Changes in condylar cartilage after anterior mandibulardisplacement in juvenile pigs

Tomasz Gredes a,*, Heike Mack b, Alexander Spassov a, Christiane Kunert-Keil a,Matthew Steele d, Peter Proff c, Florian Mack b, Tomasz Gedrange e

aDepartment of Orthodontics, Faculty of Medicine, University of Greifswald, Greifswald, GermanybGriffith Health, Griffith University, Queensland, AustraliacDepartment of Orthodontics, University Hospital Regensburg, GermanydBundaberg Base Hospital, Bundaberg, Queensland, AustraliaeDepartment of Orthodontics, Technical University, Dresden, Germany

a r c h i v e s o f o r a l b i o l o g y 5 7 ( 2 0 1 2 ) 5 9 4 – 5 9 8

a r t i c l e i n f o

Article history:

Accepted 30 September 2011

Keywords:

Collagen

Matrix metalloproteinase

Quantitative RT-PCR

Temporomandibular joint

Vascular endothelial growth factor

a b s t r a c t

Adaptive remodelling of the mandibular condyle in response to mandibular advancement is

the mechanism exploited by orthodontic forward displacement devices.

Objective: This work investigated the expression of collagens, matrix metalloproteinases

and vascular endothelial growth factor during this process.

Design: Twenty juvenile pigs were randomly divided into two experimental groups, where the

treatment group was fitted with mandibular advancement splints, and the control group was

not. Changes in the mRNA content of condylar cartilage tissue was then were measured by

real-time PCR using specific primers after 4 weeks of treatment.

Results: The temporal pattern of the expression of Col1 and MMP13 during condylar adapta-

tion coincided with that during natural condylar growth. The amount of the expression of

Col10 during condylar adaptation was significantly lower ( p < 0.05), whereas the expression of

Col2, MMP8 and VEGF was significantly higher compared to natural growth ( p < 0.05).

Conclusions: It is suggested that condylar adaptation in growing pigs triggered by mandibu-

lar forward positioning results not only from passive adaptation of cartilage, but also

involves growth affected processes. Our results showed that mechanical strain produced

by mandibular advancement induced remodelling and revascularization in the poster-

iocranial mandibular condyle. These results are mostly consistent with former published

histological and histomorphometrical analyses.

# 2011 Elsevier Ltd. All rights reserved.

Available online at www.sciencedirect.com

journal homepage: http://www.elsevier.com/locate/aob

1. Introduction

Growth modification of the temporomandibular joint (TMJ)

during dentofacial orthopaedic treatment of class 2 malocclu-

sion by the use of functional appliances is still of great interest

for orthodontic treatment. To investigate this process specific

protrusive functional appliances have been used to move the

mandible into a protrusive position in various animal

models.1,2 In most adult animals the tissues of TMJ are

* Corresponding author. Tel.: +49 383 486 7543.E-mail address: thomasgredes@yahoo.de (T. Gredes).

0003–9969/$ – see front matter # 2011 Elsevier Ltd. All rights reservedoi:10.1016/j.archoralbio.2011.09.017

regarded as largely unresponsive to occlusal changes.1,3,4

Although many animal studies have shown that the adult TMJ

is incapable of a significant adaptive response to forces

produced by functional jaw orthopaedics, some adaptive

capability may still be present in the TMJs of young adult

specimens.3,5–7 It has already been shown that the altered

neuromuscular function after anterior mandibular displace-

ment in growing animals induces condylar cartilage and bone

responses which include chondrocytic proliferation and

d.

Table 1 – Primers sequences for real-time PCR.

