Loyola University Chicago Loyola University Chicago

Loyola eCommons Loyola eCommons

Dissertations Theses and Dissertations

2012

Cell Biology of Foxp3+ Regulatory T Cells Cell Biology of Foxp3+ Regulatory T Cells

Mariko Takami Loyola University Chicago

Follow this and additional works at: https://ecommons.luc.edu/luc_diss

Part of the Immunology and Infectious Disease Commons

Recommended Citation Recommended Citation Takami, Mariko, "Cell Biology of Foxp3+ Regulatory T Cells" (2012). Dissertations. 409. https://ecommons.luc.edu/luc_diss/409

This Dissertation is brought to you for free and open access by the Theses and Dissertations at Loyola eCommons. It has been accepted for inclusion in Dissertations by an authorized administrator of Loyola eCommons. For more information, please contact ecommons@luc.edu.

This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. Copyright © 2012 Mariko Takami

LOYOLA UNIVERSITY CHICAGO

CELL BIOLOGY OF FOXP3+ REGULATORY T CELLS

A DISSERTATION SUBMITTED TO

THE FACULTY OF THE GRADUATE SCHOOL

IN CANDIDACY FOR THE DEGREE OF

DOCTOR OF PHILOSOPHY

PROGRAM IN MICROBIOLOGY AND IMMUNOLOGY

BY

MARIKO TAKAMI

CHICAGO, IL

AUGUST 2012

Copyright by Mariko Takami, 2012 All rights reserved.

iii

ACKNOWLEDGEMENTS

First and foremost, I would like to sincerely thank my mentor, Dr. Makio Iwashima

for providing me with the learning opportunities to develop my career as a scientist. This

dissertation would not have been possible without his support. Additionally, I am forever

grateful to Dr. Knight for her encouragement throughout my graduate school carrier.

I would also like to thank my dissertation committee, Dr. Phong T. Le, Dr. Edward

M. Campbell and Dr. Caroline Le Poole for their helpful suggestions.

I would like to thank all present and past members of the Iwashima Lab for their

technical help and suggestions. Special thanks to Dr. Yoichi Seki, Dr. Mutsumi

Yamamoto, Dr. Nagendra Singh, Dr. Uma Chandrasekaran, Kathleen Jaeger and Dr.

Davood Khosravi. I would also like to thank my friend Shauna Marvin, Bruno Lima,

Alicia Martin, Fareena Biliwani and Patricia Simms for their support and friendship.

Finally, I would like to thank my parents for unwavering support.

iv

TABLE OF CONTENTS

ACKNOWLEDGEMENTS iii

LIST OF TABLES vi

LIST OF FIGURES vii

LIST OF ABBREVIATIONS ix

ABSTRACT xii

CHAPTER ONE: LITERATURE REVIEW 1 CD4+ T cell immunity 1 Introduction 1 Th1 cells 2 Th2 cells 3 Th17 cells 4 Th9 cells 5 Regulatory T cells in tolerance 6 Introduction 6 Foxp3 7 Suppression function of Treg cells 9 Inducible Treg cells (iTregs) 10 T cell receptor (TCR) proximal signaling 11 Introduction 11 RasGRP1 13 Immune homeostasis 15 TGF-β in immune homeostasis 15 Activation induced cell death (AICD) in immune homeostasis 18 Proposed model and p53 dependent apoptosis (PICA) 22 CHAPTER TWO: MATERIAL AND METHODS 25

Mice 25 Flow cytometry 25 Cytokine staining 26 Preparation of CD4+CD25+ Tregs and CD4+CD25- T cells from mouse spleen 27 Culture media 28 CD4+CD25+ Treg cell expansion 28

v

Non-Treg (CD4+CD25- T cells) expansion 28 T cell receptor stimulation using biotin-conjugated anti-CD3 antibody crosslinked by avidin 29 T cell stimulation by plate-bound anti-CD3 and anti-CD28 antibodies 30 Western blot 30 Enzyme-linked immunosorbent assay (ELISA) 31 Chromatin Immunoprecipitation (CHIP) Assay 32 Quantitative RT-PCR 34 Measurement of intracellular free calcium 35 Statistical analysis 35

CHAPTER THREE: RESULTS 38 Proximal T cell receptor (TCR) signaling in CD4+CD25+ Treg cells and CD4+CD25- T cells 38 Lack of RasGRP1 expression rescues non-Treg cells from PICA 49 Lack of RasGRP1 expression downregulates Bim expression 54 Regulation of RasGRP1 expression in CD4+ T cells 56 Foxp3 directly associate with rasgrp1 gene 61 TGF-β signaling in CD4+ T cells and PICA 65 Exogenous TGF-β renders CD4+CD25- T cells resistant to PICA 71 TGF-β signaling downregulates Bim expression 72 Effect of TGF-β for CD4+ T cell differentiation under PICA inducing conditions 81 TGF-β promotes differentiation of Th9 cells under PICA inducing condition 85 CHAPTER FOUR: DISCUSSION 91 Introduction 91 RasGRP1 expression in CD4+ T cells and PICA 93 Regulation of RasGRP1 expression in T cells 97 TGF-β signaling decides the fate of non-Treg cells and Treg cells under PICA inducing conditions 100 PICA inducing conditions skew differentiation of CD4+ T cells 103 Concluding remarks 107 REFERENCES 108 VITA 126

vi

LIST OF TABLES

Table Page

1. PCR primers 37

vii

LIST OF FIGURES

Figure Page

1. Western blot analysis of Foxp3 expression in ex vivo expanded CD4+CD25+ Tregs and non-Treg cells (CD4+CD25- T cells) 39

2. Western blot analysis of proximal TCR signaling molecules in ex vivo expanded CD4+CD25+ Treg cells and non-Treg cells (CD4+CD25- T cells) upon TCR activation 40

3. Western blot analysis of proximal TCR signaling, Ras-Erk pathway in ex vivo expanded CD4+CD25+ Treg cells and non-Treg cells (CD4+CD25- T cells) upon TCR activation 44

4. Calcium signaling in ex vivo expanded CD4+CD25+ Treg cells and non-Treg cells (CD4+CD25- T cells) upon TCR activation 47

5. Lack of RasGRP1 expression rescues non-Treg cells from PICA 51

6. Effect of RasGRP1 expression on Erk activity by non-Treg cells (CD4+CD25- T cells) under plate-bound anti-CD3/anti-CD28 antibody stimulation 52

7. Effect of RasGRP1 expression on apoptotic protein expression by CD4+CD25-

T cells under plate-bound anti-CD3/anti-CD28 antibody stimulation 55

8. Western blot analysis of RasGRP1 expression on CD4+CD25+ Treg cells and CD4+CD25- T cells 57

9. The rasgrp1 gene expression in CD4+CD25+ Treg cells and CD4+CD25- T cells 58

10. Effect of TGF-β on RasGRP1 expression by CD4+CD25- T cells 60

11. Foxp3 interaction with rasgrp1 gene in CD4+CD25+ Treg cells 62

12. Effect on TGF-β signaling blockade on PICA of CD4+CD25+ Treg cells 66

13. Effect on TGF-β signaling blockade on PICA of CD4+CD25+ Treg cells 68

viii

14. Effect of TGF-β on PICA by CD4+CD25- T cells 70

15. Effect of TGF-β on Bim expression by CD4+CD25- T cells 73

16. Effect on TGF-β signaling on cell surface expression of Fas and FasL by CD4+CD25- T cells 74

17. Effect of TGF-β on bim transcript by CD4+CD25- T cells 75

18. Effect of TGF-β signaling on Bim expression by CD4+CD25+ Treg cells 78

19. Effect of TGF-β signaling on cell surface expression of Fas and FasL by CD4+CD25+ Treg cells 79

20. Effect of TGF-β signaling on bim transcript by CD4+CD25+ Treg cells 80

21. Effect of TGF-β on Foxp3 expression by CD4+CD25- T cells under PICA inducing stimuli 82

22. Effect of TGF-β and IL-6 on PICA by CD4+CD25- T cells 83

23. Effect of TGF-β and IL-4 on PICA by CD4+CD25- T cells 86

24. Effect of TGF-β and IL-6 on PICA by CD4+CD25- T cells 88

25. Effect of TGF-β and IL-6 on PICA by CD4+CD25- T cells 89

26. Schematic model of CD4+ T cells under PICA inducing stimuli 104

ix

LIST OF ABBREVIATIONS

AICD Activation induced cell death

ALPS Autoimmne lymphoproliferative syndrome

APC Antigen presenting cells

DAG Diacylglycerol

DISC Death inducing signaling complex

DMSO Dimethyl sulfoxide

DNA Deoxyribonuclease

EAE Experimental autoimmune encephalomyelitis

ELISA Enzyme-linked immunosorbent assay

ERK Extracellular signal regulated protein kinase

FACS Fluorescence activated cell sorting

FADD Fas-asociated death domain

FasL Fas ligand

FCS Fluorescence activated cell sorting

Foxp3 Forkhead box protein 3

GVHD Graft-versus-host disease

IBD Inflammatory bowel disease

IDO Indoleamine 2,3-dioxygenase

IFN-γ Interferon gamma

x

IL Interleukin

IP3 Ionositol triphosphate

IPEX Immune dysregulation polyendocrinopathy, enteropathy, X-linked

ITAM Immunoreceptor tyrosine-based activation motif

iTreg cells Inducible regulatory T cells

LAP Latency associated protein

LAT Linker of activated T cell

LCK Leukocyte-specific protein tyrosine kinase

LT-α Lympho toxin-alpha

MHC Major histocompatibility

NFAT Nuclear translocation of the transcription factor

NOD Non obese diabetic

nTreg cells Naturally arising regulatory T cells

PBS Phosphate buffered saline

PCR Polymerase chain reaction

PICA p53-induced and CD28-dependent apoptosis

PLC Phospholipase C

PMA Phorbol 12-myristate 13 acetate

RAG-1 Recombinant activating gene-1

RasGRP1 Ras guanyl nucleotide releasing proteins 1

ROR Retinoid-related orphan receptor

RPMI1640 Roswell park memorial institute 1640

SDS-PAGE Sodium dodecylsulfate-polyacrylamide gel electrophoresis

xi

SEB Staphylococcal enterotoxin B

SH Src homology

SLE Systemic lupus erythematosus

SLP76 SH2 domain containing leukocyte protein 76

SOS Son of seventhless

T-bet T-box transcription factor

TCR T cell receptor

TGF Transforming growth factor

Th T helper

TNFR Tumor necrosis factor receptor

ZAP70 Zeta-chain associated protein 70

xii

ABSTRACT

The immune system protects us from infection by pathogens such as viruses and

bacteria. T cells play a central role in the immune response to fight against pathogens and

orchestrate other immune cells by producing cytokines or chemokines. An overreactive

immune response can lead to autoimmune diseases, therefore the immune system must

possess negative regulation mechanisms. In the periphery, naturally arising regulatory T

cells (CD4+CD25+Foxp3+ T cells; nTregs) negatively regulate immune responses and

play an important role in maintaining immune homeostasis by suppressing other immune

cells. When antigens derived from pathogens are present, conventional CD4+ T cells

recognize their cognate antigen and proliferate. After pathogen clearance, expanded

effector T cells eventually decline in number due to activation induced cell death (AICD)

to terminate immune response. However, it is not understood how nTregs respond to

antigen stimulation. Since effector T cells are needed for an immune response and nTregs

are required for maintaining peripheral tolerance, the responses to antigen stimulation in

nTregs might be different from other CD4+ T cells.

We previously discovered the phenomenon that nTregs survive and expand when

stimulated with plate-bound anti-CD3/anti-CD28 antibodies which mimic antigen

stimulation in the presence of IL-2, while conventional T cells undergo massive

xiii

apoptosis. This suggests that there is a differential survival mechanism between nTregs

and conventional T cells. Further, we found that T cell stimulation under this stimulation

was mediated by a novel form of the apoptotic pathway (p53-induced and CD28-

dependent apoptosis; PICA) and distinct from classical AICD.

In my dissertation, I hypothesized that this differential survival mechanism

between nTreg and conventional CD4+ T cells against PICA might be important in

keeping the balance between nTregs and non-Tregs thus maintaining immune

homeostasis in a physiological environment. Therefore, I investigated by which

mechanisms nTregs survive under PICA inducing stimuli. I found that at least two

signaling pathways are altered in nTregs under PICA induced stimulation thus mediating

cell survival.

I conducted TCR proximal signaling study and identified that RasGRP1

expression was substantially reduced and its downstream Ras-Erk pathway was impaired

in nTregs. nTregs express a transcription factor, Foxp3 which positively or negatively

regulates the expression of multiple genes related to nTreg functions. I performed a ChIP

assay to determine if rasgrp1 gene expression is negatively regulated by Foxp3 in

nTregs, and identified that rasgrp1 gene was indeed a Foxp3 target. Further, loss of

RasGRP1 expression rendered conventional CD4+ T cells resistant to PICA, suggesting

that reduced RasGRP1 expression in Tregs is important for cell survival under PICA

inducing stimuli.

Upon TCR activation, T cells produce various cytokines such as IL-2. TGF-b is a

pleiotropic cytokine which is also produced by T cells. Tregs, but not other conventional

xiv

T cells, express a unique form of membrane bound TGF-b upon TCR activation. I

demonstrated that TGF-b signaling is required for Tregs to survive PICA. Conversely,

conventional CD4+ T cells became resistant to PICA and underwent robust expansion

instead of apoptosis, with the reduction of the proapoptotic protein Bim, when an active

form of exogenous TGF-b is present. These data suggest a novel role for TGF-b in nTreg

biology and potentially involvement in expansion of effector T cells under PICA

inducing stimuli.

Taken together, my work provides insight into how nTregs survive under antigen

stimulation while conventional CD4+ T cells undergo apoptosis. My work suggests that

reduced RasGRP1 expression and TGF-b signaling mediate the survival of nTregs under

PICA inducing stimuli. These altered signals in Tregs are likely regulating the balance of

nTreg and conventional T cells during an immune response, thus maintaining immune

homeostasis.

1

CHAPTER ONE

LITERATURE REVIEW

CD4+ T CELL IMMUNITY

Introduction

The immune system protects us from non-self invasions such as viruses or bacterial

infections. CD4+ T cells play a major role in orchestrating other immune cells by

producing cytokines or chemokines during the adaptive immune response, hence they are

also called helper T cells. For example, CD4+ T cells help B cells to make antibodies and

also help macrophages to have enhanced activity to fight against pathogens during

infections. CD4+ T cells express T cell receptors (TCRs) on their surface and recognize

peptides derived from pathogens presented on major histocompatibility class II (MHC

class II) that are expressed by antigen presenting cells (APCs). Engagement of TCRs with

MHC class II-peptide complex leads to activation of TCR signaling cascades which

promote transcription of multiple genes including cytokine genes.

In 1986, Mossman and Coffman reported that CD4+ T cell lines were divided into

two distinct populations by cytokine production, IFN-γ producers or IL-4 producers

(Mosmann et al., 1986; Mosmann and Coffman, 1989). This was the discovery of Th1

2

and Th2 subsets. Heinzel et al. reported that BALB/c mice were more susceptible than

C57BL/6 mice during Leishmania major infections (Heinzel and Maier, 1999). This is

because BALB/c mice are biased toward a Th2 response rather than Th1. This promotes a

humoral response instead of a cellular immune response against intracellular pathogens.

This finding suggests a correct immune response at the right time leads to elimination of

pathogens, however dysregulation of differentiation of CD4+ T cells can cause chronic

infection.

Today, helper T cell differentiation is known to be much more complex and there are

at least 6 subsets reported; Th1, Th2 Th17, iTregs, Th3 and Th9 (Fukaura et al., 1996;

Jager et al., 2009; Mosmann and Coffman, 1989; Xing et al., 2011; Zhu and Paul, 2008).

Each subset produces its signature cytokines and is responsible for mediating immune

responses. Cytokine milieus and antigen stimulations determine the fate of naïve CD4+ T

cells.

Th1 cells

Th1 cells mediate cellular immune responses against intracellular pathogens by

producing IFN-γ, IL-2 and lymphotoxin-α (LTα). IFN-γ is known as type II IFNs and

activates macrophages through IFN-γ receptor signaling. This event mediates cellular

immune response fighting against mycobacterial infections such as Leishmania major

infections. LTα is another cytokine produced by Th1 cells which mediates inflammatory

responses (Suen et al., 1997). Excess Th1 response can cause tissue damages which lead

to autoimmune diseases too. For example, higher levels of LTα is detected in multiple

3 sclerosis patients, suggesting LTα is involved in the disease progression. Suen et al. has

found that LTα deficient mice are resistant to experimental autoimmune

encepahalomyelitis (EAE), suggesting that LTα mediates EAE progression (Suen et al.,

1997).

Th1 cells express a transcription factor, T-bet which is induced by IFN-γ during Th1

differentiation (Szabo et al., 2000). Ectopic expression of T-bet is sufficient to

differentiate naïve CD4+ T cells into Th1 cells. It promotes IFN-γ production and inhibits

production of IL-4, which is known as Th2 cytokine (Yin et al., 2002). Finotto et al. have

shown that T-bet deficient mice develop an asthma like phenotype (Finotto et al., 2005).

These data suggest that fine balance of Th1 cells against Th2 cells is critical to maintain

immune homeostasis.

Th2 cells

Th2 cells mediate humoral immune responses and are responsible for eliminating

extracellular pathogens, such as helminth, by producing IL-4, IL-5, IL-10 and IL-13

(Abbas et al., 1996; Glimcher and Murphy, 2000). Gros et al. and Swain et al. have

shown that naïve CD4+ T cells preferentially differentiate into IL-4 producers under anti-

CD3 antibody stimulation in the presence of IL-4 in vitro (Gross et al., 1993; Swain et al.,

1990). They also show that this culture condition inhibits cells producing IFN-γ and IL-2.

Th2 cells express a transcription factor GATA-3 and expression of GATA-3 is

upregulated during Th2 differentiation (Kurata et al., 1999; Zhu et al., 2001). IL-4

mediates IgE class switching in B cells (Shimoda et al., 1996). IgE is known to bind to

4 FC receptor on basophils and mast cells (Schulman et al., 1988). This event leads to

secretion of histamine from these cells, hence excess Th2 responses are often linked to

induction of asthma and other allergic diseases (Barnes, 2001; Zhou et al., 2001).

Th17 cells

Th17 cells mediate an inflammatory response by producing IL-17 (Ivanov et al.,

2006). Naïve CD4+ T cells can differentiate into Th17 in the presence of TGF-β and IL-6

in vitro (Bettelli et al., 2006; Mangan et al., 2006; Veldhoen et al., 2006). Th17 cells do

not produce IL-4 or IFN-γ, so it is considered a distinct subset from Th1 or Th2. IL-23 is

another critical cytokine for Th17 (Aggarwal et al., 2003). Recent studies suggest that IL-

23 is not required for Th17 differentiation but is important for maintenance and

proliferation of Th17 cells (Aggarwal et al., 2003; Bettelli et al., 2006; Veldhoen et al.,

2006). Th17 cells express an orphan nuclear transcription factor, RORγt (Ivanov et al.,

2006). RORγt directly activates transcription of IL-17 and it is required for Th17

induction (Manel et al., 2008). Further, ectopic expression of RORγt makes CD4+ T cells

Th17 like phenotype, suggesting that RORγt is sufficient to induce Th17 (Ivanov et al.,

2006; Sofi et al., 2010).

The importance of IL-17 signaling during infections was delineated using mouse

models. Ye et al. showed that IL-17 deficient mice became extremely sensitive to

intranasal Klebsiella pneumoniae compared to wild type mice using a model of Klebsiella

pneumoniae lung infection (Ye et al., 2001). IL-17 was important to clear the pathogens.

On the other hand, accumulating evidence suggests that IL-17 is also involved in the

5 development of autoimmune diseases, such as rheumatoid arthritis and multiple

sclerosis (Gold and Luhder, 2008; Hofstetter et al., 2005; Kotake et al., 1999; Nakae et

al., 2003). For example, Komiyama et al. showed that IL-17 knockout mice exhibit a

delayed onset of experimental autoimmune encephalomyelitis (EAE) (Komiyama et al.,

2006). Blockade of IL-17 signaling using anti-IL-17 neutralizing antibody experiments

also showed delayed Type I diabetes in the NOD mouse model (NOD), which produced

increased levels of IL-17 (Emamaullee et al., 2009).

In humans, Zao et al. showed that AID patients had higher frequencies of Th17 cells

(Zhao et al., 2010). Furthermore, Wong et al reported that increased levels of IL-17 in

plasma from SLE patients compared to healthy donors (Wong et al., 2008).

Th9 cells

Th9 is the most newly identified helper T cell subset, which produces IL-9. IL-9 is a

pleiotropic cytokine which influences multiple cell types including T cells, B cells and

Mast cells. For T cells, IL-9 is important for cell growth and can promote Th17

differentiation (Elyaman et al., 2009; Nowak et al., 2009; Schmitt et al., 1994). For Mast

cells, IL-9 increases their activity and also works as a growth factor (Wiener et al., 2004).

IL-9 producing CD4+ T cells were originally classified as a part of the Th2 subset,

however it is now considered as a distinct population from Th2 (Soroosh and Doherty,

2009). Naïve CD4+ T cells differentiate to Th9 in the presence of IL-4 and TGF-

β (Schmitt et al., 1994). Recently, PU.1 was characterized as the Th9 hallmark

transcription factor (Chang et al., 2009; Chang et al., 2005). PU.1 directly controls IL-9

gene transcription but also represses Th2 cytokine production (Chang et al., 2010).

6 IL-9 is thought to be involved in proinflammatory responses. Temann et al. showed

that overexpression of IL-9 in lungs of transgenic mice caused asthma symptoms such as

mucus production and subepithelial fibrosis (Temann et al., 2002). Further, Kearly et al

showed that mice treated with IL-9 neutralizing antibody ameliorated allergy

inflammation using an acute inflammatory mouse model challenged with house mite

allergen (Kearley et al., 2011).

REGULATORY T CELLS FOR TOLERANCE

Introduction

In the early 1970s, the concept of peripheral tolerance attracted attention. Gershon

and Kondo found that a T cell subset, termed suppressor T cells, dampened immune

responses (Gershon and Kondo, 1970). It was reported that the I-J molecule, which was

supposed to be located on MHC gene complex, played a key role in exerting immune

suppressive functions. However it turned out to be not true, and it was realized that such

I-J molecules did not exist after extensive studies using molecular biology techniques

(Kronenberg et al., 1983). In 1995, Sakaguchi et al. drew renewed attention for the

concept of suppressor T cells (Sakaguchi et al., 1995). They discovered that CD4+CD25+

T cells have suppressive ability against immune responses. CD25 is an IL-2 receptor

α chain and 5-10% of CD4+ T cells express CD25 under the naïve state while all CD4+ T

cells upregulate surface expression of CD25 after TCR activation (Levings et al., 2001;

Sakaguchi et al., 1995). They performed a cotransfer of CD4+CD25- and CD4+ CD25+ T

cells into athymic mice and found that the mice which only received CD4+CD25- T cells

7 developed severe autoimmune symptoms including colitis and auto-antibody production

(Sakaguchi et al., 1995). This experiment suggests that CD4+CD25+ T regulatory (Treg)

cells indeed have suppressive functions to control immune responses. Later, accumulated

evidence suggested that IL-2 receptor α chain (CD25) was not only a Treg cell surface

marker but also critical for development, survival and function of Treg cells (D'Cruz and

Klein, 2005; Fontenot et al., 2005).

CD4+CD25+ Treg cells develop in the thymus. Itoh et al. found that TCR transgenic

mice which also lack Rag expression did not develop Tregs, suggesting that Tregs need

TCR specificity for cell development (Itoh et al., 1999). Recent studies suggested that

TCR repertoires between CD4+CD25+ Treg cells and CD4+CD25-T cells were comparable

but distinct by sequencing the variable region of TCR α chain (Kuczma et al., 2009;

Madakamutil et al., 2008; Singh et al., 2010b).

Foxp3

Although CD4+CD25+ T cells were discovered as a CD4+ T cell subset which had

suppressive functions and termed regulatory T cells by the Sakaguchi group, it was not

understood what controlled suppressive function of CD4+CD25+ Treg cells.

Scurfy mice came about by a spontaneous mutations on the X choromosome. These

mice exhibit autoimmune disease symptoms including splenomegaly and

lymphadenopathy. In 2001, Benett et al. discovered the scurfy mice had mutations in the

foxp3 gene (Bennett et al., 2001). Hori et al. then reported that Foxp3 was specifically

expressed in the CD4+CD25+ Treg cell population (Hori et al., 2003). Further, they

showed that overexpression of Foxp3 rendered non-Treg cells (CD4+CD25- T cells) to a

8 Treg-like phenotype with suppressive functions (Hori et al., 2003). Also, Fontenot et al.

showed that ectopic expression of Foxp3 conferred suppressor function on peripheral T

cells (Fontenot et al., 2003). In humans, autoimmune syndrome X-linked neonatal

diabetes mellitus, enteropathy and endocrinopathy (IPEX) patients have multiple

mutations in the foxp3 gene, suggesting there is a link between foxp3 mutations and

autoimmune disease (Lopes et al., 2006; Myers et al., 2006). Furthermore, forced

expression of Foxp3 using transgenic mice rendered mice more susceptible to virus

infection challenges and showed reduced T cell numbers in the spleen and lymph nodes

while T cell development occurred normally (Guo et al., 2010). These finding suggested

that Foxp3 was a master regulator of Treg cells. Foxp3 is a transcription factor and a

member of the forkhead family (Ziegler, 2006). It has a fork head (FKH) domain which

binds to core DNA sequences (Coffer and Burgering, 2004; Lin and Peng, 2006).

