cell cycle regulation of the murine cdc25b promoter: essential role
TRANSCRIPT
Cell cycle regulation of the murine cdc25B promoter:
essential role for NF-Y and a proximal repressor element1
Kathrin Körner, Valérie Jérôme, Thorsten Schmidt and Rolf Müller2
From the Institute of Molecular Biology and Tumor Research (IMT)
Philipps University, Emil-Mannkopff-Strasse 2
35033 Marburg, Germany
Running title: Cell cycle regulation of cdc25B transcription
Keywords: cell cycle regulation, cdc25B promoter, transcriptional control,
transcriptional repression, NF-Y/CBF
1This work was supported by grants
from the Deutsche Forschungsgemeinschaft (SFB397/C1, Mu601/9-2)
2To whom requests for reprints should be addressed, at
Institut für Molekularbiologie und Tumorforschung (IMT),
Emil-Mannkopff-Strasse 2, 35033 Marburg, Germany
Tel +49 6421 28 66236; Fax +49 6421 28 68923; [email protected]
JBC Papers in Press. Published on December 4, 2000 as Manuscript M008696200 by guest on February 18, 2018
http://ww
w.jbc.org/
Dow
nloaded from
- 2 -
SUMMARY
Expression of the cdc25B gene is upregulated late during cell cycle progression
(S/G2). We have cloned the murine cdc25B promoter to identify elements involved
in transcriptional regulation. A detailed structure-function analysis led to the
identification of several elements that are located upstream of a canonical Inr
motif at the site of transcription initiation and are involved in transcriptional
activation and regulation. Activation of the promoter is largely mediated by NF-
Y and Sp1/3 interacting with one and four proximal binding sites, respectively.
In addition, NF-Y plays an essential role in cell cycle regulation in conjunction
with a repressor element (CCRR) located ~30 nucleotides upstream of the
putative Inr element and overlapping a consensus TATA motif. The CCRR is
unrelated to the previously described cell cycle-regulated repressor elements.
Taken together, our observations suggest that expression of the cdc25B gene is
controlled through a novel mechanism of cell cycle-regulated transcription.
3The abbreviations used are: CDE, cell cycle-dependent element; CDF, CDE-binding factor;
CHR, cell cycle genes homology region; DMS, dimethyl sulfate; LMPCR, ligation-mediated
PCR; NF-Y, nuclear factor-Y; Rb: retinoblastoma protein.
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 3 -
INTRODUCTION
Cell cycle progression in mammalian cells is associated with the phase-specific
transcription of defined sets of genes (1). Such periodically expressed genes frequently
encode proteins that either directly control cell cycle progression or function in
periodically occurring metabolic processes, such as nucleotide and DNA biosynthesis. A
major regulator of the cell cycle-dependent expression of these genes is the transcription
factor E2F (2-4). Transcriptionally inactive complexes of E2F with pocket proteins of the
pRb family assemble in Go/early G1, but during cell cycle progression these complexes
dissociate, and the release of transcriptionally active "free E2F" leads to the activation of
E2F-responsive genes. It has become clear, however, that E2F can also act either as an
active repressor, which, at least in part, appears to be due to the Rb3-mediated recruitment
of histone deacetylases. The first example of a gene that is repressed by E2F is the mouse
B-myb gene (5), but a number of other genes repressed via E2F sites in their promoters
have been identified, for example, E2F-1 (6, 7), orc-1 (8), cdc 6 (9-11), cdc25A (12, 13)
and p107 (14). Interestingly, structure-function analysis of the B-myb promoter identified
an E2F binding site close to the transcription start sites which is necessary but not
sufficient for cell cycle regulation (15, 16). Mutational analyses showed that an adjacent
element, termed Bmyb-CHR, is indispensable for repression and acts as a co-repressor
element together with the E2F-BS.
cdc25C exemplifies a group of cell cycle genes whose transcription is up-regulated
later than that of B-myb, i.e. in S/G2. cdc25 has originally been discovered in S. pombe as
a regulator of G2->M progression (17, 18). Higher eukaryotes contain at least 3 genes
with a high degree of similarity to cdc25, encoding the Cdc25A, Cdc25B and Cdc25C
protein phosphatases (19-28). The Cdc25C phosphatase activates the Cdc2/cyclin B
complex and thereby enable the entry into mitosis (20, 24, 28-30). Cdc25A appears to
play a role in regulating entry into S-phase (13, 26, 31), while Cdc25B is required for G2-
>M progression (32-36).
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 4 -
For the cdc25C promoter, repression of upstream activators via a bipartite site,
consisting of the "cell cycle-dependent element" (CDE) and the "cell cycle genes
homology region" (CHR), has been established as the major regulatory mechanism (37,
38). As shown by genomic footprinting, both elements are cooperatively bound in a
periodic fashion by a repressor that has been designated CDF-1 (37, 39). A similar
mechanism seems to be of global relevance, since a number of other similarly regulated
cell cycle genes, such as cyclin A (37, 40), cdc2 (37, 41), CENP-A (42), polo-like kinase
(PLK) (43) and survivin (44), have been identified. Recently, a factor (CHF) interacting
with the CHR in the cyclin A promoter has been described (45).
Cell cycle regulation of cdc25B resembles that of cdc25C, which is in agreement
with its function at the final stages of the cell cycle (32-36). The cdc25B gene is of interest
also in view of its possible involvement in human cancer (19, 46-48), and its oncogenic
potential in transgenic mice (49, 50). However, to date the promoter of the cdc25B gene
has not been analyzed, and consequently the mechanism controlling the cell cycle-
regulated expression are unknown. In the present study, we have addressed this question.
We have cloned the murine cdc25B promoter and have identified regulatory elements and
interacting transcription factors required for cdc25B transcription and contributing to its
regulation of expression during the cell cycle.
