ot t ot ot ot t o othe he he he he he e e he e e e e e e e er r r r r r r re re re e re e e e re re e e e e ese se se se se se se se s se se se se s se e e s se ea ar ar a ar ar ar ar a a ar a a a ch ch ch ch ch ch ch ch c c ch c c ch c c er er e er er er e er er er e e e e e e s s s s s s s s s s s s s s s ar a a ar a ar ar a a a are e e e e e e e e e e e e e e e e en en en en en en en en en e e e e e e e co co co co co co co co co o c c co c c c cour ur u ur ur ur ur ur ur u u ag ag ag ag ag ag ag ag ag ag g a ag ged ed ed ed ed ed ed ed ed ed e e e ed t t t t t t t t t t to o o o o o o o o o o o ot t ot ot ot ot ot ot t ot t ot ot t ot t t the h he he h h he he he he he he h he e he er r r r r r r r r r r r r r r re re r re re re re r re re r re e e e rese se se se se se se se se se se se s s s s ar ar a ar ar ar ar ar r r r ar ar ar ar a a ar rch h h ch ch ch ch ch ch ch ch ch ch c ch c c er er er er er er r r er er r er er r er r rs s s s s s s s s s s s s s s s s ar ar ar ar ar ar ar r r r ar ar ar ar a ar ar re e e e e e e e e e e en en en en en en en en n n en en en nco co co co co co co co co co co c c ur u ur ur ur ur ur u ur r r ur r r u ur u ur ur r r rag a ag ag ag ag ag g ag ag g ag ag a a a a ed d d ed ed ed ed ed ed ed ed ed d e t t t t t t t t t t t t t t t t t t to o o o o o o o o o o submit ideas or attend as observers. ot o ot ot t o o ot ot ot the h h he h he e e e h h h he e e r r r r r r r r re re re e e re r re re e se se se se s se se e e se se se e ar a a a ar a a a a ar ar a ar r ch ch c ch ch h h h c c c ch h h her e e e er er r e e e er r rs s s s s s s s s ar a a a a ar a a ar ar a a a ar re e e e e e e e e e e e en en en en en n en en en en n n n n nco co co co co c co o o c co co o our u u u u u u ur r ur u u u u ur r rag ag ag ag ag ag ag ag g ag ag ag a a ed ed ed ed e ed ed d d ed ed d d d t t t t t t t t t t o o o o o o su su su su s su s su su su su su su su s s su ubm bm bm bm bm bm bm bm b bm m m bm b bmit it it t it it it t t t i it it it i i i i i i i i ide de de de de de de de de de e e de e e e d d d d as as as as as as s as as as as s as as a a a o o o o o o o o o o o or r r r r r r r r r at at at at at at at at at at at at at at atte te te e te te te te te te te e e t te e te te e end nd nd nd nd nd d nd nd nd nd n nd nd nd d a a a a a a a a a a a a a a as s s s s s s s s s s s s s s s s s ob ob ob ob ob ob ob ob ob ob ob ob b bse se se se se s s se se se se se se e e s s se e serv rv rv v v v v v rv v rv r r rv r er er er er er er er e e er er e er e e er r rs s s s s s s s s s s s s s s s su su su su su su su su su u u u su u u su s s bm bm bm bm bm b bm bm bm bm bm bm m m bm mit it it it it i i it it t it it t i it t t t t t i i i i i i i i i i i i ide d de de de de de de de de de de deas as as as as as as as as as s s s s as o o o o o o o o o o o or r r r r r r r r r r r r r r r at at at at t at at at at at t at at a at t at at tte te te te t t te te t te te te t te e te t nd nd nd nd nd nd nd nd nd n nd n n n nd a a a a a a a a a a a a a a a as s s s s s s s s s s s s s s s ob ob ob ob b b ob b ob ob ob ob obse se se se se s se se se se se se s s s rv rv rv rv rv rv rv r rv r r r v v v v v v v r ver er er er er er er er e er er r r er ers s s s s s s s s s s s s s o o o o o o o o . . . . . . . . . . . . . . . . . su su su s s s s su su su su For more information, please contact the Fo o o Fo Fo Fo o Fo Fo F Fo Fo Fo F F r r r r r r r r r r r r r r r r mo mo mo mo mo mo mo m mo m mo m mo mo mo m more re re re re re re re r r re r re re e re e e r i i i i i i i i i i i i i inf nf nf nf nf nf nf nf nf nf f nf nf f n nf f for or or or or or or or or r r or r or orma ma ma ma ma ma ma ma m ma m ma ma ma a ma a a ma mati t ti ti ti ti ti t ti ti ti t ti t ti ti t t t on on on on on on on on on on on n n on n n n n n, , , , , , , , , , , , , pl pl pl pl pl pl pl pl p p p p p p pl l lea ea ea ea ea ea ea ea ea ea a ea ea ea a e ea ease se se se se se se se se se se se s se se s s s se e se e c c c c c c c c c c c c c c con on on on on on on on on n on n n on on n n n nta ta ta t ta ta ta ta ta ta ta t ta ta ta a a act ct ct ct ct ct ct t ct ct c ct t t ct ct ct ct t ct c ct c t t t t t t t t t t t t t t t t t the he he h he he he he he he he h he e e e h h h h F Fo Fo Fo F Fo Fo Fo Fo Fo o F F F F project manager: Fo Fo Fo Fo Fo o o o Fo F Fo Fo o r r r r r r mo m m mo m m m mo o o mo mo m m mo mo o o re re re re re e e r r re e e i i i i i i i inf n n n nf nf nf n n n n nf nf nf n or or or o o or or or o or r r ma m m m m ma m m m m m m m m pr pr pr pr pr pr pr pr pr r r p pr oj oj oj oj j oj oj oj o o oj ec e e ec ec ec ec c ec e ec ec ec c c e e e ect t t t t t t t t t t t t t t ma ma ma ma ma ma a ma ma ma ma ma a ma ma ma ana na na na na na na na na a a na na a n n n nage ge ge ge ge ge ge ge ge e ge ge ge e e e r r r r r r r pr p pr pr p p pr pr pr pr pr r r pr pr pr r roj oj oj j oj oj j oj oj oj o o oj oj o ec ec ec ec ec e ec ec ec ec e ec c c c ct t t t t t t t t t t t t t t t t t ma m m ma ma m ma ma ma ma ma m ma ma ma a ana na n na na na na a na na na na na a a age ge ge ge ge ge g ge ge g ge g ge ge ger r r r r r r r i i i io o o o a a a a a a a a a a a a a ti t t t t ti ti t t t ti i i r: r: : : r: : r r: r: r: r: : r: : : : r r: r: r r r r r: r: r: r r: : : r: r: r: : : : : Larry Nixon La La La La La La L La La L La La a La a a a L La arr rr rr rr rr rr rr rr r rr rr rr rr rr rr y y y y y y y y y y y y y y y Ni Ni Ni i Ni Ni Ni i Ni i i i Ni N Ni i Ni N xo x xo xo xo x xo x xo xo xo xo x xo xo xo x xon n n n n y y y y y y y y y y N N N N N N N N N N N N N N N N n n n n n n n n n n n n n n n Wildfire Risk Management Coordinator La La La a a a La a L La L La a a a a a rr rr r rr r r rr r rr r r r y y y y y Ni Ni N N N Ni N Ni Ni N N N N Ni ixo xo xo xo o o x x x xo x x xo xo o n n n n n n n n n n n n n n n Wi Wi Wi Wi Wi W Wi Wi Wi W W Wi Wi W Wi Wi i Wi i W Wi Wi Wi il l ld ld ld d d ld l ld ld ld d d ld ld d l l ld d dfi fi f f fi fi fi fi fi i fi fi f fi i fi fi fi f fi fi i i ire re re re re re re r re re r re re re e e e e e e r R R R R R R R R R R R R R R R R R R Ris is is is i is is is i is is s is is is is is s is i k k k k k k k k k k k k k k k k k k k k Ma Ma Ma Ma a M Ma Ma a Ma Ma Mana na na n na na na na na a a age ge ge ge ge ge e e ge ge ge ge e e e eme me e me me e e me e me me me e e e e e ent nt nt t t n nt nt nt nt nt nt C C C C C C C C C C C C C C Coo oo oo oo oo oo oo oo oo oo oo oord d rd d rd d rd rd d rd rd rd d r r rd rd rd d r rd din in in in i in in in in in in in i i in in n n n n i in n nat t at t t at at at at at t at at at t at t t t at at at t a a o o o o o o o o o o o o k k k k k k k k k k k Ma M M Ma Ma Ma M Ma M Ma Ma M Ma Ma Ma Ma Ma a a Mana na na n na na na na na na na na na na na age ge ge ge ge ge ge ge g g ge ge ge e eme me me me m me me me m me me me e me me me e e e e e ent nt t nt nt t nt nt t nt nt t nt n nt t t t nt n n or or r or r or r or or or r r r or or or r Fire k k k k k k k k k k k k k Ma M Ma Ma Ma M Ma Ma Ma Ma M M M Ma Ma Ma Ma Ma M M Fi F Fi Fi Fi F F F Fire r re re re e e re e e re e e Fi F Fi Fi Fi Fi Fi Fi Fi i Fi i Fi Fi Fi Fire re re re re re re re re r r r re Science, a a a a a a age ge ge ge ge ge ge ge e me me me me m m me m me m me m me m me m men n n n n n n n n a an n na na na na na a na a n na n na na a e e e e e e e e e e e e e e e e e e e e e e e e e Sc Sc Sc Sc c c Sc Sc S Sc c c Sc c c S ie ie ie ie e e e ie e e e e e enc nc nc nc nc nc c nc nc c nc c nc c ce e e e e e e e e e e e Sc Sc Sc Sc S Sc Sc Sc Sc Sc Sc c c cie i i ie ie i ie ie ie ie ie ie i i ie i ie ie enc nc nc nc nc nc nc nc n n nc nc nc nc nce e e e e e e e e e e e S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S S C C C C C C C C nt n nt n nt t nt nt n n nt t t C e, e e e, e, e, e, e e e, e, e, , , e e e e e e e e e e e e e e Forest Management Fi F Fi Fi i F Fi Fi Fi i ire re re e r re e e e e e e e Sc c c c c c c cie ie ie ie e e e i i ie ie enc nc nc nc nc nc nc c n n nc n n e e e e e e e S S S S S S S S Fo Fo F F F Fo o o o o o o o o ore re re re re re re r re re r re re re re e e est st t st st st st st st st t st st st st st st st s st st st M M M M M M M M M M M Man an an an an an an an an a a anag ag ag ag ag a ag ag ag ag ag ag g gem em em em em em em em em em em e e e e en en en en en en e en e en en en e e e t t t t t t M M M M M M M M M M M M M M Man an an an an an an an n n an an an a an an a g g g g g g g gem em em em em m em em m em em em em m e en en en en en n n en en n en en n n en e t t t t t t t t t t t t t ag ag ag ag ag ag a ag ag ag a ag ag g a a F F F F F F F F F F F F F F F F F F F Division, e e e e, e, e, e, , e, e, , , , t t t t t t t t t t t t t t t t t t t t t t t t t t Di Di D Di D D D D D vi vi vi i vi i vi i vi vi vi vi vi vi i v v vi v i si si si si si si si si si si si si si i s s s s s s s on on on on on on on on n on on on on n, , , , , , , , , , , Di i i i i i i i i i i i i i i i i i i i i D D D D D D D D D D D D D D D D D D D D D D D D D D D D D D D D D D Environment and Natural Resources, Fo o o o o o o ore re re re e e r re r re est st st st s st st s s st t t M M M M M M M M M M M M M M M