cbf 3075

8192019 Cbf 3075

httpslidepdfcomreaderfullcbf-3075 16

Regulation of Trek1 expression in nasal mucosa with allergic rhinitisby speci1047297c immunotherapy

Yuzhi Wang1 Lingyan Lv1 Hongrui Zang2 Zhenfeng Gao1 Feng Zhang1 Xingjie Wang1 and Xuanyan Zhou1

1 Department of Otolaryngology Liaocheng Second Peoplersquos Hospital Taishan Medical College Liaocheng China2 Department of Otolaryngology Beijing Tongren Hospital Capital Medical University Beijing China

Epithelial barrier dysfunction is involved in the pathogenesis of allergic disorders such as nasal allergy TWIK-related K(+) 1 (Trek1) po-tassium channels are required in the maintenance of the epithelial barrier function This study aims to investigate the role of antigen-speci1047297c immunotherapy (SIT) in the regulation of Trek1 expression in the nasal mucosa In this study patients with nasal allergy were treated

with SIT andor Clostridium butyricum The expression of Trek1 and histone demethylase 1 (HDAC1) in the nasal epithelia was assessed byreal-time reverse transcription polymerase chain reaction and Western blotting Serum cytokines were assessed by enzyme-linked immuno-sorbent assay The results showed that Trek1 and HDAC1 were detected in the nasal epithelia Trek1 was lower whereas HDAC1 was higher in patients with allergic rhinitis as compared with healthy controls Trek1-null RPMI2650 monolayers showed a markedly compromised ep-ithelial barrier function Treatment with SIT signi1047297cantly increased the Trek1 levels in the nasal epithelia of allergic rhinitis patients that werefurther improved in conjunction of SIT and administration of probiotic C butyricum In conclusion nasal epithelia express Trek1 that can besuppressed by allergic response SIT can restore the expression of Trek1 in the nasal epithelia and can be further improved by conjunctionwith administration of C butyricum Copyright copy 2014 John Wiley amp Sons Ltd

key wordsmdashepithelial barrier allergy rhinitis immunotherapy TWIK-related K(+) 1 potassium channels

INTRODUCTION

Allergic rhinitis (AR) indicates a type-I allergic response inthe nasal mucosa Its clinical symptoms include sneezingitching rhinorrhea and nasal congestion1 The most com-mon complications include rhinosinusitis and initiating al-lergic in1047298ammation in the lower airways2 The therapeuticeffect of AR is not satisfactory currently3

It is recognized that the pathological changes in the ARnasal mucosa include the over production of antigen-speci1047297c IgE in1047297ltration of mast celleosinophil in the tissueand the T helper (Th)2 polarization4 The causative factorsof AR are not fully understood yet It is proposed that theepithelial barrier dysfunction plays a critical role in AR5

The epithelial barrier consists of the epithelial cell body

and the tight junctions surrounding the top of the cellsThe physiological functions of the epithelial barrier are torestrict macromolecular molecules such as protein anti-gens to be absorbed into the deep tissue in the nasal mu-cosa where the antigens contact immune cells to initiateunwanted immune response67 The status of the tight

junction-associated proteins plays a critical role in the

maintenance of the epithelial barrier integrity8 Insuf 1047297cient

tight junction protein can result in the epithelial barrier dys-function8 Currently the remedies to regulate epithelial bar-rier functions are limited

It is suggested that the TWIK-related K(+) 1 (Trek1) po-tassium channels are an important regulator of the epithelialbarrier functions The primary role of Trek1 is for the K(+)transportation across cell membranes9 Recent reports indi-cate that Treks are involved in the maintenance of the epi-thelial barrier function The de1047297ciency of Trek1 results inepithelial barrier dysfunction10 Histone demethylase 1(HDAC1) is involved in a number of in1047298ammatory disor-ders1112 HDAC1 can inhibit the expression of Trek110 It is suggested that butyrate is an inhibitor of HDAC1 A pro-biotic strain Clostridium butyricum (C butyricum) pro-duces butyrate that can be the inhibitor of HDAC110

Based on the aforementioned information we hypothesizethat the expression of Trek1 is suppressed in the AR nasalmucosa To test the hypothesis we monitored the Trek1levels in the AR nasal epithelia before and after antigen-speci1047297c immunotherapy (SIT) The results showed that thelevels of Trek1 were signi1047297cantly lower in the AR nasal ep-ithelia than healthy controls SIT upregulated the expressionof Trek1 in AR nasal epithelia which was further upregulated in conjunction with administration of probioticC butyricum