EXPERIMENTAL PROCEDURES
Cell culture. The murine cell line NIH3T3 (kindly provided by R. Treisman, ICRF,
London) was maintained at 37°C in a 5% CO2 in DMEM supplemented with 10% foetal
bovine serum, penicillin and streptomycin.
Transfections and luciferase assays. Cells were plated on 35 mm (diameter) tissue culture
plates at a density producing 60 to 80% confluence at the time of the transfection and
transfected using the cationic liposome DOTAP as described by the manufacturer
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 5 -
(Boehringer Mannheim). For synchronisation in G0, cells were maintained in serum free
medium for 3 days. Stimulation was carried out for the indicated times with 10% FCS.
Luciferase activity was determined as published elsewhere (38, 51).
Library screening. The murine genomic λ-Fix phage library 129 FVJ (Stratagene) was
screened with a 69 bp oligonucleotide (probe n°1) annealing to the 5’-end of the murine
cdc25B cDNA (52). Three phage clones were isolated, the DNA amplified and further
mapped in 3’ direction with probes n°2 and n°3.
probe n°1:
5’-TCTAGCTAGCCTTTGCCCGCCCCGCCACGATGGAGGTACCCCTGCAGAAG
TCTGCGCCGGGTTCAGCTC-3’.
probe n°2:
5’-GGTCATTCAAAATGAGCAGTTACCATAAAACGCTTCCGATCCTTACCAGTG
AGGCTTGCTGGAACACACTCCGGTGCTG-3’
probe n°3:
5’-GTTAAAGAAGCATTGTTATTATGGGGAGGGGGGAGCAACCTCTGGGTTCA
GAATCTACATATGCTGGAAGGCCCCAATGA-3’).
Experimental details have previously been described (51). A 4.6 kb fragment containing
the promoter region and the non-coding sequence was isolated and subcloned in the
EcoRI/SalI sites of the pBluescriptIISK vector (Stratagene).
Primer extension analysis. 32P-labelled primer (10pmol) and total cellular RNA, isolated
from normal cycling NIH3T3 cells, were denatured for 10 min at 65 °C and then
incubated for 30 min at 37 °C. Primer extension was carried out in a total volume of 50 µl
containing 50mM Tris, pH 8.3, 75mM KCl, 10mM dithiothreitol, 3mM MgCl2, 400µM
dNTPs, 2U RNasin and 400 U M-MuLV reverse transcriptase (Gibco-BRL). After
incubation for 1 hr at 37 °C, the reaction was stopped with EDTA followed by RNase
treatment. The DNA was precipitated, redissolved and separated by electrophoresis on a
6% acrylamid/7M urea gel.
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 6 -
Reverse transcriptase PCR. For cDNA synthesis (53), 4µg of total RNA were annealed
to 1µg of oligo(dT) and incubated with 200U of M-MuLV reverse transcriptase for 1h at
37°C in a final volume of 20 µl. One tenth of the reaction mixture was amplified by 25
cycles of PCR in the presence of 0.5µCi α-32P-dCTP (38, 54). The experimental strategy
included the following precautions: (i) the number of PCR cycles was kept low in order to
obtain a linear amplification of the PCR products, which was possible by the incorporation
of radioactive precursor nucleotides and evaluation by autoradiography and β-radiation
scanning; (ii) all results were standardised using the signal obtained with GAPDH
(glyceraldehyde-3-phosphate dehydrogenase), whose expression is independent of cell
proliferation; (iii) all experiments were performed with at least two independent cDNA
preparations.
cdc25B promoter constructs. Primers carrying restriction sites were used for PCR with
pBIISKcdc25B as the template to generate a series of 5’ terminal deletions with
compatible ends for cloning as KpnI/NheI fragments into the multiple cloning region of
the promoterless luciferase vector pGL3-basic (Promega, Madison, WI). All PCR-
amplified fragments were verified by DNA sequencing. One- to seven-base pair mutations
were introduced into the regions of the cdc25B promoter spanning -950 to +167 or -223
to +167 using PCR-directed mutagenesis [Good, 1992 #92][Lucibello, 1995 #36].
Primers carrying the mutations (see below) and a second set of primers for subcloning
(5'cdc25B, 5’cdc25B223 and 3'cdc25B) were designed. The first PCR reaction (54) was
performed with the oligonucleotides (i) 5'cdc25B and 3'-primer carrying the mutation and
(ii) 3'cdc25B and 5'-primer carrying the mutation. The resulting products were purified
(QIAquick Spin PCR purification; Qiagen), amplified in a second PCR reaction using
5'cdc25B or 5’cdc25B223 and 3'cdc25B as primers. Site directed mutagenesis of the first
E-box (-947), mutated bases underlined, was generated by PCR with the primer 5’mE1
(5’-AGCTGGTACCTTCTCAAGCTTTCCCACTAGGTCCTTC-CCAG-3’) and the
primer cdc25B NheI (see below). The resulting fragments carrying the mutations were
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 7 -
cloned into the KpnI/NheI sites of the promoterless luciferase vector pGL3-basic
(Promega) and verified by DNA sequencing.