Primer mRNAaccessionnumber

Primer sequence 50–30

Col10

forward

NM_001005153.1 CACCAAGGCACAGTTCTTCA

Col10

reverse

ACCGGAATACCTTGCTCTC

Col1

forward

AF201723 CCAACAAGGCCAAGAAGAAG

Col1

reverse

ATGGTACCTGAGGCCGTTCT

Col2

forward

AF201724 GCACGGATGGTCCCAAAG

Col2

reverse

CAGCAGCTCCCCTCTCAC

MMP13

forward

AF069643 TTGATGATGATGAAACCTGGA

MMP13

reverse

ACTCATGGGCAGCAACAAG

MMP8

forward

AF055670 CATTTTGATGCAGAAGAAATATGG

MMP8

reverse

CATGAGCAGCAACAAGAAACA

b-Actin

forward

AY550069.1 AAGCCAACCGTGAGAAGATG

b-Actin

reverse

GTACATGGCTGGGGTGTTG

a r c h i v e s o f o r a l b i o l o g y 5 7 ( 2 0 1 2 ) 5 9 4 – 5 9 8 595

subsequent bone deposition in a posterior and posterosuper-

ior direction with condyle repositioning.3 Dannhauer proposes

that these changes are preceded by increased water binding in

the cartilage matrix.8 However, other studies show no changes

of cell proliferation or matrix synthesis in the mandibular

condyle after anterior displacement.9

Additional research on the histological level has also

shown changes in the animal TMJ associated with mandibular

advancement.2,10,11 Proff et al. has suggested that the zonal

structure of pig condyle cartilage after anterior mandibular

displacement may be modified by altering the spatial position

of the mandibular condyle in relation to the glenoid fossa. The

experimental animals displayed a significant increase in total

cartilage thickness of the posterocranial condyle cartilage

which was caused by an increase in thickness of chondro-

genic, hypertrophic, and proliferative layer, whereas in-

creased cell proliferation was not observed in experimental

animals as compared to controls.2 A similar observation was

reported in a rat study showing that the resting zone was

increased and ossification of the hypertrophic layer of the

condylar cartilage accelerated after continuous anterior and

vertical mandibular displacement.10

The aim of this study was to extend the current level of

understanding of expression of genes related to cartilage

remodelling and endochondral ossification, in response to

mandibular advancement. For this purpose, we examined the

changes in the gene expression patterns of collagens,

collagenases, and vascular epithelial growth factor using

real-time PCR. We hypothesized that during the growth and

ageing process of mandibular condylar cartilage (MCC), the

gene expressions of the major collagenases are correlated to

the gene expression of their major collagen substrates.

2. Materials and methods

2.1. Animals

Twenty, ten-week-old female pigs (Sus scrofa domestica) were

acclimatized for 14 days in the holding facility (ILAS) before

treatment. They were then divided at random into treatment

and control groups, each containing ten animals. Synthetic

build-ups (Evicrol1, SPOFA-DENTAL, Czech Republic) were fixed

bilaterally to the last premolars and first molars of the upper and

lower jaws of the treated animals. The build-ups were formed as

an oblique plane so that the mandibles of the treated animals

were directed forward during clenching. Bite opening amounted

to about 5 mm. During the 1st, 2nd, and 3rd week, the build-ups

were checked under short-term anaesthesia (Ketanest1) and

replaced if necessary. The trial was continued for 4 weeks as

described previously.2 At the end of the fourth week all twenty

animals were euthanized. Samples of left side condylar cartilage

were then removed and snap frozen in liquid nitrogen.

2.2. RNA extraction and reverse transcription

Total RNA was isolated from each cartilage sample using the

guanidinium thiocyanate–phenol–chloroform extraction meth-

od (TRIzol; Invitrogen, Germany) in combination with the

RNeasy Mini Kit (Qiagen, Hilden, Germany). RNA concentration

was determined by UV absorbance measurements. 200 ng of

total RNA from each cartilage sample was reverse transcribed

using the High-Capacity cDNA Archive Kit (PE Applied Biosys-

tems, Weiterstadt, Germany).

2.3. Real-time-PCR

SYBR1 Green PCR Core reagents (PE Applied Biosystems,

Weiterstadt, Germany) and gene-specific PCR primers from

Qiagen (Table 1) were used in the quantification of mRNAs.

PCR products were analysed on the Applied Biosystems 7500

real-time PCR system (PE Applied Biosystems, Weiterstadt,

Germany). The concentration of mRNAs for genes Col1, Col2,

Col10, MMP8, MMP13, and VEGF in each cartilage sample were

measured in relation to the concentration of mRNAs for b-

actin from the same sample. The concentration of gene

specific mRNAs in treated animals relative to control animals

was then calculated using the 2�DDCT method.12 Parallel PCR

assays for each gene target were performed with cDNA

samples and genomic standards. To quantify expression of

each gene 4 ng of reverse transcribed RNA was used in a 10 ml

reaction volume. Reaction mixtures contained 12.5 ml SYBR1

Green PCR Core reagents and 300 nM specific primer mixture.

A ‘‘no-template control’’ with water was performed parallel in

all experiments and each experiment was performed twice.