Members of the Foxp3 family function as both transcriptional activators and repressors.

Accumulated evidence suggests that Foxp3 also works as transcriptional activator and

repressor. For example, the il-2 gene is a known target of Foxp3 and its gene expression

is negatively regulated in Treg cells (Fontenot et al., 2003; Hori et al., 2003). Schubert et

al. showed that ectopic expression of Foxp3 in Jurkat cells resulted in downregulation of

il-2 (Schubert et al., 2001). Recently, mechanisms that make Foxp3 repress the il-2 gene

have been proposed. Schubert et al. showed that the il-2 promoter contained a forkhead

binding sequence adjacent to the NFAT binding site, therefore they proposed a model in

which Foxp3 competes for the binding site with NFAT thus repressing il-2 transcription

(Schubert et al., 2001). Betteli et al. showed that NFAT and Foxp3 interact in a cell free

system (in cell lysate), therefore they proposed the model where Foxp3 sequestered

9 NFAT thus inhibiting NFAT binding to the il-2 promoter (Bettelli et al., 2005). Further,

Wu et al. showed that mutations in the NFAT interaction site of Foxp3 upregulated il-2

gene expression (Wu et al., 2006). This also supports the model that Foxp3 inhibits

NFAT binding to the il-2 promoter by directly interacting with NFAT.

Additionally, other Treg function related genes such as CD25 and CTLA4 are known to

be upregulated by Foxp3 while expression of IL-4, IFN-γ genes is repressed (Ziegler,

2006).

Suppressive function of Treg cells

There have been multiple mechanisms proposed for CD4+CD25+Treg cell

suppressive functions. Hori et al. showed that Treg cells required antigenic stimulation

via TCR to exert their suppressive function against responder cells (Hori et al., 2003).

Takahashi et al. demonstrated that when Treg cells and responder cells (non-Treg cells)

were separated using permeable membrane, Treg cells were not able to suppress

proliferation of responder cells (Takahashi et al., 2000). Further, Gondek et al. showed

that culture supernatant of antigen-stimulated Treg cells failed to suppress responder cells

(Gondek et al., 2005). These results indicated that Treg cells suppress responder cells in a

cell contact dependent manner.

Treg cells do not produce IL-2, however they express high levels of IL-2 receptor α

chain, CD25 on the cell surface. Therefore, Padiyan et al. proposed the model that Treg

cells used up IL-2 thus causing deprivation of IL-2 for responder cells leading to

apoptosis (Pandiyan et al., 2007). They showed that the addition of exogenous IL-2

rescued responder T cells from apoptosis and provoked Treg cell suppressive functions.

10 The interaction of Treg cells and antigen presenting cells (APCs) has also been

proposed to make up a suppressive environment. Oderup et al. found that Treg cells

downregulated B7 costimulatory molecules expressed on DCs, suggesting that Treg cells

reduced DC function thus preventing activation of responder cells (Oderup et al., 2006).

Further, Treg cells activated DCs to upregulate expression of the enzyme indoleamine

2,3-dioxygenase (IDO) (Fallarino et al., 2003; Grohmann et al., 2003). IDO bears off

tryptophan by catabolizing the conversion of tryptophan to kyurenine, which is toxic to T

cells (Mellor and Munn, 2004). Hence, responder cells lack the essential amino acid

tryptophan and are exposed to kyurenin thus eliminating responder cells.

Cytokine secretion is also proposed to be one of Treg cell suppressive mechanism.

Nakamura et al. demonstrated that membrane bound TGF-β expressed on Treg cells were

essential for Treg cell suppressive function (Nakamura et al., 2001). Further, IL-10 and

galectin were proposed to be involved in Treg cell suppressive function (Sugimoto et al.,

2006).

Together, these findings suggest that Treg cells suppress the immune response by

multiple mechanisms in a direct or indirect manner.

Inducible Treg (iTreg) cells

Naïve CD4+ T cells can differentiate to inducible Treg (iTreg) cells when TGF-β is

present during antigen stimulation. iTreg cells also express Foxp3 as do Treg cells and

exert suppressive function (Knoechel et al., 2005). However, Foxp3 expression in iTreg

cells is not stable as nTreg cells. Floess et al. showed that iTreg cells which were

generated under TCR stimulation in the presence of TGF-β, reduced Foxp3 expression

11 and suppressive function when they were restimulated in the absence of TGF-β (Floess

et al., 2007). iTreg cells are preferentially generated in gut associated lymphoid organs,

since TGF-β level is high in these area (Chen et al., 2003; Selvaraj and Geiger, 2007).

Constant antigen exposure such as commensal bacteria or food antigens is also preferred

condition for iTreg cell induction (Kretschmer et al., 2005; Mucida et al., 2005).

T CELL RECEPTOR (TCR) PROXIMAL SIGNALING

Introduction

As mentioned above, T cells recognize antigens using its surface expressed TCR,

which initiates activation of cells thus leading to cell proliferation and cytokine

production. At the molecular level, multiple proteins form signaling cascades and convert

input TCR stimulation signals into output such as cytokine production.

Ligation of TCRs to their cognate antigens presented on MHC class II initiates TCR

signaling cascade by activating receptor associated src family phosphotyrosine kinases,

LCK. LCK then phosphorylates immunoreceptor tyrosine based activation motif (ITAM)

on TCRζ chains in the CD3/TCR complex, thus making binding site for the dual src

homology 2 (SH2) domain of src family kinase, the tyrosine kinase ζ- associated protein

70 kDa (ZAP-70) (Iwashima et al., 1994; Kane et al., 2000; Straus et al., 1996). This

event recruits ZAP -70 to the plasma membrane and activates ZAP-70. Activation of

ZAP70 then leads to phosphorylation of multiple side adopter proteins, the linker for

activation of T cells (LAT) and induces the formation of protein complex with other

12 adopter proteins including Grb-2, SHC, SLP76 by recruiting them to its

phosphorylated sites (Buday et al., 1994; Gilliland et al., 1992; Zhang et al., 1998).

Son of sevenless (SOS) is a substrate for Grb-2 and is recruited to the plasma

membrane following activation of Grb2 in the LAT complex. Activated SOS by

phosphorylation then activates a Ras guanyl nucleotide exchange factor thus leading to

Erk activation (Ravichandran et al., 1995; Xavier et al., 1998).

Phospholipase C-γ (PLC) is also one of the proteins which make a complex with

LAT following LAT activation and is activated by phosphorylation in this protein

complex (Nishibe et al., 1990). Activated PLC-γ then produces DAG and IP3 by cleaving

phosphatidylinositol-4,5-bis phosphate (PIP2) (Nishibe et al., 1990). IP3 results in the

increase of the intracellular calcium concentration [Ca2+] leading to nuclear translocation

of the transcription factor, NFAT (Crabtree, 1999; Stankunas et al., 1999). DAG activates

another Ras activator, RasGRP1 thus leading to the activation of Ras-Erk pathway (Ebinu

et al., 2000).

One of most well studied outputs upon TCR stimulation was IL-2 production. IL-2 was

originally identified as a T cell growth factor and essential for T cells to become effector

cells and proliferate (Waldmann et al., 2001). Upon TCR activation, il-2 transcription is

initiated by transcription factors including NFAT and AP-1 (Jain et al., 1995). NFAT is

activated via the calcium signaling pathway and AP-1 is regulated via the Ras-Erk

pathway. Erk activation leads to upregulation of c-Fos, which forms the AP-1 complex

(Karin et al., 1997). Therefore, both the Ras-Erk signal and calcium signal regulate

production of IL-2 in response to TCR stimulation.

13 RasGRP1

RasGRP1 was originally identified from brain and T cell cDNA library by selecting

Ras activation related genes (Ebinu et al., 2000; Tognon et al., 1998). Ebinu et al. showed

that the catalytic domain of RasGRP1 promoted activation of H-Ras in vitro using H-Ras

overexpressed Rat2 cells (Ebinu et al., 2000). Further, they demonstrated that RasGRP1

translocate to plasma membrane with PMA treatment followed by activation of Erk. They

also characterized the catalytic domain by homology search of amino acids and identified

that it contains CDC25, named for the prototypic Ras activator from Saccharomyces

cerevisiae, and Ras exchange motif (REM) domain. Shortly thereafter, Lorenzo et al

demonstrated that RasGRP1 possessed C1 domain and bound to DAG and DAG analog,

PMA (Lorenzo et al., 2000). Further, they tracked RasGRP1 localization by

overexpressing RasGRP1- GFP fusion in Hela cells and showed that RasGRP1

translocated to plasma membrane in response to PMA stimulation. These data suggest

that RasGRP1 activated Ras in response to DAG.

RasGRP1 is dominantly expressed in T cells among RasGRP family (RasGRP1, 2, 3,

4) and multiple T cell lines also express RasGRP1 (Ebinu et al., 2000). Especially, Jurkat

T cell lines have been used to investigate a role of RasGRP1 in T cells. Ebinu et al.

showed that over expression of RasGRP1 in Jurkat cells resulted in enhanced sensitivity

to TCR stimulation of Ras-Erk pathway (Ebinu et al., 2000). Further, they showed that

overexpression of RasGRP1 led to increased IL-2 production. Roose et al. reported that

RasGRP1 deficient Jurkat cell lines had decreased activity of Ras-Erk pathway and

decreased expression of CD69, which is early T cell activation marker in response to

TCR stimulation (Roose et al., 2005). These data suggest that RasGRP1 links the signal

14 between PLC-γ and Ras. Although there is another Ras activator, SOS exists in T cells,

these data suggest that RasGRP1 plays essential roles for activating Ras and is not

compensated by SOS activity. This model was more clearly supported by using RasGRP1

deficient mice.

Dower et al. engineered RasGRP1 deficient mice and demonstrated that RasGRP1

was essential for thymocyte differentiation (Dower et al., 2000). They showed that

RasGRP1 deficient mice exhibited abnormal thymocyte differentiation pattern. The

CD4+CD8+ double positive T cell ratio substantially increased while single positive CD4+

or CD8+ T cells decreased compared to littermate control, suggesting that RasGRP1

expression was required for positive selection during thymic development. In contrast,

Normant et al. used RasGRP1 transgenic mice which overexpress RasGRP1 under

control of the proximal LCK promoter (Norment et al., 2003). T cells which lack

expression of Rag1 cannot under go V, (D), J gene rearrangement, therefore they cannot

undergo development process in thymus (Swat et al., 1996). However, RasGRP1

transgenic mice in Rag1 knockout background exhibited single positive CD8+ T cells,

suggesting that RasGRP1 affects thymocyte development (Norment et al., 2003).

Dower et al. showed that RasGRP1 knockout mice have splenomegaly and

autoimmune lymphoproliferative disorder (Dower et al., 2000). These mice also had

antinuclear antibodies. These data suggest that the lack of RasGRP1 expression in T cells

leads to expansion of T cells in periphery thus influencing to B cells. Since RasGRP1

deficient mice lack RasGRP1 expression in whole body, Layer et al. further tested loss of

RasGRP1 effect specifically on T cells (Layer et al., 2003). They adoptive transferred T

cells isolated from lag mice,which has mutations in rasgrp1 gene, into T and B cell

15 deficient mice (RAG knockout mice). The recipient mice also developed autoimmune

lymphoprolifarative disease, which suggested that loss of RasGRP1 expression in T cells

causes pathogenesis.

IMMUNE HOMEOSTASIS

TGF-β in immune homeostasis

TGF-β is a pleiotropic cytokine which mediates multiple physiological functions

such as proliferation, apoptosis and differentiation and is produced by many cell types

including lymphocyte (Bommireddy and Doetschman, 2004). TGF-β is also known as an

essential factor to keep immune homeostasis (Gorelik and Flavell, 2002).

T cells dominantly produce TGF-β 1 among TGF-β family, TGF-β 1, 2 and 3 (Li et

al., 2006). The role of TGF-β 1 in immune homeostasis and peripheral tolerance has been

demonstrated using TGF-β1 deficient mice or TGF-β receptor deficient mouse models.

Kukarni et al. and Shull et al. engineered TGF-β 1 deficient mice and showed that these

mice developed an excessive inflammatory response and multifocal inflammatory disease

and died at the age of 3 to 5 weeks (Kulkarni et al., 1993; Kulkarni and Karlsson, 1993;

Shull et al., 1992). Since T cells have been known to be essential for mediating immune

disorders, it was expected that loss of TGF-β 1 caused immune disorders in a T cell

dependent manner. Later, Gorelik et al. engineered transgenic mice which expressed

dominant negative form of human TGF-β receptor II under control of the CD4 promoter

(Gorelik and Flavell, 2000). Hence, TGF-β signaling is blocked specifically in T cells in

16 these transgenic mice. They showed that these transgenic mice also developed

lymphoproliferative disorders, which suggested TGF-β signaling in T cells was required

for regulating immune homeostasis. Li et al. further investigated the definitive role of

TGF-β signaling using conditional TGF-β receptor knockout mice crossed with CD4 cre

mice (Li et al., 2006). These mice lacked expression of TGF-β receptor II in T cells.

These mice also exhibited lymphoproliferative disorders and lethal autoimmunity. This

result also supports the idea that TGF-β signaling in T cells is required for regulating

immune homeostasis.

It is now widely accepted that regulatory T cells are essential for maintaining

peripheral tolerance. Li et al. showed that the number of Treg cells in the periphery

substantially decreased in the conditional knockout mice, which lacked TGF-β signaling

in T cells, while thymic Treg cell numbers were not affected, suggesting that TGF-

β signaling affected maintenance of Treg cells (Li et al., 2006). Further, they showed that

TGF-β receptor deficient Treg cells proliferated more than wild type Treg cells in

response to TCR stimulation, suggesting TGF-β signaling was suppressing Treg cell

proliferation. To address whether the loss of peripheral tolerance in these mice is due to a

decrease in the number of Treg cells or intrinsic effect of other effector T cells, Li et al.

performed adoptive transfer experiment that transferred wild type Treg cells into neonatal

TGF-bRII deficient mice. If a reduced number of Treg cells was the cause of autoimmune

disorder in TGF-bRII deficient mice, transferred wild type Treg cells into the mice would

be expected to rescue these mice from developing autoimmune disease. However, these

mice still developed an autoimmune disease and transferred wild type Treg cells did not

17 suppress T cell activation in the host mice, which suggested that Treg cells are not only

mechanisms to keep immune homeostasis, but also that TGF-β signaling in T cells

possessed intrinsic effect leading to peripheral tolerance.

In addition to nTreg cells produced in thymus, naïve T cells also can be differentiated

to Foxp3+ Treg cells referred to as inducible Treg (iTregs) cells. In vitro, naïve CD4+ T

cells are differentiated to iTregs with TCR stimulation in the presence of TGF-β (Chen et

al., 2003; Wan and Flavell, 2005). Tone et al. showed that TGF-β induces Foxp3

expression through SMAD3 association with Foxp3 promoter (Tone et al., 2008). In an

vivo mouse model, Peng et al. demonstrated that overexpression of TGF-β 1 in pancreatic

islets resulted in expanded CD4+Foxp3+Treg cells and rescued NOD mice from

developing diabetes (Peng et al., 2004). These data suggest that TGF-β induces Treg

cells thus maintaining peripheral Treg cells not only influencing nTreg cells.

TGF-β can influence naïve CD4+ T cell differentiation into other helper T cell subset

besides iTreg cells. Betteli et al. showed that in the presence of IL-6, TGF-β can convert

naïve T cells into Th17 and iTreg differentiation was blocked (Bettelli et al., 2006). Th17

produces signature cytokine, IL-17 and leads to proinflammatory response (Bettelli et al.,

2006). Further, Gorelik et al. reported that TGF-β inhibited Th1 and Th2 differentiation

by downregulating expression of their hallmark transcription factors, T-bet and GATA-3

(Gorelik et al., 2000). This suggests that TGF-β can also contribute to inflammatory

responses rather than keep peripheral tolerance.

The ligand, TGF-β 1 is secreted by T cells as homodimer but as an inactive form by

associating with homodimer of latency associated protein (LAP) (Annes et al., 2003). To

18 initiate TGF-β signaling cascade, LAP has to be removed from TGF-β inactive form

by integrins or matrix proteins such as Thrombospondin-1 (TSP-1) (Masli et al., 2006;

Yehualaeshet et al., 1999).

TGF-β signaling is initiated when active form of TGF-β binds to TGF-β type II

receptor and results in phosphorylation of serine /threonine kinase in Type II receptor

kinase cytoplasmic domain. This event results in the engagement of tetrameric receptor

complex of TGF-β receptor type I and type II, activating type I receptor serine /threonine

kinase in the cytoplasmic region. Phosphorylated Type I receptor kinase then activates

transcription factors, SMAD proteins thus eliciting multiple cellular functions by

activating gene transcriptions (Bommireddy and Doetschman, 2004).

Antigen induced cell death (AICD) in immune homeostasis

Activation induced cell death (AICD) is one of the mechanisms to keep immune

homeostasis by decreasing T cell number in the periphery due to apoptosis. Shi et al.

originally used the term AICD to describe the phenomenon that the ligation of the TCR

on thymocytes leads to apoptotic cell death (Shi et al., 1989). At present, accumulating

evidence suggests that mature T cells also can undergo AICD. An in vitro setting of

AICD refers to a death caused by restimulation of activated T cells. To stimulate T cells

in vitro, antigenic stimulation can be mimicked by using anti-CD3 antibody activating

through the TCR and anti-CD28 antibody activating the CD28 costimulatory signal. In an

AICD in vitro model, T cells are stimulated with anti-CD3 and anti-CD28 for several

days, then restimulated with anti-CD3 or PMA and ionomycin. PMA is a diacylglycerol

analog and ionomycin is an ionophore which increases intracellular calcium

19 concentration. Treating T cells with these chemicals also resembles TCR activation

(Krammer, 2000).

In 1991, Lenardo et al. demonstrated that restimulation of T cells induced cell

surface expression of Fas ligand leading to apoptosis by using T cell hybridoma

(Lenardo, 1991). Fas is a death receptor which belongs to the tumor necrosis factor

receptor (TNFR) family and it possesses a death domain in the cytoplasmic tail of the

intracellular region (Nagata, 1997). The ligation of Fas and Fas ligand leads to activation

of Fas-associated death domain (FADD) followed by the formation of death inducing

signaling (DISC) complex (Kischkel et al., 1995). The DISC complex then activates

caspase 8 and induces apoptosis in T cells. There are soluble form and membrane bound

form of Fas ligand expressed by alternative splicing. LA et al. showed that membrane

bound form of Fas ligand was required to cause apoptosis in T cells by using mice which

lack either the soluble form or the membrane bound form of Fas ligand (LA et al., 2009).

Lenardo et al. showed that Fas mediated AICD was initiated in an IL-2 dependent

manner (Lenardo, 1991). As described above, IL-2 is a cytokine produced by T cells and

is known to be important factor for cell survival. Further, Refaeli et al. showed that IL-2

signaling upregulates the transcription and cell surface expression of Fas ligand thus

inducing apoptosis (Refaeli et al., 1998). They used IL-2 knockout mice and showed that

the IL-2 deficient CD4+ T cells did not upregulate cell surface expression of Fas ligand

and became resistant to AICD. These data surprisingly suggest IL-2 signaling is not only

a cell survival factor but also an important factor to induce AICD.

Mutant mice which have mutations in fas or fas ligand genes have been used to

study the effect of Fas/ Fas ligand pathway. Lpr mice have mutations in fas gene locus

20 and do not produce functional Fas. Gld mice have mutations in fas ligand gene locus

and do not produce functional Fas ligand (Cohen and Eisenberg, 1991). These mice

develop lymphoadenopathy with accumulated T cells and produce autoreactive

antibodies. In human, Aspinall et al. reported that autoimmune lymphoproliferative

syndrome (ALPS) patients had mutations in the fas gene (Aspinall et al., 1999). This

evidence suggests that Fas/ Fas ligand signaling plays a critical role in maintaining

immune homeostasis in the periphery.

Recent studies have shown that a mechanism other than Fas/ Fas ligand interaction is

also involved in AICD in T cells. Hildeman et al. showed that lpr and gld mice were

sensitive to T cell death induced by staphylococcal enterotoxin B (SEB), suggesting T

cell death with SEB activation was induced in a Fas/FasL independent manner (Hildeman

et al., 2002). Further, they found that Bcl-2 interacting mediator of cell death (Bim) is

responsible for this apoptosis induced by SEB activation using T cells isolated from Bim

knockout mice. Snow et al. reported that Bim also played an important role in inducing

AICD. They knocked down Bim expression in primary human T cells isolated from

healthy donors and showed that T cells, which lacked Bim expression were rescued from

AICD in vitro (Snow et al., 2008). They further found that T cells derived from ALPS

patients expressed lower level of Bim and the cells were more resistant to AICD in vitro.

Bim is a member of BCL-2 family and BH-3 only protein, which has only one of Bcl-

2 homology region, BH-3. BCL-2 family mediates intrinsic apoptosis associated with

mitochondrial membranes and at least 20 family members have been identified (Gross et

al., 1999). Some of them are constitutively expressed on mitochondrial membrane or

translocate to mitochondria upon stimulation. They are separated into two groups by their

21 function, pro-apoptotic and anti-apoptotic. Anti-apoptotic proteins include BCL-2,

BCL-X and BCL-W. Pro-apoptotic proteins include Bim, BAK, BAD and BAX. Bim

antagonizes BCL-2 which inhibits BAK and BAX pro-apoptotic function by associating

with them (O'Connor et al., 1998). Hence, Bim releases Bak and BAX and leads to

activation of caspase 9 and apoptosis in cells.

Bim expression is regulated at both the transcriptional and the post-transcriptional

level. Bim has three isoforms, Bim EL, Bim L, and Bim S (O'Connor et al., 1998). These

isoforms are produced by alternative splicing and all of them can induce apoptosis. In T

cells, Bim is upregulated upon TCR stimulation through protein kinase C and in a

calcineurin dependent manner (Sandalova et al., 2004).

Bim deficient mice exhibit lymphadenopathy and contain increased number of T

cells and B cells compared to littermate controls (Bouillet et al., 1999). These mice also

develop severe autoimmune disease phenotypes as seen in Fas, Fas ligand mutant mice

(lpr, gld mice), suggesting that Bim also plays a critical role in mediating immune

homeostasis.

Recent studies suggest that Bim and Fas have a complementary effect. Hutcheson et

al. generated mice which lacked expression of both Bim and Fas by crossing lpr and Bim

knockout mice and showed that the mice exhibited much more severe autoimmune

disease phenotype depicted by lymphoadenopahty compared to Bim or Fas single

deficient mice (Hutcheson et al., 2008). These mice accumulated a large number of T

cells and B cells in lymphoid organs and it expanded to half of the animal’s body mass.

These data suggest Bim and Fas pathway has synergistic effect on developing

autoimmune disease.

22

PROPOSED MODEL AND P53 DEPENDENT APOPTOSIS (PICA)

We previously discovered the phenomenon that non-Treg cells undergo apoptosis

when CD4+ and CD8+ T cells are stimulated with plate-bound anti-CD3/anti-CD28

antibodies coated on plastic plate in the presence of IL-2 over 4 days (Singh et al.,

2010a). Activation induced cell death (AICD) is a well known mechanism that causes T

cell apoptosis. Boehme et al. showed that T cell blasts isolated from p53 deficient mice

were sensitive to anti-CD3 antibody induced cell death, suggesting that AICD did not

require p53 expression (Boehme and Lenardo, 1996). p53 is a transcription factor which

is activated upon cellular stresses, including UV damage and inappropriate cell

proliferative signals. p53 regulates cell cycle and other cellular functions (Levine, 1997).

We showed that p53 deficient CD4+ T cells became resistant to apoptosis induced by

plate-bound anti-CD3/anti-CD28 antibody stimulation, suggesting the apoptosis induced

by this stimulation was in a p53 dependent manner and distinguishable from classical

AICD. Hence, we named this novel form of apoptosis caused by plate-bound anti-

CD3/anti-CD28 antibody stimulation “p53-induced CD28-dependent apoptosis” (PICA)

to distinguish it from classical AICD (Singh et al., 2010a). Interestingly, CD4+CD25+

Treg cells were resistant to PICA and selectively expanded under PICA-inducing

conditions while non-Treg cells (CD4+CD25- T cells) underwent massive apoptosis. The

Treg cell number increased 7,000 fold in 7 days under plate-bound anti-CD3/anti-CD28

antibody stimulation.

23 We further showed that PICA was induced in non-Treg cells in a Bim and Fas/

FasL dependent manner due to upregulation of each molecule upon plate-bound anti-

CD3/ anti-CD28 antibody stimulation by using Bim deficient and lpr (Fas mutant) mice.

In contrast, Treg cells suppressed Bim and FasL expression under PICA inducing stimuli.