The following oligonucleotides were used as primers:
cdc25B KpnI 5’-AGCTGGTACCAGTTCTCAACTGCCCACTAG-3’
cdc25B223 KpnI 5’-AGCTGGTACCATGGGAGCGGGCGGGGCCGG-3’
cdc25B NheI 5’-GGGCAAAGGCTAGCTAGAGGG-3’
5’mE2, 5’-AAACAGACTCAAGCTTTCAAGGTGATTAGGTCATTAGA-3’
3’mE2, 5’-TAATCACCTTGAAAGCTTGAGTCTGTTTTCCTGG-3’
5’mNF-Y, 5’-CGCCCCCATTAATGGCGTCTGGCGGCGCTGC-3’
3’mNF-Y, 5’-CAGACGCCATTAATGGGGGCGCCGGTTCCGG-3’
5’2mCCRR, 5’-GCTGTTATTTTTCTCATATATAAGGAGGTGGAGGTGG-3’
3’2mCCRR, 5’-CCTCCTTATATATGAGAAAAATAACAGCGGCAGCGCC-3’
5’mG30G, 5’-GCTGTTATTTTTCGAAGATATAAGGAGGTGGAGGTGG-3’
3’mG30G, 5’-CCTCCTTATATCTTCGAAAAATAACAGCGGCAGCGCC-3’
5’mTATA, 5’-TTTTCGAACGATGTTGGAGGTGGAGGTGGCAGC-3’
3’mTATA, 5’-ACCTCCAACATCGTTCGAAAAATAACAGCGGCAG-3’
Electrophoretic mobility shift assays. Preparation of nuclear extracts and electrophoretic
mobility shift assays (EMSAs) were performed as described (55, 56), using poly (dI:dC)
or poly (dA:dT for CCRR gelshifts or dI:dC for Sp1 and NF-Y gelshifts) as non-specific
competitors. One to 2 µl of Hela or 4 to 6 µl NIH3T3 nuclear extracts were incubated
with approximately 0.5 picomoles of radiolabeled probe in the suitable binding buffer.
NF-Y EMSA: 10mM Hepes, pH 7.8; 50mM K-glutamate; 5mM MgCl2; 1mM DTT; 5%
(v/v) glycerol; 1mM EDTA, pH 8.0; 0.5µg/µl poly dI:dC. Sp1 EMSA: 20mM Tris.Cl, pH
7.5; 0.1mM EDTA; 0.5mM MgCl2; 10mM KCl; 0.2mM ZnSO4; 10% glycerol; 0.4µg/µl
polydI:dC. CCRR EMSA: 100mM Tris.Cl, pH 7.9; 30% glycerol; 0.4mM EDTA, pH
8.0; 2mM DTT; 0.5µg/µl polydA:dT. EMSA reactions for Sp1/3 and NF-Y binding were
performed at room temperature for 15 min followed by gel electrophoresis at 4°C using
4% polyacrylamide gels. Supershifts were carried out by pre-incubating EMSA reactions
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 8 -
on ice for 20 min with 1 µl of the indicated antibodies prior to addition of the radiolabeled
probe. For detection of other protein-DNA complexes, EMSA reactions were carried out
on ice for 15 min. Sp1 and Sp3 antibodies were obtained from G. Suske (IMT Marburg).
The NF-Y antibody was obtained from R. Mantovani (Milan). The following
oligonucleotides were used as probes and/or competitors:
cdc25B NF-Y: 5’-GGAACCGGCGCCCCCATTGGTCG-3’
Bona fide NF-Y: 5’-GATTTTTTCCTGATTGGTTAAAAGT-3’
mcdc25B NF-Y (MY): 5’-GGAACCGGCGCCCCCATTAATGG-3’
GT box: 5’-AGCTTCCTTGCCACACCCCTGCAG-3’
-103/-80: 5’-GTTGGTCCCGCCCTCCCGGGAAC-3’
-120/-97: 5’-GTCAGCCTCAGCCCCGCCCTTGGT-3’
-209/-187: 5’-GCCGGGGCGGTACGTGTGGGG-3’
-226/-206: 5’-GCAATGGGAGCGGGCGGGGC-3’
-64/-29: 5´-GCGTCTGGCGGCGCTGCCGCTGTTATTTTTCGAATA
-64/-20: 5’-GCGTCTGGCGGCGCTGCCGCTGTTATTTTTCGAA
TATATAAGGAG-3’
-64/-20 3mCCRR: 5’-GCGTCTGGCGGCGCTGCCGCTGTTATTTTTATCA
TATATAAGGAG-3’
ns: 5’-GAATAAAGTTTTACTGATTTTTGAGACA -3’
Shown are the top strand oligonucleotides. For radioactive labelling by filling-in with 32P-
dCTP an additional G was added to the 5´-end of the bottom strand oligonucleotides.
Underlined letters represent mutated bases.
Genomic footprinting. For genomic footprinting (38, 57), NIH3T3 cells were maintained
in serum free medium for 3 days for synchronization in G0 and stimulation was carried
out for the indicated times with 10% FCS. The cells were, then treated with 0.2% DMS
for 2 min. After DMS treatment, cells were washed three times with cold phosphate-
buffered saline (PBS) and the DNA was isolated. As reference, NIH3T3 genomic DNA
was methylated in vitro with 0.2% DMS for 10-30s. Piperidine cleavage was performed
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 9 -
as described. Genomic DNA (3µg) were used for LMPCR as described. The Stoffel
fragment of Taq polymerase (Perkin Elmer) was used instead of the native enzyme.
Sample were phenol extracted and ethanol precipitated before primer extention with 32P-
labelled primers.
The following oligonucleotides were used as primers:
first primer, Tm = 52°C, 5’-d(AGTCACCCTAAGAAGCG)-3’;
second primer, Tm = 74°C, 5’-d(CGAGCAGAAGTAGCTGGTCCAGC)-3’;
third primer, Tm = 88°C, 5’-d(CTGGTCCAGCCTCAGCCTCAGCCCC)-3’.