Correspondence to Yuzhi Wang Department of OtolaryngologyLiaocheng Second Peoplersquos Hospital Taishan Medical College Liaocheng252600 ChinaE-mail yuzhirrwang126com

Received 11 August 2014

Revised 11 October 2014 Accepted 13 October 2014Copyright copy 2014 John Wiley amp Sons Ltd

cell biochemistry and function

Cell Biochem Funct 2015 33 23ndash28Published online 22 December 2014 in Wiley Online Library

(wileyonlinelibrarycom) DOI 101002cbf3075

8192019 Cbf 3075


MATERIALS AND METHODS

Reagents

The antibodies of Trek1 and HDAC1 were purchased from Santa Cruz Biotec (Beijing China) The C butyricum wasa gift from Shenzhen Kexing Biotech Co Ltd (Shenzhen

China) The ELISA kits of interleukin (IL)-4 IL-5 andIL-13 were purchased from RampD Systems (BeijingChina) Mite extracts were purchased from ALK (HongKong China) The reagents of quantitative reverse tran-scription polymerase chain reaction (qRT-PCR) were pur-chased from Invitrogen (Shanghai China)

Study subjects

Patients with perennial AR (sensitized to mite allergens)were recruited into this study in our clinic from 2010 to2013 AR was diagnosed by their physicians with our established procedures including AR history allergen skintest and nasal allergen challenge Healthy volunteers were

recruited as controls who did not have AR history nasalcavity in1047298ammation or rhinosinusitis The experimental pro-cedures were approved by the Human Ethic Committee at Taishan Medical College An informed written consent was obtained from each subject

Mice

Male BALBc mice (6ndash8 weeks old) were purchased from Shanghai Xinmao Experimental Animal Center (ShanghaiChina) The mice were maintained in a pathogen-free en-vironment The experimental procedures were approvedby the Animal Ethic Committee at Taishan MedicalCollege

Recording the total nasal AR symptom score (TNSS)

We asked the patients to record the symptom score beforeand after SIT The records included rhinorrhea sneezingnasal obstruction and nasal itchy The symptom score wasrecorded using a 6-point scoring system (0 indicating nosymptom 1 very mild 2 mild 3 moderate 4 severeand 5 very severe) The TNSS was de1047297ned as the sum of the scores for four nasal symptoms rhinorrhea sneezingnasal obstruction and itchy nose

Allergen-SIT

The subcutaneous injection with the speci1047297c Ag vaccinewas employed in the present SIT study The updosingapproach was carried out for SIT in the present study that was routinely used in our clinic and also publishedelsewhere13 After reaching the optimal dosage the pa-tients received the Ag vaccine at the doses once a monthAfter each injection the patients remained in the hospitalunder observation for 1 h In addition ten AR patientswere treated with placebo (saline) The physicians andAR patients were not aware of who were treated withplacebo

Oral administration of C butyricum

Each AR patients took two capsules of probiotics(C butyricum 420mgcapsule) or placebo (the capsulescontained vehicle and no probiotics) twice a week

Collection of nasal epithelial specimens

Nasal epithelial specimens were collected by scraping thesurface of the inferior turbinate with a plastic curette Thespecimens were processed for extraction of total RNA andproteins with the procedures in the online protocols

Real-time reverse transcription polymerase chain reaction(qRT-PCR)

The total RNA was extracted from the collected nasal epi-thelial specimens The complementary DNA was synthe-sized using a reverse transcription reagent kit Thequantitative polymerase chain reaction was carried out ona MiniOpticon PCR device (Bio-Rad Shanghai China)

with the SYBR Green Super mix The results were calcu-lated using the 2ΔΔCt method and normalized to a percent-age of the internal control β-actin The primers used in thisstudy include Trek1 forward caattcgacggagctggatg re-verse cttctgtgcgtggtgagatg and HDAC1 forward cttcccca-acccctcagatt reverse atccctttcacccagacctg

Western blotting

The total protein extracts were fractioned by sodium dodecylsulfate polyacrylamide gel electrophoresis and transferredonto a polyvinylidene fluoride membrane After blockingwith 5 skim milk for 30 min the membrane was incubatedwith the primary antibodies (01ndash06μgml) at 4 degC overnight

and followed by incubation with the secondary antibodies(conjugated with horseradish peroxidase) for 1 h at room tem-perature Washing with Tris-buffered saline-Tween 20 wasperformed after each incubation The blots on the membranewere developed with an enhanced chemiluminescence reagent kit The results were recorded with X-ray films