The p53 deficient mice were also equally susceptible to AICD compared to wild type

mice. On the other hand, accumulated evidence suggests that the lack of p53 expression

in mice leads to earlier onset or exacerbated autoimmune diseases in various mouse

models. Simelyte et al. showed that experimental induced arthritis mice, which lack p53

expression exhibited exacerbated disease symptoms compared to wild type mice

(Simelyte et al., 2005). Okuda et al. used an experimental autoimmune encephalomyelitis

(EAE) model, which showed p53 deficient mice injected with myelin oligodendricyte

glycoprotein developed more severe disease than the wild type control (Okuda et al.,

2003). Zheng et al. reported that p53 deficient mice are more susceptible to streptozocin-

induced diabetes which was used as a model for type I diabetes (Zheng et al., 2005). In

humans, Maas et al. reported that peripheral blood mononuclear cells isolated from

rheumatoid arthritis patients expressed lower level of p53 at the mRNA level compared

to healthy donors in response to gamma-radiation (Maas et al., 2005). These observations

suggest that p53 dependent cell death rather than AICD might be important to maintain

immune homeostasis. However, it is not understood what causes dysregulation in

immune homeostasis and exacerbated autoimmune disease phenotype in p53 deficient

mouse models.

Our in vitro data using plate-bound anti-CD3/anti-CD28 antibody stimulation

showed that p53 dependent apoptosis (PICA) caused apoptosis in non-Treg cells but

24 expand Treg cells, so it was predicted that PICA inducing condition would increase the

ratio of CD4+CD25+ Treg cells to non-Treg cells (CD4+CD25- T cells). Hence, we

propose the model that the differential survival mechanism between Treg cells and non-

Treg cells against PICA is important to balance Treg cells and non-Treg cells thus

maintaining immune homeostasis. Therefore, we herein will determine the differential

survival mechanisms of Treg cells and non-Treg cells using plate-bound anit-CD3/anti-

CD28 antibody stimulation.

25

CHAPTER TWO

MATERIALS AND METHODS

Mice

BALB/c, C57BL/6 and CD4dnTgfbr2 were purchased from Jackson Laboratory (Bar

Harbor, ME). RasGRP1 knockout mice were a gift from Dr. James C Stone (University

of Alberta, Canada). All mice were maintained under specific pathogen-free conditions.

All procedures were approved and monitored by the Institutional Animal Care and Use

Committee of Loyola University Chicago.

Flow cytometry

Fluorochrome-conjugated antibodies specific for Foxp3 (clone FJK-16s) and IL-17A

(clone ebio17B7) (eBioscience, San Diego, CA), anti-CD4 (clone GK1.5) and anti-IL-9

(clone RM9A4) (Biolegend, San Diego, CA), annexin V, 7-aminoactinomycin D (7AAD),

anti-CD25 (7D4), anti-Fas (Jo2) and anti-FasL (MFL3) (BD Biosciences, San Jose, CA)

were used in the experiments. Cells were pelleted by centrifugation at 1,500 rpm for 5 min

at 4°C. 10 µl of culture supernatant from 24G2 hybridoma (FC receptor blocker) was added

and tubes were kept at room temperature for 5min. Cells were then washed with FACS

buffer (1% FCS, 0.1% sodium azide in 1× PBS). Cell surface staining was performed using

26 50 µl of antibodies (1:100 to 1:500 dilution in FACS buffer) for 30 min on ice. After

staining, cells were washed with FACS buffer. For Foxp3 staining, cells were fixed and

permeabilized using FOXP3 Staining Buffer Set (eBiosciences, San Diego, CA) as

described in the manufacture’s protocol. Briefly, cells were washed twice with 1× PBS

after cell surface staining followed by fixation with 300ul of 1× FixPerm buffer overnight

at 4°C. The next day, cells were washed twice with FACS buffer and incubated with 1×

permiabilization buffer for 10 min on ice. Cells were then stained with anti-Foxp3 antibody

(diluted as 1:200) for 1 hour on ice followed by washing with FACS buffer. For annexin V

and 7AAD staining, cells were stained in annexin binding buffer (10 mM HEPES pH7.4,

140 mM NaCl, 2.5 mM CaCl2) with 7AAD (diluted as 1:50) and annexin V (diluted as

1:50) for 15min at room temperature in the dark. Cells were kept on ice after staining and

data was collected within 30min. Data was collected on a flow cytometer (FACS Canto II,

BD Biosciences, San Jose, CA or an Accuri’s C6 flow cytometer, Accuri Cytometers, Ann

Arbor, MI) and analyzed using FlowJo software (TreeStar, Ashland, OR).

Cytokine staining

For intracellular cytokine staining, cells were harvested and restimulated with 50 ng/ml

phorbol 12-myristate 13-acetate (PMA) (Fisher scientific, Pittsburgh, PA) and 1 µM

ionomycin (Sigma-Aldrich, St. Louis, MO) in the presence of 2 µM monencin for 4 hours.

Cells were then washed twice with 1× PBS followed by fixation using 4%

Paraformaldehyde for 10 min at room temperature. Tubes were then filled with FACS

buffer and kept overnight at 4 °C. The next day, cells were washed twice with FACS buffer

27 and permeabilized with 250 µl of permeabilization buffer (containing 50 mM NaCl,

0.02% NaN3, 5mM EDTA, 0.5% TritonX, pH7.5) on ice for 10min. Cells were then washed

twice with FACS buffer and incubated with 250 µl of 3% bovine serum albumin (BSA) for

blocking. Intracellular staining with anti-IL-17 (diluted as 1:400) or anti-IL-9 (diluted as

1:200) antibodies was performed on ice for 1hour followed by washing with FACS buffer.

Data was collected on a flow cytometer (FACS Canto II, BD Biosciences) and analyzed

using FlowJo software (TreeStar, Ashland, OR).

Preparation of CD4+CD25+ Treg cells and CD4+CD25- T cells from the mouse spleen

Splenic CD4+ T cells were purified by depletion of non-CD4+ T cells by the panning

method. Spleens were mashed using the frosted side of glass slides to release cells.

Splenocytes were treated with ACK lysis buffer (Gibco, Grand Island, NY) for 1 min to

remove red blood cells by hypotonic shock. Cells were washed with washing media

(containing 1% FCS in RPMI1640) followed by an incubation with 20% of anti-CD8

(using 3-155 hybridoma culture supernatant) on ice for 30 min. Cells were then washed

twice with washing media. Washed cells were plated on goat anti-mouse immunoglobulin

pre-coated plates and allowed to adhere to plate-bound anti-mouse immunoglobulin for 30

min. Non-adherent cells were collected and this crude fraction of CD4+ T cells was then

resuspended in sorting media (containing 2% FCS, 10mM Hepes, 4.2mM Sodium

bicarbonate in Hanks balanced salt solution, 1× Hank’s buffer) at a concentration of 50×

106 cells/ml and then labeled with fluorochrome-conjugated anti-CD4 and anti-CD25

antibodies on ice for 45min. Cells were then washed with sorting medium. CD4+CD25- T

28 cells /CD4+CD25+ T cells were then sorted using a cell sorter (FACS ARIA, BD

Biosciences, San Jose, CA or MoFlo cell sorter, Beckman Coulter, Brea, CA). Sorted cells

were kept overnight at 4°C in culture media and then used for experiments.

Culture media

RPMI 1640 media supplemented with 10% FCS (Atlanta Biologicals, Lawrenceville,

GA), β-mercaptoethanol (50 µM), glutamine, Hepes (10 mM), sodium pyruvate (1 mM),

and non-essential amino acids (Invitrogen, Grand Island, NY) were used in the

experiments.

Treg cell expansion

Sorted CD4+CD25+ Treg cells resuspended into 5 mls of culture media with10ng/ml of

mouse IL-2 (PeproTech, Rocky Hill, NJ) and were plated in 60 mm petri dishes (USA

scientific, Orlando, FL) pre-coated overnight at room temperature with 2 ml of anti-CD3

(clone 2C11) and anti-CD28 (clone 37-51) (Biolegend, San Diego, CA) antibodies (5µg/ml

each) diluted in 0.1M Borate buffer (pH 8.5). After 4- 5 days of culturing, cells were

scraped from dishes by pipetting and split into newly anti-CD3/ anti-CD-28 pre-coated

dishes (~2.5× 106 cells per plate). Cells were harvested by pipetting after 2-3 days of

culture.

Non-Treg cell (CD4+CD25- T cells) expansion

The anti-CD3/anti-CD28 coated beads were used for stimulation and expansion of

29 CD4+CD25- T cells. 100 µl of 4.5 µmeter polystyrene beads (Polysciences, Inc,

Warrington, PA) (containing ~2.5× 107 beads) were resuspended in 1ml borate buffer

(0.1M Boric acid, pH 8.5) containing anti-CD3 (10 µg/ml) and anti-CD28 (10 µg/ml)

antibodies and kept at room temperature overnight with gentle rocking. The next day, anti-

CD3 and anti-CD28 coated beads were washed three times with borate buffer to remove

unbound antibodies followed by blocking with 10% FCS for 30 min. The anti-CD3/ anti-

CD28 antibodies coated beads were stored in 10% FCS culture medium. Sorted

CD4+CD25- T cells (1× 106 cells) were pelleted and resuspended in 50 µl culture medium

containing 4× 106 pre-coated beads. Cells were then kept in a 37 °C water bath for 45 min

to promote cell-bead contact. After 45 min of cell-beads incubation, cells bound to beads

were then carefully transferred to 2 mls of culture media containing 10 ng/ml of IL-2.

T cell receptor stimulation using biotin-conjugated anti-CD3 antibody cross-linked by

avidin

CD4+CD25- T cells or CD4+CD25+ Treg cells were sorted on FACS Aria and

expanded in vitro for 7 days as described above. After expansion, cells were washed three

times with wash media (RPMI1640 containing 1% FCS) to remove stimulation and then

cultured in 10% FCS complete media in the presence of 1ng/ml IL-2 for overnight. The

next day, cells were resuspended in 10% FCS culture media. 5× 106 cells resuspended in

1ml of 10% FCS culture media were allowed to sit in a 1.5 ml microcentrifuge tube and

warmed for 10min in a 37°C water bath. Cells were then stimulated with 5 µg/ml functional

grade biotin-conjugated anti-CD3 antibody (2C11) (eBioscience, Sandiego, CA) cross-

30 linked by 5 µg/ml avidin egg (calbiochem, EMD Chemicals, Rockland, MA).

T cell stimulation by plate-bound anti-CD3 and anti-CD-28 antibodies

Sorted CD4+CD25+ or CD4+CD25- T cells were placed into 60 mm dishes pre-coated

overnight at room temperature (with 2 ml of anti-CD3, clone 2C11 and anti-CD28, clone

37-51, Biolegend at concentration of 5 µg/ml each in 0.1M borate buffer pH 8.5) containing

5 mls of RPMI culture media in the presence of recombinant IL-2 (10ng/ml). TGF-

β signaling in cell culture was blocked using 5 µg/ml anti-TGF-β 1, 2, 3 antibody (clone

1D11) (R&D Systems, Minneapolis, MN) or 10 µM SB431542 (Sigma-Aldrich�). 2.5 nM of

recombinant human TGF-β (R&D Systems, Minneapolis, MN) was used as an active form

of TGF-β. IL-4 signaling was blocked in cell cultures using 10% 11B11 hybridoma culture

supernatant (which contains anti-IL-4).

Western blot

Equal number of cells was lysed in SDS sample buffer (2% SDS, 125mM DTT, 10%

glycerol, 62.5 mM Tris-HCl, pH 6.8). Cell lysates were then boiled for 10 min and loaded

onto 8-15% SDS PAGE gels. After gel electrophoresis, separated proteins were transferred

overnight onto PVDF membranes (Millipore, Birellica, MA) at 30 V at 4℃. Blotted

membranes were then blocked with 5% skim milk in 1× TBST buffer (containing 20 mM

Tris-Hcl pH6.8, 137 mM NaCl, 0.1% Tween 20) for one hour and probed with antibodies

specific for phospho-ERK (clone E10), phospho-Mek, phospho-cRaf, Bim, Mek (Cell

signaling technology, Danvers, MA), Erk (Millipore, Billerica, MA), Raf 1(clone C-20),

31 RasGRP (clone 199), Fas ligand (kay-10), Sos1 (clone C-23) (Santa Cruz

biotechnology, Santa Cruz, CA), Ras (clone 18/Ras) (BD Biosciences, San Jose, CA), or β-

actin (clone AC15) (Sigma-Aldrich, St. Louis, MO). All antibodies were diluted in dilution

buffer (containing 0.2-5% BSA, 0.1% sodium azide in TBST) for probing. The membranes

were further probed with anti-rabbit or anti-mouse HRP conjugated secondary antibodies

(Cell Signaling Technology). Signals were detected by enhanced chemiluminescence

(ECL) plus western blotting detection reagents (GE Healthcare, Piscataway, NJ).

Enzyme-linked immunosorbent assay (ELISA)

IL-17, IL-4, IFN-γ and IL-9 production was measured by enzyme-linked

immunesorbent assay (ELISA). Purified or biotin conjugated antibodies specific for IL-4

(clone 11B11) (Biolegend, San Diego, CA), IL-4-biotin (clone 13VD6-24G2), IFN-γ (clone

R4-6A2) (eBioscience, San Diego, CA), IFN-γ-biotin (clone XMG1.2) (BD Biosciences,

San Jose, CA) were used in these experiments. Mouse IL-17A ELISA MAXTM Standard

Sets and mouse IL-9 ELISA MAXTM Set Deluxe (Biolegend, San Diego, CA) were used for

detection of IL-17 and IL-9. ELISA for IL-4 and IFN-γ were performed in 96 well flat

bottom ELISA microplates (BD Bioscience) coated with 50 µl of polyclonal anti-IL-4

(1:500) or anti-IFN-γ antibodies (1:500) diluted in bicarbonate buffer (pH8.0) and

incubated overnight at 4°C. Plates were washed the next day using washing buffer

(containing 0.05% Triton× in 1× PBS) to remove unbound antibodies and then incubated

with 50 µl of cell culture supernatants overnight at 4°C. Cell culture supernatant was

removed by washing followed by incubation with biotin-conjugated anti-IL-4 and anti-

32 IFN-γ antibodies for 1 hour at room temperature. Excess antibodies were washed and

plates were incubated with HRP conjugated avidin for 30 min at room temperature

followed by washing wash buffer. Plates were then incubated with 50 µl of 3,3′,5,5′-

tetramethylbenzidine (TMB substrate) (Sigma Aldrich, St. Louis, MO) for a few minutes

and then the enzyme reaction was stopped by adding 50 µl of stopping solution (containing

2M H2SO4). Data was collected on microplate reader, KCjunior (Bio-Tek instruments,

Winooski, VT) using 450 nm wavelength. Serial dilutions of standards were used to

generate a standard curve which was then used to calculate cytokine concentration.

Chromatin Immunoprecipitation (CHIP) Assay

A ChIP assay was performed using a ChIP assay kit (Usb, Cleveland, Ohio) as

described in the manufacture’s protocol with some modifications. CD4+CD25+ Treg cells

were sorted on a FACS Aria and then expanded in vitro for 7 days as described above. 1×

107 Treg cellss were used for each set of experiments. Harvested cells were centrifuged at

1,500 rpm for 5 min at 4°C followed by washing the cell pellet with 10 ml of 1× PBS

(containing 2% FCS). Cells were then resuspended in freshly made 1% formaldehyde in 1×

PBS (containing 2% FCS). Cells were incubated for 15min at room temperature with gentle

rocking thoroughly on rotating shaker platform to promote crosslinking. This was followed

by the addition of glycine to the cells for a final concentration of 0.125M for 5 min at room

temperature to halt crosslinking. Cells were then washed twice with 10 ml of chilled 1×

PBS (containing 2% FCS). Cells were pelleted and frozen in liquid nitrogen quickly and

stored at -80°C for future use or lysed immediately in 1 ml of cell lysis buffer. Cell lysate

33 was sonicated for chromatin fragmentation using Sonifier250 (BRANSON, Fisher

scientific, Pittsburgh, PA). The condition of sonication was optimized to make the

chromatin DNA fragment size between 200 and 800bp. The optimized condition is Duty

cycle 80%, Level 2.5 for 15 sec for 4 sets and Duty cycle 80%, Level 3.0 for 10sec once.

Samples were chilled on ice for 2 min between each cycle. Samples were then centrifuged

at 13,000 rpm at 4°C for 10 min and supernatants were transferred to a new 1.5 ml

microcentrifege tubes. 100 µl of cell lysate (1× 106 cells) was diluted in 500 µl lysis buffer

and pre-cleared by using 50 µl of pre-blocked beads with gentle rocking for 1 hour at 4°C.

Beads were then centrifuged at 3,000 rpm for 5 min at 4°C and the supernatant was

carefully transferred to new 1.5 ml microcentrifuge tube followed by incubation with 4 µg

of rabbit polyclonal anti-Foxp3 antibody (Novus biologicals, Littleton, CO) or polyclonal

rabbit IgG (Cell signaling technology, Danvers, MA) as a negative control overnight at 4°C

with gentle agitation. The next day, samples were centrifuged at 3,000 rpm for 5 min at 4°C

and were washed with 1 ml of lysis buffer for 10 min with gentle rocking followed by

washing with 1 ml of high salt buffer, 1 ml of lithium salt buffer and 1 ml of TE buffer. 120

µl of elution buffer was then added and the samples were incubated for 20 min on a

rotisserie shaker at room temperature. Beads were pelleted by centrifuge at 3,000 rpm for 5

min at room temperature and supernatants were transferred to a new 1.5 ml microcentrifuge

tube. Beads pellets were again resuspended in 120 µl of elution buffer and incubated for 20

min on rotisserie shaker at room temperature. Beads were centrifuged at 3,000 rpm for 5

min at room temperature and supernatants were combined with 1st collection followed by

incubation with 9 µl of 5 M NaCl overnight at 65°C to reverse crosslink. The next day,

34 DNA was purified using QIAquick PCR purification kit (QIAGEN, Valencia, CA) and

eluted using 40 µl of 10 mM Tris-HCl, pH8.5. PCR was performed using TaKaRa ExTaq

(Fisher Scientific) and primer sets (Table 1).

Quantitative RT-PCR

Total RNA was isolated as described in the manufacture’s protocol (Ambion, Applied

Biosystems, Carlsbad, CA). Cells were centrifuged at 3,000 rpm for 5 min at 4°C and lysed

in 500 µl of TRI reagent (Ambion) by pipetting followed by an incubation for 5 min at

room temperature. 200 µl of chroloform was added and the samples were incubated for

10min at room temperature followed by centrifugation at 13,000 rpm for 10 min at 4°C.

The top aqueous phase (~400 µl) was transferred to new tube and mixed with 400 µl of

isopropanol followed by an incubation for 5 min at room temperature. Samples were then

centrifuged at 13,000 rpm for 10 min at 4°C and washed with 500 µl of 70% EtOH. Total

RNA was resuspended in 15-30 µl of RNase free water.

cDNA was synthesized from total RNA using OligodT primers and Superscript III

cDNA synthesis kit (Invitrogen, Grand Island, NY). ~1 µg of total RNA was incubated

with 1 µl of 50 µM oligo (dT) primers and 1 µl of 10 mM dNTP for 5 min at 65°C.

Samples were then chilled on ice for 2 min and incubated with cDNA systhesis mix (1× RT

buffer, 5 mM MgCl2, 10 mM DTT, 40 U RNaseOUT and 200 U SuperScriptIII RT) for 50

min at 50°C. The reaction was then terminated by incubation at 85°C for 5 min and chilled

on ice for 5 min. Remaining RNA was digested by incubation with 1 µl of RNaseH for 20

min at 37°C. cDNA synthesis reaction was stored at -20°C.

35 Realtime PCR was performed using MaximaTM SYBR Green qPCR master mix

(Fermentus, Fisher scientific, Pittsburgh, PA) and primer sets (Table 1).

Measurement of intracellular free calcium

CD4+CD25- T cells or CD4+CD25+ Treg cells were sorted on FACS Aria and expanded

for 7 days as described above. After expansion, cells were washed three times with wash

media (RPMI1640 containing 1% FCS) to stop stimulation and cultured in 10% FCS

culture media in the presence of 1 ng/ml IL-2 overnight. The next day, cells were

resuspended in 10% FCS culture media and loaded with 6 µl of 1 mM Fura-2 AM (at a

final concentration of 6 µM) (Molecular probe, Invitrogen, Grand Island, NY) for 15 min at

37°C in dark. Cells were then washed with 1× Hanks buffer (without calcium) (Gibco,

Invitrogen, Grand Island, NY) to quench excess dye and then resuspended in 1 ml of 1×

Hanks buffer (without calcium). Intracellular free calcium was measured by transferring

cells into a cuvette of a spectrofluorophotometer (RH500, Shimadzu, Columbia, MD) and

the data were calculated at 340 nm/380 nm excitation. First, the spectrofluorophotometer

was paused after monitoring the basal level of [Ca2+] for 60 sec. The

spectrofluorophotometer was then resumed and cells were stimulated with 5 µg/ml

functional grade biotin-conjugated anti-CD3 antibody (2C11, eBioscience, San Diego, CA)

crosslinked by 5 µg/ml avidin egg (calbiochem, EMD chemicals, Philadelphia, PA). Data

were collected for 10 min after stimulation.

Statistical analysis

36 Statistical significance was determined by 2-tailed Student T tests.

37 Table 1. PCR primers RASGRP1 FD

GTCTGAGTTGGTACTGTTCCT

RASGRP1 RV

GGTGAGTCACTCCACAGAGA

BIM FD

AGTGGGTATTTCTCTTTTGACACA

BIM RV

TCAATGCCTTCTCCATACCAGACG-3

HPRT FD

TTGCTGGTGAAAAGGACCTCTCGA

HPRT RV

CCACAGGACTAGAACACCTGCTAA

CHIP RASGRP1 CR1 FD

GGACTTCTGTGAAGATACCTCA

CHIP RASGRP1 CR1 RV

CTCTCTGCACATTGTCATCTGCA

CHIP RASGRP1 CR2 FD

CTTACAGAGCCAGCAACTTGACTT

CHIP RASGRP1 CR2 RV

CTCGCATGTCTAGTACATGGACA

CHIP RASGRP1 CR3 FD

ACAGAGCCAGCAACTTGACTT

CHIP RASGRP1 CR3 RV

CATGGACAGTAACCAAGGCAGCAA

CHIP RASGRP1 CR4 FD

CAGGCAGAGCTCAGTCTGGGCCA

CHIP RASGRP1 CR4 RV

GTGCCAGCAGACCTGGCCAAGA

38

CHAPTER THREE

EXPERIMENTAL RESULTS

Proximal T cell receptor (TCR) signaling in CD4+CD25+Treg cells and CD4+CD25-T cells

Since CD4+CD25+ Treg cells but not non-Treg cells (CD4+CD25- T cells) survive

PICA inducing conditions, it is expected that CD4+CD25+ Treg cells respond to plate-

bound anti-CD3/anti-CD28 antibody stimulation differently compared to non-Treg cells. In

plate-bound anti-CD3/anti-CD28 antibody stimulation, immobilized (plate-bound) anti-

CD3 antibody activates TCR signaling and immobilized anti-CD28 antibody activates

CD28 costimulatory signaling. Although CD28 costimulatory signaling is required for full

activation of T cells, the main T cell activation signaling is mediated through TCR.

Therefore, we hypothesized that proximal TCR signaling might be altered in CD4+CD25+

Treg cells, thus becoming resistant to PICA. To study TCR signaling in CD4+CD25+ Treg

cells, we decided to take a biochemical approach. It has been challenging to obtain enough

Treg cells to perform signaling studies for two reasons. First, CD4+CD25+ Treg cells are

madeup only 5-10% of CD4+ T cells in humans and mice. Second, commonly used bead-

bound anti-CD3/anti-CD28 antibody stimulation or irradiated antigen presenting cells

(APC) with anti-CD3 stimulation have difficulties expanding pure populations of

CD4+CD25+ Treg cells, because a small number of contaminated non-Treg cells can expand

39

Fig. 1 Western blot analysis of Foxp3 expression in ex vivo expanded CD4+CD25+

Treg cells and non-Treg cells. CD4+CD25+ Treg cells or CD4+CD25- T cells were

isolated from the spleen of BALB/c mice. CD4+CD25+ Treg cells were stimulated and

expanded with plate-bound anti-CD3/anti-CD28 antibodies in the presence of IL-2.

CD4+CD25- T cells were stimulated with bead-bound anti-CD3/anti-CD28 antibodies in

the presence of IL-2. Cells were harvested at day 7 and rested for overnight without anti-

CD3/ anti-CD28 antibody stimulation. Cells were then directly lysed into SDS sample

buffer and subjected for western blot analysis using anti-Foxp3 and anti-β actin (for

loading control) antibodies

40

41 Fig. 2 Western blot analysis of proximal TCR signaling molecules in in ex vivo

expanded CD4+CD25+ Tregs and non-Tregs (CD4+CD25- T cells) upon TCR

activation. Ex vivo expanded CD4+CD25+ Tregs or non-Tregs (CD4+CD25- T cells)

isolated from the spleen of BALB/c mice were stimulated with biotin-conjugated anti-

CD3 crosslinked with avidin for 15, 30 min. Cells were then directly lysed into SDS

sample buffer and subjected for western blot analysis using anti-phospho-LCK (tyrosine

394), anto-phospho-LCK (tyrosine 505), anti-LCK, anti-TCRζ (A), and phopho-tyrosine

(B) antibodies. Phosphotyrosine levels of some proteins indicated with arrows were

downregulated in Treg cells compared to non-Treg cells. In contrast, bands indicated with

asterisks were detected at higher levels in Treg cells.