RESULTS
Cloning of the mouse cdc25B promoter. A mouse embryo genomic DNA library was
screened with an oligonucleotide representing the mouse cdc25B coding region. Several
recombinant phage spanning approximately 30 kb of genomic DNA were isolated and
mapped (Fig. 1A). One phage clone (designated III in Fig. 1A) was used to subclone a
1.1 kb fragment representing the sequence 5’ to the translation start codon. This fragment
(B950) was linked to the firefly luciferase gene and transfected into NIH3T3 cells to test
whether the isolated promoter fragment was functional in a transient expression assay. As
shown in Fig. 2A, B950 was cell cycle-regulated after serum stimulation of cells that had
been synchronized in G0. Thus, hardly any luciferase activity was detectable in G0 cells
and at early stages after serum stimulation, but there was a ~4-fold induction at 18 h after
serum stimulation, peaking at 22 hrs (8-fold induction). At this stage, most cells had
entered, or passed through, G2 (data not shown). In addition, we determined the
expression profile of the endogenous cdc25B gene in the same cell system, and found a
similar time course (Fig. 2B; cdc2 induction shown for comparison). These data indicate
that the isolated promoter fragment is sufficient to confer on a luciferase reporter gene a
pattern of cell cycle regulation that mirrors its physiological regulation.
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 10 -
Structure of the mouse cdc25B promoter. The nucleotide sequence of B950 was
determined for both strands (EMBL Nucleotide Sequence Database accession number:
AJ296019). The most relevant part of the sequence, as determined below, is shown in Fig.
1B. Inspection of the sequence revealed a match with a canonical TATA-box motif 190
nucleotides 5’ to the ATG (Fig. 1C). A single transcription start site cluster was identified
by primer extension analysis ~30 nucleotides downstream of this motif and overlapping
with a Initiator (Inr) consensus sequence (Figs. 1C, 3). Although we cannot formally rule
out the formal possibility that the cdc25B gene contains additional initiation sites outside
the region analyzed, these observations strongly suggest that a TATA-box and/or an Inr
element direct the initiation of transcription and define the transcriptional start site. The A
within the Inr motif was therefore designated position +1 (see Fig. 1C). A search for
potential regulatory sites using the online program and Web Signal Scan
(http://www.bimas.dcrt.nih.gov/molbio/signal/) revealed the presence of additional putative
transcription factor binding sites: two E-boxes (-947 and -800), three E2F sites (-232, -58
and -50), five Sp1 sites (-570, -217, -200, -105 and -95) and a NF-Y binding site (-70).
Delineation of functional regions in the mouse cdc25B promoter by truncation analysis.
In order to identify functionally relevant regions in cdc25B promoter a series of terminal
truncations was generated from the B950 construct (-950/+167) and analyzed for
expression in G0 versus normally cycling cells (N) (Fig. 4). This analysis led to the
following conclusions:
(i) The terminal deletion of 10 nucleotides, which removes a potential E-box led to an
increase in transcriptional activity of ~40%, but had no effect on cell cycle regulation.
Truncation of the adjacent fragment spanning positions –980 to –768, which harbors
another potential E-box, had no detectable effect on transcriptional activity or cell
cycle regulation.
(ii) The region from –340 to –250 seems to have a negative effect on transcriptional
activity. However, since no putative binding sites could be identified in this region and
there was no effect on cell cycle regulation, we did not pursue this finding.
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 11 -
(iii) Further deletion of a fragment spanning nucleotides –250 to –223 and harboring a
potential E2F site had no detectable effect.
(iv) Truncation of a fragment spanning positions –223 to –180, which contains two
potential Sp1 sites, led to a clear reduction in transcriptional activity. This was further
decreased by truncation of the adjacent region spanning nucleotides –180 to –87,
which harbors two more potential Sp1 sites. The loss of these four potential Sp1
sites led to a total decrease in transcriptional activity of 60% with only a marginal
effect on cell cycle regulation.
(v) The terminal deletion of an additional 20 nucleotides resulted in a further drop in
transcriptional activity, but also led to a clear decrease in cell cycle regulation,
indicating that this promoter region which harbors a potential NF-Y site is of
particular functional relevance.
(vi) Further truncations had no additional effect cell cycle regulation, presumably because
these constructs all lacked the NF-Y site.
Identification of functional upstream elements in the mouse cdc25B promoter. To confirm
and extend the findings obtained by promoter truncation the putative E-boxes and NF-Y
binding site were altered by point mutations and the functional consequences were
analyzed in transient transfection assays. The proximal potential E2F sites were not
included in this analysis because no binding of E2F-1, E2F-3 or E2F-4 to the cdc25B
promoter could be detected in EMSA using either normal NIH3T3 cells or retrovirally
transduced cells overexpressing the respective E2F protein (kindly provided by R.
Bernards, Amsterdam), although clear binding was seen in the same assay with a bona fide
E2F site from the B-myb promoter (5, 15) (data not shown).
The mutation analyses yielded the following results (Fig. 5):
(i) Mutation of the most distal E-box led to a slight increase in promoter activity of
~36%, but did not show any influence on the cell cycle regulation. Mutation of the
second E-box had only a very weak effect, and mutation of both E-boxes had the
same effect as mutation of the most distal one alone. These data are in line with the
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 12 -
truncation analysis described above and indicate that the E-boxes are not crucial with
respect to cell cycle regulation. This promoter region was therefore not further
investigated.
(ii) Point mutations in the NF-Y binding site led to a drastic loss of both transcriptional
activity (~73%) and cell cycle regulation (57%). This result is in perfect agreement
with the deletion analysis and confirms the importance of the NF-Y site both for
transcriptional activity and cell cycle regulation.
Interaction of NF-Y and Sp1/Sp3 with the mouse cdc25B upstream activating sequence.
