chapter 13 an introduction to cloning and recombinant dna powerpoints/chapter13-jm.pdfdna...
TRANSCRIPT
![Page 1: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/1.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
Chapter 13An Introduction to Cloning and
Recombinant DNA
![Page 2: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/2.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
Southern Blot Technique
![Page 3: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/3.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
Southern Blot Technique
• Used to determine the structure of a geneor DNA sequence of interest
• May be used to analyze different alleles,related genes, and gene evolution
![Page 4: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/4.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
Southern Blot Technique
• Steps– Isolate genomic DNA–Cut DNA with restriction enzymes–Separate DNA by size using
electrophoresis–Transfer DNA to a membrane–Probe with sequence of interest that is
radioactively labeled–Visualize with X-rays
![Page 5: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/5.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
Fig. 13.19
The SouthernBlot Technique
![Page 6: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/6.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson LearningCredit: © Inga Spence/Visuals Unlimited 212643
DNA Hybridization Blot on BioRad Gel Doc 1000 Imager.
![Page 7: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/7.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
DNA Sequencing
![Page 8: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/8.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATC
DNA Sequencing
![Page 9: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/9.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
+ primer CATGT
GTACACTTACGTACTCCTCAACGGATC
DNA Sequencing
![Page 10: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/10.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGT
DNA Sequencing
![Page 11: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/11.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATC
+ DNA polymerase+ A, C, T, G
CATGT
DNA Sequencing
![Page 12: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/12.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGT
+ DNA polymerase+ A, C, T, G
GTACACTTACGTACTCCTCAACGGATCCATGTGAATGCATGAGGAGTTGCGTAG
DNA Sequencing
![Page 13: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/13.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGT
+ DNA polymerase+ A, C, T, G+ T
DNA Sequencing
![Page 14: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/14.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
DNA polynucleotide chain5’ endO-
O- -P = OO
CH2
Base
O
H
3’ H H
H
5’
O-
O- -P = OO
CH2
Base
H
3’ H H
H
O5’
OH 3’ end
![Page 15: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/15.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
DNA polynucleotide chain5’ endO-
O- -P = OO
CH2
Base
O
H
3’
H
5’
3’ end
O-
O- -P = OO
CH2
Base
H
3’
H
O5’
H
dideoxy base
chaintermination
HH
HH
![Page 16: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/16.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGT
+ DNA polymerase+ A, C, T, G+ T
GTACACTTACGTACTCCTCAACGGATCCATGTG
DNA Sequencing
![Page 17: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/17.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGT
+ DNA polymerase+ A, C, T, G+ T
GTACACTTACGTACTCCTCAACGGATCCATGTGA
DNA Sequencing
![Page 18: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/18.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGT
+ DNA polymerase+ A, C, T, G+ T
GTACACTTACGTACTCCTCAACGGATCCATGTGAA
DNA Sequencing
![Page 19: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/19.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGT
+ DNA polymerase+ A, C, T, G+ T
GTACACTTACGTACTCCTCAACGGATCCATGTGAAT
DNA Sequencing
![Page 20: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/20.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGT
+ DNA polymerase+ A, C, T, G+ T
GTACACTTACGTACTCCTCAACGGATCCATGTGAATCATGTGAAT
DNA Sequencing
![Page 21: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/21.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGT
+ DNA polymerase+ A, C, T, G+ T
GTACACTTACGTACTCCTCAACGGATCCATGTGAATCATGTGAATGCAT
DNA Sequencing
![Page 22: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/22.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGT
+ DNA polymerase+ A, C, T, G+ T
GTACACTTACGTACTCCTCAACGGATCCATGTGAATCATGTGAATGCATCATGTGAATGCAT
DNA Sequencing
![Page 23: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/23.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGT
+ DNA polymerase+ A, C, T, G+ T
GTACACTTACGTACTCCTCAACGGATCCATGTGAATCATGTGAATGCATCATGTGAATGCATGAGGAGT
DNA Sequencing
![Page 24: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/24.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
DNA Sequencing
![Page 25: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/25.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
T
DNA Sequencing
![Page 26: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/26.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGT
+ DNA polymerase+ A, C, T, G+ T