42 faster than Treg cells and take over the culture. Hence, until now, proximal TCR

signaling in Treg cells has not been well understood. We discovered the phenomenon that

Treg cells can expand more than 7,000 fold under plate-bound anti-CD3/ anti-CD28

antibody stimulation while non-Treg cells undergo massive apoptosis. By taking advantage

of this plate-bound anti-CD3/anti-CD28 antibody stimulation system, we expanded

electronically sorted CD4+CD25+ Treg cells for 7 days and examined TCR signaling. Since

non-Treg cells (CD4+CD25- T cells) undergo apoptosis under plate-bound anti-CD3/anti-

CD28 antibody stimulation, we expanded non-Treg cells with bead-bound anti-CD3/anti-

CD28 antibody stimulation for 7 days as a control. After 7 days, both Treg cells and non-

Treg cells were removed from stimulations and rested overnight to examine short term

TCR stimulation effect in Treg cells. First, we examined Foxp3 expression levels in ex vivo

expanded Treg cells by western blot. Expanded Treg cells expressed high levels of Foxp3

while non-Treg cells had very low levels of Foxp3, suggesting that Foxp3+ Treg cells were

successfully expanded (Fig. 1). Although expanded CD4+CD25- T cells also showed a faint

Foxp3 band, this could be a small contamination of Foxp3+ Treg cells. Previously, we

reported that the amount of Foxp3+ Treg cells was over 95% after 7 days of plate-bound

anti-CD3/anti-CD28 antibody stimulation using flow cytometry analysis (Singh et al.,

2010).

To determine if proximal TCR signaling is altered in Treg cells compared to non-Treg

cells, ex vivo expanded CD4+CD25+ Treg cells or non-Treg cells (CD4+CD25- T cells) were

stimulated with biotinylated anti-CD3 antibody cross-linked with avidin. Cells were then

harvested for western blot after 15 or 30 min of stimulation. The signaling events following

43 TCR activation are depicted by the activation of kinases and phosphorylation of

tyrosine residues. First, TCR activation leads to phosphorylation of the Src family tyrosine

kinase, LCK, followed by phosphorylation of immunoreceptor tyrosine-based activation

motifs (ITAMs) on the TCRζ chain. ZAP70 then binds to phosphorylated ITAMs on the

TCRζ chain leading to the activation of downstream signaling (Iwashima et al., 1994;

Straus et al., 1996). Therefore, we determined activation and expression levels of these

molecules in Treg cells compared to non-Treg cells. Treg cells expressed comparable

amounts of LCK compared to non-Treg cells and phosphorylation level of LCK residue

394, 505 stayed at basal levels even after stimulation in both Treg cells and non-Treg cells

(Fig. 2A). In contrast, TCRζ expression was substantially reduced in Treg cells compared

to non-Treg cells (Fig. 2A). Total phosphotyrosine levels were also altered in Treg cells

(Fig. 2B). Phosphotyrosine levels of some proteins indicated with arrows were

downregulated in Treg cells compred to non-Treg cells. In contrast, bands indicated with

asterisks were detected at higher levels in Treg cells compared to non-Treg cells. These

data suggest that proximal TCR signaling in Treg cells is mediated differently compared to

non-Tregs.

Next, we next focused on the downstream signaling cascade of Zap70 and assessed

activation of the major signaling pathways downstream of TCR signaling, the Ras-Erk

pathway. Surprisingly phosphorylation of Erk was significantly reduced in Tregs and

barely detectable while non-Treg cells showed strong activation of Erk after 15 or 30min

after TCR stimulation (Fig. 3A). Further, upstream of the Erk signaling cascade, Mek and

cRaf, also showed substantially reduced levels of phosphorylation while total protein

44

45 Fig. 3 Western blot analysis of proximal TCR signaling, Ras-Erk pathway in ex

vivo expanded CD4+CD25+ Treg cells and non-Treg cells (CD4+CD25- T cells) upon

TCR activation. Ex vivo expanded CD4+CD25+ Treg cells or non-Treg cells

(CD4+CD25- T cells) isolated from the spleen of BALB/c mice were stimulated with

biotin-conjugated anti-CD3 crosslinked with avidin for 15, 30 min. Cells were then

directly lysed into SDS sample buffer and subjected for western blot analysis using anti-

phopho-Erk, anti-Erk, anti-phospho-Mek, anti-Mek, anti-phospho-cRaf, anti-cRaf (A),

anti-Ras, anti-RasGRP1 and SOS (B) antibodies.

46 expression was comparable in Treg cells compared to non-Treg cells (Fig. 3A). These

data suggest Ras-Erk signaling activity in response to TCR stimulation is substantially

blocked in Treg cells compared to non-Treg cells though Ras expression was equal between

Treg cells and non-Treg cells.

In T cells, Ras activity is controlled by two Ras activators, RasGRP and SOS. Since

Ras-Erk pathway is significantly blocked in Treg cells, expression of Ras activators might

be altered in Treg cells. We then sought to determine the expression of RasGRP1 and SOS

in Treg cells compared to non-Treg cells. As we expected, RasGRP1 expression was

substantially reduced in Treg cells compared to non-Treg cells (Fig 3B). SOS expression

was also slightly reduced in Treg cells. These data suggest that the blockade of Erk

signaling might be due to reduced expression of RasGRP1 and SOS.

Next, we next monitored the mobilization of intracellular calcium in Treg cells.

Calcium signaling is another major proximal TCR signaling pathway. LAT, which is a

substrate of ZAP70, recruits and activates phospholipaseC γ (PLC γ) (Nishibe et al., 1990).

PLC γ then leads to the production of IP3 leading to the mobilization of intracellular

calcium (Crabtree, 1999). In non-Treg cells (CD4+CD25- T cells), phosphorylation of PLCγ

increased in response to TCR stimulation. In contrast, Tregs showed higher basal level of

PLCγ activation compared to non-Treg cells. Interstingly, the level of

PLCγ phosphorylation decreased after TCR stimulation in Treg cells. The total expression

of PLCγ was comparable between Treg cells and non-Treg cells (Fig 4A).

We then assessed calcium levels in response to TCR stimulation in Treg cells

compared to non-Treg cells. As described above, Treg cells and non-Treg cells were

47

48 Fig. 4 Calcium signaling in in ex vivo expanded CD4+CD25+ Treg cells and non-

Treg cells (CD4+CD25- T cells) upon TCR activation. (A) Ex vivo expanded

CD4+CD25+ Treg cells or non-Treg cells (CD4+CD25- T cells) isolated from the spleen of

BALB/c mice were stimulated with biotin-conjugated anti-CD3 cross-linked with avidin

for 15, 30 min. Cells were then directly lysed into SDS sample buffer and subjected for

western blot analysis using anti-phospho-PLC γ and anti-PLC γ antibodies. (B) Ex vivo

expanded CD4+CD25+ Treg cells or non-Treg cells (CD4+CD25- T cells) isolated from the

spleen of C57BL/6 mice were laoded with Fura2-AM and stimulated with biotin-

conjugated anti-CD3 cross-linked with avidin. Intracellular calcium level was determined

by the ratio between emission fluorescence intensities at 340nm and 380nm.

49 expanded and rested overnight. Cells loaded Fura-2-AM were stimulated with avidin

crosslinked anti-CD3 and calcium mobilization in these cells was assessed. In response to

TCR stimulation, the elevation of intracellular calcium concentration, [Ca2+] was observed

in both Treg cells and non-Treg cells. However, the [Ca2+] in Treg cells reached to a much

lower peak compared to non-Treg cells and declined to basal level. These data suggest that

calcium signaling is also altered in Treg cells. Altogether, data above indicate that proximal

TCR signaling is highly impaired in Treg cells compared to non-Treg cells.

Lack of RasGRP1 expression rescues non-Treg cells from PICA

We have demonstrated that proximal TCR signaling is drastically altered in

CD4+CD25+ Treg cells compared to non-Treg cells (CD4+ CD25- T cells). This difference

may be the key that renders Treg cells resistant to PICA and the reason why the same

plate-bound anti-CD3/CD28 antibody stimulation leads to different outcomes for

CD4+CD25+ Treg cells and non-Treg cells (CD4+CD25- T cells), either survival or death.

The most drastic differences in CD4+CD25+Treg cells were downregulation of RasGRP1

and the blockade of its down stream Ras-Erk activity in response to TCR stimulation.

RasGRP1 transmits the TCR activation signal to Ras by converting the Ras-GDP bound

form to the active Ras-GTP binding form. Whereas there are two Ras activators in T

cells, SOS and RasGRP1, Roose et al. demonstrated that RasGRP1 dominantly controls

Erk activation in response to TCR stimulation (Roose et al., 2005). Further, Dower et al.

showed that TCR dependent Erk activation is impaired in RasGRP1 deficient thymocytes

(Dower et al., 2000). Hence, it is expected that the Ras-Erk pathway is unresponsive

50 during TCR activation in Treg cells because of the downregulation of RasGRP1. Ras-

Erk signaling is highly conserved among vertebrates and plays crucial roles in

determining cellular physiology such as cell survival, proliferation and differentiation

(Ramos, 2008). In the case of T cells, Erk signaling plays an important role in thymic

positive and negative selection (Bommhardt et al., 2000; Daniels et al., 2006;

Mariathasan et al., 2001; Werlen et al., 2003). Whereas it is well studied that Erk

activation is important for cell survival, Martin et al. reported that sustained Erk signaling

promotes cell death using multiple cell types including the human lymphoblastoid Boleth

cell line (Martin et al., 2006). Therefore, we focused on RasGRP1 expression in

CD4+CD25+ Treg cells and non-Treg cells (CD4+CD25- T cells) and its down stream

Ras/Erk pathway. We hypothesized that the downregulation of RasGRP1 expression in

CD4+CD25+ Treg cells might be important for cell survival under PICA inducing

condition, plate-bound anti-CD3/anti-CD28 antibody stimulation. In other words,

CD4+CD25- T cells might undergo apoptosis in a RasGRP1/ Ras/ Erk signaling dependent

manner under PICA inducing conditions. To test our hypothesis, we used RasGRP1

knockout mice, which exhibit abnormal T cell development in the thymus due to

impaired positive selection (Dower et al., 2000). These mice develop autoimmune

disorders. These mice exhibit splenomegaly and enlarged spleens contain higher number

of CD4+ T cells whereas fewer numbers of CD4+CD25+ Treg cells in the periphery (Chen

et al., 2008). The rationale of this experiment is if the downregulation of RasGRP1 is

important for CD4+CD25+ Treg cell survival under plate-bound anti-CD3/atni-CD28

antibody stimulation, then RasGRP1 deficient CD4+CD25- T cells would also become

51

Fig. 5 The lack of RasGRP1 expression rescues non-Tregs from PICA. CD4+CD25-

T cells isolated from the spleen of RasGRP1 knockout mice (RasGRP-/-) or littermate

control (Wt) were stimulated with anti-CD3/anti-CD28 antibodies. Cells were harvested

at day 4. (A) Total number of live cells was determined. (B) Cells were stained with

annexin V and analyzed by flow cytometry.

52

Fig. 6 Effect of RasGRP1 expression on Erk activity by CD4+CD25- T cells under

plate-bound anti-CD3/anti-CD28 antibody stimulation. CD4+CD25- T cells isolated

from the spleen of RasGRP1 knockout mice (KO) or littermate control (WT) were

stimulated with plate-bound anti-CD3/anti-CD28 antibodies supplemented with IL-2.

Cells were harvested at day 3. Cells were lysed into SDS sample buffer and subjected for

western blot analysis using anti-phopho-Erk, anti-Erk and anti-β actin (for loading

control) antibodies.

53 resistant to PICA as wild type CD4+CD25+ Tregs do. To address this question, we

cultured electronically sorted CD4+CD25- T cells isolated from the spleen of RasGRP1

knockout mice or littermate control with plate-bound anti-CD3/anti-CD28 antibody

stimulation. After 4 days of stimulation, cells were harvested and cell viability was

assessed by flow cytometry analysis. As expected, cells isolated from wild type

littermates underwent massive apoptosis and over 80% of the cells became annexinV+

(Fig. 5A). In contrast, RasGRP1 deficient cells isolated from the spleen of RasGRP1

knockout mice showed a substantial decrease in the percentage of annexinV+ cells (37%)

(Fig. 5A). The total live cell number of wild type CD4+CD25- T cells decreased 30 fold

from day 0 (Fig. 5B). In contrast, the total live cell number of RasGRP1 deficient

CD4+CD25- T cells increased 4 fold from day 0. These data suggest that non-Treg cells

(CD4+CD25- T cells), which lack RasGRP1 expression avoid apoptosis and expand under

PICA inducing condition with plate-bound anti-CD3/anti-CD28 antibodies. We then

determined whether Erk activation is impaired in RasGRP1 deficient CD4+CD25- T cells

under PICA inducing condition. To address this question, we cultured electronically

sorted CD4+CD25- T cells isolated from the spleen of RasGRP1 knockout mice or

littermate control mice with plate-bound anti-CD3/anti-CD28 antibody stimulation. After

3 days of culturing, cells were harvested and lysed in SDS sample buffer. Erk activation,

determined by levels of phosphorylated Erk, was assessed by western blot analysis.

Phosphorylation of Erk was observed from wild type cells, but Erk activation was barely

detectable from RasGRP1 deficient cells, suggesting that RasGRP1 deficient cells

54 exhibited impaired Erk activity in response to plate-bound anti-CD3/ anti-CD28

antibody stimulation (Fig. 6).

Lack of RasGRP1 expression downregulates Bim expression

It is now clear that the lack of RasGRP1 expression renders CD4+ T cells resistant to

apoptosis and its downstream Erk activity is impaired in the absence of RasGRP1 under

PICA inducing condition. We next sought to determine how lack of RasGRP1 expression

changes the fate of non-Tregs from death to survival under PICA inducing stimuli. T cell

apoptosis is mainly mediated by two different pathways, Fas and Bim (Hutcheson et al.,

2008). Fas belongs to the death receptor, Tumor necrosis factor (TNF) receptor family. The

Fas/Fas ligand interaction induces activation of caspase 8 through the formation of the

death inducing signaling complex (Kischkel et al., 1995). Cell surface expression of Fas is

highly upregulated upon TCR stimulation. Bim belongs to the Bcl-2 family and initiates

apoptosis via the intrinsic pathway by activating caspase 9. Both Fas and Bim are crutial for

maintaining cell homeostasis. We previously reported that CD4+CD25- T cells isolated

from Bim knockout mice or lpr mice which lack functional Fas ligand are resistant to PICA

and are able to survive and expand under plate-bound anti-CD3/anti-CD28 antibody

stimulation (Singh et al., 2010). These data indicate that PICA is induced in a both Bim and

Fas/FasL dependent manner. Further, the cell surface expression of FasL/Fas and Bim were

substantially upregulated when non-Treg cells were stimulated with plate-bound anti-

CD3/anti-CD28 antibodies. In contrast, Treg cells did not exhibit increased expression of

those proapoptotic proteins and kept basal level of Bim and Fas ligand cell surface

55

Fig. 7 Effect of RasGRP1 expression on apoptotic protein expression by CD4+CD25-

T cells under plate-bound anti-CD3/anti-CD28 antibody stimulation. CD4+CD25- T

cells isolated from the spleen of RasGRP1 knockout mice (KO) or littermate control

(WT) were stimulated with plate-bound anti-CD3/anti-CD28 antibodies. Cells were lysed

in SDS sample buffer at day 3 and subjected for western blot analysis using anti-Bim,

anti-Fas ligand and anti-β actin (for loading control) antibodies. EL and L forms of Bim

are indicated with arrowheads. Membrane-bound and soluble forms of Fas ligand are

indicated with arrowheads.

56 expression under plate-bound anti-CD3/anti-CD28 antibody stimulation. To determine

if the lack of RasGRP1 expression in CD4+CD25- T cells blocks upregulation of Bim and

Fas/ FasL, we cultured electronically sorted CD4+CD25- T cells isolated from the spleen of

RasGRP1 knockout mice or littermate control under plate-bound anti-CD3/anti-CD28

antibody stimulation. After 3 days, cells were harvested and lysed in SDS sample buffer.

Bim, Fas and Fas ligand expression were assessed by western blot analysis. At day 3, wild

type cells exhibited increased Bim expression compared to unstimulated cells. In contrast,

RasGRP1 deficient cells expressed basal levels of Bim after stimulation (Fig. 7A).

Unstimulated cells also showed lower Bim expression compared to wild type cells. Fas

ligand expression was increased in both RasGRP1 knockout cells and wild type cells,

suggesting there is no effect of RasGRP1 on FasL expression (Fig. 7B). These data suggest

that upregulation of Bim under plate-bound anti-CD3/anti-CD28 antibody stimulation is in

a RasGRP1 expression dependent manner.

Regulation of RasGRP1 expression in CD4+ T cells

The data above indicate that the level of RasGRP1 expression correlates with CD4+ T

cell fate of death or survival. As described in Fig. 3B, we demonstrated that Treg cells

substantially downregulate RasGRP1 expression compared to non-Treg cells. This

experiment was done using ex vivo-expanded cells to obtain enough CD4+CD25+ Treg cells

for western blot analysis. Since it is not understood how the rasgrp1 gene is regulated in

response to TCR stimulation, we next compared the RasGRP1 expression levels in freshly

isolated cells and activated state of CD4+CD25+ Treg cells/ CD4+CD25- T cells.

57

Fig. 8 Western blot analysis of RasGRP1 expression on CD4+CD25+ Treg cells and

CD4+CD25- T cells. CD4+CD25+ Treg cells or CD4+CD25- T cells were isolated from

the spleen of BALB/c mice. CD4+CD25+ Treg cells were stimulated and expanded with

plate-bound anti-CD3/anti-CD28 antibodies in the presence of IL-2. CD4+CD25- T cells

were stimulated with bead-bound anti-CD3/anti-CD28 antibodies in the presence of IL-2.

Cells were harvested at day 0 or day 7. Cells were then lysed into SDS sample buffer and

subjected for western blot analysis using anti-RasGRP1 and anti-β actin (for loading

control) antibodies.

58

Fig. 9 The rasgrp1 gene expression in CD4+CD25+ Treg cells and CD4+CD25- T cells.

CD4+CD25+ Treg cells or CD4+CD25- T cells were isolated from the spleen of BALB/c

mice. CD4+CD25+ Treg cells were stimulated and expanded with plate-bound anti-

CD3/anti-CD28 antibodies in the presence of IL-2. CD4+CD25- T cells were stimulated

with bead-bound anti-CD3/anti-CD28 antibodies in the presence of IL-2. Cells were

harvested at day 7 and total RNA was isolated for real time PCR. * p<0.05

59 Electronically sorted CD4+CD25+ Treg cells were stimulated with plate-bound anti-

CD3/CD28 antibodies. FACS sorted CD4+CD25- T cells were stimulated with bead-bound

anti-CD3/anti-CD28 antibodies. Cells were harvested at day 0 and day 7 and lysed in SDS

sample buffer. RasGRP1 expression was assessed by western blot analysis. If RasGRP1

expression changes in response to TCR stimulation, then we would expect to see different

expression patterns from freshly isolated cells compared to activated cells. Surprisingly,

both CD4+CD25+ Treg cells and non-Treg cells (CD4+CD25- T cells) expressed comparable

levels of RasGRP1 at day 0 (unstimulated) (Fig. 8A). After 7 days of in vitro stimulation,

non-Treg cells showed a substantial increase of RasGRP1 expression from basal level,

while CD4+CD25+ Treg cells slightly downregulated RasGRP1 expression. These data

indicate that large differences of RasGRP1 expression previously observed between

CD4+CD25+ Treg cells and non-Treg cells was due to upregulation of RasGRP1 in non-

Treg cells in response to TCR stimulation, since freshly isolated cells (unstimulated cells)

showed basal levels of RasGRP1 expression in both Treg cells and non-Treg cells. To

determine if reduced expression of RasGRP1 in Treg cells is regulated at the transcriptional

level, we isolated RNA from in vitro expanded CD4+CD25+ Treg cells or CD4+CD25- T

cells and performed quantitative PCR (Fig. 9). At day 7, non-Treg cells expressed higher

amount of rasgrp1 compared to Treg cells, suggesting that reduced RasGRP1 expression in

Treg cells is mediated by transcriptional regulation.

CD4+CD25- T cells can be differentiated into Foxp3+ Treg cells (inducible Treg cells) in

the periphery when TGF-β is present (Chen et al., 2003; Wan and Flavell, 2005). Next, we

determined if inducible Tregs also downregulate RasGRP1 expression under TCR

60

Fig. 10 RasGRP1 expression by CD4+CD25- T cells in iTreg cell polarizing

condition. CD4+CD25- T cells isolated from the spleen of C57BL/6 mice were

stimulated with plate-bound anti-CD3 and soluble anti-CD28 antibodies. Cells were

harvested at day 0, 1, 3, 4 and 7. Cells were lysed into SDS sample buffer and subjected

for western blot analysis using anti-RasGRP1, anti-Foxp3 and anti-β actin antibodies.

61 stimulation. To address this question, electronically sorted CD4+CD25- T cells were

stimulated with plate-bound anti-CD3 plus soluble anti-CD28 antibodies in the presence or

absence of TGF-β. Stimulation with plate-bound anti-CD3 plus soluble anti-CD28 in the

presence of TGF-β has previously been in reported as iTreg cell polarizing conditions

(Fantini et al., 2007). After 1, 3, 5 or 7 days of culturing, cells were lysed in SDS sample

buffer. RasGRP1 expression and Foxp3 expression were assessed by western blot analysis.

In the absence of TGF-β, no Foxp3 induction occurred while RasGRP1 expression

gradually increased with the highest peak observed at day 7 (Fig. 10). In contrast, cells

stimulated in the presence of TGF-β started to express Foxp3 after one day of stimulation

and gradually increased its expression level with longer activation, suggesting that cells

differentiated into iTreg cells. Although increased expression of Foxp3 expression is either

due to an increase of Foxp3 expression per cell or an increase in the proportion of Foxp3+ T

cells, RasGRP1 expression was inversely correlated to Foxp3 expression and was reduced

from basal level. As Foxp3 expression increased, RasGRP1 expression reduced in the

presence of TGF-β suggesting that iTreg cells also downregulated expression of RasGRP1.

Foxp3 directly associate with rasgrp1 gene

We next determined by which mechanism CD4+CD25+ Treg cells downregulate

RasGRP1 expression. As we described in Fig. 9, downregulation of rasgrp1 is mediated at

the transcriptional level. Further, we showed that RasGRP1 expression was reciprocally

correlated with Foxp3 expression in the iTreg cell induction model (Fig. 10). Foxp3 is a

transcription factor recognized as the most descriptive marker of Tregs and expressed by

62

63 Fig. 11 Foxp3 interaction with rasgrp1 gene in CD4+CD25+ Treg cells. (A)

Forkhead consensus sequences were found in rasgrp1 promoter region indicated with red

ellipses. CR1, 2, 3, 4 and 5 are regions amplified by PCR. (B) Expanded CD4+CD25+

Treg cells isolated from the spleen of C57BL/6 mice were lysed and cross-linked for

ChIP assay. DNA was extracted from precipitated samples for PCR primer sets which

amplify forkhead consensus regions from rasgrp1 promoter.

64 both nTreg cells and iTreg cells in mice. Foxp3 negatively or positively controls many

genes which are related to Treg functions. Overexpression of Foxp3 is sufficient to make T

cells suppressive function (Hori et al., 2003). Therefore, we hypothesized that Foxp3 might

downregulate rasgrp1 expression by directly associating with the rasgrp1 transcription

control region. To address this question, we determined if Foxp3 associates with the

transcription control region of rasgrp1. Foxp3 belongs to the fork head family that binds to

fork head consensus TRTTKW as previously reported (Overdier et al., 1994). Therefore,

we first searched if there are any forkhead consensus sequences upstream of rasgrp1 from

the transcription starting site. We found that there are 4 potential Foxp3 binding sites up to

4 kb upstream of the rasgrp1 gene (Fig. 11A). To determine if Foxp3 binds to these

forkhead consensuses which exist upstream of the rasgrp1 transcription starting site, we

designed the primers to amplify these regions and performed a ChIP assay. Expanded Treg

cells were lysed and cross-linked. Cell lysates were precipitated using anti-Foxp3 antibody

or an isotype control antibody. If Foxp3 binds to upstream of the rasgrp1 transcription

starting site, we would expect to see that DNA fragment precipitated with Foxp3 and

amplified by PCR reaction. Among the Foxp3 antibody precipitated samples, only the CR1

and CR2 primer sets amplified clearly detectable bands (Fig. 11B). Since no bands were

detected from isotype precipitated samples, these data suggest that Foxp3 directly

associates with the rasgrp1 gene and possibly downregulates rasgrp1 transcription in Treg

cells.