In order to investigate protein interactions at the potential NF-Y site in the cdc25B
promoter we performed electrophoretic mobility shift assays (EMSAs) with nuclear
extracts from normally cycling NIH3T3 cells. A synthetic oligonucleotide encompassing
this element was used as a probe and competitors representing either the same site (self-
competition), a bona fide NF-Y site from the MHC class II promoter (Eα-Y) (58), an Sp1
binding site (GT-box) or a mutated cdc25B element (MY). As shown in Fig. 6, only the
former two oligonucleotides were able to prevent the formation of a DNA-protein
complex. Neither the GT-box nor the mutated cdc25B element showed any competition.
Likewise, no effect on complex formation was seen, when binding sites for other CAAT-
box binding factors, i.e., C/EBP or NF-I/CTF (59), were used (data not shown). To obtain
further evidence that NF-Y interacts with the cdc25B promoter we analyzed the effect of a
monoclonal antibody (αNF-Y A) against the A-subunit of NF-Y (kindly provided by D.
Mathis) (58). This antibody led to the expected supershift of the observed complex (58,
59). Taken together, these data clearly suggest that the protein complex interacting with the
cdc25B site is NF-Y.
Similar experiments were performed to analyze protein binding to the four
functionally relevant Sp1 sites at positions -217, -200, -105 and –95. EMSAs were
performed using four different probes representing these sites in conjunction with a
specific (self) or non-specific competitor (unrelated sequence) and antibodies specific for
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 13 -
Sp1 or Sp3 (kindly provided by G. Suske, Marburg) (60, 61). The data in Fig. 7 clearly
show that all four sites specifically interact with Sp1 and Sp3, leading to the formation of
the expected complexes (60).
Identification of a proximal repressor element. Finally, we scanned the proximal promoter
for the presence of additional sites that might play a role in cell cycle regulation. Toward
this end, we introduced point mutations into this region in the context of an otherwise
intact promoter fragment (-223/+167 construct). Construct 2mCCRR harbors two
mutations at positions –32 and –33, while construct m30G is mutated at position –30, i.e.
the first nucleotide of the TATA motif. As shown in Fig. 8, both these mutations led to a
3- to 4-fold increased activity in G0 cells, resulting a 50-60% loss in cell cycle regulation.
These results indicate that this region of the promoter functions as a cell cycle-regulated
repressor. Previous studies have shown that other S/G2 genes are regulated by two
contiguous repressor elements, CDE and CHR, whose function is dependent on a exact
spacing relative to each other (37, 39). Since the sequence surrounding the repressor
element in the cdc25B promoter (…TGTTATTTTTCGAATATAT…; approximate
position of repressor element underlined) only bears a vague resemblance with a CDE-
CHR module (cdc25C: ...CTGGCGGAAGGTTTGAA..., CDE and CHR underlined) it
can be concluded that these sequences are functionally unrelated. We refer to this element
in the cdc25B promoter as “cell cycle-regulated repressor” (CCRR).
Protein interaction with the CCRR. Finally, we sought to obtain direct evidence for the
existence of a protein complex interacting with the CCRR. For this purpose, we performed
EMSAs with a fragment containing nucleotides –64 to -20 of the murine cdc25B promoter
as a probe and NIH3T3 nuclear extract. As shown in Fig. 9, the most slowly migrating
complex specifically interacted with the CCRR. While self-competition was highly
efficient, no competition was seen with the same oligonucleotide harboring a mutation in
the region of the CCRR or a 5’ truncation of 9 nucleotides. Likewise, no competition was
observed with an unrelated sequence. In addition, the binding activity was not competed by
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 14 -
B-myb or cdc25C CHR sequences (data not shown), which confirms the conclusion that
the CCRR represents a functionally unrelated repressor element.
In vivo protection of the CCRR region. In order to obtain further evidence that the CCRR
represents a protein binding site we performed genomic DMS footprinting of the region
surrounding the transcriptional start site in NIH3T3 cells. Figure 10 shows a typical in
vivo footprint of the bottom strand. It is obvious that in the region of the CCRE multiple
residues were protected: A at –28, A at –30 and G at –34, the two former nucleotides being
part of the TATA-motif.
DISCUSSION
The data reported in the present study suggest that the cdc25B promoter is controlled by a
novel mechanism of cell cycle-regulated transcription, which involves both a NF-Y binding
site and the CCRR repressor element. None of the two binding sites is sufficient to confer
cell cycle regulation on its own, pointing to a functional interplay between the putative
repressor interacting with NF-Y. Although NF-Y has been shown for a number of other
promoters to play a crucial role in cell cycle-regulated transcription (37, 59, 62-65), its
precise role has not been determined. The data presented in the present study point to a
dual function of NF-Y in the context of the cdc25B promoter: NF-Y is crucial for
promoter activation, which might be related to its described ability to recruit other
transcription factors to a promoter (66), but also for cell cycle regulation. This is
reminiscent of the situation described for the cdc25C promoter, where NF-Y cooperates
with the cell cycle-regulated repressor CDF-1 (59). In this case, CDF-1 presumably
functions by specifically repressing NF-Y mediated activation, since the repressor function
of CDF-1 is dependent on an active promoter and is specific for a small subset of
transcriptional activators (67). It is possible that an analogous situation exists in case of
the cdc25B promoter, but the precise underlying mechanism remains to be investigated.
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 15 -
Another interesting aspect relates to the fact that the CCRE apparently overlaps the
TATA motif. Although there is no formal proof at present that the putative TATA element
is functional in the cdc25B promoter, its sequence (TATATAA) exactly fits that of a
canonical TATA-box and its spacing relative to the transcriptional start site and the
putative Inr element is within the expected range. This raises the intriguing possibility that
a CCRE-interacting repressor functions by interfering with the basal transcriptional
machinery, e.g. by inhibiting the assembly of a functional initiation complex. Future
analyses will have to address these mechanistic questions in detail. The present study
provides the basis for such studies.