Cell culture

RPMI2650 cells (An airway epithelial cell line ATCCUSA) were cultured in DMEM (Dulbeccorsquos modi1047297ed eaglemedium) supplemented with 100 Uml penicillin 01 mgmlstreptomycin 10 fetal bovine serum and 2 mM L-glutamineThe medium was changed daily

Trek1 gene silence

RPMI2650 cells were treated with the short hairpin RNA of Trek1 or control short hairpin RNA with commercial re-agent kits following the manufacturer rsquos instructions

Recording transepithelial electric resistance (TER) of the RPMI2650 monolayers

RPMI2650 cells were seeded on inserts (04 μM pore sizeMillipore) in 12-well transwell chambers The TER was

24 y wang ET AL

Copyright copy 2014 John Wiley amp Sons Ltd Cell Biochem Funct 2015 33 23ndash28

8192019 Cbf 3075


recorded daily with a Millipore electric resistance system-2(Millipore) and calculated as Ωcm 2

Assessment of the permeability of the RPMI2650monolayers

On day 8 the medium in the bottom well was changed with15-ml fresh DMEM the medium in the upper well was re-placed with 10-ml DMEM containing FITC-Dextran at 10 mgml After 1-h culture the amount of dextran pre-sented in the bottom well was determined with a microplatereader (FLx80 BioTek Shanghai China)

Statistics

The data are presented as mean plusmn SD The differencesbetween groups were determined by ANOVA A plt 005was set as a signi1047297cant criterion

RESULTS

Lower Trek1 levels and higher levels of HDAC1 in the nasal epithelia of AR patients

Based on published data that Trek1 plays a critical role inthe maintenance of epithelial barrier integrity10 we assessedthe levels of Trek1 in the nasal epithelia of 18 AR patientsand 18 healthy controls The results of qRT-PCR(Figure 1A) and Western blotting (Figure 1B 1C) showedthat compared with healthy controls the levels of Trek1were signi1047297cantly lower in AR patients (Figure 1A 1B)On the other hand we measured the levels of HDAC1 inthe specimens The results showed that higher levels of

HDAC1 were detected in the AR nasal epithelia thanhealthy controls (Figure 1A 1C)

On the other hand we also detected high levels of Trek1and low levels of HDAC1 in the mouse nasal mucosa Treat-ment with a Th2 cytokine IL-4 signi1047297cantly inhibited theexpression of Trek1 and increased the levels of HDAC1 inthe mouse nasal mucosa (Figure 2)

Trek1 is critical in maintaining the epithelial barrier function

To test the role of Trek1 in maintaining the epithelial barrier function we prepared monolayers with RPMI2650 cells (anairway epithelial cell line) in a Transwell system TheTrek1-null RPMI2650 monolayers showed a compromised

epithelial barrier function as indicated by signi1047297cantly lower TER and signi1047297cantly higher permeability to dextran(Figure 3)

SIT modulates the levels of Trek1 in the AR nasal mucosa

To investigate the role of immunotherapy in the regulationof Trek1 and HDAC1 in the nasal epithelia we treated ARpatients with SIT andor C butyricum (a probiotic) for 6 months The levels of Trek1 and HDAC1 were assessedby Western blotting The results showed that SIT signi1047297-cantly increased the levels of Trek1 in the AR nasal epithelia as compared with the patients treated with placebo but still

lower than the healthy group Treating AR patients withSIT in conjunction with probiotics further increased thelevels of Trek1 in the nasal epithelia Treating withprobiotics alone slightly increased the expression of Trek1in the nasal epithelia (Figure 4A) SIT did not alter the ex-pression of HDAC1 in the nasal epithelia as compared withthe placebo group (Figure 4B) Treating AR patients withSITprobiotics markedly downregulated the levels of HDAC1 in the nasal epithelia which was not signi1047297cantlydifferent from the group treated with probiotics alone(Figure 4B)

The levels of Trek1 are negatively associated with ARsymptoms and serum Th2 cytokines