65 TGF-β signaling in CD4+ T cells and PICA

The data above focused on the difference of proximal TCR signaling between

CD4+CD25+ Treg cells and other non-Treg cells (CD4+CD25- T cells) and found that Ras

guanyl nucleotide exchange protein 1 (RasGRP1) is downregulated in CD4+CD25+ Treg

cells compared to other CD4+ T cells. Further, we showed RasGRP1 expression in non-

Treg cells (CD4+CD25- T cells) is critical to promote apoptosis under PICA inducing

condition stimulated with plate-bound anti-CD3/ anti-CD28 antibody. Altogether, these

data indicate that downregulation of RasGRP1 in CD4+CD25+ Treg cells might be one of

the survival mechanisms against apoptosis under plate-bound anti-CD3/anti-CD28

antibody stimulation.

Is downregulation of RasGRP1 in CD4+CD25+ Treg cells the only mechanism to

control cell survival? Next, we focused on the downstream events of proximal TCR

signaling, which includes cytokine production. CD4+ T cells produce a variety of

cytokines such as IL-2, IL-4 and IFN-γ in response to TCR stimulation along with CD28

co-stimulation. TGF-β is a pleiotropic cytokine, which is also produced by CD4+ T cells

and influences cell proliferation, apoptosis and differentiation (Chang et al., 2003;

Conery et al., 2004; Jung et al., 2004; Murillo et al., 2005; Sillett et al., 2001). TGF-β is

secreted in an inactive form by noncovalently attaching to latency associated peptide

(LAP) (Li and Flavell, 2008). Nakamura et al. reported that CD4+CD25+ Treg cells

produce more TGF-β compared to other CD4+ effector T cells (Nakamura et al., 2001).

Furthermore, CD4+CD25+ Treg cells but not other CD4+ effector T cells (CD4+CD25- T

cells) express TGF-β on their surface by interacting with LAP and anchor protein, GARP

66

Fig. 12 Effect on TGF-β signaling blockade on PICA of CD4+CD25+ Treg cells.

CD4+CD25+ Treg cells isolated from the spleen of C57BL/6 mice were stimulated with

plate-bound anti-CD3/anti-CD28 antibodies in the presence or absence of SB431542

(TGF-β super-family type I receptor kinase inhibitor) or anti-TGF-β antibody in media

supplemented with IL-2. (A) Cells were harvested at day 3 and total number of live cells

was determined. (B) At day 3, cells were stained with annexin V and analyzed by flow

cytometry. ** p< 0.01

67 (Glycoprotein A repetitions predominant) (Tran et al., 2009). Surface bound TGF-β on

CD4+CD25+ Treg cells exerts a suppressive function toward effector T cells (Nakamura

et al., 2001). Although it is not well understood if there are any other specific roles of

surface bound TGF-β, there are clear differences about TGF-β production and its

expression style between CD4+CD25+ Treg cells and other CD4+ effector T cells. Hence

we hypothesized that there is more active TGF-β signaling in Treg cells and that might be

important for CD4+CD25+ Treg cell survival under PICA inducing condition, plate-bound

anti-CD3/anti-CD28 antibody stimulation. To test our hypothesis, we first determined if

TGF-β signaling is required for the survival of Treg cells. To inhibit TGF-β signaling in

Treg cells, we used a TGF-β super-family type I receptor kinase inhibitor (SB431542) or

a TGF-β neutralizing antibody. SB431542 is a small molecule inhibitor that blocks TGF-

β type I receptor serine/threonine kinase activity by competing with the ATP binding site

of its kinase. TGF-β neutralizing antibody binds to TGF-β thus blocking TGF-β

association with the TGF-β receptor. Purified CD4+CD25+ Treg cells were stimulated

with plate-bound anti-CD3/anti-CD28 antibodies in the presence of TGF-β signaling

inhibitor (SB431542) or anti-TGF-β neutralizing antibody (anti-TGF-β-1, 2, 3 antibody).

If TGF-β signaling is important for CD4+CD25+ Treg cell survival, we would expect to

see that CD4+CD25+ Treg cells inhibited TGF-β signaling would undergo apoptosis under

plate-bound anti-CD3/anti-CD28 antibody stimulation. After three days of stimulation,

cells were harvested and analyzed by flow cytometry. CD4+CD25+ Treg cells expanded

~2 fold compared to the starting cell number (Fig. 12A). When TGF-β super-family type

68

Fig. 13 Effect of TGF-β signaling blockade on PICA of CD4+CD25+ Treg cells.

CD4+CD25+ Treg cells isolated from the spleen of dnTgfbr2mice or wildtype littermate

control were stimulated with plate-bound anti-CD3/anti-CD28 antibodies. (A) Cells were

harvested at day 3 and total number of live cells was determined. (B) At day 3, cells were

stained with annexin V and analyzed by flow cytometry. **p< 0.01

69 I receptor kinase inhibitor (SB431542) was added, cell growth was substantially

blocked and the cell number decreased approximately 5 fold. Similarly, when

CD4+CD25+ Treg cells were treated with anti-TGF-β antibody, live cell number

decreased substantially compared to the starting number (Fig. 12A). Flow cytometric

analysis showed that this decrease in cell numbers corresponds to an increase in annexin

V+ apoptotic/dead cell frequency (Fig. 12B). These data suggest that TGF-β signaling in

CD4+CD25+ Tregs is critical for cell survival under PICA inducing condition, stimulation

with plate-bound anti-CD3/ anti-CD28 antibodies.

To further confirm these results, we examined PICA resistance by CD4+CD25+ Treg

cells isolated from transgenic mice expressing a dominant-negative form of TGF-β receptor

type II under the control of mouse CD4 promoter (CD4dnTgfbr2). These mice have a

normal level of Foxp3+CD4+CD25+ Treg cells (~8 weeks old) although TGF-β receptor

signaling is substantially blocked in T cells. We isolated splenic CD4+CD25+ Treg cells

from CD4dnTgfbr2 mice or their wild type littermate control and stimulated them with

plate-bound anti-CD3/anti-CD28 antibodies in the presence of IL-2. After 3 days of

culture, we harvested cells and assessed their survival (Fig. 13A). While the number of

wild type littermate Treg cells increased from day 0, the number of CD4dnTgfbr2 Treg cells

was less than 10% of the control and decreased compared to the starting cell number. As

observed with the chemical inhibitor of TGF-β signaling and TGF-β neutralizing antibody,

the frequency of annexinV+ cells were about 2 fold higher in CD4dnTgfbr2 T cell culture

compared to that of the littermate control (Fig. 13B). Since we did not add exogenous

TGF-β to the culture, the data strongly suggest that CD4+CD25+ Treg cells provide TGF-

70

Fig. 14 Effect of TGF-β on PICA by CD4+CD25- T cells. CD4+CD25- T cells isolated

from the spleen of C57BL/6 mice were stimulated with plate-bound anti-CD3/anti-CD28

antibodies in the presence or absence of recombinant TGF-β in media supplemented with

IL-2. (A) Cells were harvested at day 3 and stained with annexin V for flow cytometry

analysis. (B) Total number of live cells was determined at day 3. **p< 0.01

71 β in an autocrine manner to maintain CD4+CD25+ Treg cell resistance against PICA.

Exogenous TGF-β renders CD4+CD25- T cells resistant to PICA

Since TGF-β signaling is important for the survival of CD4+CD25+ Treg cells in an

autocrine manner, it is possible that non-Tregs (CD4+CD25- T cells) undergo apoptosis

under plate-bound anti-CD3/anti-CD28 antibody stimulation due to less or lack of TGF-

β signaling. Ouyang et al. reported that CD4+CD25- T cells express comparable level of

TGF-β receptor although it is slightly lower than Treg cells (Ouyang et al., 2010). Since the

TGF-β receptor is expressed in non-Tregs (CD4+CD25- T cells), the addition of the active

form of TGF-β might might render a survival signal to non-Tregs (CD4+CD25- T cells)

from PICA under plate-bound anti-CD3/anti-CD28 antibody stimulation. We cultured

FACS sorted CD4+CD25- T cells under PICA-inducing conditions, stimulation with anti-

CD3/anti-CD28 antibodies, in the presence or absence of exogenous TGF-β. After 3 days

of culturing, we harvested cells and assessed their survival. As observed previously, cells

that were stimulated by plate-bound anti-CD3/anti-CD28 antibodies underwent apoptotic

cell death detected by an increase of annexin V+ cells (Fig 14A). When exogenous TGF-

β was added to the culture, as we predicted, the frequency of apoptotic/dead cells decreased

substantially. This change with the addition of TGF-β was due to expansion of the number

of live cells and not due to a decrease of annexin V+ cell numbers (Fig. 14B). When

CD4+CD25- T cells were stimulated with plate-bound anti-CD3/anti-CD28 antibodies, the

final live cell number after 3 days of stimulation was about the same as the starting sample

(1.2 fold increase). In contrast, the annexin V- cell number increased by 2.8 fold when

72 CD4+CD25- T cells were stimulated with plate-bound anti-CD3/anti-CD28 antibodies

in the presence of TGF-β. These data show that TGF-β renders CD4+CD25- T cells

resistant to PICA and allows them to expand.

TGF-β signaling downregulates Bim expression

We have demonstrated that CD4+CD25+ Treg cells resist PICA in an autocrine TGF-β

signaling dependent manner and non-Treg cells (CD4+CD25- T cells) are rescued from

apoptosis in the presence of TGF-β, suggesting TGF-β signaling is a key to controlling

CD4+ T cell fate (survival or apoptosis) under PICA inducing conditions. We then sought to

determine by which mechanisms TGF-β signaling rescues CD4+ T cells from PICA under

plate-bound anti-CD3/anti-CD28 antibody stimulation. As we described above, T cell

apoptosis is mainly mediated by two different pathways, Fas and Bim. We previously

reported that CD4+CD25- T cells isolated from Bim knockout mice or lpr mice which lack

functional Fas ligand are resistant to PICA and are able to survive and expand under plate-

bound anti-CD3/anti-CD28 antibody stimulation (Singh et al., 2010). These data indicate

that PICA is induced in both a Bim and Fas/FasL dependent manner. Further, those

proapoptotic molecules, Bim and Fas ligand (cell surface) expression were substantially

upregulated when non-Treg cells were stimulated with plate-bound anti-CD3/anti-CD28

antibody stimulation. In contrast, Treg cells did not exhibit increased expression of those

proapoptotic proteins and kept basal level of Bim and Fas ligand in the same stimulation

condition. We therefore hypothesized that TGF-β signaling in CD4+ T cells might

downregulate these apoptotic proteins. Since TGF-β rescued CD4+CD25- T cells from

73

Fig. 15 Effect of TGF-β on Bim expression by CD4+CD25- T cells. CD4+CD25- T cells

isolated from the spleen of C57BL/6 mice were stimulated with plate-bound anti-

CD3/anti-CD28 antibodies in the presence or absence of recombinant TGF-β in media

supplemented with IL-2. Cells were harvested at day 3. Cells were lysed into SDS sample

buffer and subjected for western blot analysis using anti-Bim and anti-β actin (for loading

control) antibodies. EL and L forms are indicated with arrows.

74

Fig. 16 Effect on TGF-β signaling on cell surface expression of Fas and FasL by

CD4+CD25- T cells. CD4+CD25- T cells isolated from the spleen of C57BL/6 mice were

stimulated with plate-bound anti-CD3/anti-CD28 antibodies in the presence or absence of

recombinant TGF-β in media supplemented with IL-2. (A) Cells harvested at day 3 were

stained for Fas ligand (FasL) expression and analyzed by flow cytometry. (B) Cells

harvested at day 3 were stained for Fas expression and analyzed by flow cytometry.

75

Fig. 17 Effect of TGF-β on bim transcript by CD4+CD25- T cells. CD4+CD25- T cells

isolated from the spleen of C57BL/6 mice were stimulated with plate-bound anti-

CD3/anti-CD28 antibodies in the presence or absence of recombinant TGF-β in media

supplemented with IL-2. Cells were harvested at day 3 and total RNA was isolated for

real time PCR. Bim gene expression was normalized to hprt transcript.

76 PICA under plate-bound anti-CD3/ anti-CD28 antibody stimulation, we first

determined whether addition of exogenous TGF-β reduces expression of Bim and/or Fas

ligand by CD4+CD25- T cells. If our hypothesis is correct, we would expect to observe that

CD4+CD25- T cells cultured in the presence of TGF-β decreases the expression of Bim or

Fas/Fas ligand. Unstimulated CD4+CD25- T cells expressed two forms (L and EL isoforms)

of Bim at a basal level. When stimulated with plate-bound anti-CD3/anti-CD28 antibodies,

CD4+CD25- T cells expressed both forms of Bim at a level clearly higher than that seen in

unstimulated T cells (Fig 15). Stimulated CD4+CD25- T cells in the presence of TGF-β, on

the other hand, showed a markedly reduced level of Bim protein expression, even lower

than that in unstimulated T cells. In contrast to Bim expression, TGF-β treatment caused a

mild reduction in expression of FasL in CD4+CD25- T cells (Fig. 16A), while expression of

Fas did not differ between TGF-β treated or untreated samples (Fig. 16B). Together, the

data clearly show that TGF-β suppresses the expression of molecules required for

apoptosis, particularly Bim, by CD4+CD25- T cells stimulated by PICA-inducing

conditions. Bim is regulated at both transcriptional and posttranscriptional regulations

(Ewings et al., 2007). We then determined if TGF-β reduced the expression of Bim in

CD4+CD25- T cells at transcriptional level by performing real time PCR. Bim gene

expression level in TGF-β treated cells were about 3 fold lower compared to untreated cells

under plate-bound anti-CD3/anti-CD28 antibody stimulation, suggesting that TGF-

β negatively regulates the transcription of bim (Fig 17).

We next determined if TGF-β signaling in CD4+CD25+ Treg cells plays the same role

as in conventional T cells. If TGF-β signaling in CD4+CD25+ Treg cells keeps cells

77 resistant to PICA, it would be expected that CD4+CD25+ Treg cells treated with TGF-β

signaling inhibitor (SB431542) would express higher levels of Bim. To test this,

CD4+CD25+ Treg cells were purified and stimulated with plate-bound anti-CD3/anti-CD28

antibodies for 3 days with or without TGF-β signaling inhibitor (SB431542). Three days

later, cells were harvested and tested for the expression of Bim, Fas and FasL (cell surface)

(Fig. 18 and Fig. 19). Stimulated Treg cells expressed a comparable level of Bim protein to

unstimulated cells and showed a stark contrast to Bim expression by CD4+CD25- T cells as

we reported previously. In contrast, Treg cells that were stimulated in the presence of

TGF-β signaling inhibitor showed a substantial upregulation of Bim expression (Fig. 18).

The increase was more evident for the EL form of Bim than for the L form. The EL form is

considered to play a major role in apoptosis by inducing the release of apoptotic proteins

Bax and Bak. Unlike Bim, Fas and FasL expression by stimulated by CD4+CD25+ Treg

cells did not increase with TGF-β treatment (Fig. 19A, B). We then determined if TGF-β

signaling in Treg cells negatively regulate Bim expression at transcriptional level as

CD4+CD25- T cells. If TGF-β signaling in Treg cells negatively regulates Bim expression

at transcriptional level, then we would expect to see upregulation of bim transcription in

TGF-β signaling inhibitor treated Treg cells under plate-bound anti-CD3/anti-CD28

antibody stimulation. After 2 days of plate- bound anti-CD3/anti-CD28 antibody

stimulation in the presence or absence of TGF-β signaling inhibitor, Tregs were harvested

and total RNA was isolated to perform quantitative PCR. As we expected, bim gene

expression was 3 fold higher in TGF-β signaling inhibitor (SB431542) treated Treg cells

compared to DMSO treated control, suggesting that TGF-β signaling in Treg cells also

78

Fig. 18 Effect of TGF-β signaling on Bim expression by CD4+CD25+ Treg cells.

CD4+CD25+ Treg cells isolated from the spleen of C57BL/6 mice were stimulated with

plate-bound anti-CD3/antiCD28 antibodies in the presence or absence of SB431542

(TGF-β super-family type I receptor kinase inhibitor) in media supplemented with IL-2

for 2 days. Cells were harvested and lysed in SDS sample buffer and subjected for

western blot analysis using anti-Bim or anti-β actin (for loading control) antibodies.

79

Fig. 19 Effect of TGF-β signaling on cell surface expression of Fas and FasL by

CD4+CD25+ Treg cells. CD4+CD25+ Treg cells isolated from the spleen of C57BL/6

mice were stimulated with plate-bound anti-CD3/antiCD28 antibodies in the presence or

absence of SB431542 (TGF-β super-family type I receptor kinase inhibitor) in media

supplemented with IL-2. (A) Cells harvested at day 2 were stained for Fas ligand (FasL)

expression and analyzed by flow cytometry. (B) Cells harvested at day 2 were stained for

Fas expression and analyzed by flow cytometry.

80

Fig. 20 Effect of TGF-β signaling on bim transcript by CD4+CD25+ Treg cells.

CD4+CD25+ Treg cells isolated from the spleen of C57BL/6 mice were stimulated with

plate-bound anti-CD3/anti-CD28 antibodies in the presence or absence of recombinant

TGF-β in media supplemented with IL-2. Cells were harvested at day 2 and total RNA

was isolated for real time PCR. Bim gene expression was normalized to hprt transcript.

81 downregulates Bim at transcriptional regulation (Fig. 20). Taken together with the data

from studies with CD4+CD25- T cells, the data demonstrate that TGF-β signaling plays a

pivotal role in suppression of the Bim under PICA inducing conditions.

Effect of TGF-β for CD4+ T cell differentiation under PICA inducing conditions

As mentioned above, TGF-β signaling also promotes T cell differentiation. It is well

established that TGF-β can induce differentiation of naïve CD4+ T cells into Foxp3+

inducible Treg (iTreg) cells. Since CD4+CD25+ naturally arising Treg cells are resistant to

PICA, we then hypothesized that the survival of CD4+CD25- T cells observed with

exogenous TGF-β may have been due to the conversion of CD4+CD25- T cells to Foxp3+

iTreg cells. To test this possibility, we stimulated FACS sorted CD4+CD25- T cells with

plate-bound anti-CD3 plus either soluble or plate-bound anti-CD28 antibodies in the

presence of TGF-β (including IL-2). Stimulation with plate-bound anti-CD3 and soluble

anti-CD28 antibodies in the presence of TGF-β was used for inducible Treg cell polarizing

conditions as previously reported (Fantini et al., 2007). After 3 days of stimulation,

expression of Foxp3 was examined by flow cytometry. When stimulated by plate-bound

anti-CD3 and soluble anti-CD28 antibodies in the presence of TGF-β (inducible Treg cells

polarizing condition), a significant proportion of cells (37.3%) expressed Foxp3 (Fig. 21).

However, only 5.3% of cells expanded with both the anti-CD3 and anti-CD28 antibodies

being plate-bound expressed Foxp3. The percentage of Foxp3+ T cells from plate-bound

anti-CD28 antibody stimulated cells was comparable to those stimulated without TGF-β,

82

Fig. 21 Effect of TGF-β on Foxp3 expression by CD4+CD25- T cells under PICA

inducing stimuli. CD4+CD25- T cells isolated from the spleen of C57BL/6 mice were

stimulated with either plate-bound anti-CD3/anti-CD28 antibodies or plate-bound anti-

CD3 and soluble anti-CD28 antibodies in the presence of absence of TGF-β in media

supplemented with IL-2. Cells were harvested at day 3 were stained for CD4 and Foxp3,

and analyzed by flow cytometry.

83

84

Fig. 22 Effect of TGF-β and IL-6 on PICA by CD4+CD25- T cells. CD4+CD25- T

cells isolated from the spleen of C57BL/6 mice were stimulated with either plate-bound

anti-CD3/anti-CD28 antibodies or plate-bound anti-CD3 and soluble anti-CD28

antibodies in the presence of absence of TGF-β, IL-6 in media supplemented with IL-2.

(A) Cells were harvested at day 3 were re-stimulated with PMA and Ionomycin for 4

hours in the presence of monensin and stained for IL-9 and IL-17 expression, then

analyzed by flow cytometry. (B) Total number of IL-17+ cells and IL-9+ cells were

determined based on the data obtained in (A).

85 suggesting inducible Treg induction did not occur with PICA inducing condition,

plate-bound anti-CD3/ anti-CD28 antibody stimulation. Together, the data show that

CD4+CD25- T cells treated with TGF-β become resistant to PICA not because CD4+CD25-

T cells differentiated into inducible Treg cells.

TGF-β promotes differentiation of Th9 cells under PICA-inducing condition

TGF-β is not only involved in iTreg cell differentiation but also for other helper T cell

subset differentiations, such as Th9 or Th17 (Soroosh and Doherty, 2009; Yang et al.,

2010). Since TGF-β rescued CD4+CD25- T cells from PICA without inducing Foxp3+

Tregs, we then determined whether cells survived PICA in the presence of TGF-β

differentiated into other effector T cell subsets. To address this question, we stimulated

purified CD4+CD25- T cells with plate-bound anti-CD3 plus either soluble or plate-bound

anti-CD28 antibodies in the presence or absence of TGF-β. After 3 days of stimulation,

cells expressing IL-9 or IL-17 were assessed by intracellular cytokine staining. CD4+CD25-

T cells stimulated by plate-bound anti-CD3 plus anti-CD28 without TGF-β did not express

IL-9, but a significant portion of the cells stimulated by the same manner in the presence of

TGF-β expressed IL-9 (14%) (Fig. 22A). The actual number of cells producing IL-9 also

increased significantly with TGF-β (Fig. 22B), showing that TGF-β induced differentiation

of a group of CD4+CD25- T cells into Th9 cells under PICA-inducing conditions. In

contrast, CD4+CD25- T cells stimulated by plate-bound anti-CD3 plus soluble anti-CD28

antibodies did not express IL-9 either with or without TGF-β. No increase in Th17 cells

was observed under either of these conditions (Fig. 22B). These data suggest that PICA

86

Fig. 23 Effect of TGF-β and IL-4 on PICA by CD4+CD25- T cells. CD4+CD25- T

cells isolated from the spleen of C57BL/6 mice were stimulated with either plate-bound

anti-CD3/anti-CD28 antibodies or plate-bound anti-CD3 and soluble anti-CD28

antibodies in the presence of absence of TGF-β, anti-IL-4 antibody in media

supplemented with IL-2. (A) Cells harvested at day 3 were re-stimulated with PMA and

Ionomycin for 4 hours in the presence of monensin and stained for IL-9 and IL-17

expression, then analyzed by flow cytometry. (B) Culture supernatant was collected at

day 3. IL-4 production was determined by ELISA. ** p< 0.01

87 inducing conditions, stimulation with plate-bound anti-CD3/anti-CD28 antibody,

promotes differentiation of CD4+CD25- T cells to Th9 subset.

Dardalhon et al. reported that Th9 is induced in an IL-4 dependent manner (Dardalhon

et al., 2008). We then determined if Th9 cells were induced in an IL-4 dependent manner

under plate-bound anti-CD3/anti-CD28 antibody stimulation. To address this question, we

cultured electronically sorted CD4+CD25- T cells stimulated with plate-bound anti-CD3

antibody plus either plate-bound anti-CD28 or soluble anti-CD28 antibodies in the presence

or absence of anti-IL-4 (2C11 hybridoma culture supernatant). After 3 days of culture, we

assessed IL-9 producing cells by cytokine staining. Indeed, addition of anti-IL-4 antibody

abrogated induction of Th9 cells by TGF-β and plate-bound anti-CD3/anti-CD28

antibodies (Fig. 23). Whereas IL-4 producing cells were not detectable by cytokine

staining after three days of stimulation (data not shown), culture supernatants from cells

stimulated with plate-bound anti-CD3/anti-CD28 antibodies contained a clearly detectable

level of IL-4 either in the presence or absence of TGF-β (Fig. 23B). TGF-β abrogated IL-4

production in cells stimulated with plate-bound anti-CD3 and soluble anti-CD28 while no

decrease of IL-4 was observed for cells stimulated with plate-bound anti-CD3/anti-CD28

antibodies (Fig. 23B). In contrast to IL-4, the level of IFN-γ in the cytoplasm and culture

supernatants from cells stimulated by plate-bound anti-CD3/antiCD28 antibody was

moderately higher than that of cells stimulated by plate-bound anti-CD3 and soluble anti-

CD28 antibodies (Fig. 24). The data suggest that T cells stimulated with plate-bound anit-

CD3/anti-CD28 antibodies resist suppression of IL-4 production by TGF-β and

differentiate into Th9 in part due to the presence of autocrine IL-4.

88

Fig. 24 Effect of TGF-β and IL-6 on PICA by CD4+CD25- T cells. CD4+CD25- T

cells isolated from the spleen of C57BL/6 mice were stimulated with either plate-bound

anti-CD3/anti-CD28 antibodies or plate-bound anti-CD3 and soluble anti-CD28

antibodies in the presence of absence of TGF-β, IL-6 in media supplemented with IL-2.