Acknowledgements - We are grateful to R. Bernards for retrovirally transduced cells
overexpressing specific E2F family members and to Dr. M. Krause for synthesis of
oligonucleotides.
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 16 -
REFERENCES
1. Müller, R. (1995) Trends Genet. 11(5), 173-178
2. Brehm, A., Miska, E., Reid, J., Bannister, A., and Kouzarides, T. (1999) Br J Cancer
80 Suppl 1, 38-41
3. Lavia, P., and Jansen-Durr, P. (1999) Bioessays 21(3), 221-30
4. Muller, H., and Helin, K. (2000) Biochim Biophys Acta 1470(1), M1-M12
5. Lam, E. W., and Watson, R. J. (1993) EMBO J. 12(7), 2705-13
6. Hsiao, K.-M., McMahon, S. L., and Farnham, P. J. (1994) Genes. Dev. 8, 1526-1537
7. Johnson, D. G., Ohtani, K., and Nevins, J. R. (1994) Genes Dev. 8(13), 1514-1525
8. Ohtani, K., DeGregori, J., Leone, G., Herendeen, D. R., Kelly, T., and Nevins, J. R.
(1996) Mol. Cell. Biol. 16, 6977-6984
9. Yan, Z., DeGregori, J., Shohet, R., Leone, G., Stillman, B., Nevins, J. R., and Williams,
R. S. (1998) Proc Natl Acad Sci U S A 95(7), 3603-8
10. Hateboer, G., Wobst, A., Petersen, B. O., Le Cam, L., Vigo, E., Sardet, C., and Helin,
K. (1998) Mol Cell Biol 18(11), 6679-97
11. Ohtani, K., Tsujimoto, A., Ikeda, M., and Nakamura, M. (1998) Oncogene 17(14),
1777-85
12. Chen, X., and Prywes, R. (1999) Mol Cell Biol 19(7), 4695-702
13. Vigo, E., Muller, H., Prosperini, E., Hateboer, G., Cartwright, P., Moroni, M. C., and
Helin, K. (1999) Mol Cell Biol 19(9), 6379-95
14. Zhu, L., Zhu, L., Xie, E., and Chang, L.-S. (1995) Mol. Cell. Biol. 15(7), 3552-3562
15. Liu, N., Lucibello, F. C., Zwicker, J., Engeland, K., and Müller, R. (1996) Nucl. Acids
Res. 24, 2905-2910
16. Bennett, J. D., Farlie, P. G., and Watson, R. J. (1996) Oncogene 13, 1073-1082
17. Russell, P., and Nurse, P. (1986) Cell 45(1), 145-153
18. Millar, J. B. A., and Russell, P. (1992) Cell 68(3), 407-410
19. Nagata, A., Igarashi, M., Jinno, S., Suto, K., and Okayama, H. (1991) New Biol 3,
959-968
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 17 -
20. Millar, J. B. A., McGowan, C. H., Lenaers, G., Jones, R., and Russell, P. (1991)
EMBO J. 10, 4301-4309
21. Millar, J. B. A., Blevitt, J., Gerace, L., Sadu, K., Featherstone, C., and Russell, P.
(1991) Proc Natl Acad Sci USA 88, 10500-10504
22. Lee, M. S., Ogg, S., Xu, M., Parker, L., Donoghue, D., Maller, J., and Piwnica-
Worms, H. (1992) Mol. Biol. Cell 3, 73-84
23. Kumagai, A., and Dunphy, W.G. (1991) Cell 64, 903-914
24. Gautier, J., Solomon, M.J., Booher, R.N., Bazan, J. F., Kirschner, M. W. (1991) Cell
67, 197-211
25. Honda, R., Ohba, Y., Nagata, A., Okayama, H., and Yasuda, H. (1993) FEBS Lett
318(3), 331-4
26. Jinno, S., Suto, K., Nagata, A., Igarashi, M., Kanaoka, Y., Nojima, H., and Okayama,
H. (1994) Embo J 13(7), 1549-56
27. Sadhu, K., Reed, S. I., Richardson, H., and Russell, P. (1990) Proc. Natl. Acad. Sci.
USA 87, 5139-5143
28. Strausfeld, U., Fernandez, A., Capony, J. P., Girard, F., Lautredou, N., Derancourt, J.,
Labbe, J. C., and Lamb, N. J. (1994) J Biol Chem 269(8), 5989-6000
29. Dunphy, W. G., and Kumagai, A. (1991) Cell 67(1), 189-196
30. Sebastian, B., Kakizuka, A., and Hunter, T. (1993) Proc. Natl. Acad. Sci. USA 90(8),
3521-3524
31. Blomberg, I., and Hoffmann, I. (1999) Mol Cell Biol 19(9), 6183-94
32. Forrest, A. R., McCormack, A. K., DeSouza, C. P., Sinnamon, J. M., Tonks, I. D.,
Hayward, N. K., Ellem, K. A., and Gabrielli, B. G. (1999) Biochem Biophys Res
Commun 260(2), 510-5
33. Gabrielli, B. G., De Souza, C. P., Tonks, I. D., Clark, J. M., Hayward, N. K., and
Ellem, K. A. (1996) J Cell Sci 109(Pt 5), 1081-93
34. Reynolds, R. A., Yem, A. W., Wolfe, C. L., Deibel, M. R., Jr., Chidester, C. G., and
Watenpaugh, K. D. (1999) J Mol Biol 293(3), 559-68
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 18 -
35. Lammer, C., Wagerer, S., Saffrich, R., Mertens, D., Ansorge, W., and Hoffmann, I.
(1998) J Cell Sci 111(Pt 16), 2445-53
36. Nishijima, H., Nishitani, H., Seki, T., and Nishimoto, T. (1997) J Cell Biol 138(5),
1105-16
37. Zwicker, J., Lucibello, F. C., Wolfraim, L. A., Gross, C., Truss, M., Engeland K., and
Müller, R. (1995) EMBO J 14, 4514-4522