The specificity of the reaction was examined by creating a

dissociation curve for each sample and finally by checking the

PCR products using agarose gel electrophoresis.

2.4. Statistical analyses

Statistical analysis was performed using the SigmaPlot

Software (Systat Software, Inc., 1735, Technology Drive, San

a r c h i v e s o f o r a l b i o l o g y 5 7 ( 2 0 1 2 ) 5 9 4 – 5 9 8596

Jose, CA 95110, USA). The obtained values for the groups were

compared using Student’s unpaired t-test. Data are given as

means � SEM. p < 0.05 was considered statistically significant.

3. Results

Both treated and control animals showed a similarly age-

dependent increase in body weight over the course of this

study. By the end of the fourth week a mesial occlusion with

reverse overjet had been induced in the treated animals by

the synthetic build-ups. The magnitude of this sagittal

Fig. 1 – Quantification of MMP8 (A), MMP13 (B), VEGF (C), Col1 (D)

(hatched bars) and treated pigs (grey bars). The mRNA levels of

Means W SD are given in all cases for n = 10 samples. Stars indi

treated animals, unpaired t-test.

advancement was 7.6 mm � 1.5 mm. Increased chewing

frequency and tooth abrasion was also noted in the treated

animals.

3.1. Altered gene expression after treatment withsynthetic build-ups

After 4 weeks of treatment marked differences in the expres-

sion of genes representative of cartilage metabolism in the

TMJ were observed. Expression of mRNA for the Col2

gene (hyaline cartilage) was higher in treated animals

(9572963 � 2369056; mean � SEM; p < 0.05) compared to

, Col2 (E) and Col10 (F) mRNA levels in untreated control pigs

all tested genes are given in relation to that of b-actin.

cate significant differences: *p < 0.05, untreated versus

a r c h i v e s o f o r a l b i o l o g y 5 7 ( 2 0 1 2 ) 5 9 4 – 5 9 8 597

controls (1901777 � 567492). Likewise, expression of mRNA for

MMP8 in treated animals (1195 � 354; mean � SEM; p < 0.05)

was higher compared to untreated animals (85 � 36). Expres-

sion of mRNA for VEGF was 8.7-fold increased in treated

animals (551705 � 85529 versus 63407 � 13861). In contrast,

expression of mRNA for the Col10 gene (hypertrophic

cartilage) decreased significantly during treatment to less

than 60% of the mRNA level of untreated animals,

2123717 � 241523 copies for treated animals versus

3291934 � 605787 copies for untreated animals. Finally, ex-

pression of mRNA for the Col1 gene (type 1 collagen) and

MMP13 remained almost very similar in the TMJs of both

treated and untreated animals (Fig. 1).

4. Discussion

The mandibular condylar cartilage serves as both an articular

condyle, and as a growth centre in the juvenile mandible.13

Numerous studies have shown that forward mandibular

displacement enhances condylar growth and induces condy-

lar adaptation, thereby changing the morphology of the

mandible.1–3 This sequence of adaption to mechanical stress

must reasonably include detection of mechanical stress,

signal transduction, modulation of gene expression, cellular

proliferation, and cellular differentiation. These stages would

lead eventually to microscopically and then macroscopically

observeable changes. This study examined alteration in

expression of genes known to be involved in cartilage

metabolism and endochondral ossification, namely Col1,

Col2, Col10, MMP8, MMP13, and VEGF in response to

mandibular advancement in juvenile pigs.

It has previously been proposed that mechanical strain

causes chondroid cells to differentiate initially into chondro-

genic cells, which produce type 2 collagen, forming the

framework of the chondroid matrix, followed by differentia-

tion into cells capable of producing bone matrix.14,15 It has also

been shown that chondrogenesis is stimulated or altered by

mechanical loading, depending on the age.16 Earlier data

showed that there is an increase in production of the SOX9

transcription factor, and collagen type 2 protein, in the glenoid

fossa in response to anterior displacement of 35 day old rat

mandibles.14 Anterior displacement of the mandible in

10 week old pigs has been observed to lead to an increase in

thickness of the condrogenic, proliferative, and hypertrophic

layers of cartilage on the posterior aspect of the mandibular

condyle,2 although SOX9 expression is repressed at the pre-

hypertrophic layers and below in order to permit expression of

VEGF and subsequent ossification.17 Consistent with previous

work, our study noted an approximately five-fold increase in

expression of type 2 collagen mRNA expression after anterior

mandibular displacement. This significant increase could be

explained by an increase in chondrocyte activity. In conjunc-

tion with higher expression of type 2 collagen mRNA, we also

detected a significantly higher expression of MMP8 mRNA, an

enzyme that is able to cleave type 2 collagen.