(A) Cells harvested at day 3 were re-stimulated with PMA and ionomycin for 4 hours in

the presence of monensin and stained for IFN-γ expression, then analyzed by flow

cytometry. Total number of IFN-γ+ cells was determined based on the data obtained in

flow cytometry analysis. (B) Culture supernatant was collected at day 3. IFN-γ

production was determined by ELISA. ** p< 0.01, * p< 0.05

89

Fig. 25 Effect of TGF-β and IL-6 on PICA by CD4+CD25- T cells. CD4+CD25- T cells

isolated from the spleen of C57BL/6 mice were stimulated with either plate-bound anti-

CD3/anti-CD28 antibodies or plate-bound anti-CD3 and soluble anti-CD28 antibodies in

the presence of absence of TGF-β, IL-6 in media supplemented with IL-2. Culture

supernatant was collected at day 3. IFN-γ production was determined by ELISA. ** p<

0.01

90 IL-6 plays a critical role in regulating the balance between Th17 and Treg cells

and induces Th17 along with TGF-β (Kimura and Kishimoto, 2010). Since IL-6 is mainly

produced by non-T cell populations such as antigen presenting cells or non-hematopoietic

cells including keratinocytes and fibroblasts, we next tested if exogenous IL-6 plus TGF-β

changes the fate of CD4+CD25- T cells under PICA-inducing conditions. When

CD4+CD25- T cells were stimulated in the presence of TGF-β and IL-6, the frequency of IL-

17+ cells showed a modest increase over the TGF-β only control groups (Fig. 22A). The

increase was higher for plate-bound anti-CD28 antibody stimulation than soluble anti-

CD28 stimulation (3.7% over 1.4%). In addition, we observed a substantial increase in the

amount of IL-17 detected in the culture supernatant for cells stimulated with plate-bound

anti-CD28 antibody than with soluble anti-CD28 controls (Fig. 25). This was not merely

due to an increase in total live cell numbers in the presence of exogenous IL-6 (Fig. 22B).

Rather, there was a marked increase in the cell number of IL-17+ cells, suggesting that

plate-bound anti-CD3/anti-CD28 antibody stimulation promotes differentiation and/or

expansion of Th17 cells.

91

CHAPTER FOUR

DISCUSSION

Introduction

CD4+CD25+ Treg cells comprise about 5-10% of CD4+ T cells in the periphery of

mice and humans. Since Tregs suppress immune responses, the balance between Treg

cells and effector T cells is critical in determining an immunogenic or tolerogenic

environment in the body. During an infection, the immunogenic environment is needed to

fight against pathogens, thus effector CD4+ T cells undergo clonal expansion by

recognizing their cognate antigen via TCR and orchestrate other immune cells by

producing a variety of cytokines. On the other hand, excess immunity leads to tissue

damage and can cause autoimmune disorders. Therefore, expanded effector T cells

undergo apoptosis following an immune response. This event is known as activation

induced cell death (AICD) (Shi et al., 1989). However, it has not been addressed how

CD4+CD25+ Treg cells respond to antigen stimulation compared to effector CD4+ T cells.

Since effector T cells are needed for an immune response and Treg cells are required for

maintaining peripheral tolerance, the responses to antigen stimulation in Treg cells might

be different from other CD4+ T cells.

Our laboratory recently discovered the phenomenon that CD4+CD25- T cells

undergo apoptosis when stimulated with plate-bound anti-CD3/anti-CD28 antibodies

92 over 4 days in the presence of IL-2, while Treg cells survive and expand (Singh et al.,

2010). Classical AICD occurs in a p53 independent manner, however we found that the

cell death due to plate-bound anti-CD3/CD28 antibody stimulation is mediated by a novel

form of the apoptosis pathway (p53-induced and CD28-dependent apoptosis: PICA) and

is distinct from classical AICD. Other groups have reported that p53 deficient mice

develop exacerbated experimental autoimmune arthritis, experimental autoimmune

encephalomyelitis and streptzotocin-induced diabetes even though p53 deficient T cells

are sensitive to AICD (Okuda et al., 2003; Simelyte et al., 2005; Zheng et al., 2005).

These observations led us to hypothesize that PICA is important to control the balance of

Treg cells versus non-Treg cells in the periphery. Understanding the differential survival

mechanisms between Treg cells and non-Treg cells against PICA might give us a better

understanding of peripheral tolerance and help us to identify therapeutic targets to treat

immune dysregulation such as autoimmune diseases, GVHD, and cancer.

In this study, we focused on two different aspects that mediate differential survival

mechanisms of Treg cells compared to non-Treg cells under PICA inducing condition,

plate-bound anti-CD3/anti-CD28 antibody stimulation in vitro. First, from a TCR

proximal signaling study, we found that the Ras activator, Ras guanyl nucleotide

releasing proteins (RasGRP1) expression was substantially reduced in Treg cells

compared to effector T cells (non-Treg cells) and its downstream Ras-Erk pathway was

significantly impaired. Further, non-Treg cells which lack RasGRP1 expression were

resistant to PICA and they expanded under PICA inducing stimuli. Second, we found that

TGF-β signaling rendered CD4+CD25- T cells resistant to PICA and was required for

93 survival and expansion by CD4+CD25+ Treg cells when stimulated with plate-bound

anti-CD3/anti-CD28 antibodies. These data suggest that both TGF-β and RasGRP1

signaling play crucial roles in mediating PICA thus balancing the proportion of Treg cell

and non-Treg cell subsets.

RasGRP1 expression in CD4+ T cells and PICA

Our data demonstrates that RasGRP1 expression is substantially reduced in Treg cells

compared to non-Treg cells (CD4+CD25- T cells) after TCR activation. To determine if

reduced RasGRP1 expression in Treg cells is one of the survival mechanisms under

PICA inducing conditions, we used RasGRP1 deficient non-Treg cells (CD4+CD25- T

cells). Our data show that RasGRP1 deficient non-Treg cells are resistant to PICA under

plate-bound anti-CD3/CD28 antibody stimulation, suggesting that RasGRP1 signaling is

required for inducing PICA in non-Treg cells.

RasGRPs are activators for Ras by converting the Ras-GDP bound form to the

active Ras-GTP form (Dower et al., 2000). TCR signaling leads to activation of

Phospholipase C γ (PLCγ) which produces diacylglycerol (DAG). The DAG recruits

RasGRP1 to the plasma membrane allowing RasGRP1 to interact with Ras thus

activating Ras-Erk signaling. T cells dominantly express RasGRP1 among RasGRP

family members (RasGRP1, 2, 3, 4) and RasGRP1 plays a critical role in T cell immunity

have been demonstrated using RasGRP1 deficient mice or lag mice which have mutations

in the rasgrp1 gene. Layer et al. showed that lag mice develop lymphoadenopathy at 3 to

4 month old (Layer et al., 2003). These mice possess enlarged spleens containing a larger

94 number of CD4+ T cells compared to wild type littermate controls and developed an

autoimmune disorder which is depicted by high levels of antinuclear antibodies in the

serum. Transferring the T cells isolated from lag mice (RasGRP1 mutant mice) into T

and B cell deficient mice (Rag knockout mice) causes the host to develop an autoimmune

disorder, suggesting RasGRP1 expression in CD4+ T cells is required for maintaining

immune homeostasis. Priatel et al. reported that adoptive transfer of CD4+ T cells

isolated from RasGRP1 knockout mice into congenic host mice also develop exacerbated

autoimmune disorder phenotype compared to wild type CD4+ T cells transferred into the

host (Priatel et al., 2007). These data also support the idea that RasGRP1 expression in

CD4+ T cells is required for maintaining immune homeostasis. RasGRP1 is known to be

required for T cell development in the thymus (Dower et al., 2000). Positive selection is

impaired in RasGRP1 deficient mice but negative selection is normal in these mice,

suggesting central tolerance is kept intact. Why do RasGRP1 deficient mice develop an

autoimmune disorder? One of the mechanisms might be dysregulation of peripheral

tolerance in RasGRP1 deficient mice. Our data demonstrate that RasGRP1 expression is

substantially upregulated in non-Treg cells in response to TCR stimulation. Further,

CD4+CD25- T cells isolated from RasGRP1 deficient mice become resistant to PICA

under stimulation with plate-bound anti-CD3/anti-CD28 antibodies over 4 days while

wild type non-Tregs undergo massive apoptosis. Altogether, we propose the model that

effector CD4+ T cells which lack RasGRP1 expression cannot undergo apoptosis and

survive, hence the increased ratio of effector CD4+ T cells (non-Treg cells) against Treg

cells break a tolerance thus causing an autoimmune syndrome.

95 Recently, Yasuda et al. reported systemic lupus erythematosus (SLE) patients

express lower levels of RasGRP1 compared to healthy donors (Yasuda et al., 2007). They

also showed that SLE patients had a higher frequency of alternating splicing of rasgrp1

which produces a dysfunctional protein. Wen et al. also reported that RasGRP1

expression is lower in SLE patients compared to healthy donors (Pan et al., 2010). Their

data suggest that microRNA-21 is highly expressed in SLE patient and further

microRNA-21 directly the downregulates RasGRP1 expression. These data also support

our model that PICA is balancing Treg cells and non-Treg cells in an RasGRP1

dependent manner.

Our previous report shows that RasGRP1 expression is downregulated in Treg cells

compared to non-Treg cells. Since lowered RasGRP1 expression seems to induce

dysregulation of effector T cells, reduced expression of RasGRP1 in Treg cells may be

critical to maintain immune homeostasis.

We have previously shown that PICA is induced in a Bim and Fas/Fas ligand

interaction dependent manner (Singh et al., 2010). Our data demonstrate that the

proapoptotic protein, Bim, is substantially reduced in RasGRP1 deficient non-Treg cells

(CD4+CD25- T cells) under plate-bound anti-CD3/anti-CD28 antibody stimulation

compared to littermate control. This suggests that RasGRP1 signaling mediates

upregulation of Bim under PICA inducing conditions. Further, reduced expression of

Bim in Treg cells under plate-bound anti-CD3/anti-CD28 antibody stimulation might also

be due to downregulated RasGRP1 expression. Recently, Stang et al. reported that

activating RasGRP1 signaling by the DAG analogue, breostatin, leads to apoptotic cell

96 death in the Tredo non-Hodgkin’s B cell lymphoma line (Stang et al., 2009). They also

demonstrated that apoptotic cell death is mediated by phosphorylation of the proapoptotic

protein, Bim, through the activation of the RasGRP-Ras-Erk pathway. We have not

examined if PICA is induced by ERK activity. We can address this question by treating

non-Treg cells (CD4+CD25- T cells) with a Mek inhibitor (PD98059 or UO1). If PICA is

induced in an Erk acrivity dependent manner, we would expect to observe that non-Treg

cells treated with the Mek inhibitor avoid apoptosis and survive under plate-bound anti-

CD3/CD28 antibody stimulation.

We have demonstrated that non-Treg cells which lack RasGRP1 expression are

resistant to PICA. Hence, it is expected that the downregulation of RasGPR1 expression

in Treg cells is important for cell survival under PICA inducing stimuli. However, we

haven’t addressed if the downregulation in Treg cells is required for Treg cell survival

under plate-bound anti-CD3/anti-CD28 antibody stimulation. It would be interesting to

address if overexpression of RasGRP1 renders Treg cells sensitive to PICA. Due to

technical difficulties with the use of a retrovirus or lentivirus transduction system on

murine Treg cells to overexpress RasGRP1, we were not successful in addressing this

question. In future studies, an alternative approach such as co-overexpressig Foxp3 and

RasGRP1 in non-Treg cells can be tested. If downregulation of RasGRP1 expression is

important for Treg survival under plate-bound anti-CD3/anti-CD28 antibody stimulation,

we would expect to see CD4+ T cells co-overexpressed Foxp3 and RasGRP1 undergo

apoptosis under PICA inducing stimuli.

97 Regulation of RasGRP1 expression in T cells

As described above, previous reports show that RasGRP1 deficient mice exhibit

substantially reduced single positive T cells in the thymus. Since they have normal

numbers of double positive T cells, RasGRP1 is required for positive selection but not for

negative selection. RasGRP1 is expressed in all stages of thymocyte development as well

as peripheral T cells. Han et al. showed that EL4 lymphoma cells derived from murine

thymoma also expresses RasGRP1 and EL4 cells downregulate RasGRP1 expression in

response to PMA stimulation (Han et al., 2007). PMA, a DAG analogue, renders

RasGRP1 to translocate into the plasma membrane by directly binding to C1 thus

allowing RasGRP1 to associate with Ras. Since DAG is produced upon TCR stimulation,

this data led us to think that RasGRP1 expression might be downregulated in response to

TCR stimulation. Contrary to what was expected from previous study, our data

demonstrate that RasGRP1 expression is substantially increased after 7 days of ex vivo

stimulation in non-Treg cells (CD4+CD25- T cells). Interestingly, Treg cells continuously

expressed basal levels of RasGRP1. Presently, it is not known if upregulation of

RasGRP1 expression in non-Treg cells (CD4+CD25- T cells) has any specific roles in

effector CD4+ T cells. Ebinu et al. reported overexpression of RasGRP1 in human Jurkat

T cell lines leads to a higher production of IL-2 (Ebinu et al., 2000). Perhaps, this

upregulation of RasGRP1 expression might be required for non-Treg cells to possess

effector functions such as cytokine production. Future study is needed to address this

question. On the other hand, Treg cells retained basal levels of RasGRP1 expression

after ex vivo stimulation for 7 days. We found that the difference of RasGRP1 expression

98 in ex vivo expanded Treg cells and non-Treg cells is controlled at the transcriptional

level. The rasgrp1 mRNA level was about 15 fold lower in expanded Treg cells

compared to non-Treg cells.

Foxp3 is a transcription factor which belongs to the forkhead family and is

specifically expressed in Treg cells. Since Foxp3 positively or negatively control many

genes related to Treg cell functions, we hypothesized that Foxp3 controls rasgrp1

transcription. To address this question, we performed a ChIP assay on expanded Treg

cells using anti-Foxp3 antibody. We found 4 sites that a contain forkhead consensus

sequence up to 4kb upstream of the rasgrp1 transcription starting site. Primers designed

to detect two of the sites amplified a strong band from the Foxp3 antibody precipitated

sample but not from the isotype IgG control antibody precipitated sample, suggesting that

Foxp3 indeed binds to the rasgrp1 gene transcription regulation region. Recently, Marson

et al. performed that ChIp assay combined with gene chip microarray using murine T cell

hypridoma that overexpressed Foxp3. They reported that Foxp3 controls about 1,100

genes including well known Foxp3 target genes such as IL-2 and CTLA4 (Marson et al.,

2007). Zheng et al. also performed a similar approach as Mason et al. and reported that

Foxp3 controls about 1,200 genes using CD4+CD25+ Treg cells isolated form C57BL/6

mice (Zheng et al., 2007). Neither of them identified the rasgrp1 gene as a Foxp3 target.

Our study is the first to report Foxp3 targets the rasgrp1 gene. There are a few

possibilities why the rasgrp1 gene was not identified as a Foxp3 target. A microarray

based approach might select a target gene with stringent conditions, thus rasgrp1 was not

picked up. Another possibility is that Foxp3 might bind to the rasgrp1 gene only after

99 cells are activated. Since we used ex vivo expanded Treg cells stimulated for 7 days

with plate-bound anti-CD3/anti-CD28 antibodies for the ChIP assay, Treg cells were in

an activated state. We also observed that freshly isolated Treg cells and non-Treg cells

expressed comparable level of RasGRP1. This also supports the idea that Foxp3 binds to

the rasgrp1 gene after TCR activation. Future studies are needed to determine if Foxp3

binds to rasgrp1 before or after TCR stimulation.

We have demonstrated that Foxp3 targets the rasgrp1 gene, but we have not

addressed if Foxp3 binding leads to the downregulation of rasgrp1 transcription in Treg

cells. One mechanism by which Foxp3 negatively regulates gene expression is

competition of the binding site with the transcription factor, nuclear factor of activated T

cells (NFAT) (Schubert et al., 2001). NFAT mediates immune functions such as cytokine

production and the activity of NFAT is regulated by calcium signaling. We found that the

NFAT binding consensus sequence exists adjacent to one of the potential Foxp3 binding

sites, 3kb upstream of the rasgrp1 transcription starting site. In future studies, it will be

interesting to address if downregulation of rasgrp1 transcription is due to Foxp3

competing with NFAT for its binding site. This question can be examined by performing

a ChIP assay using NFAT antibody. We can compare NFAT binding to the rasgrp1 gene

in Foxp3 overexpressed CD4+CD25- T cells using a retroviral transduction system. We

can also test if Foxp3 negatively regulates RasGRP1 by transiently overexpressing Foxp3

in non-Treg cells using retrovirus transduction and assess rasgrp1 transcription levels by

real time PCR. If Foxp3 downregulates RasGRP1 expression, we would expect to see

100 decreased rasgrp1 gene expression in Foxp3 transduced non-Treg cells compared to

control cells.

A recent report shows that microRNA-21 directly targets RasGRP1 expression and

downregulates expression levels (Pan et al., 2010). Other groups have reported that

microRNA-21 is highly expressed in Treg cells compared to non-Treg cells (Rouas et al.,

2009). Taken together, there might be a RasGRP1 downregulation mechanism by

microRNA-21 along with transcriptional regulation of rasgrp1 by Foxp3. Understanding

the role of microRNA-21 in Treg cells might give us another regulation mechanism of

RasGRP1 in Treg cells. In the future, it would be interesting to examine the role of

microRNA-21 under PICA inducing condition.

TGF-β signaling decides the fate of non-Treg cells and Treg cells under PICA inducing

conditions

Our data demonstrate that TGF-β signaling is required for Treg cell survival under

plate-bound anti-CD3/anti-CD28 antibody stimulation. Nakamura et al. reported that

TGF-β production in response to TCR stimulation was higher in Treg cells compared to

non-Treg cells by measuring total TGF-β from culture supernatants (Nakamura et al.,

2001). However, this assay does not tell how much active TGF-β, which can be

associated with TGF-β receptor is present in culture supernatant of Treg cells or non-

Treg cells. Our data show that Treg cells undergo apoptosis under plate-bound anti-

CD3/antiCD28 antibody stimulation when TGF-β signaling is blocked by a chemical

inhibitor (SB431542) or an anti-TGF-β neutralizing antibody. In contrast, non-Treg cells

101 became resistant to PICA in the presence of exogenous active TGF-β. Taken together,

it is expected that Treg cells might possess specific mechanisms to release the active form

of TGF-β. To convert latent TGF-β to the active form, latent associated protein (LAP)

needs to be cleaved from TGF-β by TGF-β activators such as integrins or

thrombospondin-1 (TSP-1) (Masli et al., 2006). Currently, it is not understood if Treg

cells express these molecules. It has been demonstrated that Treg cells but not other T

cells express a membrane bound form of TGF-β. There might be specific mechanisms to

convert latent TGF-β into the active form of the membrane bound TGF-β, thus Tregs but

not non-Tregs are able to survive under PICA inducing conditions. Recently, Oida et al.

reported that murine CD4+CD25- T cells also express the membrane bound of TGF-β

without inducing Foxp3+ inducible Treg cells (iTreg) when cells were stimulated in the

presence of exogenous TGF-β (Oida and Weiner, 2010). This observation supports the

idea that membrane bound TGF-β might be important for Treg and non-Treg cell survival

under PICA inducing conditions. In future studies, we can address the production of the

active-form of TGF-β by Treg cells or non-Treg cells under plate-bound anti-CD3/anti-

CD28 antibody stimulation. Further, it would be interesting to determine the role of

membrane bound TGF-β in Treg cell survival under PICA inducing conditions. To

address this question, we can knockdown GARP which anchors TGF-β on the cell

surface. If membrane bound TGF-β has a specific role for Treg cell survival under plate-

bound antibody stimulation, GARP knockdowned Treg cells might become sensitive to

PICA.

102 Our data show that TGF-β signaling reduces expression of Bim. Recent reports

showed that TGF-β regulates expression of Bim in non-lymphoid cells and mitogen- and

stress-activated protein kinase-1 (MSK-1) plays a critical role in the anti-apoptotic

functions of TGF-β (Hoshino et al., 2011; van der Heide et al., 2011). Currently, it is not

known if MSK plays any role in T cell activation or death. In the future, it will be

interesting to determine by which mechanisms TGF-β signaling downregulates Bim

expression. Complex and intricate regulation of Bim by TGF-β potentially reflects what

has been reported on the role of microRNA-25 (Petrocca et al., 2008). In CD4+CD25- and

CD4+CD25+ T cells, Bim protein levels are negatively regulated by TGF-β. Notably,

recent reports show that microRNA-25, which regulates Bim protein synthesis and

promotes anti-apoptotic responses, was much reduced in Treg cells from patients with

multiple sclerosis (De Santis et al., 2010; Li et al., 2009). Loss of this microRNA could

lead to an increase in Bim protein expression by Treg cells and their death, hence less

effective maintenance of self-tolerance. In the future, we can determine the role of

microRNA-25 in Bim expression in Treg cells under PICA inducing conditions.

Recently, Ouyang demonstrated that TGF-β promotes nTreg cells cell survival during

negative selection, where Bim plays a critical role (Ouyang et al., 2010). Though thymic

selection does not require p53, the data suggest that TGF-β signaling can be anti-

apoptotic under certain conditions in connection to Bim expression. Though PICA is an

ex vivo event established by use of anti-receptor antibodies, our previous work shows that

PICA can be induced by extended stimulation from allogenic dendritic cells in vitro

103 (Singh et al., 2010). Therefore, it will be interesting to see if TGF-β rescues effector

T cells from PICA in vivo.

PICA inducing conditions skews differentiation of CD4+ T cells

We have demonstrated that TGF-β signaling promotes the differentiation of

CD4+CD25- T cells that receive PICA inducing stimuli. Our data show that non-Tregs

(CD4+CD25- T cells) become resistant to PICA in the presence of exogenous TGF-β

under plate-bound anti-CD3/anti-CD28 antibody stimulation. Since TGF-β is known to

promote inducible Treg cell differentiation, we expected that Foxp3+ T cells were

induced under PICA inducing stimuli, thus they became resistant to PICA. However, this

phenomenon is not due to induction of Foxp3+ inducible Treg cells. Our data suggest that

non-Treg cells preferentially differentiated into Th9 (IL-9 producing cells) in an IL-4

dependent manner instead of becoming iTreg cells in the presence of TGF-β under PICA

inducing stimuli. Further, IL-17 production is also substantially increased under PICA

inducing stimuli compared to plate-bound anti-CD3/ soluble anti-CD28 antibody

stimulation. Currently, the molecular mechanisms that underlie this phenomenon are

unknown. TGF-β may be simply providing a signal required for survival of T cells and

IL-4 provides differentiation signaling for Th9. Similary, TGF-β might allow T cells to

survive PICA so that exogenous IL-6 can induce differentiation of surviving cells into

Th17 cells. Alternatively, TGF-β could also provide the signaling required for

initiation/establishment of differentiation. In either case, the plasticity of CD4+ T cell

104

Fig. 26 Schematic model of CD4+ T cells under PICA inducing stimuli. Conventional

CD4+ T cells undergo PICA when stimulated with plate-bound anti-CD3/CD28

antibodies, whereas nTreg cells expand robustly under same conditions. TGF-β signaling

and reduced RasGRP1 expression mediate survival of nTreg cells under PICA inducing

stimuli. Conversely, when an active form of exogenous TGF-β is present, non-Treg cells

become resistant to PICA and undergo robust expansion instead of apoptosis, with

reduction of the proapoptotic protein Bim. Substantial fraction of PICA-resistant T cells

expressed IL-9. Moreover, the presence of IL-6 along with TGF-β led to the generation

of Th17.

105 differentiation provided by TGF-β and PICA stimulation might play significant roles

in determining the outcomes in vivo (Fig. 26).

Accumulated evidence suggests that TGF-β promotes iTreg cell differentiation with

antigen stimulation. However, we have discovered that PICA inducing stimuli does not

induce iTreg cell differentiation even in the presence of TGF-β. Conversely, non-Treg

cells differentiated into Th9 cells instead of becoming iTreg cells under PICA inducing

stimuli when TGF-β was present. Further more, in Th17 polarizing conditions, PICA

inducing stimuli induced more IL-17 producing cells compared to soluble anti-CD28

stimulation. Since Th9 and Th17 cells mediate effector immune responses by producing

IL-9 and IL-17, these data indicate that the condition of PICA inducing stimuli might be

able to shift physiological conditions from a tolerogenic to an immunogenic environment

even in the presence of TGF-β, which possesses immune suppressive effects. In our

study, we have used plate-bound anti-CD3/anti-CD28 antibody stimulation as PICA

inducing stimuli compared to plate-bound anti-CD3 plus soluble anti-CD28 antibody

stimulation. At present, it is not clear how the difference caused by plate-bound anti-

CD28 antibody compared to soluble anti-CD28 antibody leads to a different outcome on

the survival of non-Treg cells in the presence of TGF-β. It would be interesting to address

the mechanism by which plate-bound anti-CD28 antibody stimulation skews the

difference of CD4+ T cells compared to soluble anti-CD28 antibody stimulation. Since the

difference of these stimulations is only the type of anti-CD28 antibody stimulation, we

propose to determine the downstream CD28 signaling pathway by co-

immunoprecipitating CD28 associating molecules using anti-CD28 antibody under plate-

106 bound anti-CD28 stimulation. We expect that CD28 interacting protein such as AKT

might be differentially regulated between plate-bound anti-CD28 and soluble anti-CD28

antibody stimulated cells. Although it still remains unclear and needs to be addressed, the

molecular mechanisms behind skewing CD4+ T cell differentiation under PICA inducing

stimuli has potential applications in clinical settings as an immunotherapy tool for

treating disease or immune disorders.