38. Lucibello, F. C., Truss, M., Zwicker, J., Ehlert, F., Beato, M., and Müller, R. (1995)
EMBO J. 14(1), 132-142
39. Liu, N., Lucibello, F. C., Körner, K., Wolfraim, L. A., Zwicker, J., and Müller, R.
(1997) Nucl. Acids Res. 25, 4915-4920
40. Huet, X., Rech, J., Plet, A., Vie, A., and Blanchard, J. M. (1996) Mol Cell Biol 16(7),
3789-98
41. Tommasi, S., and Pfeifer, G. P. (1995) Mol. Cell. Biol. 15(12), 6901-6913
42. Shelby, R. D., Vafa, O., and Sullivan, K. F. (1997) J Cell Biol 136(3), 501-13
43. Uchiumi, T., Longo, D. L., and Ferris, D. K. (1997) J Biol Chem 272(14), 9166-74
44. Li, F., and Altieri, D. C. (1999) Cancer Res 59(13), 3143-51
45. Philips, A., Chambeyron, S., Lamb, N., Vie, A., and Blanchard, J. M. (1999)
Oncogene 18(46), 6222-32
46. Wu, W., Fan, Y. H., Kemp, B. L., Walsh, G., and Mao, L. (1998) Cancer Res 58(18),
4082-5
47. Gasparotto, D., Maestro, R., Piccinin, S., Vukosavljevic, T., Barzan, L., Sulfaro, S., and
Boiocchi, M. (1997) Cancer Res 57(12), 2366-8
48. Kudo, Y., Yasui, W., Ue, T., Yamamoto, S., Yokozaki, H., Nikai, H., and Tahara, E.
(1997) Jpn J Cancer Res 88(10), 947-52
49. Ma, Z. Q., Chua, S. S., DeMayo, F. J., and Tsai, S. Y. (1999) Oncogene 18(32),
4564-76
50. Yao, Y., Slosberg, E. D., Wang, L., Hibshoosh, H., Zhang, Y. J., Xing, W. Q., Santella,
R. M., and Weinstein, I. B. (1999) Oncogene 18(37), 5159-66
51. Herber, B., Truss, M., Beato, M., and Muller, R. (1994) Oncogene 9(7), 2105-7
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 19 -
52. Kakizuka, A., Sebastian, B., Borgmeyer, U., Hermans-Borgmeyer, I., Bolado, J.,
Hunter, T., Hoekstra, M. F., and Evans, R. M. (1992) Genes Dev. 6(4), 578-90
53. Belyavsky, A., Vinogradova, T., and Rajewsky, K. (1989) Nucleic Acids Res 17(8),
2919-32
54. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, R., Horn, G. T., Mullis,
K. B., and Erlich, H. A. (1988) Science 239(4839), 487-91
55. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucl. Acids Res. 11, 1475-
1489
56. Barberis, A., Superti-Furga, G., and Busslinger, M. (1987) Cell 50(3), 347-59
57. Pfeifer, G. P., Steigerwald, S., Mueller, P. R., and Riggs, A. D. (1989) Science 246,
810-813
58. Mantovani, R., Pessara, U., Tronche, F., Li, X. Y., Knapp, A. M., Pasquali, J. L.,
Benoist, C., and Mathis, D. (1992) EMBO J. 11(9), 3315-22
59. Zwicker, J., Gross, C., Lucibello, F. C., Truss, M., Ehlert, F., Engeland, K., and Müller,
R. (1995) Nucleic Acids Res. 23(19), 3822-3830
60. Dennig, J., Hagen, G., Beato, M., and Suske, G. (1995) J. Biol. Chem. 270(21),
12737-12744
61. Körner, K., Wolfraim, L. A., Lucibello, F. C., and Müller, R. (1997) Nucl. Acids Res.
25(24), 4933-9
62. Sorensen, P., and Wintersberger, E. (1999) J Biol Chem 274(43), 30943-9
63. Adachi, N., Nomoto, M., Kohno, K., and Koyama, H. (2000) Gene 245(1), 49-57
64. Bolognese, F., Wasner, M., Dohna, C. L., Gurtner, A., Ronchi, A., Muller, H., Manni,
I., Mossner, J., Piaggio, G., Mantovani, R., and Engeland, K. (1999) Oncogene
18(10), 1845-53
65. Facchinetti, V., Lopa, R., Spreafico, F., Bolognese, F., Mantovani, R., Tavner, F.,
Watson, R., Introna, M., and Golay, J. (2000) Oncogene 19(34), 3931-40
66. Linhoff, M. W., Wright, K. L., and Ting, J. P. (1997) Mol Cell Biol 17(8), 4589-96
67. Zwicker, J., Lucibello, F. C., Jérôme, V., Brüsselbach, S., and Müller, R. (1997) Nucl.
Acids Res. 25, 4926-4932
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 20 -
FIGURE LEGENDS
Fig. 1. (A) Genomic structure of the murine cdc25B locus. The map was assembled
on the basis of the three analyzed page clones shown below the map. The subcloned
fragment used for promoter analysis is depicted at the bottom.
(B) Schematic of the cdc25B promoter showing putative protein binding sites. E:
E-box; Sp1: binding site for Sp1 family members; E2F: E2F site; NFY: NF-Y site
(reverse CCAAT-box); TATA: TATA-box).
(C) Nucleotide sequence of the proximal promoter region. The major site of
transcription initiation was designated position +1 (see also Fig. 3). Functional elements
(Sp1/3 and NF-Y sites) motifs identified in the present study as well as the TATA and Inr
are highlighted.