Expression of VEGF by chondrocytes is a requirement for

endochondral ossification. Expression of VEGF mRNA can be

promoted by mechanical loading, and will vary depending on

the magnitude, frequency, and duration of loading.18 It was

recently shown that not only mRNA, but also protein

expression of VEGF is up-regulated under chondrogenic

stimulation by BMP2.19 Expression of VEGF was also noted

to increase in response to mandibular advancement in this

study and this could be considered to further support the

important role of VEGF in cartilage remodelling.

Endochondral ossification has previously been associat-

ed with neovascularization (dependent on VEGF) and also

expression of collagen type 10. The level of mRNA of

collagen type 10 in the treated group was markedly

decreased and this is contradictory with the most similar

studies.2,11 On the one hand, it is known that onset of

endochondral ossification is strongly correlated with syn-

thesis of type 10 collagen protein, which is a reliable marker

for endochondral bone formation,20 on the other hand,

collagen type 10 is an indicator of apoptosis,21 which is an

undesirable process during chondrogenesis. With the

mechanical stimulation the chondrogenesis is held up

longer and less apoptosis should happen, especially in

deeper cellular layers. This fact could explain the decrease

of collagen type 10 mRNA level. The changes in synthesis of

type 10 collagen in condylar cartilage during the period of

growth were already manifested. It was observed that the

maximum expression of type 10 collagen protein was

reached delayed in comparison to its mRNA22,23 and this

might explain the discrepancy in the results compared to

previous investigations. For instance, in a study with similar

procedures, histological structures observed at the same

time point show the increase of total cartilage thickness

with significantly broadened hypertrophic layer, a zone

where type 10 collagen is specifically expressed,2 whereas

the expression of this gene in our study was significantly

down-regulated. It is believed that the expression of type 10

collagen in the hypertrophic zone is related to increased

proliferation and differentiation of mesenchymal cells in

the superficial layer of the condylar cartilage.22 The

subsequent decrease in the differentiation and population

size of mesenchymal cells slows the proliferative activity

down,22,24 which could be also explain the down-regulation

of type 10 collagen in the present study. Furthermore, no

expression changes were observed for MMP13, an enzyme

reducing the amount of type 10 collagen, neither could we

observe any changes in the genetic level of type 1 collagen,

which was described as an early bone formation marker.25

Our study revealed changes in some gene expressions in an

experimental model of growing pigs, which largely bear a

resemblance to data of other animal studies at genetic and

histological level. These findings confirm that condylar

adaptation and remodelling are not only passive effect but

in relation to mandibular protrusion they solicit a cascade of

genetic responses which can manifest themselves in a delayed

manner at the molecular level.

Acknowledgement

The authors thank Ingrid Pieper for her excellent technical

assistance.

Funding: None.

Competing interests: None declared.

a r c h i v e s o f o r a l b i o l o g y 5 7 ( 2 0 1 2 ) 5 9 4 – 5 9 8598

Ethical approval: The Committee for the Prevention of

Cruelty to Animals of Western Pomerania, Germany (No. 02-

19/98).

r e f e r e n c e s

1. Ma B, Sampson W, Fazzalari N, Wilson D, Wiebkin O. Inducedmandibular condylar growth in a sheep model afterfunctional appliance treatment. Aust Orthod J 2001;17(2):81–8.

2. Proff P, Gedrange T, Franke R, Schubert H, Fanghanel J,Miehe B, et al. Histological and histomorphometricinvestigation of the condylar cartilage of juvenile pigs afteranterior mandibular displacement. Ann Anat2007;189(3):269–75.

3. McNamara Jr JA, Hinton RJ, Hoffman DL. Histologic analysisof temporomandibular joint adaptation to protrusivefunction in young adult rhesus monkeys (Macaca mulatta).Am J Orthod 1982;82(4):288–98.

4. Ramfjord SP, Blankenship JR. Increased occlusal verticaldimension in adult monkeys. J Prosthet Dent 1981;45(1):74–83.

5. Gedrange T, Weingartner J, Hoffmann A, Homuth G, Ernst F,Bokan I, et al. Development of an improved protocol toanalyse gene expression in temporomandibular jointcondylar cartilage of rats using DNA microarrays. Adv MedSci 2008;53(2):191–7.

