case 3 - esp- · pdf filereverse transcription - polymerase chain reaction (rt-pcr)/gel...

28
Soft Tissue and Bone Pathology: curious, enigmatic and gorgeous bone and soft tissue lesions Case 3 Carlos E. de Andrea, MD, PhD

Upload: ngotuyen

Post on 03-Mar-2018

215 views

Category:

Documents


1 download

TRANSCRIPT

Soft Tissue and Bone Pathology: curious, enigmatic and gorgeous

bone and soft tissue lesions

Case 3

Carlos E. de Andrea, MD, PhD

Clinical History

22-year-old female, history of pain over her thigh

CD99

HEY1-NCOA2 Fusion

HEY1-NCOA2 Fusion

NCOA2 R: CTATCATCCCTTGATTACHEY1 F: CGAGGTGGAGAAGGAGAGTG

Wang, L. Genes Chromosomes Cancer. 2012;51: 127–139

HEY1-NCOA2 Fusion

Reverse Transcription - Polymerase Chain Reaction (RT-PCR)/Gel Electrophoresis (Roche Molecular Systems, Inc.)

119bp

HEY1-NCOA2 Fusion

119bp

Mesenchymal Chondrosarcoma: Clinical

- Generally found in young adults

- Occurs in unusual locations:Jawbones and ribs

- Extraosseous locations:Meninges included

- Highly malignant

- Prolonged course with late metastases(survival 21-67%)

Frezza AM, el al. Eur J Cancer. 2015(3):374-81

Mesenchymal Chondrosarcoma: Pathology

Biphasic appearance:Undifferentiated small blue cells or spindle

cellsWell-differentiated cartilage

Other features:Hemangiopericytoma appearanceFoci of chondroid ossificationMyxoid areas

Mesenchymal Chondrosarcoma: Small Cell Component

Mesenchymal Chondrosarcoma: Spindle Cell Component

Mesenchymal Chondrosarcoma: HPC pattern

Mesenchymal Chondrosarcoma: Cartilage with Ossification

Mesenchymal Chondrosarcoma: Myxoid Focus

Mesenchymal Chondrosarcoma: IHC

Sox9: positive in round cells and chondrocytesβ-catenin: negative in round cells, positive at cartilage interfaceOsteocalcin: negative in round cells, positive in bony matrixS100: positive in only occasional cases in round cells; usually positive in cartilageEMA (30%) and desmin (50%) can be positiveFLI1 negative; CD99 can be positive

HEY1-NCOA2 Fusion

Wang, L. Genes Chromosomes Cancer. 2012;51: 127–139

Interphase FISH detection of HEY1-NCOA2 fusion

Wang, L. Genes Chromosomes Cancer. 2012;51: 127–139

Interphase FISH detection of HEY1-NCOA2 fusion

Surg Pathol Clin. 2017 Sep;10(3):537-552

Small Round Cell Tumours

- Alveolar rhabdomyosarcomaDesmin, myogenin, PAX3-FOXO1 fusion (+PCR)- Desmoplastic round cell tumourWT1, EMA, CK, desmin, NSE, CD56, EWSR1 (+PCR)- Ewing sarcomaCD99, FLI1, ERG, CK, desmin, EWSR1 (+PCR)- CIC-DUX4 tumoursCD99, ERG, MUC4, CIC-DUCX4 fusion- Synovial sarcomaTLE1, EMA, CK, CD99, CD56, bcl-2, SSX-SS18 fusion- Mesenchymal chondrosarcomaSOX9, CD99, HEY1-NCOA2 fusion- Small cell neuroendocrine carcinomaTTF1, CK, CD56, CG