Man an an an an an an a an an a an an n nag ag ag ag ag ag ag ag ag ag a ag ag a em em em e em m em em em em em m m m m m m men en e en en n en en en e en n n n nt t t t F F F F F F F F F F t t t t t t t t t D Di i i i i i i i ivi vi vi v vi vi i v v v vi isi s s si si si si si si ion o o on on on on on n n n n n n n n n, , , , , , , , D D D D D D D D D D En En En En En En En E En En E En E En En En En En n n E En En E E En nvi vi vi v vi vi vi vi vi i vi vi v v vi iro ro o ro ro o o r ro ro ro ro ro o r r nm nm m nm nm nm nm nm nm nm n en en en en en en e en en en en e e e e e e t t t t t t t t t t t t t t an a an an an an an an an an a a d d d d d d d d d d d d Na a Na Na Na Na a Na Na Na Na a a a N tu tu u tu tu tu tu tu tu tu u tu t t t ra ra ra ra ra ra a ra a ra a ra a al l l l l l l l Re Re Re Re Re Re Re Re Re Re Re Re Re e Re Re e e Reso so so so so so so so so s so so so s s ur ur u ur ur ur ur ur ur ur ur ur rce ce ce ce ce ce ce ce ce ce ce ce ce e c ce ce ce es s s s s s s s s s s s s s s s s n n n n n nv v v v v v v v v v v v v o o o o o o o o o o o onm nm nm nm nm nm nm nm nm nm nm n nm m n en en en en en n en en en en en n en nt t t t t t t t t t t t t t t t t t an an an an an an an a an an an an an nd d d d d d d d d d d d d d d d Na N Na N Na Na Na Na N Na N N Na Na Na Na Na a a atu t t t tu t tu tu tu t tu tu tu t tu u u tu tu u u t t ra ra ra ra ra ra ra r ra r r ra ra ra r ra a a a vi vi vi i i vi i i vi vi i vi vi v v v vi v vi v v ro ro r r r r r r r r r r r ro r r Re Re Re R Re Re R Re Re Re Re e e eso so so so so so so so so so so so s s s s ur ur ur ur ur ur ur ur u ur u u ur r r ur ur ur r rce ce ce ce ce ce ce ce ce ce ce ce c c c a a a a a a a a a a al l l l l l l l l l R R R R R R R R s, s, s s, s, s, s, s, s, s, s, s, s s, s s, , , , Government of the NWT o o o o o o o o o nm nm nm n nm m m nm nm nm n nm nm m m m men e e en en en en en en e en n n nt t t t t t t t t an an an an a an an an a a an an an n n n nd d d d d d d d d d d Na Na Na Na a a Na a N N N Na N Na Na a atu t tu tu tu u u t tu t tu tu u u u u ra ra ra ra a a r r ra r ra a a a l l l l l l l l l Re Re Re Re R Re R Re R R R Re R R R Re e e eso s so so so o s s so so so s so Go Go Go Go Go Go Go G Go Go Go Go Go G G G ve ve ve ve ve ve ve ve ve ve ve e e e e e ern rn rn rn rn n rn rn rn rn nme me me me me me me me me me me e e e e me ent nt nt nt nt nt nt nt n nt t t t t t nt o o o o o o o o o o o of f f f f f f th th th th th th h t th th t t the e e e e e e e e e e e e e e e NW NW NW NW NW NW NW NW NW NW W NWT T T T T Go Go Go Go Go Go Go Go Go Go Go G G Go Go Go G ve v ve ve ve v ve v ve ve ve ve v v v ve e vern r rn rn rn r rn r rn rn n rn r rn n n nme m m me me me me me me me me me m me ent nt t t nt nt nt nt nt nt nt nt nt nt n nt t t t o o o o o o o o o o of f f f f f f f f f f f f f f f f f f f th th th th th th t th h h h th t t t t th t t t th t e e e e e e e e e e e e NW NW NW NW NW NW NW NW NW N NW NW N NW W NW NW W WT T T T T T T T T T T T r r r r rc o o o o o o o o our u u u ur r ur u u u u u ur ur T T T T T T T T T T T T T T T PO PO P P PO PO PO PO PO PO PO PO PO PO P P P P P P P P O O O O O O O O O O O O Box 7 o o o o o o o ve v ve ve e e ve v v ve e e e rn r r n n n r r rn n Go Go Go Go Go Go Go G Go Go O O O O O O O O O O O O O O O O O O O O O O Bo Bo Bo Bo Bo Bo Bo Bo o o o o Bo o ox x x x x x x x x x x x x 7 7 7 7 7 7 7 7 7 7 7 Bo Bo Bo Bo B Bo Bo Bo Bo Bo o o ox x x x x x x x x x x x x x x x 7 7 7 7 7 7 7 7 7 7 7 7 7 B B B B B B B B B B B B B B B B B B B B B B B B - n n n n n n n n 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 n n n n nm m m m m m - - - - - - - - - - 149 McDougal Rd. e e e e e e e e nt n nt nt n nt nt t n n nt n nt t t t o o o o o o o o o f f f f f f f f th t th th th th h t th t t th th h h th h e e e e e e e e e e NW NW N N NW NW W W NW NW N NW NW WT T T T T T T T T T e e e e e e e e e m m m m m m m m m m m m m m m m m m m m m - - - - - - - - - - - - - - - - - 4 4 4 4 4 4 4 4 4 4 4 4 4 4 4 49 9 9 9 9 9 9 9 9 9 9 9 9 9 9 Mc Mc Mc Mc Mc Mc c Mc Mc Mc Mc c c c Mc McDo Do Do Do Do Do Do Do Do Do Do o Doug ug ug ug ug ug ug g ug ug ug g g u u ug g gal a al al al al al al a a a a a a R R R R R R R R R R R Rd d d d d d d d d d d d d 4 4 4 4 4 4 4 4 4 4 4 49 9 9 9 9 9 9 9 9 9 9 9 Mc Mc Mc Mc M M Mc M Mc Mc Mc Mc Mc Mc c c cDo D D Do Do Do Do Do Do Do Do Do Do o o oug ug g ug ug ug u ug u ug ug ug g u ug g g gal al al al al l al al al a a a a a a a R R R R R R R R R R R R R R R R Rd d d d d d d d d d d 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 1 d. . d. d d. d. d d. . . d. . . . . . d. d. d d d d d d d d d d d d d d d Fort Smith, NT X0E 0P0 O O O O O O O O O O O O O O O B Bo Bo o o o ox x x x x x x x x x x x x x x x x 7 7 7 7 7 7 7 7 7 B B B B B B B B B B B 7 4 4 4 4 4 4 4 49 9 9 9 9 9 9 Mc Mc M M Mc Mc M Mc Mc M M Mc M Mc M M Do D Do Do D Do Do Do Do D ug ug ug ug ug ug ug ug ug u u u al al a a al a al al l l al al a al l 1 1 1 1 1 1 1 1 1 1 Fo Fo Fo Fo Fo Fo Fo Fo Fo F Fo Fo o o o F F F rt rt rt rt rt rt rt rt rt t rt rt t t S S S S S S S S S S S S S S Sm mi m mi mi mi mi m m mi m mi mi mith th th t th th th th h t t t th th h h h, , , , , , , , , , , , NT NT N NT T NT NT N N NT T N N NT N NT X X X X X X X X X X X X X X X0E 0E 0E 0E 0E 0E E 0 0E E 0E 0E E 0E E 0E E 0 0 0 0 0 0 0 0 0 0 0 0P0 P P P0 P0 P P P0 P0 P0 P P P o o o o o o o o o ort t t rt rt rt rt rt rt rt t rt rt rt rt rt t t t S S S S S S S S S S S S S S S S Fo F Fo Fo Fo F Fo Fo Fo F Fo Fo Fo F F F S S S S Sm m m m m m m m m m m m m m m m m m m m h h h h h h h h h h h h h h NT N N NT NT N NT NT NT NT NT NT NT T NT T T NT T X X X X X X X X X X X X X X X X X0E 0E 0E 0E 0E 0E 0E 0E E E E 0E 0E 0E E E E 0 0 0 0 0 0 0 0 0 0 0P0 P P0 P P0 P P P0 P P P P0 t t t t t t t t t t t t t t i i i i i i i i i i i i i it t t t t t t t t t t t t mi mi mi mi mi mi mi mi m m mi m d d d d d d d d d d d d d R R R R R R R R R R R R R Rd d 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 0 867.872.7705 (P) 867.872.2077 ( 86 86 86 86 86 86 86 86 86 86 86 86 86 86 6 6 6 6 6 8 7. 7 7. 7. 7. 7 7 7 7. 7. 7. 7 7 7 7 7 7. . . 7 7 7. .87 87 87 87 87 87 87 7 7 8 87 87 87 87 87 87 872. 2. . . 2. 2. 2. 2. 2 2 2 2 2. 2 2 2 2. 2. . . . 2 2 2 2 2.77 77 77 77 77 77 77 77 77 77 77 77 77 77 77 7705 05 05 05 05 05 05 05 05 05 05 05 05 5 05 5 5 5 5 5 ( ( ( ( ( ( ( ( ( ( ( ( P) P) P) P) P) P) P) P) P) ) P) P) P P P) P 8 8 8 8 8 8 8 8 8 8 8 8 8 867 67 67 67 67 67 67 67 6 67 67 67 67 7 7 7 7.8 8 .8 .8 .8 .8 .8 .8 .8 8 8 .8 .8 8 .8 8 . . . . . 72 72 72 72 72 72 72 72 72 72 72 72 72 72 2 72 2 7 72 2.2 .2 .2 .2 .2 .2 .2 .2 2 .2 .2 2 .2 .2 2 .2 . . .2 2 . .2 207 07 07 07 07 07 07 07 07 0 07 7 07 07 7 77 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 7 87 87 87 8 87 87 87 87 87 7 87 87 7 87 87 7 8 8 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 77 7 77 77 77 77 77 77 77 77 77 7 77 77 705 05 05 0 05 05 05 05 05 5 05 5 5 0 0 05 5 5 ( ( ( ( ( ( ( ( ( ( ( (P) P) P) P P) P) P) P) P) P) ) ) P) P) P P 8 8 8 8 8 8 8 8 8 8 8 8 8 8 867 67 67 67 67 67 67 7 67 67 67 67 67 6 67 67 6 6 67 7 67 8 8 8 8 8 8 8 8 8 8 8 8 8 8 872 72 7 72 72 72 72 72 72 72 72 2 7 7 72 2 72 2 72 2 7 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 2 20 0 0 0 0 0 0 0 0 0 0 0 0 7 7 7 7 7 7 7 7 7 07 07 07 07 07 07 7 07 07 7 7 0 07 07 07 7 7 77 7 7 7 7 7 7 7 7 7 7 F ( ( ( ( ( ( ( ( ( ( ( ( ( ( ( ) F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F F ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) The Site The site is 50 km north of Fort Providence NWT on Hwy 3. The project area is in two parts: Blocks 1 & 2 are approximately 640ha of timbered area bordered by Hwy 3 on the east and birch bog along its other boundaries. The stand originated from a wildland fire in 1931 and is predominantly 10m Jack Pine with Black Spruce and Aspen. Block 1 was the site of the ICFME. Blocks 3 & 4 are 3 km south and are composed of approximately 150 ha of birch bog which straddles the highway. Examining mulched line burn rates Exa Exa Exa Exa Exa Exa Exa Exa Exa Exa Exa Ex Ex x Exa Exa Exa a E min min min min i min min min min min min min min m ing in ing ing ing ing ing ing ing ing in ing g ing ng ing ing mu mu mu mu m mu mu mu mu mu mu mu mu u mulch lch lch lch lc lch lc ch lch lch lch ch c c ch c c ed ed ed d ed ed ed ed ed ed ed e ed ed ed e e ed lin l lin lin lin lin lin in i i lin lin in n n n neb eb b eb eb eb eb eb eb eb eb eb b b eb e urn urn urn urn u urn urn urn r urn rn urn urn urn urn r ra ra ra ra ra ra ra a ra ra ra ra a ra a r te te t te te te te te te te te te te te es es es es es es es es es es es s es s e es s i in n n n (FPInnovations) mu mu mu m m mu mu u mu m lc lch lch lch lch lch lch c ch c ch c ed e e e ed e ed ed d d d ed lin lin lin li li in in in n n i e e e e e e e e e n ng ng ng ng ng ng g g ng ng g m m m m m m FP FP FP FP P P FP P FP P P FP P PInn Inn Inn Inn nn Inn n Inn nn Inn nn nn Inn nnova ova ova ova ov ova ova ova ova ova ova ova ova ova o a vatio tio tio tio tio tio tio tio o tio o tio t tio tio o i ns ns ns ns ns ns ns n n ns ns ns ns n n ns FP FP FP FP FP FP P FP FP FP FP P PInn Inn Inn In Inn Inn Inn Inn Inn n n nn nn n nn n ova ova ova ova ova ova ova ov v v