The nasal clinical symptoms were recorded weekly by thepatients Peripheral blood samples were obtained at 6 months before and after commencement of SIT the serum levels of Th2 cytokines were determined by ELISA The re-sults showed that SIT markedly suppressed the nasal ARsymptoms (Figure 5A) and downregulated the levels of

Figure 1 Levels of TWIK-related K(+) 1 (Trek1) and histone demethylase 1 (HDAC1) in the nasal epithelia Nasal epithelial specimens were collected from 18 allergic rhinitis (AR) patients and 18 healthy volunteers Two specimens were pooled as one sample to assess mRNA four specimens were pooled to assessproteins (A) The bars indicate the mRNA levels of Trek1 and HDAC1 (BndashC) The immune blots indicate the protein levels of Trek1 (B) and HDAC1 (C) Thebars below indicate the integrated density of the immune blots The data of bars are presented as mean plusmn standard deviation plt 001 compared with thehealthy group The data are a representative of three independent experiments

25immunotherapy regulates trek1 in epithelia


8192019 Cbf 3075


Figure 2 Interleukin (IL)-4 suppresses TWIK-related K(+) 1 (Trek1) and increases histone demethylase 1 (HDAC1) in the mouse nasal mucosa NaiumlveBALBc mice were treated with a nasal drop containing saline (saline) or IL-4 (100 ngml 50μlnostrilday) daily for 7 days (A) The bars indicate the mRNAlevels of Trek1 and HDAC1 in the mouse nasal mucosa (BndashC) The immune blots indicate the protein levels of Trek1 (B) and HDAC1 (C) in the mouse nasalmucosa The bars below the blots indicate the integrated density of the immune blots The data of bars are presented as mean plusmn standard deviation plt 001compared with the saline group Each group consists of six mice The data are a representative of six independent experiments

Figure 3 Inhibition of TWIK-related K(+) 1 (Trek1) compromises the epithelial barrier function RPMI2650 cells were treated as indicated on the x -axis of the 1047297gures The cells were cultured into monolayers in a Transwell system (A) The bars indicate the transepithelial electric resistance (TER) of the monolayers(recorded on day 8 after the gene silence) (B) The bars indicate the dextran in the culture supernatant at the basal chambers to represent the content of dextranpassed through the monolayers from the apical chambers (C) The immune blots show the results of Trek1 gene silence The data are presented as mean

plusmn standard deviation plt 001 compared with the medium group The data are a representative of three independent experiments Control shRNA (shRNA)short hairpin RNA

Figure 4 Speci1047297c immunotherapy (SIT) modulates expression of TWIK-related K(+) 1 (Trek1) in the nasal epithelia Allergic rhinitis patients were treatedwith SIT andor Clostridium butyricum [probi (probiotics)] (each group consists of 12 patients) Other 12 allergic rhinitis patients were treated with placebo(saline) The nasal epithelial specimens were collected from each patient of the SIT group before and 6 months after commencement of SIT Specimens werealso obtained from the placebo group (n = 12) and healthy subjects (n = 12) Specimens from four patients were pooled as one sample and analysed by Westernblotting (AndashB) The immune blots indicate the protein levels of Trek1 (A) and histone demethylase 1 (HDAC1) (B) in the nasal epithelia The bars indicate thesummarized integrated density of the immune blots The data of bars are presented as mean plusmn standard deviation plt 001 compared with healthy group plt 001 compared with the group of SITprobi The data are a representative of three independent experiments

26 y wang ET AL


8192019 Cbf 3075


Th2 cytokines (Figure 5BndashD) as compared with the placebogroup although the cytokine levels were still higher than thehealthy controls

SIT in conjunction with oral C butyricum further increasesTrek1 in nasal epithelia and enhances the therapeutic effect on AR

The data of Figure 1 indicate that HDAC1 levels are higher in the AR nasal epithelia HDAC1 is an inhibitor of Trek1that can be suppressed by butyrate10 Thus we treated ARpatients with SIT in conjunction with or without administra-tion of C butyricum The nasal epithelial specimens werecollected and analysed The results showed that the adminis-tration of SIT and C butyricum signi1047297cantly increased theTrek1 levels and suppressed the HDAC1 levels in the nasalepithelia In addition the nasal clinical scores and Th2 cyto-kines were downregulated in AR patients treated with bothSIT and C butyricum to the healthy control levels How-ever treating with C butyricum alone did not show detect-able changes of TNSS and Th2 cytokines in AR patients(Figure 5)