GTACACTTACGTACTCCTCAACGGATCCATGTGAATCATGTGAATGCATCATGTGAATGCATGAGGAGT
DNA Sequencing
![Page 27: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/27.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGT
+ DNA pol+ A, C, T, G+ T
+ DNA pol+ A, C, T, G+ A
+ DNA pol+ A, C, T, G+ G
+ DNA pol+ A, C, T, G+ C
DNA Sequencing
![Page 28: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/28.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
T A G C
DNA Sequencing
![Page 29: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/29.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
T A G C
G
DNA Sequencing
![Page 30: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/30.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
T A G C
GA
DNA Sequencing
![Page 31: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/31.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
T A G C
GAA
DNA Sequencing
![Page 32: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/32.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
T A G C
GAAT
DNA Sequencing
![Page 33: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/33.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
T A G C
GAATGCATGA
DNA Sequencing
![Page 34: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/34.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGTGAATGCATGAGGAGTTGCCTAG
DNA Sequencing
![Page 35: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/35.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
T A G C
GAATGCATGA
CTTACGTACT
DNA Sequencing
![Page 36: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/36.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
Improvements in SangerSequencing
• Four-color fluorescent dyes• Use of scanners to read laser-induced
fluorescence as products run off• Improvements in sequencing reaction
enzymes• Replacement of slab gel electrophoresis
with capillary gel electrophoresis
![Page 37: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/37.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGT
+ DNA pol+ A, C, T, G+ T
+ DNA pol+ A, C, T, G+ A
+ DNA pol+ A, C, T, G+ G
+ DNA pol+ A, C, T, G+ C
DNA Sequencing
![Page 38: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/38.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
GTACACTTACGTACTCCTCAACGGATCCATGT
+ DNA pol+ A, C, T, G+ T
+ DNA pol+ A, C, T, G+ A
+ DNA pol+ A, C, T, G+ G
+ DNA pol+ A, C, T, G+ C
DNA Sequencing
![Page 39: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/39.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
DNA Sequencing
GTACACTTACGTACTCCTCAACGGATCCATGT
+ DNA pol+ A, C, T, G+ A, C, T, G
![Page 40: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/40.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
Automated DNA Sequencing
Fig. 13.20
![Page 41: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/41.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
Automated Sequencer
![Page 42: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/42.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
Sequencing is just the start…
![Page 43: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/43.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
DNA Microarrays
![Page 44: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/44.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
Goal: To get at complete expression profile in a cell/tissueat given time
Step 1: Make or purchase microarray
Need gene sequences and sequenced genomes
PCR up real and predicted ORFs
Spot on glass slide/chip
DNA Microarrays
![Page 45: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/45.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
DNA Microarrays
![Page 46: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/46.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
Isolate RNA from 2 different kinds of cells to be compared
Cell 1 - RNA labeled with red fluorescent tag
Cell 2 - RNA labeled with green fluorescent tag
Step 2: Isolate and label RNA
DNA Microarrays
![Page 47: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/47.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
Step 3: Hybridize RNA to Microarray
DNA Microarrays
Hybridize chip with red and green RNA
Use scanner to examine fluorescence
Red - RNA present in Cell 1 but not Cell 2Green - RNA present in Cell 2 but not in Cell 1Yellow - RNA present in both
![Page 48: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/48.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
Microarray Results
![Page 49: Chapter 13 An Introduction to Cloning and Recombinant DNA Powerpoints/chapter13-JM.pdfDNA Hybridization Blot on BioRad Gel Doc 1000 Imager. Chapter 13 Human Heredity by Michael Cummings](https://reader035.vdocument.in/reader035/viewer/2022070110/6048251303a18840500a5a18/html5/thumbnails/49.jpg)
Chapter 13 Human Heredity by Michael Cummings ©2006 Brooks/Cole-Thomson Learning
Stem cells
SaundersMageeShriner-CahnChatterjeeLawrenceOlson
Prenatal genetic testing
BrowerGorenkoffKwakChoDamianoCheis
Cloning of animals/humans
BondurantLapidesSimonVigneronPradaSiegel
Genetically modified plants/animals
PowersRosenblumLeSotomilCoyleKropp
Too much technology?
SpiwakDavidsonFeiGrossmanMarwellRoth
Behavioral genes
SeplowitzRichLenardCollinsDionneRudberg