ova a ova ova ova ova atio tio tio tio tio io tio tio tio ti i t tio ti tio tio o ons n ns n ns n ns n n ns ns ns ns (F (F (F (F (F (F (F (F ( ( (F (F (F (F ( (F ( (F (F (F ( (F F (F (F (F (F r r r r r r b b b b b b b b b bu u u u u u u u u u s) s) s) s) s) s) s) s) s) s) s) s) s s) ) s) s) s) s) s) s) s) s) ) ) s) s) New Terra Torch ready to ignite stand to test FireSmart New New New New New N New New New New New New New New New ew New w Te Te Te Te Te Te Te Te Te Te Te Te e e e Terra rra rra rra rra rra rra rra rra r rra rra rra rra rra rra ra a r To To To T To To To T To To To To To To o o o T rch rch rch rch rch rch rch rch rch rc rch ch rch rch c c re re re re re re r re re re e re re e re re e eady ady dy ady ady ady ady ady ady ady ady ady y ady ady dy ady ad ady to to t to to to to to to to to t to to to to ig ig ig ig ig i ig ig ig ig ig g ig g g g g ig gnit nit nit ni nit nit nit nit nit nit nit nit nit ni nit nit nit t n es es es es es es es es es es es es s es es estan tan tan tan tan tan tan tan tan tan ta tan tan an n tan tan andt dt dt dt dt dt dt t dt dt dt dt dt d dt d dt dtot ot t ot ot ot ot ot ot ot ot t o t ot ot ot o est est est est est est est est est est est est t est e es est est s es e Fi Fi Fi Fi Fi Fi Fi Fi F F Fi Fi Fi Fi i i FireS reS reS reS reS reS reS S reS reS reS reS S reS r reS r re eS reS reSmar mar mar mar mar mar mar mar mar mar mar mar ma mar mar ma ma mart t t t t t t t t t t t t t t prescriptions (FPInnovations) To To To T To To T T T o o o orch rch rch rch rch c ch h rch rch ch ch re re re re re e e ready ady ady ady ady ady dy ady dy ady ady to t to to to o o o o to t t ig ig ig ig ig g g g ig ig g g ig gnit nit nit n nit nit nit nit t t nit n ni e s e e e s es es s s e s e s e stan tan tan tan t tan an an an tan an n nd t d d t d t dt d d d t d t t d t d t d to t o o o t o o o o t t o t t pre pre pre pre pre pre pre pre pre pre pre pre pre pre e e r scr scr scr sc scr c scr scr scr sc scr sc scr sc sc c s r ript ipt ipt ipt ipt ipt ipt pt ipt pt pt p ipt t p ipt ip ion ion ion ion on ion on io ion on on on n on ions ( s ( s ( s ( s ( s ( s ( s ( s ( s ( s ( s s s ( s FPI FPI F FP FP FPI FPI FP FP FP FPI FP P F FPI FP nno nno nno nno nno nno nno nno no no nno nno no nno n nn vat vat vat vat vat vat vat vat v vat v vat at vat a a ion ion ion io ion ion on on ion on ion ion o o ion ns s s s s s s s s s s s s s s pre pre pre pre p pre p pre pre pre pre pr pre p p e prescr s scr scr scr scr scr scr scr scr scr cr sc script i ipt ip ipt ipt ipt ipt ipt ipt ipt t ipt ipt ipt ipt p ion ion ion ion i ion i ion ion ion ion ion ions( ( s( s( ( ( ( s( s( s( s( s s ( s s(FPI FPI FPI FPI FP FP F FPI FP FPI PI FP FP P FPI F nno nno nno nno nno nno nno nno nno nno nno nno o o nn n vat vat vat vat vat vat vat vat vat vat vat va a at v tion ion ion i ion ion ion ion ion ion ion on ns s s s s s s s s s s s s s s s t t t t t t t t t t t t test est e es est est st es est e est s s) s) ) s) ) ) s) ) ) s) ) ) s) ) ) ) ) s) ) ) ) ) ) s) ) s s Collecting cameras and instruments after survival Zone burn. Col Col Co Col Col Col Col Co Col C Col Col C Col Co C Co o lec lec lec le lec lec lec lec lec lec ec ec ec c c e e ec ectin tin tin ti t tin tin in tin tin tin tin in t tin t tingc gc gc gc gc g gc gc gc gc gc gc g gc c gc came ame ame ame ame ame me me am ame ame ame ame ame ame a ame e eras ras ras ras ras as ras ras ras ras as ra ras ras ras a as s an an an an an an an an an an an an an an an a a di di d d di d d di di di di i i di di di di d nst nst t nst nst nst nst n nst nst nst n nst st t nst s rum rum rum rum rum rum rum rum rum um rum rum rum rum m rument ent t nt ent ent ent ent ent ent en ent en ent en ent t tsa sa sa sa sa sa sa sa sa sa sa sa s sa s afte fte fte ft fte fte fte fte f fte fte ft t fte fte fte fte e ers rs rs r r rs rs rs s rs rs rs rs rs s rs s surv urv urv urv urv urv urv rv urv urv urv urv urv r urv urv r iva i iva iva iva iva iva iva iva iv i iva iva iva a iva alZ lZ lZ l lZ lZ lZ lZ Z lZ Z Z Z Z Z Z Z Zone one one one one one one one o one one one one one o o e bu bu b bu bu bu bu bu bu bu bu b bu bu bu bu burn rn rn rn rn rn n rn rn rn rn n rn r rn n. n. n. n. n n. n. n. n. . n. . . . (FPInnovations, UofA & National Geographic) tin tin t tin tin tin i tin n n n i g c g c g c g c g g c g c g c g c g c g c c g g ame ame ame ame ame ame am ame me me ameras ras ras ras ras ras as as as ra a a an an an a an an n n an n n a a di d i d i d i d di d i d d d i d d nst ns nst n ns nst nst st st st st ns rum rum rum rum r rum um um um um ument en e ent ent ent ent ent n n nt t ent n n s a s sa s a sa s a s a a s a s s a afte fte fte f fte t te te e e e fte t ter s r s rs rs s s s s r s surv u urv urv urv u urv u ur urv u u iva iva iva iva va va va iva va v l Z l Z lZ lZ l Z Z Z l Z l Z l o o o o o o (FP (FP (FP (FP (FP (FP FP (FP (FP (FP (FP (FP F (F Inn Inn Inn Inn Inn nn nn nn Inn Inn Inn nn n Inn nn n I ova ova ova ova ova ova ova ova ova ova ova ova ov ova va atio tio tio tio tio tio tio tio tio o tio o tio t ti ti ns, ns, ns, ns, ns, ns, ns, ns, ns, ns, s, s s, s s s s, ns ns, Uo Uo Uo Uo Uo Uo Uo Uo Uo Uo Uo Uo Uo Uo UofA fA fA fA A fA fA fA fA fA A A fA fA fA A A & N &N & N & N & N & N & N & & N & N & N & N &N & N & & & N Nati ati at at ati ati at ati ati ati ati a ati at ati t ona ona ona ona ona ona ona ona ona ona ona ona ona ona n n nal G l G l G l G l G G G l G G lG l G G l G G G l eog eog eog eog eog eog eog eog eog eog eog eog eog eog g e rap rap rap rap rap rap p rap ap rap rap rap a rap a hic hic h hic hic hic hic hic hic hic ic h h hi i (FP (FP (FP (F (FP ( (FP (FP (FP (FP FP (FP F (FP (FP P (FPInn Inn Inn I Inn Inn Inn Inn Inn nn n nn nn nn nn n nnova ova ova ova ova ova ova ova ova ova ov v va va a a ovatio io ti tio tio tio tio tio tio tio t tio tio tio i tions ns ns n ns n n ns ns s ns n ns ns n ns s Uo Uo Uo Uo U Uo Uo Uo Uo Uo Uo U Uo Uo Uo ofA f fA fA f fA fA fA fA fA fA f fA fA f fA &N &N &N &N &N &N &N &N &N N &N &N &N N &N Nati ati ati ati ati ati ati ati ati ati ti ati ati a ati at t ona ona ona na na o ona ona ona ona na n ona a ona onalG lG lG lG lG lG G lG G G G G G G G G Geog eog eog eog eog eog og eog eog eog eog g og og e grap rap rap rap rap rap rap rap rap p p rap ap p aphic hic hi hic hi hi hi i hi hic hic i hic h h e e e e one one one one one n n n one one one c c c c c c c c c c c c c c) ) ) ) ) ) ) ) ) ) ) ) c c c c c c c c c c c c c c) ) ) ) ) ) ) ) ) ) ) ) ) Collecting samples for carbon deposition in forest fire ash study. Col Col Col Col Col Co Col Col Col Col Col C Co C Col Co C lec lec lec lec l lec lec lec lec le ec ec ec ec e ec e ectin tin tin tin tin tin tin i tin tin tin tin i tin n tin t t gs g gs gs gs gs gs gs gs gs gs gs g s g gs gsamp amp amp amp amp amp mp amp amp amp amp amp amp amp amp mples les les l les les les les les les s es les e es es e les fo fo fo fo fo fo fo fo fo fo fo fo fo fo o forc rc rc rc rc rc rc rc rc rc rc rc rc rc c c c carb b arb arb arb arb arb arb arb arb r r arb arb arb r arb a on on on on on on n on on on on on on on on on dep dep dep dep dep dep dep dep dep dep dep dep dep e dep ep dep deposi osi i osi osi osi osi osi osi i osi si osi osi osi s os os s tio tio tio tio tio tio tio tio tio ti tio i tio ti i tio tio oni ni ni ni ni i ni ni ni ni ni ni n i ni ninf nf nf nf nf nf f nf nf nf f nf nf nf n n f n ore ore ore ore ore ore r ore ore ore ore ore ore ore ore or re rest st st st st st st st st st st st st st s st st st fir fir fir fir fir fir fir fir fir fir fir fi fir fir i fir ir f ea ea ea ea ea ea a ea ea ea ea ea e ea ea ea ea eash sh sh sh sh sh sh sh sh sh sh sh sh s sh s stu stu stu stu stu stu st stu stu stu tu tu stu stu stu stu t dy dy d dy dy dy dy dy dy dy dy dy dy dy dy y. y. y. y y. y. y y. y. y. y. y y. y. (Swansea University, Canadian Forest Service and University of Col C Col Col Co o Col Col ol l le le lec lec ec lec c c lec le ec ectin tin tin tin tin in tin i tin n tin ng s g s g g s g g s g g s s g s g g s amp amp amp amp amp amp mp amp m mp amp amp a amp amp mples l les les es es es les s le fo fo fo fo fo o o o f fo or c r r r c r r c c c c r c carb arb arb arb arb arb arb arb b arb b a arb bon on on o o on on n on n n on n n dep dep dep dep dep dep dep d dep ep e dep dep osi os osi os osi si s osi i os osi s s ti ti tio tio tio tio tio tio ti tio ion i ni n i n n i n i n n i n i n n i n n in f n f nf n nf n n f n f n f n n n f n ore ore o ore o ore ore ore re ore r st st s st st st st t st s st t fir f f fi ir ir ir fir ir ire a e a e a ea e a e a e a e a e a a ash sh sh sh sh h sh sh sh sh h stu stu stu stu stu stu t stu stu u u s s stu s u udy dy dy dy dy dy dy dy d dy d dy y y y. y. y. . . . . (Sw (Sw (Sw (Sw (Sw Sw (Sw (Sw (Sw (Sw Sw (Sw Sw (Sw ans ans ans ans ans ans ans ans ans ans ans s ans ans ans s an ea ea ea ea ea ea ea ea ea ea ea ea ea e ea ea a Uni Uni Uni Uni Un Un Un Un Un Uni Uni Uni U Un ni iver ver ver ver ver ver ver ver ver ver ver ve ver er er v ver sit sit sit sit sit sit sit sit sit sit sit s s s sit ity, y, y, y, y, y, y, y, y, y, y, y y, , y y, Can Can Can Can Can Can Can Can Can Ca Can Can Ca anad adi ad ad adi adi ad adi ad adi ad a a a an an an an an