DISCUSSION

The therapeutic effect of SIT on AR is to be further im-proved The present data indicate that SIT in conjunctionwith oral administration with C butyricum can obtain better AR symptom control and downregulation of serum Th2 cy-tokines than using SIT alone On the other hand the data show that the levels of Trek1 are lower and the levels of HDAC1 are higher in the AR nasal epithelia than healthysubjects The data are strengthened by the cell culture study

in which the Trek1-null RPMI2650 monolayers show a sig-ni1047297cantly compromised epithelial barrier function

Speci1047297c immunotherapy is the only speci1047297c therapy for the treatment of AR currently3 The therapeutic effect is tobe improved The present data show that SIT does improvethe AR clinical symptoms and downregulate the serum levels of Th2 cytokines in AR patients However the quan-tity of the AR-related parameter is still higher in these AR

patients despite treating with SIT In fact the therapeutic ef-fect of SIT is to be further improved14

Trek1 is a potassium channel protein Apart from its ma- jor function transporting K + across cell membranes recent studies indicate that Trek1 plays an important role in themaintenance of the epithelia barrier integrity10 It is acceptedthat the epithelial barrier dysfunction is one of the causativefactors in the initiation of mucosal allergic in1047298ammation15

To restore the epithelial barrier function facilitates the allevi-ation of allergic disorders16 Our data add novel informationto the epithelial barrier studies by showing that much lessquantity of Trek1 is in the AR nasal epithelia as comparedwith healthy controls Interestingly the levels of Trek1 inthe nasal epithelia are inversely correlated with the ARclinical symptoms and the serum Th2 cytokines Theunderlying mechanism may be the insuf 1047297cient Trek1 that causes the epithelial barrier dysfunction as suggested byBittner et al10 the inference is supported by our further experimental data that Trek1-null RPMI2650 monolayersshow a markedly compromised epithelial barrier function

Histone demethylase 1 is also involved in the pathogene-sis of a number of in1047298ammatory disorders Turgeon et al in-dicate that epithelial HDAC1 and HDAC2 restrain theintestinal in1047298ammatory response by regulating intestinal ep-ithelial cell proliferation and differentiation17 The present

Figure 5 Clostridium butyricum promotes the therapeutic effect of speci1047297c immunotherapy (SIT) on allergic rhinitis (AR) AR patients and treatments are the

same as in Figure 2 Total nasal AR symptom score (TNSS) was recorded weekly by each subject Peripheral blood samples were collected from the subjectsSerum Th2 cytokines were determined by ELISA (AndashD) The bars (mean plusmn standard deviation) indicate the TNSS (A averaged from the recorded data) andTh2 cytokines (BndashD) plt 001 compared with healthy group plt 005 compared with the group treated with SIT alone Probi probiotics ( C butyricum)The blood samples from individual subjects were processed separately The data are summarized from 12 independent experiments IL interleukin



8192019 Cbf 3075


data show that the expression of HDAC1 is inverselycorrelated with the expression of Trek1 The phenomenonimplicates that HDAC1 may suppress the expression of Trek1 in the nasal mucosa The inference is supported byBitterner recent publication10 Our data show that SIT doesnot alter the expression of HDAC1 in the human nasal

epithelia but administering C butyricum markedly sup-pressed the levels of HDAC1 in the nasal epithelia Theunderlying mechanism is that C butyricum producesbutyrate the latter is an inhibitor of HDAC118 Thus inconjunction of SIT and C butyricum the therapeutic effect on AR was signi1047297cantly enhanced

In summary the present data indicate that administeringC butyricum enhances the therapeutic effect of SIT on ARvia suppressing the expression of HDAC1 and upregulatingthe expression of Trek1 in the nasal epithelia

CONFLICT OF INTEREST

None to declare

REFERENCES

1 Bittner S Ruck T Schuhmann MK et al Endothelial TWIK-relatedpotassium channel-1 (TREK1) regulates immune-cell traf 1047297cking intothe CNS Nat Med 2013 19 1161ndash1165

2 Busbee PB Nagarkatti M Nagarkatti PS Natural indoles indole-3-carbinol and 33-diindolymethane inhibit T cell activation by staphy-lococcal enterotoxin B through epigenetic regulation involving HDACexpression Toxicol Appl Pharmacol 2014 274 7ndash16

3 Dreborg S Lee TH Kay AB et al Immunotherapy is allergen-speci1047297ca double-blind trial of mite or timothy extract in mite and grass dual-allergic patients Int Arch Allergy Immunol 2012 158 63ndash70