Fig. 2. Cell cycle regulation of cdc25B transcription. (A) Time course of luciferase
activity in G0-synchronized NIH3T3 cells after transfection of the B950 construct and
serum stimulation. (B) Kinetics of endogenous cdc25B mRNA expression in serum-
stimulated NIH3T3 cells. The analysis was performed by RT-PCR. For comparison, the
induction of cdc2 mRNA was also measured.
Fig. 3. Mapping of the 5' end of cdc25B mRNA by primer extension in normally
cycling NIH3T3 cells. As a negative control yeast tRNA was used. A sequencing
reaction was run alongside (lanes labeled G, A, T, C) to be able to accurately determine the
nucleotide positions.
Fig. 4. Delineation of functionally important regions in the cdc25B promoter.
Terminally truncated cdc25B promoter-luciferase constructs were analyzed in transient
expression assays in both quiescent (G0) and normally growing (N) NIH3T3 cells.
Values are given as relative luciferase activities normalized to 100 for the longest promoter
construct (-950) in normally growing cells.
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 21 -
Fig. 5. Identification of functionally important elements in the cdc25B promoter.
cdc25B promoter-luciferase constructs with point mutations in defined elements (E-boxes,
NF-Y site) were analyzed in transient expression assays in both quiescent (G0) and
normally growing (N) NIH3T3 cells. Values are given as relative luciferase activities
normalized to 100 for the wild-type construct (-950) in normally growing cells. N/G0
gives the factor of cell cycle regulation. Sites are labeled as in Fig. 1B.
Fig. 6. Binding of NF-Y to the murine cdc25B promoter. A fragment encompassing
positions –85 to –63 was used as a probes in EMSA using NIH3T3 nuclear extract. The
assay was performed in the presence and absence of antibodies specific for the A subunit
of NF-Y (αNF-Y A). No effect was seen with irrelevant anti-serum (data not shown).
Competitors were identical to the respective probes (self-competition) or represented a
bona fide NF-Y site (MHC), a GT-box or the mutated cdc25B NY-Y site (MY).
Fig. 7. Binding of Sp1 and Sp3 to four elements of the murine cdc25B promoter.
Fragments encompassing positions –103 to –80, -120 to –97, -209 to –187 and –226 to -
206 were used as probes in EMSAs using NIH3T3 nuclear extract. The assay was
performed in the presence and absence of antibodies specific for Sp1 (αSp1) or Sp3
(αSp3). The respective pre-immune sera did not show any effect (data not shown).
Competitors were identical to the respective probes (self-competition; s) or represented a
non-specific sequence (ns).
Fig. 8. Functional analysis of the cdc25B promoter region harboring the CCRR.
cdc25B promoter-luciferase constructs with mutations in the CCRR were analyzed in
transient expression assays in both quiescent (G0) and normally growing (N) NIH3T3
cells. Nucleotide positions are indicated at the top. Mutated nucleotides are underlined.
The dotted line shows the approximate position of the repressor element (CCRE). –223
represents the wild-type promoter construct. Error bars indicate standard deviations.
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
- 22 -
Fig. 9. Identification of a CCRR-binding activity. A fragment encompassing
positions –64 to -20 of the murine cdc25B promoter was used as a probe for EMSA using
NIH3T3 nuclear extract. Four different competitors were used: s, identical to the probe; -
64/-20 3mCCRR, same as probe but with 3 mutations in the region of the CCRE (at –32, -
33 and –34); -64/-29, same as probe but lacking 9 nucleotides at the 5’ end; ns, non-
specific sequence. The upper-most band represents a specific CCRR-protein complex.
The nature of the other complexes is unclear, but on the basis of the competition data these
appear to be non-specific.
Fig. 10. In vivo footprint of the cdc25B promoter region around the transcriptional
start site. Growing NIH3T3 cells were treated with DMS and protected purine bases
were detected by LMPCR (bottom strand). Numbers on the left indicate nucleotide
positions relative to the start site of transcription (+1). Protected nucleotides can be seen
in the region of the CCRR overlapping the TATA motif.
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
0
2,5
5
7,5
10
Indu
ctio
n
0 4 7 18 20 22 24 26
Time post stimulation (h)
B
Fig. 2
0 4 8 12 16 20 0 4 8 12 16 20Time post stimulation (h)
cdc2 cdc25B
GAPDH GAPDH
A by guest on February 18, 2018
http://ww
w.jbc.org/
Dow
nloaded from
Fig. 3
G A T C NIH
3T3
yeas
t
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
100 11.4 8.8-223
26.6 7 3.8-223mNF-Y *
NF-Y site
-950mE1 * 136.3 15.2 8.9
-950mE2 *
-950mE1/E2 * *
117.7 18.1
130.5 22.5
6.5
5.8
E-boxes
N G0 N/G0
-950 100 13 7.7
Fig. 5
by guest on February 18, 2018 http://www.jbc.org/ Downloaded from
free probe
CCRR
s -64/
-20
3mC
CR
R
-64/
-29
nscompetitor:
Fig. 9
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
-63
-56
-45
-34
-30-28
-9
+1in
viv
o
in v
itro
TATAprotected
Fig. 10
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from
Kathrin Korner, Valerie Jérome, Thorsten Schmidt and Rolf Müllerproximal repressor element
Cell cycle regulation of the murine cdc25B promoter: essential role for NF-Y and a
published online December 4, 2000J. Biol. Chem.
10.1074/jbc.M008696200Access the most updated version of this article at doi:
Alerts:
When a correction for this article is posted•
When this article is cited•
to choose from all of JBC's e-mail alertsClick here
by guest on February 18, 2018http://w
ww
.jbc.org/D
ownloaded from