an an n an an a an a For For For For For F For For For or For For Fo o est est est est est est est est est est est es e est es s st t Se Se Se Se Se Se Se Se Se Se Se Se Se Se e e Servi rvi rv rvi vi v rv rv rvi v rvi v rvi vi v ce ce ce ce ce ce ce ce ce ce ce ce ce ce e e e e and and and and and and and and and and and and d n Un Un Un Un Un Un Un Un Un Un Un U Un nive ive ive ive ive ive ve ve ive ive ve ve ive ve ve i rsi rsi rsi rsi rsi rsi rs si rs rsi s s s s s rsi ity ty ty ty ty ty ty ty ty ty ty ty of of of of of o of o of o o of of of (Sw (Sw (Sw ( (Sw (Sw (Sw (Sw (Sw (Sw (Sw Sw Sw Sw (Sw w S Swans ans ans an ans ans a ans ans n ans ans s ans a ans ans n ea ea ea ea ea ea ea ea a ea e ea e ea a a a Uni ni ni Uni Uni Un Uni Uni Uni i Un Uni Uni ni ni n n n ver ver ver ver ver ver ver ver ver v ver ver r ver ver rsit sit sit si sit sit sit sit sit t sit sit sit sit it t s ty y y y y y y y y y y y y y y Can Can Can Can Can Can Can Can Can Can Can Can Can C Can Can a a adi adi d adi ad adi adi adi adi adi adi adi adi d a ad adi d an an an an an an n an n an an an an n n an For For For For For For For For For For For r or or or F F est t est t est est est est est es est t st est s est Se Se Se Se Se Se Se S Se S Se S Se S Servi vi rvi rvi vi rvi rvi vi rvi rvi rvi rvi rv rv ce ce ce ce ce ce ce ce ce e e ce e e and and d and and and and nd and and a and a an nd nd a Un Un Un Un Un Un n Un Un Un Un U Un Un n n nive ive ive ive iv ive ive ive ive ve iv v ve e ve i ersi rsi si rsi rsi rsi i rsi rsi rsi rsi rs rs rs s si ity ty ty ty ty ty ty t ty ty t ty ty y y ty y of of f of of of of of of of of of of o o f f f f f f f f f f f f f Alberta) adi ad adi di adi ad di d di ad di dian an an an an an an an an an n n For F For Fo For or o or For F For Alb Alb Alb Alb Alb Alb Alb Alb Alb Alb Alb Alb A b lb A Alb Al ert ert ert ert ert er ert ert ert ert ert ert e ert e e e a a a a a a a a a a a a a a Alb Alb Alb lb l Alb b Alb Alb Alb Alb Alb Alb Alb Alb Albert ert ert ert t ert ert ert ert ert ert ert ert t e a a a a a a a a a t t t t t rest est e es es s est e est e est a) a) a) a) a) a) a) a) a) a) a) a) a) a a a) a) ) a) ) a) a) a) ) a) a) a a) Testing small IR detectors Tes Tes Tes T Tes Tes Tes Tes Tes Tes es Tes Tes Tes Te Tes s s e tin tin tin tin tin tin tin tin tin tin tin t tin tin i tin t tings gs gs gs gs gs gs gs gs gs g gs gs smal mal mal mal mal mal mal mal ma ma ma ma ma ma mal ma m lI lI l lI lI lI lI I lI I lI I I IRd Rd Rd Rd Rd Rd d Rd R Rd Rd Rd Rd Rd Rd d R ete ete ete ete ete te ete ete ete ete ete ete ete te t ete ete ecto cto cto ct cto cto cto cto cto cto cto cto t cto to ct to c rs r rs r r r r rs r r r rs rs r r s s s s s s s s s s s s s s s (FPInnovations) tin tin tin tin tin tin tin tin tin n tin ing s g s g s g g s g s g g s g s g s g s mal mal mal mal mal ma mal ma mal ma mal ma a lI l I l l l I l I I l I I IR d R d R d R d R d R d Rd d d R d d R d R d et et e et et et t e et (FP (FP (FP (FP (FP (FP (FP (FP (FP FP (FP (FP FP ( Inn Inn Inn nn Inn Inn nn nn n n nn nnova ova ova ova ova ova ova ova ova ova ov ova va v tio tio tio tio tio io tio tio tio o io tio t t tio t n ns ns ns ns n ns ns n ns s s s n (FP (FP ( (FP (F (FP (FP (FP FP F (FP (FP (FP P (FP FPInn Inn Inn Inn Inn I Inn Inn nn n n nn nn nn nnova ova ova ova o ova ova ov v ova va a ova ova ova ovatio tio tio tio tio i tio tio tio tio tio tio tio t t t ns ns ns ns ns n ns n n ns ns t t t to o t t t te te te te e te e e e te tect c c c ct ct c ct ct c ct s) s) ) s) s) s) s) s) s) s) s s s) s) s) s) s) ) ) s) s) s) ) s) s s s) s) s s Testing fire proof cameras on FireSmart burn. Tes Tes Tes Tes Tes Tes Tes Tes Tes Tes Tes es Tes es es stin tin tin tin tin tin ti tin tin tin t tin tin tin in in tin t gf gf gf gf gf gf gf f gf gf f gf gf gf g g f f g g ire ire ire ire ire ire ire ire ire ire ire re re e e i e pr pr pr p pr pr pr pr pr pr r r pr pr p oof oof oof oof oof oof oof oof oof f oof oof f o oo oo o of ca ca ca ca ca a c ca ca ca c ca ca ca ca ca ca amer mer mer mer mer m mer mer er mer mer mer me mer mer me e as as as as as as as as as as s as as as as as as s on on on on on on on on on n on on on o on Fir Fir Fir Fir Fir ir Fir Fir Fi Fir Fir Fir Fir r ir reSm eSm eSm eSm eSm eSm eSm eSm eS eSm eSm eSm S eSm m m m eSm e art art art art t art art art art art art art art ar ar rt art bu b bu b b b bu bu bu b bu bu bu bu bu urn rn rn rn n rn rn rn rn rn n rn r rn rn n n. n. n n. n. n. n. . . n (FPInnovations & National Geographic) es es e e es s s s es s stin tin tin tin tin tin in i tin n tin ing f g f g g f g g f g g g g f g f ire i ire ire ire re ire e e e r r pr pr pr p p p pr pr pr p pr oof oo oof oof oof oof oo of oof oof ca ca ca ca c ca c ca ca ca amer me me mer mer me mer mer mer mer m m as as as as a as as as as on o on on on on on on on n n Fir Fir Fir Fir Fir ir Fir Fi ireSm eSm eS eSm eSm eSm eSm S S Sm eSm eSm mart art art art art art art t t ar a art t b b b b b b b b b (FP (FP (FP ( (FP (FP (FP (FP (FP (FP (FP (FP (FP FP PInn Inn Inn Inn nn Inn Inn nn nn In nn Inn nn Inn n nnova ova ova ova ova o ova ova ova ova ova ova ova ova v vatio tio tio tio tio o tio tio tio tio tio tio t t tions ns ns ns ns ns ns ns ns ns ns ns s s s n & N & N & N & N & N & N & N & & &N & N &N & N &N & & N & Nati ati ati ati ati ati at ati ati at a ati t at ationa ona ona ona ona ona ona ona ona ona ona a ona ona n n n l G l G l G l G G l G l G l G G G l G G G G l Geog eog eog eog eog eog eog eog eog eog eog eog eog eog eog eog eog eograp rap rap rap rap rap ap rap rap rap p rap a rap ra hic hic h hic hic hic hic hic hic h hic h h hi h hi (FP (FP ( ( (FP (FP (FP (FP (FP (FP (FP (FP (FP (FP (FP P (FP (FPInn Inn Inn Inn I Inn Inn I Inn Inn I Inn n Inn n nnova ova ova ova ova ova ova v ova ova ova ova ova va vatio io tio tio tio tio tio tio tio tio t t t tio tio tions ns ns ns n ns ns s ns ns n ns ns n ns s &N &N &N &N &N &N &N &N &N &N &N N & &N &N & ati ati i ati ati ti ati ati ati ati ati ati t ati at t t ona ona ona ona ona ona on ona ona ona ona ona on on n onalG lG lG l lG lG lG lG lG G G G G G G Ge eog eog eog eog eog og eog eog eog eog o eog g g eograp rap rap rap rap ap rap rap rap rap rap a ap rap phic hi hi h hic hi hi hic hic hi hi i hi h hic n n n n n n n bu bu bu bu u u u u u bu bu ur rn r r rn rn rn c c c c c c c c c c c c) ) ) ) ) ) ) ) ) ) ) c c c c c c c c c c c c c) ) ) ) ) ) ) ) ) ) ) ) Igniting Survival Zone plot with new Terra Torch. Ign Ign Ign Ign Ign Ig Ign Ign Ign Ign gn Ign Ign gn gn g Igniti iti ti iti iti i iti iti iti iti iti iti ti iti t ti it ng ng ng ng ng n ng ng ng ng ng ng g ng ng n ng Sur Sur Sur Sur Sur Sur Sur Su Sur Sur Sur Su S Sur ur Sur Su ur S viv viv viv viv viv viv viv iv viv viv viv viv viv viv viv viv v vival al al al l al al al a al a al a a Zon Z Zon Zon Zon Zon Zon Z Zon Zon Zon Zon Zon Z Zon Z Z ep ep ep ep ep p ep ep ep ep ep ep ep ep e e e lot lot lot lot lot lot lot lot t ot lot lot o lot lot t lot wi wi wi wi wi wi wi wi wi i wi wi w wi w wi w th th h th th th th th th th th t th th t th new new new new new new new new new new new new new w w new new Te Te Te Te Te Te Te Te Te Te Te Te Te Te e Te e erra rra rra rra rra rra rra a rra rra rra rra rra rra a a To To To T To To To T To To To To To To To Torch rch rch rch rch rch rch rch rch rch rch rch rch rch c rch rch c c h h h h h h h h h h h. . . . . . . . (FPInnovations ) a a al al al al al l a al a Zon Zon Zon Zon Zon Zon on on Z n n ne p e p e p e p e p p e p p p e p p e plot lo lot l lot ot ot t lot lo ot ot t wi wi wi w w wi w w w w th th th th th t th th th h h h (FP (FP (FP (FP (FP (FP (FP FP (FP (FP (FP (FP (FP FP PInn Inn Inn nn nn Inn nn nn n nn nn In nnova ova ova ova ova ova ova ova ova ov ova ov ova ov o a atio tio tio tio tio tio tio tio tio tio tio tio i ns ns ns ns ns ns ns ns ns n n ns ns s s ns ns n (FP (FP ( (FP (FP (FP ( (FP (FP (FP (FP (FP FP FP F ( Inn Inn Inn Inn I Inn Inn Inn nn n nn nn n nn n nn nn nnova ova ova ova ova ova v ova ova ova va ova v o atio tio i tio ti tio tio tio tio ti tio ti tio tio o t ons ns ns n ns ns ns ns ns ns s n ns ns s s e e e ew e e e h h h h h h h h ne ne ne ne n n ne ne n n s s s s s ) ) ) ) ) ) ) ) ) ) ) s ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) ) Regen from ICFME burn in 1999 Reg Reg Reg Reg Reg R Reg Reg Reg Re Reg Reg Reg Reg Reg Reg Reg egen en en en en en en e en en en en en n en n en fro fro fro fro fro fro fro fro fro fro fro fro fro fr r fro o rom I m I m I m I m I mI m I mI m m I m m m m m m I m m ICFM CFM CFM CFM CFM CFM CFM CFM CFM CFM FM FM CFM CFM C CFM CFM C CFME b E b E b E b E b Eb E b E b E E b Eb E b E E b E b E E burn urn urn urn rn urn urn urn urn urn urn urn urn urn urn r in in in in in in in in in in in in i in in in n 19 19 19 19 19 19 19 19 19 19 19 9 19 19 19 199 9 9 9 9 9 9 9 9 9 9 9 9 9 99 99 99 99 99 9 99 99 9 99 99 9 99 99 99 9 9 Untreated plot Unt Unt Unt Unt Unt Unt Unt Unt Unt Unt Unt Unt Unt Unt Unt Unt Unt U rea rea rea rea rea rea rea rea rea rea rea rea rea rea e eated ted ted ted ted ted ted ted ted ted t ted ted ted ed ed d e pl pl pl pl pl pl pl pl p p pl p p p p o o o o o o o o o o o o o ot ot t ot t ot ot ot ot ot ot ot ot t ot ot t t t t