4 Erekosima N Suarez-Cuervo C Ramanathan M et al Effectiveness of subcutaneous immunotherapy for allergic rhinoconjunctivitis andasthma a systematic review Laryngoscope 2014 124 616ndash627

5 Gangl K Niederberger V Valenta R Multiple grass mixes as opposedto single grasses for allergen immunotherapy in allergic rhinitis Clin

Exp Allergy 2013 43 1202ndash12166 Grainge CL Davies DE Epithelial injury and repair in airways

diseases CHEST Journal 2013 144 1906ndash1912

7 Hu YJ Wang YD Tan FQ et al Regulation of paracellular permeabil-ity factors and mechanisms Mol Biol Rep 2013 40 6123ndash6142

8 Jeong Y Du R Zhu X et al Histone deacetylase isoforms regulateinnate immune responses by deacetylating mitogen-activated proteinkinase phosphatase-1 J Leukoc Biol 2014 95 651ndash659

9 Kojima T Go M Takano K et al Regulation of tight junctions inupper airway epithelium Biomed Res Int 2013 2013 947072

10 Netzel-Arnett S Buzza MS Shea-Donohue T et al Matriptaseprotects against experimental colitis and promotes intestinal barrier recovery In 1047298 amm Bowel Dis 2012 18 1303ndash1314

11 Pastorelli L De Salvo C Mercado JR et al Central role of the gut epithelial barrier in pathogenesis of chronic intestinal in1047298ammationlessons learned from animal models and human genetics Front

Immunol 2013 4 28012 Rondon C Campo P Togias A et al Local allergic rhinitis concept

pathophysiology and management J Allergy Clin Immunol 2012

129 1460ndash

146713 Salazar F GhaemmaghamiA Allergen recognition by innateimmune cells

critical role of dendritic and epithelial cells Front Immunol 2013 4 35614 Scadding G Cytokine pro1047297les in allergic rhinitis Curr Allergy Asthma

Rep 2014 14 1ndash815 Shimazu T Hirschey MD Newman J et al Suppression of oxidative

stress by beta-hydroxybutyrate an endogenous histone deacetylaseinhibitor Science 2013 339 211ndash214

16 Shusterman D Occupational irritant and allergic rhinitis Curr Allergy

Asthma Rep 2014 14 1ndash817 Turgeon N Blais M Gagne JM et al HDAC1 and HDAC2 restrain

the intestinal in1047298ammatory response by regulating intestinal epithelialcell differentiation PLoS One 2013 8 e73785

18 Zhao H Sprunger LK Simasko SM Expression of transient receptor potential channels and two-pore potassium channels in subtypes of vagal afferent neurons in rat Am J Physiol Gastrointest Liver Physiol

2010 298 G212ndashG221

28 y wang ET AL


8192019 Cbf 3075


MATERIALS AND METHODS

Reagents

The antibodies of Trek1 and HDAC1 were purchased from Santa Cruz Biotec (Beijing China) The C butyricum wasa gift from Shenzhen Kexing Biotech Co Ltd (Shenzhen

China) The ELISA kits of interleukin (IL)-4 IL-5 andIL-13 were purchased from RampD Systems (BeijingChina) Mite extracts were purchased from ALK (HongKong China) The reagents of quantitative reverse tran-scription polymerase chain reaction (qRT-PCR) were pur-chased from Invitrogen (Shanghai China)

Study subjects

Patients with perennial AR (sensitized to mite allergens)were recruited into this study in our clinic from 2010 to2013 AR was diagnosed by their physicians with our established procedures including AR history allergen skintest and nasal allergen challenge Healthy volunteers were

recruited as controls who did not have AR history nasalcavity in1047298ammation or rhinosinusitis The experimental pro-cedures were approved by the Human Ethic Committee at Taishan Medical College An informed written consent was obtained from each subject

Mice

Male BALBc mice (6ndash8 weeks old) were purchased from Shanghai Xinmao Experimental Animal Center (ShanghaiChina) The mice were maintained in a pathogen-free en-vironment The experimental procedures were approvedby the Animal Ethic Committee at Taishan MedicalCollege

Recording the total nasal AR symptom score (TNSS)