6. Isacsson G, Carlson DS, McNamara Jr JA, Isberg AM. Effect ofmaxillomandibular fixation on condylar growth in juvenileMacaca mulatta: a cephalometric and histologic study. Scand JDent Res 1993;101(2):103–9.

7. Sim Y, Carlson DS, McNamara Jr JA. Condylar adaptationafter alteration of vertical dimension in adult rhesusmonkeys, Macaca mulatta. Cranio 1995;13(3):182–7.

8. Dannhauer KH. The growth reaction of thetemporomandibular cartilage to biomechanical stimuli andits significance for functional orthodontics—the results ofexperimental animal and biophysical research. FortschrKieferorthop 1992;53(1):53–60.

9. Tewson DH, Heath JK, Meikle MC. Biochemical andautoradiographical evidence that anterior mandibulardisplacement in the young growing rat does not stimulatecell proliferation or matrix formation at the mandibularcondyle. Arch Oral Biol 1988;33(2):99–107.

10. Ghafari J, Degroote C. Condylar cartilage response tocontinuous mandibular displacement in the rat. AngleOrthod 1986;56(1):49–57.

11. Rabie AB, Xiong H, Hagg U. Forward mandibular positioningenhances condylar adaptation in adult rats. Eur J Orthod2004;26(4):353–8.

12. Livak KJ, Schmittgen TD. Analysis of relative geneexpression data using real-time quantitative PCRand the 2(�Delta Delta C(T)) method. Methods2001;25(4):402–8.

13. Sakamoto Y, Takano Y. Morphological influence of ascorbicacid deficiency on endochondral ossification in osteogenicdisorder Shionogi rat. Anat Rec 2002;268(2):93–104.

14. Rabie AB, She TT, Harley VR. Forward mandibularpositioning up-regulates SOX9 and type II collagenexpression in the glenoid fossa. J Dent Res 2003;82(9):725–30.

15. Roach HI. Trans-differentiation of hypertrophicchondrocytes into cells capable of producing a mineralizedbone matrix. Bone Miner 1992;19(1):1–20.

16. Lee DA, Bader DL. Compressive strains at physiologicalfrequencies influence the metabolism of chondrocytesseeded in agarose. J Orthop Res 1997;15(2):181–8.

17. Hattori T, Muller C, Gebhard S, Bauer E, Pausch F, Schlund B,et al. SOX9 is a major negative regulator of cartilagevascularization, bone marrow formation and endochondralossification. Development 2010;137(6):901–11.

18. Leung FY, Rabie AB, Hagg U. Neovascularization and boneformation in the condyle during stepwise mandibularadvancement. Eur J Orthod 2004;26(2):137–41.

19. Bluteau G, Julien M, Magne D, Mallein-Gerin F, Weiss P,Daculsi G, et al. VEGF and VEGF receptors aredifferentially expressed in chondrocytes. Bone2007;40(3):568–76.

20. Kong RY, Kwan KM, Lau ET, Thomas JT, Boot-Handford RP,Grant ME, et al. Intron–exon structure, alternative use ofpromoter and expression of the mouse collagen X gene,Col10a-1. Eur J Biochem 1993;213(1):99–111.

21. Walker GD, Fischer M, Gannon J, Thompson Jr RC, OegemaJr TR. Expression of type-X collagen in osteoarthritis. JOrthop Res 1995;13(1):4–12.

22. Shen G, Hagg U, Rabie AB, Kaluarachchi K. Identification oftemporal pattern of mandibular condylar growth: amolecular and biochemical experiment. Orthod Craniofac Res2005;8(2):114–22.

23. Shen G, Zhao Z, Kaluarachchi K, Bakr Rabie A. Expression oftype X collagen and capillary endothelium in condylarcartilage during osteogenic transition—a comparisonbetween adaptive remodelling and natural growth. Eur JOrthod 2006;28(3):210–6.

24. Urist MR. Bone morphogenetic protein: the molecularizationof skeletal system development. J Bone Miner Res1997;12(3):343–6.

25. Donahue HJ, Li Z, Zhou Z, Yellowley CE. Differentiation ofhuman fetal osteoblastic cells and gap junctionalintercellular communication. Am J Physiol Cell Physiol2000;278(2):C315–22.