Upload: others

Post on 29-Jul-2020

9 views

Category:

Documents


0 download

TRANSCRIPT

Page 1: Canadian Boreal Communities FireSmart (CBCFS) Project sitewildfire/2012/Posters/Nixon.pdf · Communities FireSmart (CBCFS) project site. We would like to make the Wildfire community

Wildfire professionals from around the world have been coming to the NWT to conduct research at our wildfire research site since the mid 1990s. Originally used for the International Crown Fire Modelling Experiment (ICFME) from 1997-2000, the location has continued to be used for research as the Canadian Boreal Communities FireSmart (CBCFS) project site.

We would like to make the Wildfire community aware of activities and availability of the site and encourage researchers to make use of it.

The research team, lead by GNWT ENR staff and FPInnovations, includes local fire crews and researchers who have come from government, institutional and private sectors from across Canada as well as over a dozen countries including the UK, USA, Russia, France & Japan.

The knowledge and understanding of fire behaviour, firefighter safety, equipment and FireSmart principles gained by these researchers is shared with wildfire professionals all over the world.

Most of the activity at the site occurs towards the end of June but researchers can be found onsite at any time of the year depending on their objectives.

Canadian Boreal Communities

FireSmart (CBCFS) Project site

Getting involvedGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGeeeeeeeeeeeeeeeeeeeeeeeeeeettttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttttiiiiiiiiiiiiiiiiiiiiiiiiinnnnnnnnnnnnnnnnnnnnnnnnnnngggggggggggggggggggggggggg iiiiiiiiiiiiiiiiiiiiiinnnnnnnnnnnnnnnnnnnnnnnnnnnnnnvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvvoooooooooooooooooooolllllllllllllllllvvvvvvvvvvvvvvvvvvvvvvvvvvveeeeeeeeeeeeeeeeeeeeeeeeeeedddddddddddddddddddddddddddddddddddddddddgggggggActivities on the site are coordinated by AcAcAcAcAcAcAcAcAcAcAccAcAcActitiititittitititititittittiiitttt viviviviivivivivivivivvvivivivitititititiittititititititititititttt esesesesesesesesesesesesessesssesseeee oooooooooooonnnnnnnnnnnnnnnn ththhththhttththththththththttthtttheeeeeeeeeeeeeeeee sisisisisisiisisisisisisiiissssssitetetetetetetetetetetetetttetetteete aaaaaaaaaaaaaaaaaarerererererrererereererererereeere ccccccccccccccccccooooooooooooooooooooooordrddrdrddrdrdrdrdrrrrrddrdr inininiininininininininiinnninnnnnatatatattatatatatattatatatatttatatattttedededededdedededededeededeeede bbbbbbbbbbbbbby yyyyyyyyyy yy yyyyyyyyyAcAcAAcAcAAcAcAcAcAcAAcAAa GNWT project manager who works AcAAAcAAcAAcAcccAccctitititttiiiitititivivvvivvviviiivvivivviiittittitiitiitittiiiieseseseseseessesess oooooooon nnnnnnnnnnnnn thththttthhthhthhhtthe eeeeeee sisssiisiiiissiitettetteteeettetee aaaaaaaaaaaarrerrerrerereeereree cccccccccoooooooooooooooooordrdrrrdrdrddddddiiinininnnnnninnininininnnnnnaatataataaaaataattaatatedededededdddededddd bbbbbbbbaaaaaaaaaaaa GNGNGNGNGNGNGNGNGNGGGNGGGG WTWTWWWTWTWWTWWW pppppppppppppprororoooororoooooojejejejeejeeejeejeeeeeeeectctctctctcctctcctctttcccc mmmmmmmmmmmanananananananaaanaaaa agagagagagagagagagagagaaagagerereererererereereeeeee wwwwwwwwwwwhohohohohohohoooooooo wwwwwwwwwwwwororororororororoooroo kskskskskskssssksksksksksssaaaaaaaaaaaaaaaa GNGNGNGNGNGNGNGNGNGNGNNNNNNNGNGGNWTWTWWWTWWTWWTWWWTTTWTWTWTWTWTWTTT pppppppppppppprororororororrorrrororroooor jejejjejjejejejejejejjjjejeeectcttctctctctcttctctctctctttttctctt mmmmmmmmmmmmmmanananananananananannanananaaaa agagagagagagagagagagagggagagaagererererererererererrrrerr wwwwwwwwwwwwwwwwwwwhohhohohhohohohohohohohoo wwwwwwwwwwwwwworororororororrororrorrorrkskkskskkkskskskskskksksksksksssswith FPInnovations, researchers, local a aaaaaaaaaaaaaa GNGNGNGNGGNGNGNNGNGNNNNNWTWTWTWWTTTWTWTWWWTT ppppppppppppprorrorooorrrooooooojejejejeejejejeejejejjjj ctctctcctctctctcctttct mmmmmmmmmmmmmmmanaaanaannannaaaaannnnagagagaagagggaggagaagagagaagereeerererrreeerrre wwwwwwwwwhohohohohohhooohhhhhoooooo wwwwwwwworoorooororooorrrrkskskskskkskksksskkkskkss wiwiwiwiwiwwwiwiwiw thththththththtttt FFFFFFFFFPPIPPPPIPPIPIPIP nnnnnnnnnnnnnnnnn ovovovovovovovovovovovovatatataataatatatatatatttta iooioooioooioiooooonsnsnsnsnsnssnsnsnssnsnsss,,,,,,,,,,, rereeerereererereeeeeeeseseseseseseseseseseseseeeseeeeearaaaraarararaara chchchchchchcchhchchccccccc ereeerererereeeerereree s,s,s,s,s,s,s,s,sss,s,s,,s llllococococococococococococccalaalaalaalalaaawiiwiwiwiiwiwiwiwiwiiwiwwiwwwiwiw thththththththttthththhtthttt FFFFFFFFFFFFFFPIPIPIPPIPIIPIPIPIPPPP nnnnnnnnnnnnnnnnnnnnnnnnnnnnnovovovovovovovvvvovovovovovvatatatttatatatatatatatatattatattioioioioioioiiioiooioii nsnnsnsnsnsnsnssnsnsnsnssssssns rerrererrrerereererereeesesesesesesesesesesesessesss ararararararrarrrarararararrarchchchchchchchchchchchcccc ererererererrrerrerererrerrersssssssssssssss llllllllococococococococococoooccccco alalalalalalalalaaaaaaauthorities and Regional and Territorial wiwwwiwwiiiwwwwiwwiitthtthththhtthhhhhhtt FFFFFFFPIPPIPPIIPPIPInnnnnnnnnnnnnnnnnnnnnnnnnnovovoooovovovovoovataatatataattatataaattttioiioiooiooooiioioooonsnsnsnsnsnsnssnnnnns, ,,,,,,,,,,,,,,, rerrreereeeerrreeeeeseseseseseeseseseseseseseararaaaraaraaaraaaraarra chchchcchchhhchchcchhhhhhc erereeerrereerrrree s,s,ss,s,,s,ss,s,,,,s,,, llllllocoocococcocococococccalaalaalaaalaaaaalal auauaauauauauauaaauaauuthththththhhththtthththorororororororororoorritititittittittttiititieieieeieieieeeeeeeeei ssssssssssssssss anananaananananaanaaaannd ddddddddddddd ReReReReReReReReReeReReReeeeeRRReR gigigiggigigigiggigiiiggggg onoononononononononoonnalalaalalaalaaalaaalllall aaaaaaaaaaaaaaaandndndndndndndndndndndndnndd TTTTTTTTTTTTTererererererereererererereee riririrrririririririr totototototottototottotott ririirirriririrririr alalalalalalalaalaaaaallaa auauauaaauauaauauuuuuuauaa thththththththththhththhthttttt orororororororororrrrrororititititititiitttititiitttiittttieiieieieieiieieieieieiessssssssssssssss ananananananannannannaannaa ddddddddddddd ReReReReReReRReReReReReegigigiigigigiigigigigggigigg ononononononononononnnnnonalalalalalalalalalaaaaaaa aaaaaaaaaaaaandndndndnddndnddndndnndd TTTTTTTTTTTTTTTTererereerererereerrrrerrererre ririririiririiriririrririirr totototottttototottototoott riririririiririririrrrriiirr alalalalalallalalalaaaaaFire Control.auauauauauauauaauuauauauauuthththththhhthhtthhhhororoorooroorororroritititiiititttiitttieiieiieeieeiieessssssssss anaaaaaanannnnnFFiFiFFiFFFFiFFFFiiirererererrerereerereeeeeerr CCCCCCCCCCCCCCCConononoononoononnononnnnntrtrtrtrtrtrtrtrttrttttrrrroooooooooooFiFiFiFiFiFFiiFFiFiFiFiFiiFFFiiiiiiF rerrererrerrerreererererrerere CCCCCCCCCCCCCCononononoonnonononononnontrtrttrtrtrtrtrtrttrrrrrtrtrrtrtrooooooooooo

nnnnnddddananaaaanannaaaanannnnalllllllllll..............lllllllllllFFFiFFiiFFiFiFii

The majority of the research is ThhhhhhhThThThhhheeeeeeeeeeeeeeeeeee mammamamamamammamamamamamaaaaajojojjojojjojojojojojojjjoriiriririririrririrriirrr tytyttytytytytyttytyttytytyytytytttt oooooooooooofffffffffffffffff ththththththththtthttttththtthtttt eeeeeeeeeeeeeeeee rererrererrererererererreerereeesesesesesesesesesesesesessseesearararararararrrararararraaraaa chchchhchchcchchcchchchccc iiiiiiiiiiiiiissssssssssssssssssThTTThThhTThThTTTTTTTTTconducted by FPInnovations, however ThThThThThThTThhhheeeeeeeeeeeee mammamamamamaamaaammammmaaajojojojjojojoojjjjojojojjjj ririrriirrriiityttyttyytyttyttyttytyyyyy ooooooooooof fffffff thththhhththhtttthhhhhhhht e eeeeeeeeeeee rerrerereeeerrreeesesessesseseeseseses araaaararararaaraaarrrrchchchcchhchhcccchhhh iiiiiiiissssssssssssscococoococoocococococccccccooondndddndndndndndndnddducucucucucucucucccucucucccteteteteeteteteteteteeeetteeedddddddddd bybybybyybybybybybyb FFFFFFFFFFPIPIPIIPPPPIPInnnnnnnnnnnnnnnnnovovovovovovovovovovovovo ataattataatatatatatatattioioioiooooooooonsnsnsnsnsnssssnssnssss,,,,,,,,,,,,,, hohohohohoohohohohoowewewewewewewewewewewweweweeeeeeeevevevevevevevevvevevvvevvevevveveveerrrrrrrrrrrrrrrcocococococococococococc ndndndndndndndndndndnnnddn ucuccucuccucuucucucucuccccctetetetttetetetettetetettttt ddddddddddddd bybybybybbybybybybybyyyyyyybby FFFFFFFFFFFFFFFFPIPPIPIPIPIPIPPIPPPIIP nnnnnnnnnnnnnnnnnnnnnnnnnnnovovovovovovovovvovvvvovvvovo atatattatatatattatatatatatatatioioioioioioioiioooonsnsnsnsnsnsnsnnsnnsnsnsnssns hohohohhohohohohohohohohhowwwwwwwwwwwwwwwother researchers are encouraged to cocococococococooondndndndndnndndnddndndnnnddducucucucuucucucucuuccctetetettetetteteed ddddddddddd bybbybybybybbyybbbbybyy FFFFFFFFFFPIPPIPIPIIIPIPIIInnnnnnnnnnnnnnnnnnnnnnnnovoovovovovvvovatatataaatataaatatataaa ioioioioooiioonsnnnsnnsnssnssnsnsnn ,,,,,,,,,,,,,,, hhohhohhohohohohohohhhowewewwewweweweeewwwevevevevevvveveeveer rrrrrrrrototototototoottototottootheheheheheheeeheeeeeeeeerrrrrrr rerereereeeerereeeeeesesesesesesesesessesesesesseeesseeaararaararararaaaraaa chchchchchchchchccchccchcc erereererereererereeeeee sssssssssssssss araaaraararaaaareeeeeeeeeeeeeeeee eneneneneneneneneneeeeeee cococococococococoocccoccccoururuururururururuu agagagagagagagagagaggaaggededededededededededeeeed tttttttttttooooooooooooottotototototottottotottotttthehhehehhhehehehehehehheeheerrrrrrrrrrrrrrr rererrererererrerrerrereeeresesesesesesesesesesesesessss araraarararararrrrararrararaaarrchhhchchchchchchchchchchcchcc ererererererrrererrererrerrrsssssssssssssssss arararararararrrrararrararraararreeeeeeeeeee enenenenenenenennnenenenncocococococococococococc uruurururururuurrrurrruuruururrrragaagagagagaggagaggagagaaaa edddedededededededededde tttttttttttttttttttooooooooooosubmit ideas or attend as observers. otootottoootototthehhhehheeeehhhheeeer rrrrrrr rerereeererrereeesesesesesseseeesesesees araaaaraaaaararaarraa chchcchchhhhcccchhhhereeeererreeeerrrssssssssssss araaaaaraaararaaaarreeeeeeeeeeee enenenenennenenenennnnnncocococococcoooccocooouruuuuuuurruruuuuurrragagagagagagagaggagagagaaggggededededeededddededddd tttttttttttto ooooooosusususussussusususususususssuubmbmbmbmbmbmbmbmbbmmmbmbbmititittititittttiitititi iiiiiiiidedededededededededeeedeeeedddd asasasasasassasasasassasasaaa oooooooooooorr rrrrrrrr atatatatatatatatatatatatatatatteteteeteteteteteteteeetteeteteeendndndndndnddndndndndnndndndd aaaaaaaaaaaaaaas sssssssssssssssss obobobobobobobobobobobobbbsesesesesessseseseseseseeessseeservrvrvvvvvvrvvrvrrrvr ererererererereeerereereeerrrsssssssssssssssssususususususususuuuusuuususs bmbmbmbmbmbbmbmbmbmbmbmmmbmmitititititiiitittitittiitttttt iiiiiiiiiiiiideddededededededededededeasasasasasasasasasasssssas oooooooooooorrrrrrrrrrrrrrrr atatatattatatatatattatataattatatttetetetetttetettetetetteetet ndndndndndndndndndnndnnnnd aaaaaaaaaaaaaaaassssssssssssssss obobobobbbobbobobobobobsesesesesessesesesesesesss rvrvrvrvrvrvrvrrvrrrvvvvvvvrverererererererereererrrererssssssssssssss