We propose the potential applications of PICA inducing stimuli as cancer vaccines

for the following reasons. First, PICA inducing stimuli blocks iTreg cell differentiation in

the presence of TGF-β. TGF-β plays an important role in tumor development. Many

types of tumor cells produce large amounts of TGF-β in the tumor microenvironment and

TGF-β production leads to conversion of CD4+ T cells into iTreg cells. For example, Lu

et al. demonstrated that gastric cancer cells directly convert CD4+ T cells into iTreg cells

in a TGF-β dependent manner (Lu et al., 2011). Liu et al. demonstrated that non-Treg

cells converted into iTreg cells at the tumor site in a TGF-β dependent manner using a

mouse model (Liu et al., 2007). This is known to be one of the tumor evasion

mechanisms to escape immune surveillance (Curiel, 2007; Nishikawa and Sakaguchi,

2010). If we can mimic PICA inducing stimuli at the tumor site, we would expect to see

the blockade of iTreg cell induction at the tumor site thus gaining a more efficient

immune response to fight against cancer.

Secondly, PICA inducing stimuli made non-Treg to differentiate into Th9 cells in the

presence of TGF-β. Further, they differentiated into Th17 and produced large amounts of

IL-17 when TGF-β and IL-6 were present. If we can match PICA inducing stimuli at the

107 tumor sites, Th17 and Th9 cells might trigger an effective immune response by

producing IL-17 and IL-9.

Therefore, we would like to further address how we can duplicate PICA inducing

stimuli at the tumor site. Since CD28 signaling is thought to play a key role, we will

examine modulation of CD28 signaling for T cells at the tumor site by administration of

anti-CD28 antibody or overexpression of B7, which is the ligand for CD28 on APCs.

Conclusion remarks

My work provides insight into how nTreg cells survive under antigen stimulation

while conventional CD4+ T cells undergo apoptosis. My work suggests that reduced

RasGRP1 expression and TGF-β signaling mediate the survival of nTreg cells under

PICA inducing stimuli. These altered signals in Treg cells are likely regulating the

balance of nTreg cells and conventional T cells during immune response thus maintaining

immune homeostasis. These could be new therapeutic targets to treat immune

dysregulations.

108

REFERENCES

Abbas, A.K., K.M. Murphy, and A. Sher. 1996. Functional diversity of helper T lymphocytes. Nature 383:787-793.

Aggarwal, S., N. Ghilardi, M.H. Xie, F.J. de Sauvage, and A.L. Gurney. 2003.

Interleukin-23 promotes a distinct CD4 T cell activation state characterized by the production of interleukin-17. The Journal of biological chemistry 278:1910-1914.

Annes, J.P., J.S. Munger, and D.B. Rifkin. 2003. Making sense of latent TGFbeta

activation. Journal of cell science 116:217-224. Aspinall, A.I., A. Pinto, I.A. Auer, P. Bridges, J. Luider, L. Dimnik, K.D. Patel, K.

Jorgenson, and R.C. Woodman. 1999. Identification of new Fas mutations in a patient with autoimmune lymphoproliferative syndrome (ALPS) and eosinophilia. Blood cells, molecules & diseases 25:227-238.

Barnes, P.J. 2001. Th2 cytokines and asthma: an introduction. Respiratory research 2:64-

65. Bennett, C.L., J. Christie, F. Ramsdell, M.E. Brunkow, P.J. Ferguson, L. Whitesell, T.E.

Kelly, F.T. Saulsbury, P.F. Chance, and H.D. Ochs. 2001. The immune dysregulation, polyendocrinopathy, enteropathy, X-linked syndrome (IPEX) is caused by mutations of FOXP3. Nature genetics 27:20-21.

Bettelli, E., Y. Carrier, W. Gao, T. Korn, T.B. Strom, M. Oukka, H.L. Weiner, and V.K.

Kuchroo. 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature 441:235-238.

Bettelli, E., M. Dastrange, and M. Oukka. 2005. Foxp3 interacts with nuclear factor of

activated T cells and NF-kappa B to repress cytokine gene expression and effector functions of T helper cells. Proceedings of the National Academy of Sciences of the United States of America 102:5138-5143.

Boehme, S.A., and M.J. Lenardo. 1996. TCR-mediated death of mature T lymphocytes

occurs in the absence of p53. J Immunol 156:4075-4078.

109 Bommhardt, U., Y. Scheuring, C. Bickel, R. Zamoyska, and T. Hunig. 2000. MEK

activity regulates negative selection of immature CD4+CD8+ thymocytes. J Immunol 164:2326-2337.

Bommireddy, R., and T. Doetschman. 2004. TGF-beta, T-cell tolerance and anti-CD3

therapy. Trends in molecular medicine 10:3-9. Bouillet, P., D. Metcalf, D.C. Huang, D.M. Tarlinton, T.W. Kay, F. Kontgen, J.M.

Adams, and A. Strasser. 1999. Proapoptotic Bcl-2 relative Bim required for certain apoptotic responses, leukocyte homeostasis, and to preclude autoimmunity. Science 286:1735-1738.

Buday, L., S.E. Egan, P. Rodriguez Viciana, D.A. Cantrell, and J. Downward. 1994. A

complex of Grb2 adaptor protein, Sos exchange factor, and a 36-kDa membrane-bound tyrosine phosphoprotein is implicated in ras activation in T cells. The Journal of biological chemistry 269:9019-9023.

Chang, C.J., C.H. Liao, F.H. Wang, and C.M. Lin. 2003. Transforming growth factor-

beta induces apoptosis in antigen-specific CD4+ T cells prepared for adoptive immunotherapy. Immunology letters 86:37-43.

Chang, H.C., L. Han, R. Jabeen, S. Carotta, S.L. Nutt, and M.H. Kaplan. 2009. PU.1

regulates TCR expression by modulating GATA-3 activity. J Immunol 183:4887-4894.

Chang, H.C., S. Sehra, R. Goswami, W. Yao, Q. Yu, G.L. Stritesky, R. Jabeen, C.

McKinley, A.N. Ahyi, L. Han, E.T. Nguyen, M.J. Robertson, N.B. Perumal, R.S. Tepper, S.L. Nutt, and M.H. Kaplan. 2010. The transcription factor PU.1 is required for the development of IL-9-producing T cells and allergic inflammation. Nature immunology 11:527-534.

Chang, H.C., S. Zhang, V.T. Thieu, R.B. Slee, H.A. Bruns, R.N. Laribee, M.J. Klemsz,

and M.H. Kaplan. 2005. PU.1 expression delineates heterogeneity in primary Th2 cells. Immunity 22:693-703.

Chen, W., W. Jin, N. Hardegen, K.J. Lei, L. Li, N. Marinos, G. McGrady, and S.M.

Wahl. 2003. Conversion of peripheral CD4+CD25- naive T cells to CD4+CD25+ regulatory T cells by TGF-beta induction of transcription factor Foxp3. The Journal of experimental medicine 198:1875-1886.

Chen, X., J.J. Priatel, M.T. Chow, and H.S. Teh. 2008. Preferential development of CD4

and CD8 T regulatory cells in RasGRP1-deficient mice. J Immunol 180:5973-5982.

110 Coffer, P.J., and B.M. Burgering. 2004. Forkhead-box transcription factors and their role

in the immune system. Nature reviews. Immunology 4:889-899. Cohen, P.L., and R.A. Eisenberg. 1991. Lpr and gld: single gene models of systemic

autoimmunity and lymphoproliferative disease. Annual review of immunology 9:243-269.

Conery, A.R., Y. Cao, E.A. Thompson, C.M. Townsend, Jr., T.C. Ko, and K. Luo. 2004.

Akt interacts directly with Smad3 to regulate the sensitivity to TGF-beta induced apoptosis. Nature cell biology 6:366-372.

Curiel, T.J. 2007. Tregs and rethinking cancer immunotherapy. J Clin Invest 117:1167-

1174. Crabtree, G.R. 1999. Generic signals and specific outcomes: signaling through Ca2+,

calcineurin, and NF-AT. Cell 96:611-614. D'Cruz, L.M., and L. Klein. 2005. Development and function of agonist-induced

CD25+Foxp3+ regulatory T cells in the absence of interleukin 2 signaling. Nature immunology 6:1152-1159.

Daniels, M.A., E. Teixeiro, J. Gill, B. Hausmann, D. Roubaty, K. Holmberg, G. Werlen,

G.A. Hollander, N.R. Gascoigne, and E. Palmer. 2006. Thymic selection threshold defined by compartmentalization of Ras/MAPK signalling. Nature 444:724-729.

Dardalhon, V., A. Awasthi, H. Kwon, G. Galileos, W. Gao, R.A. Sobel, M. Mitsdoerffer,

T.B. Strom, W. Elyaman, I.C. Ho, S. Khoury, M. Oukka, and V.K. Kuchroo. 2008. IL-4 inhibits TGF-beta-induced Foxp3+ T cells and, together with TGF-beta, generates IL-9+ IL-10+ Foxp3(-) effector T cells. Nature immunology 9:1347-1355.

De Santis, G., M. Ferracin, A. Biondani, L. Caniatti, M. Rosaria Tola, M. Castellazzi, B.

Zagatti, L. Battistini, G. Borsellino, E. Fainardi, R. Gavioli, M. Negrini, R. Furlan, and E. Granieri. 2010. Altered miRNA expression in T regulatory cells in course of multiple sclerosis. Journal of neuroimmunology 226:165-171.

Dower, N.A., S.L. Stang, D.A. Bottorff, J.O. Ebinu, P. Dickie, H.L. Ostergaard, and J.C.

Stone. 2000. RasGRP is essential for mouse thymocyte differentiation and TCR signaling. Nature immunology 1:317-321.

111 Ebinu, J.O., S.L. Stang, C. Teixeira, D.A. Bottorff, J. Hooton, P.M. Blumberg, M.

Barry, R.C. Bleakley, H.L. Ostergaard, and J.C. Stone. 2000. RasGRP links T-cell receptor signaling to Ras. Blood 95:3199-3203.

Elyaman, W., E.M. Bradshaw, C. Uyttenhove, V. Dardalhon, A. Awasthi, J. Imitola, E.

Bettelli, M. Oukka, J. van Snick, J.C. Renauld, V.K. Kuchroo, and S.J. Khoury. 2009. IL-9 induces differentiation of TH17 cells and enhances function of FoxP3+ natural regulatory T cells. Proceedings of the National Academy of Sciences of the United States of America 106:12885-12890.

Emamaullee, J.A., J. Davis, S. Merani, C. Toso, J.F. Elliott, A. Thiesen, and A.M.

Shapiro. 2009. Inhibition of Th17 cells regulates autoimmune diabetes in NOD mice. Diabetes 58:1302-1311.

Ewings, K.E., C.M. Wiggins, and S.J. Cook. 2007. Bim and the pro-survival Bcl-2

proteins: opposites attract, ERK repels. Cell Cycle 6:2236-2240. Fallarino, F., U. Grohmann, K.W. Hwang, C. Orabona, C. Vacca, R. Bianchi, M.L.

Belladonna, M.C. Fioretti, M.L. Alegre, and P. Puccetti. 2003. Modulation of tryptophan catabolism by regulatory T cells. Nature immunology 4:1206-1212.

Fantini, M.C., S. Dominitzki, A. Rizzo, M.F. Neurath, and C. Becker. 2007. In vitro

generation of CD4+ CD25+ regulatory cells from murine naive T cells. Nature protocols 2:1789-1794.

Finotto, S., M. Hausding, A. Doganci, J.H. Maxeiner, H.A. Lehr, C. Luft, P.R. Galle, and

L.H. Glimcher. 2005. Asthmatic changes in mice lacking T-bet are mediated by IL-13. International immunology 17:993-1007.

Floess, S., J. Freyer, C. Siewert, U. Baron, S. Olek, J. Polansky, K. Schlawe, H.D. Chang,

T. Bopp, E. Schmitt, S. Klein-Hessling, E. Serfling, A. Hamann, and J. Huehn. 2007. Epigenetic control of the foxp3 locus in regulatory T cells. PLoS biology 5:e38.

Fontenot, J.D., M.A. Gavin, and A.Y. Rudensky. 2003. Foxp3 programs the development

and function of CD4+CD25+ regulatory T cells. Nature immunology 4:330-336. Fontenot, J.D., J.P. Rasmussen, M.A. Gavin, and A.Y. Rudensky. 2005. A function for

interleukin 2 in Foxp3-expressing regulatory T cells. Nature immunology 6:1142-1151.

Fukaura, H., S.C. Kent, M.J. Pietrusewicz, S.J. Khoury, H.L. Weiner, and D.A. Hafler.

1996. Induction of circulating myelin basic protein and proteolipid protein-specific transforming growth factor-beta1-secreting Th3 T cells by oral

112 administration of myelin in multiple sclerosis patients. The Journal of clinical investigation 98:70-77.

Gershon, R.K., and K. Kondo. 1970. Cell interactions in the induction of tolerance: the

role of thymic lymphocytes. Immunology 18:723-737. Gilliland, L.K., G.L. Schieven, N.A. Norris, S.B. Kanner, A. Aruffo, and J.A. Ledbetter.

1992. Lymphocyte lineage-restricted tyrosine-phosphorylated proteins that bind PLC gamma 1 SH2 domains. The Journal of biological chemistry 267:13610-13616.

Glimcher, L.H., and K.M. Murphy. 2000. Lineage commitment in the immune system:

the T helper lymphocyte grows up. Genes & development 14:1693-1711. Gold, R., and F. Luhder. 2008. Interleukin-17--extended features of a key player in

multiple sclerosis. The American journal of pathology 172:8-10. Gondek, D.C., L.F. Lu, S.A. Quezada, S. Sakaguchi, and R.J. Noelle. 2005. Cutting edge:

contact-mediated suppression by CD4+CD25+ regulatory cells involves a granzyme B-dependent, perforin-independent mechanism. J Immunol 174:1783-1786.

Gorelik, L., P.E. Fields, and R.A. Flavell. 2000. Cutting edge: TGF-beta inhibits Th type

2 development through inhibition of GATA-3 expression. J Immunol 165:4773-4777.

Gorelik, L., and R.A. Flavell. 2000. Abrogation of TGFbeta signaling in T cells leads to

spontaneous T cell differentiation and autoimmune disease. Immunity 12:171-181. Gorelik, L., and R.A. Flavell. 2002. Transforming growth factor-beta in T-cell biology.

Nature reviews. Immunology 2:46-53. Grohmann, U., C. Orabona, F. Fallarino, C. Vacca, F. Calcinaro, A. Falorni, P.

Candeloro, M.L. Belladonna, R. Bianchi, M.C. Fioretti, and P. Puccetti. 2002. CTLA-4-Ig regulates tryptophan catabolism in vivo. Nature immunology 3:1097-1101.

Gross, A., S.Z. Ben-Sasson, and W.E. Paul. 1993. Anti-IL-4 diminishes in vivo priming

for antigen-specific IL-4 production by T cells. J Immunol 150:2112-2120. Gross, A., J.M. McDonnell, and S.J. Korsmeyer. 1999. BCL-2 family members and the

mitochondria in apoptosis. Genes & development 13:1899-1911.

113 Guo, L., J. Tian, E. Marinova, B. Zheng, and S. Han. 2010. Inhibition of clonal

expansion by Foxp3 expression as a mechanism of controlled T-cell responses and autoimmune disease. European journal of immunology 40:71-80.

Han, S., S.M. Knoepp, M.A. Hallman, and K.E. Meier. 2007. RasGRP1 confers the

phorbol ester-sensitive phenotype to EL4 lymphoma cells. Molecular pharmacology 71:314-322.

Heinzel, F.P., and R.A. Maier, Jr. 1999. Interleukin-4-independent acceleration of

cutaneous leishmaniasis in susceptible BALB/c mice following treatment with anti-CTLA4 antibody. Infection and immunity 67:6454-6460.

Hildeman, D.A., Y. Zhu, T.C. Mitchell, P. Bouillet, A. Strasser, J. Kappler, and P.

Marrack. 2002. Activated T cell death in vivo mediated by proapoptotic bcl-2 family member bim. Immunity 16:759-767.

Hofstetter, H.H., S.M. Ibrahim, D. Koczan, N. Kruse, A. Weishaupt, K.V. Toyka, and R.

Gold. 2005. Therapeutic efficacy of IL-17 neutralization in murine experimental autoimmune encephalomyelitis. Cellular immunology 237:123-130.

Hori, S., T. Nomura, and S. Sakaguchi. 2003. Control of regulatory T cell development

by the transcription factor Foxp3. Science 299:1057-1061. Hoshino, Y., Y. Katsuno, S. Ehata, and K. Miyazono. 2011. Autocrine TGF-beta protects

breast cancer cells from apoptosis through reduction of BH3-only protein, Bim. Journal of biochemistry 149:55-65.

Hutcheson, J., J.C. Scatizzi, A.M. Siddiqui, G.K. Haines, 3rd, T. Wu, Q.Z. Li, L.S. Davis,

C. Mohan, and H. Perlman. 2008. Combined deficiency of proapoptotic regulators Bim and Fas results in the early onset of systemic autoimmunity. Immunity 28:206-217.

Itoh, M., T. Takahashi, N. Sakaguchi, Y. Kuniyasu, J. Shimizu, F. Otsuka, and S.

Sakaguchi. 1999. Thymus and autoimmunity: production of CD25+CD4+ naturally anergic and suppressive T cells as a key function of the thymus in maintaining immunologic self-tolerance. J Immunol 162:5317-5326.

Ivanov, II, B.S. McKenzie, L. Zhou, C.E. Tadokoro, A. Lepelley, J.J. Lafaille, D.J. Cua,

and D.R. Littman. 2006. The orphan nuclear receptor RORgammat directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell 126:1121-1133.

114 Iwashima, M., B.A. Irving, N.S. van Oers, A.C. Chan, and A. Weiss. 1994.

Sequential interactions of the TCR with two distinct cytoplasmic tyrosine kinases. Science 263:1136-1139.

Jager, A., V. Dardalhon, R.A. Sobel, E. Bettelli, and V.K. Kuchroo. 2009. Th1, Th17,

and Th9 effector cells induce experimental autoimmune encephalomyelitis with different pathological phenotypes. J Immunol 183:7169-7177.

Jain, J., C. Loh, and A. Rao. 1995. Transcriptional regulation of the IL-2 gene. Current

opinion in immunology 7:333-342. Jung, Y.J., J.Y. Kim, and J.H. Park. 2004. TGF-beta1 inhibits Fas-mediated apoptosis by

regulating surface Fas and cFLIPL expression in human leukaemia/lymphoma cells. International journal of molecular medicine 13:99-104.

Kane, L.P., J. Lin, and A. Weiss. 2000. Signal transduction by the TCR for antigen.

Current opinion in immunology 12:242-249. Karin, M., Z. Liu, and E. Zandi. 1997. AP-1 function and regulation. Current opinion in

cell biology 9:240-246. Kearley, J., J.S. Erjefalt, C. Andersson, E. Benjamin, C.P. Jones, A. Robichaud, S.

Pegorier, Y. Brewah, T.J. Burwell, L. Bjermer, P.A. Kiener, R. Kolbeck, C.M. Lloyd, A.J. Coyle, and A.A. Humbles. 2011. IL-9 governs allergen-induced mast cell numbers in the lung and chronic remodeling of the airways. American journal of respiratory and critical care medicine 183:865-875.

Kimura, A., and T. Kishimoto. 2010. IL-6: regulator of Treg/Th17 balance. European

journal of immunology 40:1830-1835. Kischkel, F.C., S. Hellbardt, I. Behrmann, M. Germer, M. Pawlita, P.H. Krammer, and

M.E. Peter. 1995. Cytotoxicity-dependent APO-1 (Fas/CD95)-associated proteins form a death-inducing signaling complex (DISC) with the receptor. The EMBO journal 14:5579-5588.

Knoechel, B., J. Lohr, E. Kahn, J.A. Bluestone, and A.K. Abbas. 2005. Sequential

development of interleukin 2-dependent effector and regulatory T cells in response to endogenous systemic antigen. The Journal of experimental medicine 202:1375-1386.

Komiyama, Y., S. Nakae, T. Matsuki, A. Nambu, H. Ishigame, S. Kakuta, K. Sudo, and

Y. Iwakura. 2006. IL-17 plays an important role in the development of experimental autoimmune encephalomyelitis. J Immunol 177:566-573.

115 Kotake, S., N. Udagawa, N. Takahashi, K. Matsuzaki, K. Itoh, S. Ishiyama, S. Saito,

K. Inoue, N. Kamatani, M.T. Gillespie, T.J. Martin, and T. Suda. 1999. IL-17 in synovial fluids from patients with rheumatoid arthritis is a potent stimulator of osteoclastogenesis. The Journal of clinical investigation 103:1345-1352.

Krammer, P.H. 2000. CD95's deadly mission in the immune system. Nature 407:789-

795. Kretschmer, K., I. Apostolou, D. Hawiger, K. Khazaie, M.C. Nussenzweig, and H. von

Boehmer. 2005. Inducing and expanding regulatory T cell populations by foreign antigen. Nature immunology 6:1219-1227.

Kronenberg, M., M. Steinmetz, J. Kobori, E. Kraig, J.A. Kapp, C.W. Pierce, C.M.

Sorensen, G. Suzuki, T. Tada, and L. Hood. 1983. RNA transcripts for I-J polypeptides are apparently not encoded between the I-A and I-E subregions of the murine major histocompatibility complex. Proceedings of the National Academy of Sciences of the United States of America 80:5704-5708.

Kuczma, M., I. Pawlikowska, M. Kopij, R. Podolsky, G.A. Rempala, and P. Kraj. 2009.

TCR repertoire and Foxp3 expression define functionally distinct subsets of CD4+ regulatory T cells. J Immunol 183:3118-3129.

Kulkarni, A.B., C.G. Huh, D. Becker, A. Geiser, M. Lyght, K.C. Flanders, A.B. Roberts,

M.B. Sporn, J.M. Ward, and S. Karlsson. 1993. Transforming growth factor beta 1 null mutation in mice causes excessive inflammatory response and early death. Proceedings of the National Academy of Sciences of the United States of America 90:770-774.

Kulkarni, A.B., and S. Karlsson. 1993. Transforming growth factor-beta 1 knockout

mice. A mutation in one cytokine gene causes a dramatic inflammatory disease. The American journal of pathology 143:3-9.

Kurata, H., H.J. Lee, A. O'Garra, and N. Arai. 1999. Ectopic expression of activated Stat6

induces the expression of Th2-specific cytokines and transcription factors in developing Th1 cells. Immunity 11:677-688.

LA, O.R., L. Tai, L. Lee, E.A. Kruse, S. Grabow, W.D. Fairlie, N.M. Haynes, D.M.

Tarlinton, J.G. Zhang, G.T. Belz, M.J. Smyth, P. Bouillet, L. Robb, and A. Strasser. 2009. Membrane-bound Fas ligand only is essential for Fas-induced apoptosis. Nature 461:659-663.

Layer, K., G. Lin, A. Nencioni, W. Hu, A. Schmucker, A.N. Antov, X. Li, S. Takamatsu,

T. Chevassut, N.A. Dower, S.L. Stang, D. Beier, J. Buhlmann, R.T. Bronson,

116 K.B. Elkon, J.C. Stone, L. Van Parijs, and B. Lim. 2003. Autoimmunity as the consequence of a spontaneous mutation in Rasgrp1. Immunity 19:243-255.

Lenardo, M.J. 1991. Interleukin-2 programs mouse alpha beta T lymphocytes for apoptosis. Nature 353:858-861.

Levine, A.J. 1997. p53, the cellular gatekeeper for growth and division. Cell 88:323-331. Levings, M.K., R. Sangregorio, and M.G. Roncarolo. 2001. Human cd25(+)cd4(+) t

regulatory cells suppress naive and memory T cell proliferation and can be expanded in vitro without loss of function. The Journal of experimental medicine 193:1295-1302.

Li, M.O., and R.A. Flavell. 2008. TGF-beta: a master of all T cell trades. Cell 134:392-

404. Li, M.O., S. Sanjabi, and R.A. Flavell. 2006a. Transforming growth factor-beta controls

development, homeostasis, and tolerance of T cells by regulatory T cell-dependent and -independent mechanisms. Immunity 25:455-471.

Li, M.O., Y.Y. Wan, S. Sanjabi, A.K. Robertson, and R.A. Flavell. 2006b. Transforming

growth factor-beta regulation of immune responses. Annual review of immunology 24:99-146.

Li, Y., W. Tan, T.W. Neo, M.O. Aung, S. Wasser, S.G. Lim, and T.M. Tan. 2009. Role

of the miR-106b-25 microRNA cluster in hepatocellular carcinoma. Cancer science 100:1234-1242.

Lin, L., and S.L. Peng. 2006. Coordination of NF-kappaB and NFAT antagonism by the

forkhead transcription factor Foxd1. J Immunol 176:4793-4803. Liu, V.C., L.Y. Wong, T. Jang, A.H. Shah, I. Park, X. Yang, Q. Zhang, S. Lonning, B.A.