We asked the patients to record the symptom score beforeand after SIT The records included rhinorrhea sneezingnasal obstruction and nasal itchy The symptom score wasrecorded using a 6-point scoring system (0 indicating nosymptom 1 very mild 2 mild 3 moderate 4 severeand 5 very severe) The TNSS was de1047297ned as the sum of the scores for four nasal symptoms rhinorrhea sneezingnasal obstruction and itchy nose

Allergen-SIT

The subcutaneous injection with the speci1047297c Ag vaccinewas employed in the present SIT study The updosingapproach was carried out for SIT in the present study that was routinely used in our clinic and also publishedelsewhere13 After reaching the optimal dosage the pa-tients received the Ag vaccine at the doses once a monthAfter each injection the patients remained in the hospitalunder observation for 1 h In addition ten AR patientswere treated with placebo (saline) The physicians andAR patients were not aware of who were treated withplacebo

Oral administration of C butyricum

Each AR patients took two capsules of probiotics(C butyricum 420mgcapsule) or placebo (the capsulescontained vehicle and no probiotics) twice a week

Collection of nasal epithelial specimens

Nasal epithelial specimens were collected by scraping thesurface of the inferior turbinate with a plastic curette Thespecimens were processed for extraction of total RNA andproteins with the procedures in the online protocols

Real-time reverse transcription polymerase chain reaction(qRT-PCR)

The total RNA was extracted from the collected nasal epi-thelial specimens The complementary DNA was synthe-sized using a reverse transcription reagent kit Thequantitative polymerase chain reaction was carried out ona MiniOpticon PCR device (Bio-Rad Shanghai China)

with the SYBR Green Super mix The results were calcu-lated using the 2ΔΔCt method and normalized to a percent-age of the internal control β-actin The primers used in thisstudy include Trek1 forward caattcgacggagctggatg re-verse cttctgtgcgtggtgagatg and HDAC1 forward cttcccca-acccctcagatt reverse atccctttcacccagacctg

Western blotting

The total protein extracts were fractioned by sodium dodecylsulfate polyacrylamide gel electrophoresis and transferredonto a polyvinylidene fluoride membrane After blockingwith 5 skim milk for 30 min the membrane was incubatedwith the primary antibodies (01ndash06μgml) at 4 degC overnight

and followed by incubation with the secondary antibodies(conjugated with horseradish peroxidase) for 1 h at room tem-perature Washing with Tris-buffered saline-Tween 20 wasperformed after each incubation The blots on the membranewere developed with an enhanced chemiluminescence reagent kit The results were recorded with X-ray films

Cell culture

RPMI2650 cells (An airway epithelial cell line ATCCUSA) were cultured in DMEM (Dulbeccorsquos modi1047297ed eaglemedium) supplemented with 100 Uml penicillin 01 mgmlstreptomycin 10 fetal bovine serum and 2 mM L-glutamineThe medium was changed daily

Trek1 gene silence

RPMI2650 cells were treated with the short hairpin RNA of Trek1 or control short hairpin RNA with commercial re-agent kits following the manufacturer rsquos instructions

Recording transepithelial electric resistance (TER) of the RPMI2650 monolayers

RPMI2650 cells were seeded on inserts (04 μM pore sizeMillipore) in 12-well transwell chambers The TER was

24 y wang ET AL


8192019 Cbf 3075





Statistics


RESULTS
















8192019 Cbf 3075






26 y wang ET AL


8192019 Cbf 3075





DISCUSSION












8192019 Cbf 3075






None to declare

REFERENCES















129 1460ndash









2010 298 G212ndashG221

28 y wang ET AL


8192019 Cbf 3075





Statistics


RESULTS
















8192019 Cbf 3075






26 y wang ET AL


8192019 Cbf 3075





DISCUSSION












8192019 Cbf 3075






None to declare

REFERENCES















129 1460ndash









2010 298 G212ndashG221

28 y wang ET AL


8192019 Cbf 3075






26 y wang ET AL


8192019 Cbf 3075





DISCUSSION












8192019 Cbf 3075






None to declare

REFERENCES















129 1460ndash









2010 298 G212ndashG221

28 y wang ET AL


8192019 Cbf 3075





DISCUSSION












8192019 Cbf 3075






None to declare

REFERENCES















129 1460ndash









2010 298 G212ndashG221

28 y wang ET AL


8192019 Cbf 3075






None to declare

REFERENCES















129 1460ndash









2010 298 G212ndashG221

28 y wang ET AL


cbf 3075

Documents