o oooooooo................. susususssssususususuu

For more information, please contact the FoooFoFoFooFoFoFFoFoFoFF rrrrrrrrrrrrrrrr momomomomomomommommommomomommorererererererererrrerrerreereeer iiiiiiiiiiiiiinfnfnfnfnfnfnffnfnfnfffnfnffnnffforororororororororrrorrorormamamamamamamamammammamamaamaaamamatittititititittititittittitittt onononononononononononnnonnnnnn,,,,,,,,,,,,,,,,,,,, plplplplplplplplpppppppllleaeaeaeaeaeaeaeaeaeaaeaeaeaaeeaeasesesesesesesesesesesesessesesssseesee ccccccccccccccconononononononononnonnnononnnnntatatattatatatatatatattatataaaactctctctctctcttctctcctttctctctcttctcctc tttttttttttttttttthehehehhehehehehehehehheeeehhhh FFoFoFoFFoFoFoFoFooFFFFproject manager:FoFoFoFoFooooFoFFoFooor rrrrr mommmommmmooomomommmomoooorerererereeerrreeeeee iiiiiiiinfnnnnfnfnfnnnnnfnfnfn orororooorororoorrroo mammammamamaammmmmmm tittttiiprprprprprprprprprrrpprpp ojojojojjojojojooojjjeceeececececceceecececcceeeect tttttttttttt tt mamamamamamaamamamamamaamamamaanananananananananaaananaannnnagegegegegegegegegeegegegeeeegg rrrrrrrprpprprppprprprprprrrprprprrrojojojjojojjojojojooojojo ecececececeececececeeccccctttttttttttttttttt mammmamammamamamamammamamaaananannanananaanananananaaaagegegegegegeggegeggeggegegerrrrrrrr

iiiiooooaaaaaaaaaaaaaaatitttttitittttiiittr:r:::r::rr:r:r:r::r::::rr:r:rrrrr:r:r:rr:r::r:r:r:::::

Larry NixonLaLaLaLaLaLaLLaLaLLaLaaLaaaaLLaarrrrrrrrrrrrrrrrrrrrrrrrrrrrryyyyyyyyyyyyyyy NiNiNiiNiNiNiiNiiiiNiNNiiNiN xoxxoxoxoxxoxxoxoxoxoxxoxoxoxxonnnnnyyyyyyyyyy NNNNNNNNNNNNNNNN nnnnnnnnnnnnnnnWildfire Risk Management Coordinator

LaLaLaaaaLaaLLaLLaaaaaaarrrrrrrrrrrrrrrrry yyyyyyyyyyyyy NiNiNNNNiNNiNiNNNNNiixoxoxoxoooxxxxoxxxoxooonnnnnnnnnnnnnnnWiWiWiWiWiWWiWiWiWWWiWiWWiWiiWiiWWiWiWiillldldldddldlldldldddldlddllldddfififffififififiifififfiififififfifiiiirerererererererrererrerereeeeeeer RRRRRRRRRRRRRRRRRRRisisisisiisisisiisissisisisisissisi k kkkkkkkkkkkkkkkkkkk MaMaMaMaMaMMaMaaMaMaManananannananananaaanagegegegegegeeegegegegeeeeememeememeeemememememeeeeeeentntntttnntntntntntntn CCCCCCCCCCCCCCCoooooooooooooooooooooooorddrdrdrdrdrdrddrdrdrddrrrdrdrddrrddininininiinininininininiiininnnnniinnnattatttatatatatattatatattattttatatattaa ooooooooooookkkkkkkkkkk MaMMMaMaMaMMaMMaMaMMaMaMaMaMaaaManananannananananananananananaagegegegegegegegegggegegeeemememememmemememmememeemememeeentntntnntnneeeeeentnttntnttntnttntnttntnnttttntnn ororrorrorrorororrrrorororr

Fire kk kkkkkk kkkkk MaMMaMaMaMMaMaMaMaMMMMaMaMaMaMaMM nnnanannanaaaa

FiFFiFiFiFFFFirerrerereeereeereeeFiFFiFiFiFiFiFiFiiFiiFiFiFiFirerererererererererrrrre Science,aaaaaaagegegegegegegegeeggggggggg mememememmmemmemmemmemmemmentntnntnnnntnnn Caannnananananaanaannannanaa

eeeeeeeeeeeeeeeeeeeeeeeee ScScScScccScScSScccScccS ieieieieeeeieeeeeeencncncncncnccncnccnccnccceeeeeeeeeeeeScScScScSScScScScScSccccieiiieieiieieieieieieiiieiieieencncncncncncncncnnncncncncnceeeeeeeeeeeeSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSCCCCCCCCntnntnnttntntnnnttt C

e,eee,e,e,e,eee,e,e,,,eeeeeeeeeeeeeeForest Management

FiFFiFiiFFiFiFiiirerereerreeeeeeee Sccccccccieieieieeeeiiieieencncncncncncnccnnncnn eeeeeeeSSSSSSSSFoFoFFFFoooooooooorerererererererrererrererereeeeststtstststststststtstststststststsststst MMMMMMMMMMMManananananananananaaanagagagagagaagagagagagagggemememememememememememeeee eneneneneneneeneeneneneee ttttttMMMMMMMMMMMMMMManananananananannnanananaanana agaaggggagggggemememememmememmememememme enenenenennnenennenennnene tttttttttttttagagagagagagaagagagaagaggaaFFFFFFFFFFFFFFFFFFF Division,

eeee,e,e,e,,e,e,,,,,,,,,,,,tttttttttttttttttttttttttt DiDiDDiDDDDD viviviiviiviiviviviviviviivvviv isisisisisisisisisisisisisiisssssss ononononononononnononononn,,,,,,,,,,,DiiiiiiiDiiiiiiiiiiiiiiDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDDD

Environment and Natural Resources,Foooooooorererereeerrerreeststststsststsssttt MMMMMMMMMMMMMMMManananananananaananaanannnagagagagagagagagagagaagagagggggemememeemmemememememmmmmmmmeneneenenneneneneennnnnttttFFFFFFFFFF ttttttttt DDiiiiiiiiivivivivviviivvvviisisssisisisisisiionooonononononnnnnnnnnn,,,,,,,,,,,,,DDDDDDDDDD

EnEnEnEnEnEnEnEEnEnEEnEEnEnEnEnEnnnEEnEnEEEnnvivivivviviviviviivivivvviiroroororooorrororororoorr nmnmmnmnmnmnmnmnmnmn eneneneneneneeneneneneeeeee tttttttttttttt anaananananananananaa dddddddddddd NaaNaNaNaNaaNaNaNaNaaaaN tutuutututututututuututtt rarararararaaraaraaraaallllllll ReReReReReReReReReReReReReeReReeeResososososososososossosososs ururuurururururururururrcececececececececececececeeccececeesssssssssssssssssnnnnnnvvvvvvvvvvvvvviviiv roroorooooroooroonmnmnmnmnmnmnmnmnmnmnmnnmmn enenenenennenenenenennenntttttttttttttttttt anananananananaanananananndddddddddddddddd NaNNaNNaNaNaNaNNaNNNaNaNaNaNaaaatuttttuttutututtutututtuuututuuutt rarararararararrarrrarararraaaaviviviiiviiiviviivivivvvvivvivv rororrrrrrrrrrrrrorr aaalll ReReReRReReRReReReReReeesosososososososososososossss ururururururururuuruuurrrurururrrcececececececececececececccaaaaaaaaaaallllllllll RRRRRRRR s,s,ss,s,s,s,s,s,s,s,s,ss,ss,,,,,,Government of the NWT

ooooooooooonmnmnmnnmmmnmnmnmnnmnmmmmmeneeeneneneneneneennnnt tttttttttt ananananaanananaaananannnnnd dddddddddd NaNaNaNaaaNaaNNNNaNNaNaaatuttututuuuttuttutuuuuuurarararaaarrrarraaaaal llllllll ReReReReRReRReRRRReRRRReeeesososososooosssososossouruuuurrGoGoGoGoGoGoGoGGoGoGoGoGoGGG veveveveveveveveveveveeeeeeernrnrnrnrnnrnrnrnrnnmememememememememememeeeeemeentntntntntntntntnnttttttnt oooooooooooofffffff ththththththhtththtttheeeeeeeeeeeeeeee NWNWNWNWNWNWNWNWNWNWWNWTTTTTGoGoGoGoGoGoGoGoGoGoGoGGGoGoGoG vevvevevevvevvevevevevvvveevernrrnrnrnrrnrrnrnrnrnrrrnnnnmemmmemememememememememmeentntttntntntntntntntntntntnntttt oooooooooooffffffffffffffffffffff ththththththtthhhhthttttthttttht eeeeeeeeeeee NWNWNWNWNWNWNWNWNWNNWNWNNWWNWNWWWTTTTTTTTTTTT

rrrrrcooooooooouruuuurruruuuuuururuTTTTTTTTTTTTTTT

PO POPPPOPOPOPOPOPOPOPOPOPOPPPPPPPPOOOOOOOOOOOO Box 7 oooooooovevveveeevevvveeeeeernrnrnnnnnrrrnnmmmmmmmGoGoGoGoGoGoGoGGoGoGG

OOOOOOOOOOOOOOOOOOOOOO BoBoBoBoBoBoBoBoooooBoooxxxxxxxxxxxxx 77777777777BoBoBoBoBBoBoBoBoBooooxxxxxxxxxxxxxxxx 7777777777777BBBBBBBBBBBBBBBBBBBBBBBB -nnnnnnnnnmmmmmmm7777777777777777777nnnnnmmmmmmmmmm

---------- 149 McDougal Rd.eeeeeeeeeentnntntnntnttnnntnntttttt ooooooooooffffffff thtththththhtthttththhhthht e eeeeeeeeeeee NWNWNNNWNWWWNWNWNNWNWWTTTTTTTTT Teeeeeeeeeeemmmmmmmmmmmmmmmmmmmmm

----------------- 4444444444444444999999999999999 McMcMcMcMcMccMcMcMcMccccMcMcDoDoDoDoDoDoDoDoDoDoDooDougugugugugugugguguguggguuugggalaalalalalalalaaaaaa RRRRRRRRRRRRddddddddddddd444444444444999999999999 McMcMcMcMMMcMMcMcMcMcMcMccccDoDDDoDoDoDoDoDoDoDoDoDoooougugguguguguuguugugugguuggggalalalalallalalalaaaaaaa RRRRRRRRRRRRRRRRRddddddddddd111111111111111111111111111111 d..d.dd.d.dd...d......d.d.ddddddddddddddddFort Smith, NT X0E 0P0