Teicher, and C. Lee. 2007. Tumor evasion of the immune system by converting CD4+CD25- T cells into CD4+CD25+ T regulatory cells: role of tumor-derived TGF-beta. J Immunol 178:2883-2892.

Lopes, J.E., T.R. Torgerson, L.A. Schubert, S.D. Anover, E.L. Ocheltree, H.D. Ochs, and

S.F. Ziegler. 2006. Analysis of FOXP3 reveals multiple domains required for its function as a transcriptional repressor. J Immunol 177:3133-3142.

Lorenzo, P.S., M. Beheshti, G.R. Pettit, J.C. Stone, and P.M. Blumberg. 2000. The

guanine nucleotide exchange factor RasGRP is a high -affinity target for diacylglycerol and phorbol esters. Molecular pharmacology 57:840-846.

117 Lu, X., J. Liu, H. Li, W. Li, X. Wang, J. Ma, Q. Tong, K. Wu, and G. Wang. 2011.

Conversion of intratumoral regulatory T cells by human gastric cancer cells is dependent on transforming growth factor-beta1. Journal of surgical oncology 104:571-577.

Maas, K., M. Westfall, J. Pietenpol, N.J. Olsen, and T. Aune. 2005. Reduced p53 in

peripheral blood mononuclear cells from patients with rheumatoid arthritis is associated with loss of radiation-induced apoptosis. Arthritis and rheumatism 52:1047-1057.

Madakamutil, L.T., I. Maricic, E.E. Sercarz, and V. Kumar. 2008. Immunodominance in

the TCR repertoire of a [corrected] TCR peptide-specific CD4+ Treg population that controls experimental autoimmune encephalomyelitis. J Immunol 180:4577-4585.

Manel, N., D. Unutmaz, and D.R. Littman. 2008. The differentiation of human T(H)-17

cells requires transforming growth factor-beta and induction of the nuclear receptor RORgammat. Nature immunology 9:641-649.

Mangan, P.R., L.E. Harrington, D.B. O'Quinn, W.S. Helms, D.C. Bullard, C.O. Elson,

R.D. Hatton, S.M. Wahl, T.R. Schoeb, and C.T. Weaver. 2006. Transforming growth factor-beta induces development of the T(H)17 lineage. Nature 441:231-234.

Mariathasan, S., A. Zakarian, D. Bouchard, A.M. Michie, J.C. Zuniga-Pflucker, and P.S.

Ohashi. 2001. Duration and strength of extracellular signal-regulated kinase signals are altered during positive versus negative thymocyte selection. J Immunol 167:4966-4973.

Marodi, L., S. Schreiber, D.C. Anderson, R.P. MacDermott, H.M. Korchak, and R.B.

Johnston, Jr. 1993. Enhancement of macrophage candidacidal activity by interferon-gamma. Increased phagocytosis, killing, and calcium signal mediated by a decreased number of mannose receptors. The Journal of clinical investigation 91:2596-2601.

Marson, A., K. Kretschmer, G.M. Frampton, E.S. Jacobsen, J.K. Polansky, K.D.

MacIsaac, S.S. Levine, E. Fraenkel, H. von Boehmer, and R.A. Young. 2007. Foxp3 occupancy and regulation of key target genes during T-cell stimulation. Nature 445:931-935.

Martin, P., M.C. Poggi, J.C. Chambard, K.E. Boulukos, and P. Pognonec. 2006. Low

dose cadmium poisoning results in sustained ERK phosphorylation and caspase activation. Biochemical and biophysical research communications 350:803-807.

118 Masli, S., B. Turpie, and J.W. Streilein. 2006. Thrombospondin orchestrates the

tolerance-promoting properties of TGFbeta-treated antigen-presenting cells. International immunology 18:689-699.

Mellor, A.L., and D.H. Munn. 2004. IDO expression by dendritic cells: tolerance and

tryptophan catabolism. Nature reviews. Immunology 4:762-774. Mosmann, T.R., H. Cherwinski, M.W. Bond, M.A. Giedlin, and R.L. Coffman. 1986.

Two types of murine helper T cell clone. I. Definition according to profiles of lymphokine activities and secreted proteins. J Immunol 136:2348-2357.

Mosmann, T.R., and R.L. Coffman. 1989. TH1 and TH2 cells: different patterns of

lymphokine secretion lead to different functional properties. Annual review of immunology 7:145-173.

Mucida, D., N. Kutchukhidze, A. Erazo, M. Russo, J.J. Lafaille, and M.A. Curotto de

Lafaille. 2005. Oral tolerance in the absence of naturally occurring Tregs. The Journal of clinical investigation 115:1923-1933.

Murillo, M.M., G. del Castillo, A. Sanchez, M. Fernandez, and I. Fabregat. 2005.

Involvement of EGF receptor and c-Src in the survival signals induced by TGF-beta1 in hepatocytes. Oncogene 24:4580-4587.

Myers, A.K., L. Perroni, C. Costigan, and W. Reardon. 2006. Clinical and molecular

findings in IPEX syndrome. Archives of disease in childhood 91:63-64. Nagata, S. 1997. Apoptosis by death factor. Cell 88:355-365. Nakae, S., A. Nambu, K. Sudo, and Y. Iwakura. 2003. Suppression of immune induction

of collagen-induced arthritis in IL-17-deficient mice. J Immunol 171:6173-6177. Nakamura, K., A. Kitani, and W. Strober. 2001. Cell contact-dependent

immunosuppression by CD4(+)CD25(+) regulatory T cells is mediated by cell surface-bound transforming growth factor beta. The Journal of experimental medicine 194:629-644.

Nicholson, L.B., and V.K. Kuchroo. 1996. Manipulation of the Th1/Th2 balance in

autoimmune disease. Current opinion in immunology 8:837-842. Nishibe, S., M.I. Wahl, S.M. Hernandez-Sotomayor, N.K. Tonks, S.G. Rhee, and G.

Carpenter. 1990. Increase of the catalytic activity of phospholipase C-gamma 1 by tyrosine phosphorylation. Science 250:1253-1256.

119 Norment, A.M., L.Y. Bogatzki, M. Klinger, E.W. Ojala, M.J. Bevan, and R.J. Kay.

2003. Transgenic expression of RasGRP1 induces the maturation of double-negative thymocytes and enhances the production of CD8 single-positive thymocytes. J Immunol 170:1141-1149.

Nowak, E.C., C.T. Weaver, H. Turner, S. Begum-Haque, B. Becher, B. Schreiner, A.J.

Coyle, L.H. Kasper, and R.J. Noelle. 2009. IL-9 as a mediator of Th17-driven inflammatory disease. The Journal of experimental medicine 206:1653-1660.

O'Connor, L., A. Strasser, L.A. O'Reilly, G. Hausmann, J.M. Adams, S. Cory, and D.C.

Huang. 1998. Bim: a novel member of the Bcl-2 family that promotes apoptosis. The EMBO journal 17:384-395.

Oderup, C., L. Cederbom, A. Makowska, C.M. Cilio, and F. Ivars. 2006. Cytotoxic T

lymphocyte antigen-4-dependent down-modulation of costimulatory molecules on dendritic cells in CD4+ CD25+ regulatory T-cell-mediated suppression. Immunology 118:240-249.

Oida, T., and H.L. Weiner. 2010. TGF-beta induces surface LAP expression on murine

CD4 T cells independent of Foxp3 induction. PloS one 5:e15523. Okuda, Y., M. Okuda, and C.C. Bernard. 2003. Regulatory role of p53 in experimental

autoimmune encephalomyelitis. Journal of neuroimmunology 135:29-37. Ouyang, W., O. Beckett, Q. Ma, and M.O. Li. 2010. Transforming growth factor-beta

signaling curbs thymic negative selection promoting regulatory T cell development. Immunity 32:642-653.

Overdier, D.G., A. Porcella, and R.H. Costa. 1994. The DNA-binding specificity of the

hepatocyte nuclear factor 3/forkhead domain is influenced by amino-acid residues adjacent to the recognition helix. Molecular and cellular biology 14:2755-2766.

Pan, W., S. Zhu, M. Yuan, H. Cui, L. Wang, X. Luo, J. Li, H. Zhou, Y. Tang, and N.

Shen. 2010. MicroRNA-21 and microRNA-148a contribute to DNA hypomethylation in lupus CD4+ T cells by directly and indirectly targeting DNA methyltransferase 1. J Immunol 184:6773-6781.

Pandiyan, P., L. Zheng, S. Ishihara, J. Reed, and M.J. Lenardo. 2007.

CD4+CD25+Foxp3+ regulatory T cells induce cytokine deprivation-mediated apoptosis of effector CD4+ T cells. Nature immunology 8:1353-1362.

Peng, Y., Y. Laouar, M.O. Li, E.A. Green, and R.A. Flavell. 2004. TGF-beta regulates in

vivo expansion of Foxp3-expressing CD4+CD25+ regulatory T cells responsible

120 for protection against diabetes. Proceedings of the National Academy of Sciences of the United States of America 101:4572-4577.

Petrocca, F., A. Vecchione, and C.M. Croce. 2008. Emerging role of miR-106b-25/miR-

17-92 clusters in the control of transforming growth factor beta signaling. Cancer research 68:8191-8194.

Priatel, J.J., X. Chen, L.A. Zenewicz, H. Shen, K.W. Harder, M.S. Horwitz, and H.S.

Teh. 2007. Chronic immunodeficiency in mice lacking RasGRP1 results in CD4 T cell immune activation and exhaustion. J Immunol 179:2143-2152.

Ramos, J.W. 2008. The regulation of extracellular signal-regulated kinase (ERK) in

mammalian cells. The international journal of biochemistry & cell biology 40:2707-2719.

Ravichandran, K.S., U. Lorenz, S.E. Shoelson, and S.J. Burakoff. 1995. Interaction of

Shc with Grb2 regulates the Grb2 association with mSOS. Annals of the New York Academy of Sciences 766:202-203.

Refaeli, Y., L. Van Parijs, C.A. London, J. Tschopp, and A.K. Abbas. 1998. Biochemical

mechanisms of IL-2-regulated Fas-mediated T cell apoptosis. Immunity 8:615-623.

Roose, J.P., M. Mollenauer, V.A. Gupta, J. Stone, and A. Weiss. 2005. A diacylglycerol-

protein kinase C-RasGRP1 pathway directs Ras activation upon antigen receptor stimulation of T cells. Molecular and cellular biology 25:4426-4441.

Rouas, R., H. Fayyad-Kazan, N. El Zein, P. Lewalle, F. Rothe, A. Simion, H. Akl, M.

Mourtada, M. El Rifai, A. Burny, P. Romero, P. Martiat, and B. Badran. 2009. Human natural Treg microRNA signature: role of microRNA-31 and microRNA-21 in FOXP3 expression. European journal of immunology 39:1608-1618.

Sakaguchi, S., N. Sakaguchi, M. Asano, M. Itoh, and M. Toda. 1995. Immunologic self-

tolerance maintained by activated T cells expressing IL-2 receptor alpha-chains (CD25). Breakdown of a single mechanism of self-tolerance causes various autoimmune diseases. J Immunol 155:1151-1164.

Sandalova, E., C.H. Wei, M.G. Masucci, and V. Levitsky. 2004. Regulation of expression

of Bcl-2 protein family member Bim by T cell receptor triggering. Proceedings of the National Academy of Sciences of the United States of America 101:3011-3016.

Schmitt, E., T. Germann, S. Goedert, P. Hoehn, C. Huels, S. Koelsch, R. Kuhn, W.

Muller, N. Palm, and E. Rude. 1994. IL-9 production of naive CD4+ T cells

121 depends on IL-2, is synergistically enhanced by a combination of TGF-beta and IL-4, and is inhibited by IFN-gamma. J Immunol 153:3989-3996.

Schubert, L.A., E. Jeffery, Y. Zhang, F. Ramsdell, and S.F. Ziegler. 2001. Scurfin

(FOXP3) acts as a repressor of transcription and regulates T cell activation. The Journal of biological chemistry 276:37672-37679.

Schulman, E.S., M.C. McGettigan, T.J. Post, R.J. Vigderman, and S.S. Shapiro. 1988.

Human monocytes generate basophil histamine-releasing activities. J Immunol 140:2369-2375.

Selmaj, K., C.S. Raine, B. Cannella, and C.F. Brosnan. 1991. Identification of

lymphotoxin and tumor necrosis factor in multiple sclerosis lesions. The Journal of clinical investigation 87:949-954.

Selvaraj, R.K., and T.L. Geiger. 2007. A kinetic and dynamic analysis of Foxp3 induced

in T cells by TGF-beta. J Immunol 178:7667-7677. Shi, Y.F., B.M. Sahai, and D.R. Green. 1989. Cyclosporin A inhibits activation-induced

cell death in T-cell hybridomas and thymocytes. Nature 339:625-626. Shimoda, K., J. van Deursen, M.Y. Sangster, S.R. Sarawar, R.T. Carson, R.A. Tripp, C.

Chu, F.W. Quelle, T. Nosaka, D.A. Vignali, P.C. Doherty, G. Grosveld, W.E. Paul, and J.N. Ihle. 1996. Lack of IL-4-induced Th2 response and IgE class switching in mice with disrupted Stat6 gene. Nature 380:630-633.

Shull, M.M., I. Ormsby, A.B. Kier, S. Pawlowski, R.J. Diebold, M. Yin, R. Allen, C.

Sidman, G. Proetzel, D. Calvin, and et al. 1992. Targeted disruption of the mouse transforming growth factor-beta 1 gene results in multifocal inflammatory disease. Nature 359:693-699.

Sillett, H.K., S.M. Cruickshank, J. Southgate, and L.K. Trejdosiewicz. 2001.

Transforming growth factor-beta promotes 'death by neglect' in post-activated human T cells. Immunology 102:310-316.

Simelyte, E., S. Rosengren, D.L. Boyle, M. Corr, D.R. Green, and G.S. Firestein. 2005.

Regulation of arthritis by p53: critical role of adaptive immunity. Arthritis and rheumatism 52:1876-1884.

Singh, N., M. Yamamoto, M. Takami, Y. Seki, M. Takezaki, A.L. Mellor, and M.

Iwashima. 2010a. CD4(+)CD25(+) regulatory T cells resist a novel form of CD28- and Fas-dependent p53-induced T cell apoptosis. J Immunol 184:94-104.

122 Singh, Y., C. Ferreira, A.C. Chan, J. Dyson, and O.A. Garden. 2010b. Restricted

TCR-alpha CDR3 diversity disadvantages natural regulatory T cell development in the B6.2.16 beta-chain transgenic mouse. J Immunol 185:3408-3416.

Snow, A.L., J.B. Oliveira, L. Zheng, J.K. Dale, T.A. Fleisher, and M.J. Lenardo. 2008.

Critical role for BIM in T cell receptor restimulation-induced death. Biology direct 3:34.

Sofi, M.H., Z. Liu, L. Zhu, Q. Yu, M.H. Kaplan, and C.H. Chang. 2010. Regulation of

IL-17 expression by the developmental pathway of CD4 T cells in the thymus. Molecular immunology 47:1262-1268.

Soroosh, P., and T.A. Doherty. 2009. Th9 and allergic disease. Immunology 127:450-458. Stang, S.L., A. Lopez-Campistrous, X. Song, N.A. Dower, P.M. Blumberg, P.A. Wender,

and J.C. Stone. 2009. A proapoptotic signaling pathway involving RasGRP, Erk, and Bim in B cells. Experimental hematology 37:122-134.

Stankunas, K., I.A. Graef, J.R. Neilson, S.H. Park, and G.R. Crabtree. 1999. Signaling

through calcium, calcineurin, and NF-AT in lymphocyte activation and development. Cold Spring Harbor symposia on quantitative biology 64:505-516.

Straus, D.B., A.C. Chan, B. Patai, and A. Weiss. 1996. SH2 domain function is essential

for the role of the Lck tyrosine kinase in T cell receptor signal transduction. The Journal of biological chemistry 271:9976-9981.

Suen, W.E., C.M. Bergman, P. Hjelmstrom, and N.H. Ruddle. 1997. A critical role for

lymphotoxin in experimental allergic encephalomyelitis. The Journal of experimental medicine 186:1233-1240.

Sugimoto, N., T. Oida, K. Hirota, K. Nakamura, T. Nomura, T. Uchiyama, and S.

Sakaguchi. 2006. Foxp3-dependent and -independent molecules specific for CD25+CD4+ natural regulatory T cells revealed by DNA microarray analysis. International immunology 18:1197-1209.

Swain, S.L., A.D. Weinberg, M. English, and G. Huston. 1990. IL-4 directs the

development of Th2-like helper effectors. J Immunol 145:3796-3806. Swat, W., Y. Shinkai, H.L. Cheng, L. Davidson, and F.W. Alt. 1996. Activated Ras

signals differentiation and expansion of CD4+8+ thymocytes. Proceedings of the National Academy of Sciences of the United States of America 93:4683-4687.

123 Szabo, S.J., S.T. Kim, G.L. Costa, X. Zhang, C.G. Fathman, and L.H. Glimcher.

2000. A novel transcription factor, T-bet, directs Th1 lineage commitment. Cell 100:655-669.

Takahashi, T., T. Tagami, S. Yamazaki, T. Uede, J. Shimizu, N. Sakaguchi, T.W. Mak,

and S. Sakaguchi. 2000. Immunologic self-tolerance maintained by CD25(+)CD4(+) regulatory T cells constitutively expressing cytotoxic T lymphocyte-associated antigen 4. The Journal of experimental medicine 192:303-310.

Temann, U.A., P. Ray, and R.A. Flavell. 2002. Pulmonary overexpression of IL-9

induces Th2 cytokine expression, leading to immune pathology. The Journal of clinical investigation 109:29-39.

Tognon, C.E., H.E. Kirk, L.A. Passmore, I.P. Whitehead, C.J. Der, and R.J. Kay. 1998.

Regulation of RasGRP via a phorbol ester-responsive C1 domain. Molecular and cellular biology 18:6995-7008.

Tone, Y., K. Furuuchi, Y. Kojima, M.L. Tykocinski, M.I. Greene, and M. Tone. 2008.

Smad3 and NFAT cooperate to induce Foxp3 expression through its enhancer. Nature immunology 9:194-202.

Tran, D.Q., J. Andersson, R. Wang, H. Ramsey, D. Unutmaz, and E.M. Shevach. 2009.

GARP (LRRC32) is essential for the surface expression of latent TGF-beta on platelets and activated FOXP3+ regulatory T cells. Proceedings of the National Academy of Sciences of the United States of America 106:13445-13450.

van der Heide, L.P., M. van Dinther, A. Moustakas, and P. ten Dijke. 2011. TGFbeta

activates mitogen- and stress-activated protein kinase-1 (MSK1) to attenuate cell death. The Journal of biological chemistry 286:5003-5011.

Veldhoen, M., R.J. Hocking, C.J. Atkins, R.M. Locksley, and B. Stockinger. 2006.

TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells. Immunity 24:179-189.

Waldmann, T.A., S. Dubois, and Y. Tagaya. 2001. Contrasting roles of IL-2 and IL-15 in

the life and death of lymphocytes: implications for immunotherapy. Immunity 14:105-110.

Wan, Y.Y., and R.A. Flavell. 2005. Identifying Foxp3-expressing suppressor T cells with

a bicistronic reporter. Proceedings of the National Academy of Sciences of the United States of America 102:5126-5131.

124 Wange, R.L., S.N. Malek, S. Desiderio, and L.E. Samelson. 1993. Tandem SH2

domains of ZAP-70 bind to T cell antigen receptor zeta and CD3 epsilon from activated Jurkat T cells. The Journal of biological chemistry 268:19797-19801.

Werlen, G., B. Hausmann, D. Naeher, and E. Palmer. 2003. Signaling life and death in

the thymus: timing is everything. Science 299:1859-1863. Wiener, Z., A. Falus, and S. Toth. 2004. IL-9 increases the expression of several

cytokines in activated mast cells, while the IL-9-induced IL-9 production is inhibited in mast cells of histamine-free transgenic mice. Cytokine 26:122-130.

Wong, C.K., L.C. Lit, L.S. Tam, E.K. Li, P.T. Wong, and C.W. Lam. 2008.

Hyperproduction of IL-23 and IL-17 in patients with systemic lupus erythematosus: implications for Th17-mediated inflammation in auto-immunity. Clin Immunol 127:385-393.

Wu, Y., M. Borde, V. Heissmeyer, M. Feuerer, A.D. Lapan, J.C. Stroud, D.L. Bates, L.

Guo, A. Han, S.F. Ziegler, D. Mathis, C. Benoist, L. Chen, and A. Rao. 2006. FOXP3 controls regulatory T cell function through cooperation with NFAT. Cell 126:375-387.

Xavier, R., T. Brennan, Q. Li, C. McCormack, and B. Seed. 1998. Membrane

compartmentation is required for efficient T cell activation. Immunity 8:723-732. Xing, J., Y. Wu, and B. Ni. 2011. Th9: a new player in asthma pathogenesis? The Journal

of asthma : official journal of the Association for the Care of Asthma 48:115-125. Yang, L., Y. Pang, and H.L. Moses. 2010. TGF-beta and immune cells: an important

regulatory axis in the tumor microenvironment and progression. Trends in immunology 31:220-227.

Yasuda, S., R.L. Stevens, T. Terada, M. Takeda, T. Hashimoto, J. Fukae, T. Horita, H.

Kataoka, T. Atsumi, and T. Koike. 2007. Defective expression of Ras guanyl nucleotide-releasing protein 1 in a subset of patients with systemic lupus erythematosus. J Immunol 179:4890-4900.

Ye, P., P.B. Garvey, P. Zhang, S. Nelson, G. Bagby, W.R. Summer, P. Schwarzenberger,

J.E. Shellito, and J.K. Kolls. 2001. Interleukin-17 and lung host defense against Klebsiella pneumoniae infection. American journal of respiratory cell and molecular biology 25:335-340.

Yehualaeshet, T., R. O'Connor, J. Green-Johnson, S. Mai, R. Silverstein, J.E. Murphy-

Ullrich, and N. Khalil. 1999. Activation of rat alveolar macrophage-derived latent transforming growth factor beta-1 by plasmin requires interaction with

125 thrombospondin-1 and its cell surface receptor, CD36. The American journal of pathology 155:841-851.

Yin, Z., C. Chen, S.J. Szabo, L.H. Glimcher, A. Ray, and J. Craft. 2002. T-Bet expression

and failure of GATA-3 cross-regulation lead to default production of IFN-gamma by gammadelta T cells. J Immunol 168:1566-1571.

Zhang, W., J. Sloan-Lancaster, J. Kitchen, R.P. Trible, and L.E. Samelson. 1998. LAT:

the ZAP-70 tyrosine kinase substrate that links T cell receptor to cellular activation. Cell 92:83-92.

Zhao, Y., J. Yang, Y.D. Gao, and W. Guo. 2010. Th17 immunity in patients with allergic

asthma. International archives of allergy and immunology 151:297-307. Zheng, S.J., S.E. Lamhamedi-Cherradi, P. Wang, L. Xu, and Y.H. Chen. 2005. Tumor

suppressor p53 inhibits autoimmune inflammation and macrophage function. Diabetes 54:1423-1428.

Zheng, Y., S.Z. Josefowicz, A. Kas, T.T. Chu, M.A. Gavin, and A.Y. Rudensky. 2007.

Genome-wide analysis of Foxp3 target genes in developing and mature regulatory T cells. Nature 445:936-940.

Zhou, Y., M. McLane, and R.C. Levitt. 2001. Th2 cytokines and asthma. Interleukin-9 as

a therapeutic target for asthma. Respiratory research 2:80-84. Zhu, J., L. Guo, C.J. Watson, J. Hu-Li, and W.E. Paul. 2001. Stat6 is necessary and

sufficient for IL-4's role in Th2 differentiation and cell expansion. J Immunol 166:7276-7281.

Zhu, Y., B.J. Swanson, M. Wang, D.A. Hildeman, B.C. Schaefer, X. Liu, H. Suzuki, K.

Mihara, J. Kappler, and P. Marrack. 2004. Constitutive association of the proapoptotic protein Bim with Bcl-2-related proteins on mitochondria in T cells. Proceedings of the National Academy of Sciences of the United States of America 101:7681-7686.

Ziegler, S.F. 2006. FOXP3: of mice and men. Annual review of immunology 24:209-226.

126

VITA

The author, Mariko Takami was born in Aichi, Japan on April 6, 1978 to Yoshio and

Yukiko Takami. She received a Master of Science in Marine biology from Mie

University (Tsu, Mie, Japan) in March of 2003. After graduation, Mariko worked as a

research assistant in the lab of Dr. Kunihiro Matsumoto, Nagoya University, Aichi, Japan

(2003- 2004) and in the lab of Dr. Makio Iwashima, Medical College of Georgia,

Augusta, GA (2004- 2006).

In August of 2006, Mariko enrolled at the graduate program of Biomedical

Sciences, Medical College of Georgia (Augusta, GA) and joined the lab of Dr. Makio

Iwashima. In August of 2007, Mariko transferred to the graduate program at the

Department of Microbiology and Immunology, Loyola University Chicago with Dr.

Iwashima, where she studied the cell biology of CD4+CD25+ regulatory T cells. She

focused on determining the survival mechanism of CD4+CD25+Treg cells during an

immune response.