OOOOOOOOOOOOOOO BBoBoooooxxxx xxxxxxxxxxxxx 777777777BBBBBBBBBBB 7 444444449 999999 McMcMMMcMcMMcMcMMMcMMcMM DoDDoDoDDoDoDoDoD uguguguguguguguguguuuggggggalalaaalaalalllalalaall RRRRRRRRRdd1111111111FoFoFoFoFoFoFoFoFoFFoFooooFFF rtrtrtrtrtrtrtrtrttrtrttt SSSSSSSSSSSSSSSmmimmimimimimmmimmimimithththtththththhtttththhhh,,,,,,,,,,,, NTNTNNTTNTNTNNNTTNNNTNNT XXXXXXXXXXXXXXX0E0E0E0E0E0EE00EE0E0EE0EE0EE 000000000000P0PPP0P0PPP0P0P0PPPFoFoFoFooooooortttrtrtrtrtrtrtrttrtrtrtrtrtttt SSSSSSSSSSSSSSSSFoFFoFoFoFFoFoFoFFoFoFoFFF SSSSSmmmmmmmmmmmmmmmmmmmmmiimmmm thththhhhhthhhthhhh NTNNNTNTNNTNTNTNTNTNTNTTNTTTNTT XXXXXXXXXXXXXXXXX0E0E0E0E0E0E0E0EEEE0E0E0EEEE 00000000000P0PP0PP0PPP0PPPP0mimiimmm ttttttttttttttmiiiiiiiiimiimimiitttttttttttttmimimimimimimimimmmim

dddddddddddddRRRRRRRRRRRRRRdd0000000000000000000000

867.872.7705 (P) 867.872.2077 (,,,,,,,,,,,,,

8686868686868686868686868686666668 7.77.7.7.7777.7.7.777777...777..87878787878787778878787878787872.2...2.2.2.2.22222.2222.2....22222.777777777777777777777777777777770505050505050505050505050550555555 (((((((((((((((P)P))P)P)P)P)P)P)P)))P)P)PPP)P) 8888888888888867676767676767676676767677777.88.8.8.8.8.8.8.888.8.88.88..... 727272727272727272727272727227227722.2.2.2.2.2.2.2.22.2.22.2.22.2...22..2207070707070707070700770707777 7777777777777777878787887878787877878778787788 22222222222222222 7777777777777777777777777770505050050505050550555000555 ((((((((((((P)P)P)PP)P)P)P)P)P)))P)P)PP 8888888888888886767676767676776767676767667676667767 8888888888888887272772727272727272722777227227227 2222222222222222200000000000007070707077777777770707070707077070777007070777777777777777 F((((((((((((((((( )FFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFFF))))))))))))))))

The Site

The site is 50 km north of Fort Providence NWT on Hwy 3.

The project area is in two parts:

• Blocks 1 & 2 are approximately 640ha of timbered area bordered by Hwy 3 on the east and birch bog along its other boundaries. The stand originated from a wildland fire in 1931 and is predominantly 10m Jack Pine with Black Spruce and Aspen. Block 1 was the site of the ICFME.

• Blocks 3 & 4 are 3 km south and are composed of approximately 150 ha of birch bog which straddles the highway.

Examining mulched line burn ratesExaExaExaExaExaExaExaExaExaExaExaExExxExaExaExaaE minminminminiminminminminminminminminm inginingingingingingingingingininggingnginging mumumumummumumumumumumumuumulchlchlchlchlclchlcchlchlchlchchccchcc edededdedededededededeedededeeed linllinlinlinlinlininiilinlininnnnne be bbe be be be be be be be be bbbe be urnurnurnurnuurnurnurnrurnrnurnurnurnurnr rararararararaararararaaraar tetettetetetetetetetetetete esesesesesesesesesesessesseess

iingngngnnngggg mmm(FPInnovations)

mumumummmumuumum lclchlchlchlchlchlchcchcchc ed eeeedeededddded linlinlinliliinininnni e be bee bee be be bbbe uuuuuuuunngngngngngngggngngggggg mmmmmmFPFPFPFPPPFPPFPPPFPPPInnInnInnInnnnInnnInnnnInnnnnnInnnnovaovaovaovaovovaovaovaovaovaovaovaovaovao avatiotiotiotiotiotiotiotiootiootiottiotiooi nsnsnsnsnsnsnsnnnsnsnsnsnnnsFPFPFPFPFPFPPFPFPFPFPPPInnInnInnInInnInnInnInnInnnnnnnnnnnn ovaovaovaovaovaovaovaovvvovaaovaovaovaovaatiotiotiotiotioiotiotiotiotiittiotitiotiooonsnnsnnsnnsnnnsnsnsns(F(F(F(F(F(F(F(F(((F(F(((((F(F((F((F(F(F((FF(F(F(F(F

rrrrrrbbbbbbbbbbuuuuuuuuuus)s)s)s)s)s)s)s)s)s)s)s)s)))s))s)s)s)s)s)s)s)s)))s)s)

New Terra Torch ready to ignite stand to test FireSmart NewNewNewNewNewNNewNewNewNewNewNewNewNewNewewNeww TeTeTeTeTeTeTeTeTeTeTeTeeeeTerrarrarrarrarrarrarrarrarrarrrarrarrarrarrarraraar a ToToToTToToToTToToToToToTooooT rchrchrchrchrchrchrchrchrchrcrchchrchrchcc rererererererrerereerereerereeeadyadydyadyadyadyadyadyadyadyadyadyyadyadydyadyadady totottotototototototottotototo igigigigigiigigigigiggigggggiggnitnitnitninitnitnitnitnitnitnitnitnitninitnitnittn e se se se se se se se se se se se sse se se stantantantantantantantantantantatantananntantanand td td td td td td ttd td td td td tdd tdd td to to tto to to to to to to to tto to to to to estestestestestestestestestestestesttesteesestestsese FiFiFiFiFiFiFiFiFFFiFiFiFiiiFireSreSreSreSreSreSreSSreSreSreSreSSreSrreSrreeSreSreSmarmarmarmarmarmarmarmarmarmarmarmarmamarmarmamamart tttttttttttttttprescriptions (FPInnovations)

ToToToTToToTTToooorchrchrchrchrchcchhrchrchchch rerererereeereadyadyadyadyadyadydyadydyadyadyyy tottototoooootott igigigigiggggigigggiggnitnitnitnnitnitnitnitttnitnni e seee se se ssse se se stantantantanttanananantanannnd tdd td td tddd td ttd td td to tooo too too tto ttesteesesteststsprepreprepreprepreprepreprepreprepreprepreeerpp scrscrscrscscrcscrscrscrscscrscscrscsccs rriptiptiptiptiptiptiptptiptptptpipttpiptipp ionionioniononiononioiononononnonions (s (s (s (s (s (s (s (s (s (s (sss (s ((FPIFPIFFPFPFPIFPIFPFPFPFPIFPPFFPIFP nnonnonnonnonnonnonnonnonononnonnononnonnn vatvatvatvatvatvatvatvatvvatvvatatvataa ionionionioionionononiononionionooionnssssssssssssssspreprepreprepprepprepreprepreprprepp eprescrsscrscrscrscrscrscrscrscrscrcrscscriptiiptipiptiptiptiptiptiptipttiptiptiptiptp ionionionioniioniionionionionionions ((s (s ((((s (s (s (s (ss (ss (FPIFPIFPIFPIFPFPFFPIFPFPIPIFPFPPFPIF nnonnonnonnonnonnonnonnonnonnonnonnooonnn vatvatvatvatvatvatvatvatvatvatvatvaaatv tionionioniionionionionionioniononnssssssssssssssss

tttttttttttttestesteesesteststesesteestss) s))s)))s)))s))))))s)))))s))))))s))ss

Collecting cameras and instruments after survival Zone burn. ColColCoColColColColCoColCColColCColCoCCoo lecleclecleleclecleclecleclececececcceeecectintintintittintinintintintintininttintting cg cg cg cg cgg cg cg cg cg cg cgg ccg ccameameameameameamememeamameameameameameameaameeerasrasrasrasrasasrasrasrasrasasrarasrasrasaass anananananananananananananananaa d id iddd iddd id id id iiid id id id id nstnsttnstnstnstnstnnstnstnstnnststtnsts rumrumrumrumrumrumrumrumrumumrumrumrumrummrumententtntententententententenentenentenenttts as as as as as as as as as as as ass as afteftefteftftefteftefteffteftefttftefteftefteeer sr sr srrr sr sr ssr sr sr sr sr ssr sssurvurvurvurvurvurvurvrvurvurvurvurvurvrurvurvr ivaiivaivaivaivaivaivaivaiviivaivaivaaivaal Zl Zl Zll Zl Zl Zl ZZl ZZZZZZZZZoneoneoneoneoneoneoneoneooneoneoneoneoneoo e bububbububububububububbububububurnrnrnrnrnrnnrnrnrnrnnrnrrn n.n.n.n.nn.n.n.n..n.... (FPInnovations, UofA & National Geographic)

tintinttintintinitinnnni g cg cg cg cgg cg cg cg cg cg ccggg ameameameameameameamamememeamerasrasrasrasrasrasasasasraa aanananaanannnannnaa d id id id idd id iddd idd nstnsnstnnsnstnstststststns rumrumrumrumrrumumumumumumenteneentententententnnnttentnn s ass as as as as aas ass aaftefteftefftetteteeeeftetter sr sr sr sssssr ssurvuurvurvurvuurvuururvuu ivaivaivaivavavavaivavav l Zl Zl Zl Zl ZZZl Zl Zl onononeooneoneoneonenn(FP(FP(FP(FP(FP(FPFP(FP(FP(FP(FP(FPF(F( InnInnInnInnInnnnnnnnInnInnInnnnnInnnnnI ovaovaovaovaovaovaovaovaovaovaovaovaovovavaatiotiotiotiotiotiotiotiotiootiootiottiti ns,ns,ns,ns,ns,ns,ns,ns,ns,ns,s,ss,ssss,nsns,, UoUoUoUoUoUoUoUoUoUoUoUoUoUoUofAfAfA fAAfAfAfAfA fAAAfAfAfAAfA & N& N& N& N& N& N& N&& N& N& N& N& N& N&&& NNatiatiatatatiatiatatiatiatiatiaatiatatit onaonaonaonaonaonaonaonaonaonaonaonaonaonannnal Gl Gl Gl Gl GGGl GGl Gl GGl GGGl eogeogeogeogeogeogeogeogeogeogeogeogeogeogge raprapraprapraprapprapapraprapraparapa hichichhichichichichichichicichhhii(FP(FP(FP(F(FP((FP(FP(FP(FPFP(FPF(FP(FPP(FPInnInnInnIInnInnInnInnInnnnnnnnnnnnnnnnovaovaovaovaovaovaovaovaovaovaovvvavaaaovatioiotitiotiotiotiotiotiotiottiotiotioitionsnsnsnnsnnnsnssnsnnsnsnnss UoUoUoUoUUoUoUoUoUoUoUUoUoUoofAffAfAffAfAfAfAfAfAffAfAffA & N& N& N& N& N& N& N& N& NN& N& N& NN& NNatiatiatiatiatiatiatiatiatiatitiatiatiaatiatt onaonaonananaoonaonaonaonananonaaonaonal Gl Gl Gl Gl Gl GGl GGGGGGGGGGeogeogeogeogeogeogogeogeogeogeoggogoge grapraprapraprapraprapraprappprapappaphichichihichihihiihihichicihichh

eeeeoneoneoneoneonennnoneoneonecccccccccccccc))))))))))))))cccccccccccccc)))))))))))))

Collecting samples for carbon deposition in forest fire ash study. ColColColColColCoColColColColColCCoCColCoC lecleclecleclleclecleclecleececececeeceectintintintintintintinitintintintinitinntintt g sgg sg sg sg sg sg sg sg sg sg sg sgg sg sampampampampampampmpampampampampampampampampmpleslesleslleslesleslesleslessesleseeseseles fofofofofofofofofofofofofofoofor cr cr cr cr cr cr cr cr cr cr cr cr cr cccccarbbarbarbarbarbarbarbarbarbrrarbarbarbrarba ononononononnononononononononon depdepdepdepdepdepdepdepdepdepdepdepdepedepepdepdeposiosiiosiosiosiosiosiosiiosisiosiosiosisososs tiotiotiotiotiotiotiotiotiotitioitiotiitiotioon in in in in iin in in in in in in in in in fn fn fn fn fn ffn fn fn ffn fn fn fnn fn oreoreoreoreoreoreroreoreoreoreoreoreoreoreorrereststststststststststststststsststst firfirfirfirfirfirfirfirfirfirfirfifirfirifirirf e ae ae ae ae ae aae ae ae ae ae aee ae ae ae ae ashshshshshshshshshshshshshsshs stustustustustustuststustustututustustustustut dydyddydydydydydydydydydydydy y.y.y.yy.y.yy.y.y.y.yy.y.(Swansea University, Canadian Forest Service and University of

ColCColColCooColColollo leleleclececleccclecleecectintintintintinintinitinntinng sg sg g sgg sgg ssg sg g sggg ampampampampampampmpampmmpampampaampampmplesllesleseseseslesslee fofofofofooooffoor crrr crr ccccr ccarbarbarbarbarbarbarbarbbarbbaarbbon ononooononnonnnonnno depdepdepdepdepdepdepddepepedepdeppposiososiososisisosiiososiss tititiotiotiotiotiotiotitioion in in inn in inn in inn inn in fn fn fnn fnn fn fn fnnn fn oreoreooreooreoreorereorero st stsst stststtstsstts firfffiiririrfiririre ae ae ae ae ae ae ae ae aaashshshshshhshshshshhss stustustustustustutstustuuussstus uudydydydydydydydyddyddyyyyy.y.y..... (Sw(Sw(Sw(Sw(SwSw(Sw(Sw(Sw(SwSw(SwSw(Sw((( ansansansansansansansansansansanssansansanssan eaeaeaeaeaeaeaeaeaeaeaeaeaeeaeaa UniUniUniUniUnUnUnUnUnUniUniUniUUnniiverververververververververververvevererervverrsitsitsitsitsitsitsitsitsitsitsitssssitity, y,y,y,y,y,y,y,y,y,y,yy,,yy,y, CanCanCanCanCanCanCanCanCanCaCanCanCaanadiadiadadadiadiadadiadadiadaaaaddiananananananannananaanann ForForForForForFForForForForForForFooForestestestestestestestestestestesteseestessstte SeSeSeSeSeSeSeSeSeSeSeSeSeSeeeServirvirvrvivivrvrvrvivrvivrvivivr ce ce ce cececece cececececececeeeee andandandandandandandandandandandanddnd UnUnUnUnUnUnUnUnUnUnUnUUnniveiveiveiveiveiveveveiveiveveveivevevei rsirsirsirsirsirsirssirsrsisssssrsiityty tytytytytytytytytytytyy of ofofofofoofoofooofofof(Sw(Sw(Sw((Sw(Sw(Sw(Sw(Sw(Sw(SwSwSwSw(SwwSSwansansansanansansaansansnansanssansaansansn eaeaeaeaeaeaeaeaaeaeeaeeaaaa UnininiUniUniUnUniUniUniiUnUniUninininnn verververververververververvververrververrsitsitsitsisitsitsitsitsittsitsitsitsititts tyyyyyyyyyyyyyyy CanCanCanCanCanCanCanCanCanCanCanCanCanCCanCanaa adiadidadiadadiadiadiadiadiadiadiadidaadadid anananananannannanananannnan ForForForForForForForForForForForrorororFF esttesttestestestestestesesttstestsest SeSeSeSeSeSeSeSSeSSeSSeSServivirvirvivirvirvivirvirvirvirvirvrv cececececececececeeeceee andanddandandandandndandandaandaanndnda UnUnUnUnUnUnnUnUnUnUnUUnUnnnniveiveiveiveiviveiveiveiveveivvveevei ersirsisirsirsirsiirsirsirsirsirsrsrsssiitytytytytytytyttytyttytyyytyy ofoffofofofofofofofofofofoofffffffffffff

Alberta)adiadadidiadiaddiddiaddidianananananananananannn ForFForFoFororoorForFForestesteesessst

AlbAlbAlbAlbAlbAlbAlbAlbAlbAlbAlbAlbA blbAAlbAl ertertertertertererterterterterterteerteee aaaaaaaaaaaaaaAlbAlbAlblblAlbbAlbAlbAlbAlbAlbAlbAlbAlbAlberterterterttertertertertertertertertte aaaaaaaaa tttttrestesteesessesteesteest

a)a)a)a)a)a)a)a)a)a)a)a)a)aa)a)a))a))a)a)a))a)a)aa)

Testing small IR detectors TesTesTesTTesTesTesTesTesTesesTesTesTesTeTessse tintintintintintintintintintintinttintinitintting sg sg sg sg sg sg sg sg sg sgg sg ssmalmalmalmalmalmalmalmalmamamamamamamalmam l Il Ill Il Il Il IIl IIl IIIIR dR dR dR dR dR ddR dRR dR dR dR dR dR ddR eteeteeteeteeteteeteeteeteeteeteeteeteteteteeteectoctoctoctctoctoctoctoctoctoctoctotctotocttoc rsrrsrrrrrsrrrrsrsrr s s sssssssssssss(FPInnovations)

tintintintintintintintintinntining sg sg sg g sg sg g sg sg sg sggg malmalmalmalmalmamalmamalmamalmaa l Il Illl Il IIl IIIR dR dR dR dR dR dR dddR ddR dR deteeteeteeteteteteteeeeet ctcccctctcctt(FP(FP(FP(FP(FP(FP(FP(FP(FPFP(FP(FPFP((( InnInnInnnnInnInnnnnnnnnnnnovaovaovaovaovaovaovaovaovaovaovovavav tiotiotiotiotioiotiotiotiooiotiotttiot nnsnsnsnsnnsnsnnssssn(FP(FP((FP(F(FP(FP(FPFPF(FP(FP(FPP(FPFPInnInnInnInnInnIInnInnnnnnnnnnnnnnovaovaovaovaoovaovaovvovavaaovaovaovaovatiotiotiotiotioitiotiotiotiotiotiotiottt nsnsnsnsnsnnsnnnsns

ttttootttteteteteeteeeetetectcccctctcctctccts)s))s)s)s)s)s)s)s)sss)s))s)s)s)))s)s)s))s)sss)s)ss

Testing fire proof cameras on FireSmart burn. TesTesTesTesTesTesTesTesTesTesTesesTesesesstintintintintintintitintintinttintintininintint g fg fg fg fg fg fg ffg fg ffg fg fg fgg ffgg ireireireireireireireireireireirerereeei e prprprpprprprprprprrrprprp oofoofoofoofoofoofoofoofooffoofooffooooooof cacacacacaaccacacaccacacacacacaamermermermermermmermerermermermermemermermee asasasasasasasasasassasasasasasass onononononononononnonononoon FirFirFirFirFirirFirFirFiFirFirFirFirrirreSmeSmeSmeSmeSmeSmeSmeSmeSeSmeSmeSmSeSmmmmeSme artartartarttartartartartartartartartararrtart bubbubbbbubububbububububuurnrnrnrnnrnrnrnrnrnnrnrrnrnn n.n.nn.n.n.n...n (FPInnovations & National Geographic)

eseseeessssessstintintintintintininitinntining fg fgg fgg fgggg fg fggg ireiireireirereireeeerr prprprpppprprprpprp oofoooofoofoofoofooofoofoof cacacacaccaccacacaamermememermermemermermermermm as asasasaasasasas on oonononononononnn FirFirFirFirFirirFirFiireSmeSmeSeSmeSmeSmeSmSSSmeSmeSmmartartartartartartartttaraartt bubububbubububuubb rrnrrr(FP(FP(FP((FP(FP(FP(FP(FP(FP(FP(FP(FPFPPInnInnInnInnnnInnInnnnnnInnnInnnnInnnnnovaovaovaovaovaoovaovaovaovaovaovaovaovavvatiotiotiotiotiootiotiotiotiotiotiotttions nsnsnsnsnsnsnsnsnsnsnssssn & N& N& N& N& N& N& N&&& N& N& N& N& N&& N& Natiatiatiatiatiatiatatiatiataatitatationaonaonaonaonaonaonaonaonaonaonaaonaonannnn l Gl Gl Gl GGl Gl Gl GGGl GGGGl Geogeogeogeogeogeogeogeogeogeogeogeogeogeogeogeogeogeograprapraprapraprapaprapraprappraparapra hichichhichichichichichichhichhhihhi(FP(FP(((FP(FP(FP(FP(FP(FP(FP(FP(FP(FP(FPP(FP(FPInnInnInnInnIInnInnIInnInnIInnnInnnnnovaovaovaovaovaovaovavovaovaovaovaovavavatioiotiotiotiotiotiotiotiotiottttiotiotionsnsnsnsnnsnssnsnsnnsnsnnss & N& N& N& N& N& N& N& N& N& N& NN&& N& N& atiatiiatiatitiatiatiatiatiatiatitatiattt onaonaonaonaonaonaononaonaonaonaonaononnonal Gl Gl Gll Gl Gl Gl Gl GGGGGGGGeeogeogeogeogeogogeogeogeogeogoeogggeograpraprapraprapaprapraprapraprapaaprapphichihihhichihihichichihiihihhic

nnnnnnnbubububuuuuuububuurrnrrrnrnrncccccccccccc))))))))))))ccccccccccccc))))))))))))

Igniting Survival Zone plot with new Terra Torch. IgnIgnIgnIgnIgnIgIgnIgnIgnIgngnIgnIgngngngIgnitiititiitiitiiitiitiitiitiitiititiitittiit ng ngngngngnngngngngngnggngngnng SurSurSurSurSurSurSurSuSurSurSurSuSSururSurSuurS vivvivvivvivvivvivvivivvivvivvivvivvivvivvivvivvvival alalallalalalaalaalaa ZonZZonZonZonZonZonZZonZonZonZonZonZZonZZ e pe pe pe pe ppe pe pe pe pe pe pe pe peee lotlotlotlotlotlotlotlottotlotlotolotlottlot wiwiwiwiwiwiwiwiwiiwiwiwwiwwiw ththhththththththththtththtth newnewnewnewnewnewnewnewnewnewnewnewnewwwnewnew TeTeTeTeTeTeTeTeTeTeTeTeTeTeeTeeerrarrarrarrarrarrarraarrarrarrarrarrarraaa ToToToTToToToTToToToToToToToTorchrchrchrchrchrchrchrchrchrchrchrchrchrchcrchrchcc hhhhhhhhhhh. .......(FPInnovations )

aaalalal alallaala ZonZonZonZonZonZonononZ nnne pe pe pe pe ppe pppe ppe plotlolotllototottlotlootott wiwiwiwwwiwwww thththththtthththhhh nenenennnne(FP(FP(FP(FP(FP(FP(FPFP(FP(FP(FP(FP(FPFPPInnInnInnnnnnInnnnnnnnnnnInnnovaovaovaovaovaovaovaovaovaovovaovovaovo aatiotiotiotiotiotiotiotiotiotiotiotioit nsnsnsnsnsnsnsnsnsnnnsnsssnsnsn(FP(FP((FP(FP(FP((FP(FP(FP(FP(FPFPFPF( InnInnInnInnIInnInnInnnnnnnnnnnnnnnnnnnovaovaovaovaovaovavovaovaovavaovavo atiotioitiotitiotiotiotiotitiotitiotioot onsnsnsnnsnsnsnsnsnssnnsnsss

eeeeweeehhhhhhhh nenenenennnenenns ssss )))))))))))))s ))))))))))))))))

Regen from ICFME burn in 1999RegRegRegRegRegRRegRegRegReRegRegRegRegRegRegRegegeneneneneneneneenenenenennennen frofrofrofrofrofrofrofrofrofrofrofrofrofrrfroorom Im Im Im Im Im Im Im Imm Immmmmm Imm ICFMCFMCFMCFMCFMCFMCFMCFMCFMCFMFMFMCFMCFMCCFMCFMCCFME bE bE bE bE bE bE bE bEE bE bE bEE bE bEE burnurnurnurnrnurnurnurnurnurnurnurnurnurnurnr ininininininininininininiinininn 19191919191919191919199191919199999999999999999 999999999999999999999999999999Untreated plotUntUntUntUntUntUntUntUntUntUntUntUntUntUntUntUntUntU reareareareareareareareareareareareareareaeeatedtedtedtedtedtedtedtedtedtedttedtedtedededde plplplplplplplplppplpppp ooooooooooooo otottottotototototototottotottttt